CAUSAL AGENT, BIOLOGY AND MANAGEMENT OF THE LEAF AND STEM
DISEASE OF BOXWOOD {BUXUS SPP.)
A Thesis
Presented to
The Faculty of Graduate Studies
of
The University of Guelph
by
FANG SHI
In partial fulfillment of requirements
for the degree of
Master of Science
May, 2011
©Fang Shi, 2011 Library and Archives Bibliotheque et 1*1 Canada Archives Canada Published Heritage Direction du Branch Patrimoine de I'edition
395 Wellington Street 395, rue Wellington OttawaONK1A0N4 Ottawa ON K1A 0N4 Canada Canada
Your file Votre reference ISBN: 978-0-494-82801-4 Our file Notre reference ISBN: 978-0-494-82801-4
NOTICE: AVIS:
The author has granted a non L'auteur a accorde une licence non exclusive exclusive license allowing Library and permettant a la Bibliotheque et Archives Archives Canada to reproduce, Canada de reproduire, publier, archiver, publish, archive, preserve, conserve, sauvegarder, conserver, transmettre au public communicate to the public by par telecommunication ou par I'lnternet, preter, telecommunication or on the Internet, distribuer et vendre des theses partout dans le loan, distribute and sell theses monde, a des fins commerciales ou autres, sur worldwide, for commercial or non support microforme, papier, electronique et/ou commercial purposes, in microform, autres formats. paper, electronic and/or any other formats.
The author retains copyright L'auteur conserve la propriete du droit d'auteur ownership and moral rights in this et des droits moraux qui protege cette these. Ni thesis. Neither the thesis nor la these ni des extraits substantiels de celle-ci substantial extracts from it may be ne doivent etre imprimes ou autrement printed or otherwise reproduced reproduits sans son autorisation. without the author's permission.
In compliance with the Canadian Conformement a la loi canadienne sur la Privacy Act some supporting forms protection de la vie privee, quelques may have been removed from this formulaires secondaires ont ete enleves de thesis. cette these.
While these forms may be included Bien que ces formulaires aient inclus dans in the document page count, their la pagination, il n'y aura aucun contenu removal does not represent any loss manquant. of content from the thesis.
1+1 Canada ABSTRACT
CAUSAL AGENT, BIOLOGY AND MANAGEMENT OF THE LEAF AND STEM DISEASE OF BOXWOOD (BUXUS SPR)
Fang Shi Advisor: University of Guelph, 2011 Professor T. Hsiang
An outbreak of a boxwood disease was observed in Southern Ontario nurseries in 2008, but appears to have been present in Ontario for at least 10 years. From 2008 to 2010, over fungal 312 isolates were obtained from diseased samples. Eight major fungal morphotypes associated with the blight were identified with morphological and molecular techniques.
Among them, only Volutella buxi successfully satisfied Koch's postulates, which confirmed it is the causal agent of boxwood blight. Wounds may be the major penetration points for V. buxi since non-wounded inoculated tissues did not become diseased. The
Buxus cultivar 'Green Gem' was the most susceptible compared to 'Green Velvet', 'Green
Mound', or 'Green Mountain'. ISSR markers revealed low genetic variation of V. buxi between different cultivars and locations indicating asexual reproduction and probably a recent origin in Canada. Six fungicidal treatments showed strong preventive activity and some curative activity against Volutella blight. ACKNOWLEDGEMENTS
I really appreciate my advisor Dr. Tom Hsiang providing me this opportunity to obtain an M.Sc degree. With his knowledge, patient and encourage, I have learned how to do research in science. I would like to thank to my advisory committee member Dr. Allen
Xue for his advice. I would like to give my thanks to Dr. George Barron for his suggestions during the study and kindly offering his plant disease specimens. I would also like to thank to Dr. Janice Elmhirst for sending me plant samples from B.C. and sharing her experience and knowledge.
I would like to thank to everyone in Dr. Hsiang's lab for their help with my research
and sharing their professional and life experiences. Special thanks to Dr. Lynn Tian, Linda
He and Karla De la Cerda for their technical support and helping me get through hard times.
I would like to thank to Jennifer Llewellyn and everyone in the nursery industries. Without them, I would not be able to be involved in such an interesting and challenging project.
I would like to give my thanks to my family members and friends. Without their
spiritual support, I would not be able to accomplish what I have done, many thanks for their
endless support and unconditional love.
i TABLE OF CONTENTS
ACKNOWLEDGEMENTS i
TABLE OF CONTENTS ii
LIST OF TABLES vi
LIST OF FIGURES viii
LIST OF APPENDICES x
LIST OF ABBREVIATIONS AND ACRONYMS xi
Chapter One: Literature Review 1
1.1 Introduction 1
1.2 Major Boxwood Diseases Caused by Fungi 3
1.2.1 Fungi associated with boxwood 3
1.2.2 Volutella leaf and stem blight 5
1.2.2.1 Taxonomy 5
1.2.2.2 Morphology 6
1.2.2.3 Disease history and description 9
1.2.3 Macrophoma leaf spot 11
1.2.4 Phytophthora root rot 11
1.2.5 Cylindrocladium leaf spot 12
1.3 Control Methods for Boxwood Diseases 13
1.3.1 Cultural methods 13
1.3.2 Chemical methods 15
1.4 Hypotheses and Objectives 15
Chapter Two: Causal Agent of A Disease of Boxwood 20 2.1 Introduction 20
2.1.1 Morphological methods of identification 20
2.1.2 Molecular methods of identification 21
2.1.3 Boxwood disease causal agents 22
2.1.4 Objectives 23
2.2 Materials and Methods 23
2.2.1 Sample collection 23
2.2.2 Media preparation 24
2.2.3 Fungal isolation from diseased boxwood tissues 24
2.2.4 Identification of fungal isolates with morphological technique 25
2.2.5 DNA extraction 26
2.2.6 Primer design and selection 27
2.2.7 PCR amplification 28
2.2.8 DNA concentration 28
2.2.9 DNA sequencing and result analysis 29
2.2.10 Koch's postulates 30
2.3 Results 31
2.3.1 Disease samples 31
2.3.2 Morphological characteristics of fungal isolates 32
2.3.3 Molecular identification of morphotypes 33
2.3.4 Volutella species comparison against the database on GenBank 34
2.3.5 Testing Koch's postulates 35
2.4 Discussion 36 Chapter Three: Biological Characteristics, Pathogenicity and Genetic Variation in
Volutella buxi 48
3.1 Introduction 48
3.1.1 Biological characteristics and disease development of Volutella spp. 48
3.1.2 Boxwood cultivars 49
3.1.3 Genetic diversity of Volutella buxi 51
3.1.4 Objectives 52
3.2 Materials and Methods 53
3.2.1 Boxwood plants and fungal isolates 53
3.2.2 Growth rates of Volutella buxi isolates 53
3.2.3 Pathogenicity and resistance 54
3.2.3.1 The infection process 54
3.2.3.2 Resistance 56
3.2.4 Primer screening and PCR amplification for ISSR " 57
3.2.5 DNA extraction and ISSR data analysis 59
3.2.6 Statistical analysis 60
3.3 Results 60
3.3.1 Sample collection and fungal isolates 60
3.3.2 Temperature effects on Volutella buxi 60
3.3.3 Pathogenicity and resistance 62
3.3.4 Disease development during inoculation progress 62
3.3.5 Genetic variation in Volutella buxi 62
3.4 Discussion 63 Chapter Four: Effects of Fungicides on Volutella Blight Development 80
4.1 Introduction 80
4.1.1 Fungicides used for ornamentals in Canada 81
4.1.2 Objectives 85
4.2 Materials and Methods 85
4.2.1 Boxwood plants and fungal isolates 85
4.2.2 Fungicide selection 86
4.2.3 Fungicide sensitivity on amended agar 86
4.2.4 Fungicide test on whole plants in 25 °C room 88
4.2.5 Statistical analysis 89
4.3 Results 90
4.3.1 Boxwood samples and fungal isolates of Volutella buxi 90
4.3.2 EC50 values and threshold concentrations of fungicides 90
4.3.3 The efficacy of fungicides on boxwood plants in 25 °C room 91
4.4 Discussion 91
Chapter Five: General Discussion 102
REFERENCES 110
APPENDICES 120
V LIST OF TABLES
Table 2.1 Number and frequency of morphotypes recorded based on 312 fungal isolates associated with Volutella leaf and stem blight of boxwood. Species from the eight major morphotypes were identified with morphological and molecular biological techniques. 40
Table 2.2 A list of 41 accession numbers and species names of ITS sequences collected from GenBank by searching for 'Volutella', and then used to in phylogenetic analysis. 41
Table 3.1 Boxwood plants records with collection date, location, and number of each cultivar as 3-inch potted plants or cuttings. 69
Table 3.2 Number of Volutella buxi isolates collected from Georgetown, St. Catherines and B.C. from boxwood cultivars 'Chicagoland Green', 'Green Beauty', 'Green Mound', 'Green Mountain' and 'Green Velvet'. 70
Table 3.3 Mean mycelial growth of three Volutella buxi isolates at 10, 15, 20, 25, 30 and 35 °C. A 5-mm-diameter plug from a 7-d-old culture was used to inoculate each tube and the tubes were incubated for 16 d. Each isolate by temperature combination was repeated three times. 71
Table 3.4 Mean mycelial growth during 16 d at 25 °C of 32 Volutella buxi isolates collected from Georgetown and St. Catherines. There were five replicates for each isolate. 72
Table 3.5 Detached leaves of each boxwood cultivar were inoculated with a 0.14 ml of spore suspension of Volutella buxi (106 spores/mL) and incubated at 25 °C for 5 d. The infected leaves were rated for disease severity from 0 (low) to 9 (high). This experiment was repeated five times. 73
Table 4.1 Fungicides commonly used in Ontario nurseries (from OMAFRA 2009). 96
Table 4.2 EC50 values for three isolates of Volutella buxi based on probit analysis of mycelial growth rates on PDA amended with benomyl or iprodione at 0.1, 0, 1 and 10 |ag/mL or propiconazole at 0.01, 0.1, 0 and 1 ug/mL at 25 °C for 16 d. Each isolate by fungicide combination was repeated three times. 97
Table 4.3 Fungicides which were used against Volutella leaf and stem blight on whole plants of boxwood in 25 °C room. 98
Table 4.4 Efficacy of fungicidal treatments before (7 d) or after inoculation (7 d or 7 d plus 14 d) and incubated under 24 h light (50 umol/m2/s) at 25°C. A spore suspension of V buxi (106 spores/mL) and fungicidal treatments were applied to each plant until runoff. Disease was rated (0 to 8) at 7 d after inoculation or first fungicide application as a product of the number of symptomatic leaves (0 to 8) and the average proportion of symptomatic leaf area (ranging from 0 to 1 representing 0% to 100%). The disease ratings were translated to percent where 8=100. 99 LIST OF FIGURES
Figure 1.1 Volutella leaf and stem blight caused by Volutella buxi. Diseased boxwood leaves are bronzed and yellow. 18
Figure 1.2 Volutella leaf and stem blight caused by Volutella buxi with fruiting bodies on the leaves. 19
Figure 2.1 Eukaryotic ribosomal DNA (rDNA) gene showing primer locations in the ribosomal cassette consisting of the small subunit (SSU), large subunit (LSU), and internal transcribed spacers (ITS). Gray boxes represent highly conserved regions. Primers are positioned above (forward primers) or below (reverse primers) their sequence positions (White etal. 1991). 42
Figure 2.2 Boxwood plants infected with boxwood blight. 43
Figure 2.3 Black streaking was observed on some boxwood stems. 44
Figure 2.4 Eight morphotypes of fungi associated boxwood blight grown on PDA plates at 25 °C for 7 d: (a) Pink-orange; (b) Red; (c) Pure white; (d) White-yellow; (e) Black with black dots; (f) Red-grey; (g) Light purple; (h) Yellow-orange. 45
Figure 2.5 Volutella buxi grown on PDA plates at 25 °C for 7 d. 46
Figure 2.6 Genetic distance dendrogram of ITS sequences of Volutella buxi (Isolates 08126, 09012 and 10113), other Volutella spp. and other fungal species in the GenBank database, rooted with Leptodiscella africana. This tree was constructed using the Neighbor-Joining method with CLUSTAL X. Numbers at internal branch points represent bootstrap support expressed as a percent of 1000 replicates. GenBank accession numbers were shown before the species names, except for those which were sequenced in this study (Isolates 08126, 09012 and 10113). 47
Figure 3.1 Screw-cap test tubes filled with PDA were used for the temperature growth test for Volutella buxi. An inoculated plug from an actively growing culture was placed at the mouth of each tube. 74
Figure 3.2 Mean mycelial growth of three isolates of Volutella buxi at 10,15,20,25, 30 and 35 °C in screw-cap test tubes for 16 d. Each isolate by temperature combination was repeated three times. Bars show standard error. 75
Figure 3.3 Conidial germination of Volutella buxi at 12 h (top) and 24 h (bottom) on water agar (100x). Scale bar represents 100 um. 76
Figure 3.4 Growth of Volutella buxi after 3 d on the surface of a boxwood leaf where verticillate structures can be observed. Scale bar represents 100 um. 77
Figure 3.5 Attached leaves on whole plants of 'Green Velvet' were cut in half and
Vll inoculated by spraying a 106 spores/mL spore suspension of Volutella buxi until runoff and covering with plastic bags. Pink sporodochia appeared on inoculated cut leaves by 3 d. These pictures were taken at 5 d after inoculation. 78
Figure 3.6 UPGMA dendrogram of 86 isolates of Volutella buxi from five cultivars of boxwood, and two nurseries in Ontario and one nursery in B.C. based on two ISSR primers (AG)8 and (CAC)s. The scale is based onNei and Li's coefficient of similarity Major nodes supported by bootstrap values greater than 50% are indicated by star (*). 79
Figure 4.1 Picture of a cut agar plate. The three-strip agar assay was used to reduce number of plates used. Each strip of agar is inoculated with a different isolate of Volutella buxi, and each isolate was replicated three times. 100
Figure 4.2 Map of Ontario, Canada, showing nurseries at Georgetown, St. Catherines and Niagara-on-the-Lake where collections of Volutella buxi were made. 101
Vlll LIST OF APPENDICES
Appendix 2.1 ITS regions of eight different morphotypes of fungi collected from diseased boxwood. 120
Appendix 2.2 ITS sequencing results of three isolates of Volutella buxi (Isolates 08126, 09012 and 10113). The ITS of isolates 08126 and 09012 were sequenced with primers ITS 1 and ITS4. The ITS of isolate 10113 was only sequenced with primer ITS 1. 122
Appendix 2.3 BLAST result of the ITS sequence of Volutella buxi (Isolate 08126) against the NCBI database showing top 12 matches and top two alignments. 123
Appendix 2.4 List of nucleotide sequences and alignment used to design primers for the amplification of the Pseudonectria rousseliana beta-tubulin gene. The sequence of P. rousseliana (DQ522522) was compared with a complete beta-tubulin sequence of Gibberella fujikuroi (GFU27303). Box showed the position of forwarded and reverse primers. 126
Appendix 2.5 BLAST result of a partial beta-tubulin sequence of Pseudonectria rousseliana (Isolate 10113) against the NCBI database showing top 10 matches and top two alignments. 131
Appendix 3.1 An example of SAS statements used to analyze mycelial growth data of Volutella buxi. 134
Appendix 3.2 A total of 148 isolates of Volutella buxi were collected from different locations and boxwood cultivars in this study. Among them, 32 were chosen for temperature and fungicide test, and 86 which showed polymorphic bands with primers (AG)8 and (CAC)5 were chosen for genetic diversity analysis. Isolates which were chosen for each experiment are indicated. 135
Appendix 4.1 An example of SAS statements used to calculate EC50 values of benomyl. 139 Appendix 4.2 An example of SAS statement used to analyze the disease rating in fungicide tests on whole plants at 25 °C. 140
IX LIST OF ABBREVIATIONS AND ACRONYMS
AFLP: Amplified Fragment Length Polymorphism B.C.: British Columbia BLASTN: Basic Local Alignment Search Tool Nucleotide bp: base pair(s) C: Centigrade cm: Centimeter d: day DCOFs: Dicarboximide fungicides DEFRA: Department for Enviroment Food and Rural Affairs DMI: Demethylation inhibitor DNA: Deoxyribonucleic acid EDTA: Ethylenediaminetetraacetic acid FRAC: Fungicide Resistance Action Committee g: gram(s) ISSR: Inter Simple Sequence Repeat ITS: Internal Transcribed Spacer h: Hour (s) ha: Hectare Inc.: Incorporation L: liter(s) LSD: Lab Services Division LSU: Large Subunit M: Molar m: meter(s) min: minute(s) mol: Mole NIH: National Institutes of Health NCBI: National Center for Biotechnology Information OMAFRA: Ontario Ministry of Agriculture, Food and Rural Affairs oz: ounce PCR: Polymerase Chain Reaction PDA: Potato dextrose agar PMRA: The Pest Management Regulatory Agency rDNA: Ribosomal DNA RAPD: Random Amplification of Polymorphic DNA rRNA: Ribosomal Ribonucleic Acid rpm: revolutions per minute s: second(s) SSU: Small Subunit TBE: Tris Borate EDTA x g: times gravity TE: Tris EDTA U.K.: United Kingdom USA: United States of America
X UV: Ultraviolet V: volt v/v: volume on volume w/v: weight on volume WP: Wettable Powder CHAPTER ONE LITERATURE REVIEW 1.1 Introduction
Buxus species, known as boxwood or box, are native to Europe, Asia and America,
with the majority of species originating from tropical or subtropical areas (Pherson 2005;
Henricot and Culham 2002). Boxwood is an important landscape crop and used very
commonly for parterres, knot gardens, hedging work and topiaries all over the world
(Pherson 2005; Henricot and Culham 2002). Boxwood is capable of enduring extensive
pruning and long periods between watering (Pherson 2005). By fermentation and
distillation of boxwood, pure methanol, which also called 'spirit of box' and 'pyroxylic
spirit' was isolated by Robert Boyle in 1661 (Soni 2007). Particular species, such as B. sempervirens, have been used medicinally since ancient times (Nisa 1985). There are 160
registered cultivars of boxwood (Jacobi et al. 2003). The most common commercially used
species are B. sempervirens, B. microphylla, B. sinica and their hybrids. The features of
several important species of boxwood are as follow based on Jacobi et al. 2003. Buxus
sempervirens known as common boxwood grows from 1.5 to 3 m as a shrub or small tree.
Buxus sempervirens 'Suffruticosa' known as English boxwood grows from 0.6 to 1.2 m.
Buxus microphylla known as littleleaf grows from 0.9 to 1.2 m. Buxus microphylla var.
Japonica known as Japanese boxwood grows from 0.9 to 1.8 m. Buxus sinica var. insularis
(formerly B. microphylla var. koreana) known as Korean boxwood grows from 0.6 to 0.9 m
which is the most cold-hardy boxwood.
Since the early 1900s, boxwood diseases have been commonly reported, such as leaf
spot, leaf and stem blight, and root rots (Jacobi et al. 2003). One of the major diseases is
Volutella leaf and stem blight (Figure 1.1), which is caused by the fungus Volutella buxi
l (Corda) Berk., and is considered as the primary cause of boxwood decline (Hartman 2001).
This disease has been found in the U.S. (White 1931), the U.K. (Berkeley and Broome
1850; Moreau 1919), Canada (Joshi and Jeffries 2006 and 2010), Italy, Spain, Germany,
England (Saccordo 1883) and Switzerland (Bezerra 1963). Other species of Volutella also infect pachysandra (Safrankova 2005), alfalfa (Eken et al. 2002), red clover, blood lily
(Narayanan 1962) and other plants. Other common fungal diseases reported on boxwoods are Macrophoma leaf spot, Phytophthora root rot, and Cylindrocladium leaf spot.
Proper cultural practices can decrease the incidence of boxwood diseases (Malinoski and Davidson 2009; Jacobi et al. 2003). Fewer disease problems will be found if there is proper soil preparation, proper planting depth, and adequate soil drainage. The optimal soil pH range for growing boxwood plants is from 6.5 to 7.2 (Malinoski and Davidson 2009).
Nurseries at several locations across Ontario have observed outbreaks of boxwood diseases since at least 2000. Because 2008 was a particularly wet growing season, a boxwood disease in several nurseries in Southern Ontario was found on four commonly grown cultivars: 'Green Gem', 'Green Velvet', 'Green Mound' and 'Green Mountain'.
These are open-pollinated seedlings with the female parent B. sempervirens 'Suffruticosa' and the male parent B. sinica var. insular is. In British Columbia (B.C.), this boxwood disease was also observed in several nurseries on several cultivars, especially on Buxus sp.
'Glencoe' (commercial name 'Chicagoland Green') which is the hybrid of B. microphylla var. koreana and B. sempervirens. An unpublished internal report from a major nursery in
Ontario regarding the 2008 outbreak mentioned that Volutella leaf and stem blight (hereon referred to as Volutella blight) was the main boxwood disease encountered, based on preliminary diagnoses from a local disease diagnostic laboratory. To attempt to control this
2 disease, they used a mixture of Phyton (copper) and Nova (myclobutanil) fungicide on
diseased boxwood plants, but the treatments were found to be ineffective in reducing levels
of the disease. The etiology of this disease has not been studied, and the causal agent of the
boxwood disease in Ontario still needs for their study.
This literature review focuses on boxwood diseases caused by fungi, especially
Volutella buxi. Plant diseases which are caused by other Volutella species are also
discussed since there is often much more information about these diseases than the one on
boxwood. Other major boxwood diseases reviewed are Cylindrocladium leaf spot caused
by Cylindrocladium buxicola Henricot, Macrophoma leaf spot caused by Macrophoma
candollei (Berk. & Broome) Berl. & Voglino, and Phytophthora root rot caused by
Phytophthora spp.
1.2 Major boxwood diseases caused by fungi
1.2.1 Fungi associated with boxwood
Several fungi are known to cause diseases on boxwood. Volutella buxi is considered
the principal pathogen causing leaf spots on boxwood. Macrophoma candollei is
considered a secondary colonizer of leaves. Other important fungal diseases of boxwood
are as follows: Phytophthora root rot caused by Phytophthora cinnamomi Rands and P. parasitica Dastur, and Cylindrocladium leaf spot caused by Cylindrocladium buxicola.
These diseases and their causal agents will be discussed in their own section later.
There are some minor boxwood diseases caused by fungi, for instance, boxwood rust,
caused by Puccinia buxi D.C., was reported by Preece (2000), who pointed out that P. buxi
only occurs on old boxwood plants. However, Durrieu (2001) noted that/? buxi was found
3 on new leaves of boxwood. From the living tissues of B. sempervirens, P. buxi and
Mycosphaerella limbalis (Pers.) v. Arx. were collected in Switzerland by Bezerra (1963).
At the same location, Dothidea puccinioides Fr., Ceuthospora buxi (Fr.) Petrak,
Macrophoma mirbelii (Fr.) Berl. & Vogl., Dothiorella candollei (Berk. & Br.) Petrak.,
Hyponectria buxi (DC.) Sacc. and Pseudonectria rousseliana (Mont.) Wollenw. were isolated from dead tissues of boxwood (Bezerra 1963). Hyponectria buxi caused boxwood leaves to turn reddish rust-brown with many small sunken spots (Dodge 1944b). Olariaga et al. (2007) reported that Typhula buxi Maire has 1.5 - 8(- 14) mm long basidioma, and single, pale brown sclerotia, and can be found on dead leaves of B. sempervirens and B. balearica (Olariaga et al. 2007).
Most fungi reported on the lists of fungi associated with boxwood do not necessarily cause disease. These fungi include the following: Actinocladium rhodosporum Ehrenb.;
Armillaria mellea (Vahl) P. Kumm.; Blennoria buxi Fr.; Brachysporium britannicum S.
Hughes; Camarops lutea (Alb. & Schwein.) Shear; Cercospora spp.; Cladosporium herbarum (Pers.) Link; Chaetosphaeria inaequalis (Grove ex Berl. & Voglino) W. Gams &
Hol.-Jech.; Erythricium salmonicolor (Berk. & Broome) Burds.; Fusarium buxicola Sacc;
F. lateritium Nees; F. moniliforme J. Sheld.; F. solani (Mart.) Sacc; Gibberella buxi
(Fuckel) Cooke; Gliocladium roseum Bainier; Glomerella cingulata (Stoneman) Spauld. &
H. Schrenk; Guignardia miribelli; Helminthosporium velutinum Link; Irene buxi I. Hino &
Katum.; Microthelia incrustans (Ellis & Everh.) Corlett & S. Hughes; Microthyrium ciliatum var. hederae J.P.Ellis; Microthyrium macrosporum (Sacc.) Hohn.; Mycosphaerella buxicola (DC.) Tomilin; Nectria cinnabarina (Tode) Fr.; Nectria desmazieresii Beccari &
De Not.; Olpitrichum macrosporum (Farl. ex Sacc.) Sumst; Pachnocybe albida (Fr.) Berk.;
4 Pellicularia koleroga Cooke; Phellinus punctatus (Fr.) Pilat; Phoma glomerata (Corda)
Wollenw. & Hochapfel; Phomopsis stictica (Berk. & Broome) Traverso; Phyllactinia
corylea (Pers.) P. Karst; Phytophthora nicotianae var. Parasitica (Dastur) G.M. Waterh.;
Pythium helicoides Drechsler; Pythium irregulare Buisman; Pythium splendens Braun;
Rhizoctonia ramicola W.A. Weber & D.A. Roberts; Rosellinia buxi Fabre; Sesquicillium
buxi (J.C. Schmidt ex Link) W. Gams; Sporidesmium adscendens Berk.; Sporidesmium
altum (Preuss) M.B.Ellis; Sporidesmium carrii Morgan-Jones; Verticillium albo-atrum var.
caespitosum Wollenw.; Zygophiala jamaicensis E.W. Mason (Ellis and Ellis 1985; Farr et
al. 1989; Kobayashi 2007).
1.2.2 Volutella leaf and stem blight
1.2.2.1 Taxonomy
The fungal genus Volutella Tode (Ascomycota, Sordariomycetes, Hypocreales,
Nectriaceae) was named in 1790. Volutella ciliata (Alb. & Schwein.) Fr. (1832) is the type
species for Volutella. It can be easily isolated from washed soil particles under beech,
poplar, white cedar and especially in damp soils. It was first named as Tubercularia ciliata
(Alb. & Schwin.) (1805) and then named as V. ciliata in 1832, Chaetostroma ciliatum (Alb.
& Schwein.) Lev. in 1846 and Thysanopyxis ciliata (Alb. & Schwein.) Hohn. in 1904. In
the U.S., V. ciliata was first isolated from alfalfa in 1954 (Chilton 1954).
Some causal agents of Volutella pathogens have been known by the same names since
they were first found, such as Volutella colletotrichoides J.E. Chilton (1954), V. pachysandricola B.O. Dodge and Volutella kamatii Narayanan (1962). Other Volutella
pathogens have first gone under other scientific names and then been transferred to
5 Volutella. For instance, V. gilva (Pers.) Sacc. (1881) had a basionym of Conoplea gilva Pers. in 1822.
The fungus V. buxi has had a previous name Chaetostroma buxi Corda (Berkeley and
Broome 1850). Later, it was named by Berkeley in 1850 as Volutella buxi and this name is still in use (Berkeley and Broome 1850). Volutella buxi was considered a synonymy of
Fusisporium buxi (J.C. Schmidt ex Link) Fr. by Griffith and Henfrey (1883) which they described as "white; on dry box leaves". However, Fusisporium buxi is a synonymy of
Clonostachys buxi (J.C. Schmidt ex Link) Schroers which has a Bionectria teleomorph and is distinct from Pseudonectria (Index Fungorum website), so this synonymy is incorrect.
Volutella buxi is the anamorph of Pseudonectria rousseliana. Some synonyms of the teleomorph are as follows (Cooke 1884; Bezerra 1963 and Wollenweber 1931):
Nectria rousseliana Mont. (1851)
Stigmatea rousseliana (Tul.) Fuckel (1869)
Nectriella rousseliana (Mont.) Saccardo (1877)
Lasionectria rousseliana (Mont.) Cooke (1884)
Pseudonectria rousseliana (Mont.) Seaver (1909)
Notarisiella rousseliana (Mont.) Sacc. ex Clem. & Shear (1931)
Pseudonectria rousseliana (Mont.) Wollenw. (1931)
The currently accepted name is Pseudonectria rousseliana (Mont.) Wollenw. from
1931.
1.2.2.2 Morphology
Morphological descriptions have been given for various Volutella species, such as V.
6 ciliata, V. buxi V. colletotrichoides and V. pachysandricola. The descriptions of Volutella species generally list the mycelia as orange or salmon and slimy when grown at 25 °C on potato dextrose agar (PDA) (Eken et al. 2002 and Safrankova 2005).
The colony of V. ciliata is white and pale pink with sporodochia. Conidiophores are
Verticillium-\ikQ and produce ellipsoidal to cylindrical, non-septate conidia with a size of 4
- 6 (- 9) * (1.5 -) 2.0 - 2.5 am (Domsch and Gams 1972; Domsch et al. 1980). The sporodochia are stipitate or sessile with a height of 80 - 185 x 50 - 100 jam and a diameter of 30 - 50 um (Samuels 1977).
The mycelium of V. buxi on PDA is whitish at the beginning and becomes light pink or peach later. The conidia of V. buxi from the undersurface of dry boxwood leaves are fusiform, and the size is (2.8 -) 6.5 - 9 x 2 - 3.5(- 4.3) um (Rossman 1993). The sporodochium is 50 - 240 urn and has hairs or setae from bases to sides (Rossman and
Samuels 1993). The hyphae of V. buxi have verticillate branches (Dodge 1944c; Rossman and Samuels 1993). The color of perithecia of P. rousseliana (teleomorph of V. buxi) is from light orange to greenish (Bezerra 1963). The shape of perithecia is globose or subglobose, 135 - 190 um x 180 - 250 um, with a flat apical disc, setose and an 18 - 25 um wall (Bezerra 1963; Arslan 2009). The width of perthecial wall is 7 - 19 um (Rossman and
Samuels 1993). The asci are 43 - 52 x 7.4 - 11.2 um with single-cell walls (Rossman and
Samuels 1993). Ascospores are irregular, ellipsoid with truncated ends and become uniseriate toward base. The size of ascospores are 11.7 - 15.7 (- 17.6) x 3.7 - 4.3(- 5) um
(Rossman and Samuels 1993).
The colonies of V. colletotrichoides are orange at the beginning and become brownish orange later when they are grown on PDA plate. The shape of conidia of V.
7 colletotrichoides is navicular, 5.2 - 10 x 2 - 3.5 (jm (Domsch et al. 1980 and Eken et al.
2002). Conidiophores of V. pachysandricola are single, unbranched, monophialidic, and
9.1 - 17.5 um x 2.5 - 3.5 um. And the conidia are single- cell, hyaline and 10-21 x 3 - 4.1
um (Dodge 1944a; Safrankova 2007).
There are no details on the disease cycle of V. buxi, but the disease cycle of V. pachysandricola had been described. The infection of Japanese pachysandra by V. pachysandricola begins in senescent and damaged parts where they were exposed to sun,
winter drying, insect feeding and other factors (Safrankova 2007). Small brown spots can
be seen on leaves 5 to 9 d after infection (Safrankova 2007). Diseased areas are observed
on stems within 2 weeks of infection (Safrankova 2007). Sporodochia of V. pachysandricola are formed on leaves, stems and stolons within 6 to 8 d and produce
conidia (Safrankova 2007). The teleomorph of V. pachysandricola, Pseudomelia pachysandricola Dodge, is only observed on diseased stems. Safrankova (2007) also
demonstrated that conidia and ascospores germinate under moist conditions, and can
re-infect pachysandra plants. The spores are disseminated by air and splashing water
(Safrankova 2007).
1.2.2.3 Disease history and description
Volutella blights caused by Volutella species have been found in many countries on
different species of plants, such as Medicago sativa L. (alfalfa), Trifolium pretense L. (red
clover), Haemanthus mutliflorus Martyn (blood lily); and Pachysandra terminalis Sieb. &
Zucc. (Japanese pachysandra) (Chilton 1954; Narayanan 1962; Safrankova 2005). The
alfalfa and red clover disease caused by V. colletotrichoides was first reported in Ames,
8 Iowa, U.S. in 1954 (Chilton 1954). And the Volutella disease on alfalfa was first reported in
Turkey in 2002 (Eken et al. 2002). On infected alfalfa plant tissues, another two Volutella fungal species were also isolated, V. gilva and V. ciliata (Chilton 1954). Volutella kamatii was found on leaves of blood lily which caused the plants to have golden yellow patches and circular sporodochial fruiting bodies (Narayanan 1962). The pachysandra disease caused by V. pachysandricola is found world-wide, from North America (Dodge 1944a),
Britain, Poland 2001, Germany 2001, Turkey 2002 (Eken et al. 2002); and the Czech
Republic (Safrankova 2007).
The first published report of V. buxi may have been in August 1884 from San Francisco,
California, where V. buxi was found on dead leaves of Buxus sempervirens (Harkness
1886). The perfect stage Pseudonectria rousseliana was reportedly found in Italy, Spain,
Germany and England (Saccordo 1883). Boxwood disease caused by V. buxi was found in an English garden at Chateau Fontainbleau in France in 1915 (Moreau 1919). In August
1962, diseased samples were collected from dead B. sempervirens in Switzerland (Bezerra
1963). In Canada, Joshi & Jeffries (2006 and 2010) reported the occurrence of Volutella blight in British Columbia in the annual Canadian Plant Disease Survey (Joshi and Jeffries
2006 and 2010). However, in the 2007, 2008 and 2009 surveys, this disease was not reported (CPS 2007, 2008 and 2009).
Boxwood leaves infected with Volutella blight change from a normal dark green to bronze, and pink sporodochia can be seen on leaves and twigs (Figure 1.2) (Jacobi et al.
2003; Hansen 2000). Boxwood leaves sometimes turn bronze as well in the winter
(Pherson 2005), and this can be mistaken for Volutella blight. Volutella infections often occur following winter injury or frost injury (Hansen 2000), and the symptoms can be
9 confused with winter injury (Hansen 2000; Pataky 2003). The pink sporophores are distinctive, and can be used to distinguish Volutella blight from winter injury. New and healthy leaves will grow out in spring after winter injury, but not after severe Volutella blight infection (Hansen 2000).
1.2.3 Macrophoma leaf spot
Macrophoma leaf spot is caused by Macrophoma candollei which is considered a secondary colonizer of boxwood leaves. English and common boxwoods are less susceptible to this leaf spot compared to Japanese and Korean boxwood (Jacobi et al. 2003).
Infected leaves show symptoms varying from spotting to browning at tips or edges. Later, many raised black dots and the fruiting bodies (pycnidia) of the fungus, can easily be seen on dead and dying leaves (Jacobi et al. 2003).
The presence of disease indicates that the plant is under stress from some other factors
(Hansen 2000; Jacobi et al. 2003). Healthy, vigorous, growing plants are rarely infected by
M. candollei (Jacobi et al. 2003). No fungicide has been found to be effective for control of this disease (Malinoski and Davidson 2009; Hansen 2000), but the following cultural methods are recommended: providing water during dry conditions, avoiding overwatering, providing proper nutrition, and thinning shrubs to improve light and air circulation (Jacobi et al. 2003).
Although Macrophoma leaf spot is considered one of the important diseases of boxwood, there is limited research demonstrating this. However, Macrophoma spp. have been long investigated since they occur on wide range of hosts, such as tea, guava, apple, among others. Macrophoma theicola Petch. causes branch canker and twig dieback of tea
10 (Thseng et al. 2004). Macrophoma candollei has dark pycnidia, and single-celled hyaline conidia (Hansen 2000). Dothiorella candollei (synonym: Macrophoma candollei) has cloudy, hyaline conidia with two guttules. The size of conidia is 27 - 40 x 8 - 11 um (Ellis and Ellis 1985).
Synonyms of Macrophoma candollei are as follows:
Spaeropsis candollei Berk. & Brooke in 1855
Phoma candollei (Berk .& Broome) Sacc. in 1884
Macrophoma candollei (Berk. & Broome) Berl. &Voglino in 1886
Ludwigiella candollei (Berk. & Broome) Petr. in 1923
The currently accepted name is Dothiorella candollei (Berk. & Broome) Petr. from
1923.
1.2.4 Phytophthora root rot
Phytophthora root rot is common in the extension literature because it occurs on many species of plants. It is found not only on boxwood, but also infects chestnut, oak, cinchona, cinnamon, pineapple, among others. On Buxus, Phytophthora root rot is caused by
Phytophthora cinnamomi and P. parasitica (Jacobi et al. 2003; Malinoski and Davidson
2009; Hansen 2000). Symptoms can be seen on the whole plants. Leaves turn light green first and yellow later (Hansen 2000; Jacobi et al. 2003). The infected bark is easily separated from the wood (Hansen 2000). Sinclair and Lyon (2005) reported that approximately 60 Phytophthora spp. are important plant pathogens. In Western Australia alone, more than 2,000 plant species are susceptible to P. cinnamomi (Dobrowolski et al.
2008). Plant tissues can be killed by toxins and enzymes of Phytophthora species (Sinclair
n and Lyon 2005).
The fungus P. cinnamomi has a wide host range as a soil- and water-borne plant pathogen of woody plants (Dobrowolski et al. 2008). Small absorbing roots and larger roots can be attacked by P. cinnamomi (Sinclair and Lyon 2005). After the symptoms appear, the average life span of infected plants is six years (Sinclair and Lyon 2005). The mycelia of P. cinnamomi are produced under warm and moist conditions (Cahill et al.
2008). The optimal sporulation temperature is from 20 to 32 °C, but not below 5 - 15 °C
(Sinclair and Lyon 2005).
Unlike Macrophoma leaf spot and Volutella blight, chemical controls are available and recommended for Phytophthora root rot. Soil drenching with fungicides such as mefenoxam, metalaxyl, fosetyl-Al or etridiazole plus thiophanate methyl is feasible when root rot severity is low (Hansen 2000).
1.2.5 Cylindrocladium leaf spot
In the mid-1990s, a boxwood blight disease was found in the U.K. which was caused by the fungus Cylindrocladium (Henricot et al. 2000). This disease causes brown spots of boxwood leaves and black streaks of stems, but not death. Black streaks on the stem progress from bottom to the top of boxwood plants. Cylindrocladium species are
considered secondary pathogens of boxwood and have been associated with disease caused by Volutella buxi. However, the occurrence of Cylindrocladium leaf spot and Volutella blight can be found independently (Henricot et al. 2000).
Based on the comparison of ribosomal DNA, beta-tubulin, and the MAT! genes, the fungus Cylindrocladium buxicola was identified and named as a new species by Henricot
12 et al. in 2000. To assess the origin of C. buxicola, amplified fragment length polymorphism
PCR (AFLP) was used to analyze 18 isolates of C. buxicola from the U.K. and one isolate from New Zealand. The results showed little variation among these isolates collected in different locations, which indicated a homogenous population and asexual reproduction
(Henricot and Culham 2002).
To distinguish Cylindrocladium buxicola from other Cylindrocladium species, the growth and morphology of C. buxicola had been compared with other species of
Cylindrocladium. The fungus C. buxicola has single septate conidia with pointed apices.
The ellipsoidal vesicles of conidia are one of the features to distinguish this from C. scoparium which lacks vesicles. The vesicles of C. buxicola at (6.5) - 8.75 - (11) urn, are slightly larger than those of C. scoparium at (6) - 7 - (8) um. Conidia of C. buxicola are 42
- 68 x 4 - 6 (am, however C. scoparium is slightly smaller at 40 - 52 urn x 4 - 5 um. The optimal growth temperature of C. buxicola on 2% malt extract agar is 25 °C, but it does not grow at 30 °C, while C. scoparium is tolerant of 30 °C (Henricot and Culham 2002).
1.3 Control methods for boxwood diseases
1.3.1 Cultural methods
Currently, cultural practices are used widely to control boxwood diseases. Proper cultural activities can decrease severity of boxwood diseases. Boxwood grows better in semi-shade, because full sun can make boxwood leaves off color. Japanese boxwood is more tolerant of full sun than other species. Overwatering boxwood should be avoided, since it can predispose plants to root rot (Jacobi et al. 2003). Diseased branches and leaves should be removed as soon as possible, because thinned shrubs can allow better air circulation and prevent severe disease development (Jacobi et al. 2003; Relf 1997).
13 English boxwood {Buxus sempervirens 'Suffruticosa') should not be planted in the same place where the same species has died or declined in that location. However,
American boxwood {Buxus sempervirens) can be planted in such locations. If
Phytophthora root rot has occurred, it is better not to plant boxwood in the same area, or replant but with improved soil drainage (Relf 1997).
1.3.2 Chemical methods
No fungicides are registered for Macrophoma leaf spot or Volutella blight of boxwood in Canada (Hansen 2000). In the U.S., no fungicides are registered to control Volutella blight of boxwood (Hartman 2001). However, Daconil 2787 which contains chlorothalonil was registered to control Volutella leaf blight on pachysandra in 1980 in Canada
(http://pr-rp.hc-sc.gc.ca/ls-re/index-eng.php on Feb 11). Bordeaux mixture was reported as a control method early on against Volutella blight of boxwood (White 1931). Copper fungicides and lime sulphur applications can be used for severe infections, but diseased branches cannot be cured (Malinoski and Davidson 2009). However, Bordeaux mixture, copper and lime sulphur are not registered for boxwood diseases in Canada, and directions for their use have not been given (White 1931; Malinoski and Davidson 2009). Several nurseries have tested copper fungicides on diseased boxwood in the growth room and the field, but these chemicals were found to be generally ineffective against Volutella blight of boxwood.
To control Cylindrocladium leaf spot, several fungicides were tested on boxwood in vitro. Some of them significantly inhibited the germination of conidia or the growth of mycelia. The following fungicides can entirely inhibit mycelial growth up to 14 d:
14 carbendazim, penconazole, prochloraz, kresoxim-methyl, eproxiconazole + pyraclostrobin, epoxiconazole + kresoxim-methyl + pyraclostrobin and boscalid + pryaclostrobin. The fungicide chlorothalonil inhibits the germination of conidia of C. buxicola at 100%
(Henricot et al. 2008).
1.4 Hypotheses and Objectives
1) Hypothesis: Volutella buxi is the primary cause of the boxwood disease in Ontario nurseries.
Background: A boxwood disease has been observed in Europe and North America, and has caused economical losses in Ontario and B.C. nurseries during the last few years. However, the causal agent of the boxwood disease in Canada needs to be confirmed.
Objective: Collect diseased boxwood samples from southern Ontario and B.C. and confirm the causal agent using morphological and molecular techniques.
2) Hypothesis: DNA sequences for Volutella buxi will help resolve the phylogenetic relationships between Volutella and related taxa.
Background: On the GenBank website, there are ITS sequences for Volutella species, but the sequences differ so extensively that ones annotated as the same species certainly are not the same species. This is true for the multiple specimens of V buxi and V. ciliata which are available on GenBank.
Objective: Obtain DNA from V. buxi, and conduct a phylogenetic study using ITS sequences from these specimens as well as the sequences from GenBank. 3) Hypothesis: Young and wounded tissues of boxwood are more susceptible to infection by Volutella blight than old or unwounded tissues, and there are different between the susceptibility of different cultivars.
Background: The relative susceptibility of boxwood tissues to the boxwood disease is not known. Differential losses of different boxwood cultivars which were infected by V. buxi were observed in greenhouses and field plantings in Southern Ontario.
Objective: Study the infection process of Volutella buxi to assess the susceptibility of different boxwood ages and cultivars.
4) Hypotheses: The population structure of the fungus reflects a recent introduction into
Canada (low inter-province genetic variation) and a predominant asexual mode of reproduction (low intra-population variation).
Background: Genetic variation in any Volutella fungus has not been examined. It is not known whether these fungi reproduce and disseminate by mostly an asexual mode, and whether the fungus was recently reproduced into Canada.
Objective: Assess genetic variation in V buxi from various cultivars and geographic regions using multi-locus fingerprinting (e.g. RAPD and ISSR).
5) Hypothesis: Preventive rather than curative fungicidal treatments are needed to control
Volutella blight.
Background: No fungicides are registered for control of Volutella blight in Canada.
Previous testing by nurseries in Southern Ontario with copper fungicides found them to be ineffective against Volutella blight.
16 Objective: Conduct fungicide efficacy studies in the lab and in the greenhouse to examine preventive and curative treatments of various fungicides against Volutella blight.. Figure 1.1 Volutella leaf and stem blight caused by Volutella buxi. Diseased boxwood leaves are bronzed and yellow.
18 „^
. •••.
-*" .^-'
r<-^:^i-i- .>:^;<^r-^r.:s-:A !•••• g Figure 1.2 Volutella leaf and stem blight caused by Volutella buxi with fruiting bodies on the leaves. 19 CHAPTER TWO CAUSAL AGENT OF A DISEASE OF BOXWOOD 2.1 Introduction An outbreak of a boxwood disease occurred in Southern Ontario in 2008, after the disease had been observed in Ontario for over 10 years. The major purpose of this work was to identify the causal agent of this boxwood disease. There are both biotic and abiotic sources of injury such as winter injury or cold weather, so a large sample size is required to ensure consistent association between a causal factor and a disease. A major purpose of this work was to fulfill Koch's postulates with respect to putative causal agents of the boxwood disease. These rules were formulated by Koch in 1884 for assessing causal agents of disease and are described as follows: (1) The organism must be associated in a pathological relationship to the disease and its symptoms; (2) The organism must be isolated and obtained in pure culture; (3) Inoculation of the organism from the pure culture must reproduce the disease; and (4) The organism must be recovered once again from the lesions of the host. In addition to fulfilling Koch's postulates, the causal agents need to be identified using both traditional morphological methods and newer molecular methods of identification. 2.1.1 Morphological methods of identification The morphological identification method is the traditional way to identify fungi based on their macroscopic and microscopic features. Morphological methods can usually provide an initial identification of fungi to a taxonomic level higher than species. Furthermore, the traditional basis of fungal taxonomy is morphological, and it is necessary to first identify and name a fungus before a valid annotation of a fungal DNA sequence 20 (Webster and Weber 2007). However, some fungi may be difficult to identify by cultural and microscopic characteristics because fungi tend to have few distinguishing morphological characteristics and these may be very similar between genetically very different species (Njambere et al. 2010). 2.1.2 Molecular methods of identification Molecular methods of identification have become increasingly important, particularly as the skills for morphological identifications are becoming rarer. The importance of accuracy of fungal identification is not only for knowing the right pathogen for plant disease management, but also for the proper selection of resistance genes in plant breeding (Njambere et al. 2010). Molecular methods of identification are used to confirm morphological assessments of identification (Webster and Weber 2007). The polymerase chain reaction (PCR) is commonly used to distinguish organisms because DNA fragments amplified from specific genes or regions can be separated by electrophoresis and show banding patterns (Scow et al. 2001). The method of DNA sequencing established by Sanger in 1977 is still used for DNA sequencing (Sanger et al. 1977). There are several regions of DNA that have been commonly used for fungal identification (Atkins and Clark 2004). One of these is the ribosomal DNA (rDNA) region which in eukaryotes includes tandem repeats of coding regions for the 18S, 5.8S and 28S ribosomal subunits (Figure 2.1). Interspersed between these coding regions are the intergenic region and the internal transcribed spacer (ITS) which has been commonly used to distinguish relationships between species (White et al. 1990). The beta-tubulin gene is also commonly used in fungal species identification and phylogenetics (Atkins and Clark 21 2004). For analysis, DNA fragments of targeted fungal species are sequenced, and the sequencing results are usually compared against large databases such as GenBank. GenBank is the genetic sequence database of National Institutes of Health (NIH) which contains public DNA sequences submitted by scientists from all over the world. The Basic Local Alignment Search Tool (BLAST) is a bioinformatic method of comparing sequencing information (blast.ncbi.nlm.nih.gov/Blast.cgi). By using BLAST, the fungal species can be roughly identified through comparisons with other fungal sequences. For more accurate identification, matching sequences should be downloaded and subjected to analysis with various phylogenetic software to more precisely examine similarities and relationships. 2.1.3 Boxwood disease causal agents Boxwood disease or damage can be caused by fungi, nematodes and small animals. Major fungal diseases of boxwood and their causal agents include Volutella leaf and stem blight (Volutella buxi), Macrophoma leaf spot (Macrophoma candollei), Phytophthora root rot (Phytophthora cinnamomi and P. parasitica), and Cylindrocladium leaf spot (Cylindrocladium buxicola). Although Volutella leaf and stem blight, hereon referred to as Volutella blight, has not been found to cause the death of entire boxwood plants, it does affect the quality and quantity of boxwood products in the nursery industry. Boxwood disease caused by Volutella buxi is typically associated with pink sporodochia (Jacobi et al. 2003), and this is an obvious sign of a fungal pathogen. Many boxwood cultivars which are commonly used in nurseries are also susceptible to 22 insects, such as leaf miners (Monathropalpus buxi and M. flavus), psyllids (Psylla buxi) and mites (Eurytetranychus buxi) (Malinoski et al. 1995). Lesion nematodes {Pratylenchus spp.) and spiral nematodes (Helicotylenchus spp. and Rotylenchus spp.) can damage the roots of boxwood and cause decline (Malinoski et al. 1995; Relf 1997). Some small animals, such as meadow voles (Microtus pennsylvanicus) that feed on roots of boxwood also cause damage (Malinoski et al. 1995). 2.1.4 Objectives The first major objective of this research project was to identify fungi associated with diseased boxwood using morphological and molecular biological techniques. After assessing the frequency of isolation of particular morphotypes or preliminarily identified species, attempts were made to fulfill Koch's postulates, and demonstrate pathogenicity of these isolates to determine the causal agent or agents of the boxwood disease. 2.2 Materials and Methods 2.2.1 Sample collection Diseased boxwood cuttings and potted plants including those with pink fruiting bodies (Figure 1.2), foliar die-back (Figure 2.2), and black streaks (Figure 2.3) were collected from several nurseries in Southern Ontario and British Columbia. The diseased plants were stored at 4 °C and examined within 5 d of collection. For fungicide tests and other tests involving inoculations, healthy potted plants were placed in a 25 °C room under 24 h light (50 umol/m2/s) and watered once a week with fertilizer solution, which was prepared by adding fertilizer 20-8-20 at 1.25 g/L water, and adjusting to pH 6.0. 23 To obtain healthy boxwood tissues for testing Koch's postulate, some symptomless boxwood tissues were collected from a hedge beside the Conservatory Garden of the University of Guelph, and this cultivar was confirmed by the staff at the Grounds Department of University of Guelph as 'Green Gem'. They were used the same day of collection. 2.2.2 Media preparation To grow fungal isolates, 2% potato dextrose agar (PDA, Becton, Dickinson and Company, MD, USA) was used. To suppress the growth of bacteria, PDA was amended with the antibiotics tetracycline (at 100 ug/mL) and streptomycin (at 100 (ig/mL). Antibiotics were added to PDA when the temperature was approximately 50 to 60 °C to avoid deactivation of the antibiotics. Each 9-cm-diameter plate was filled with 15 mL PDA. Fungal isolates were also stored for longer periods on PDA slants or mixed grains (corn, wheat, barley and oats) at 4 °C. 2.2.3 Fungal isolation from diseased boxwood tissues To isolate fungi from symptomatic tissues, infected tissues were cut into 5-mm-long segments including diseased areas bordering on live areas of stems or leaves. The 5 mm pieces were dipped into 75% ethanol for 2 s to wet the tissues, and then cut into 1 mm portions with alcohol-dipped and flamed tools. These 1 mm pieces were placed into 1% sodium hypochlorite for 30 s and dipped into an autoclaved deionized water rinse. On each 9-cm-diameter Petri plate containing antibiotic-amended PDA, four 1-mm-long pieces were placed. The plates were incubated at 25 °C and observed daily for fungal growth up to 24 14 d. Colony types were grouped into morphotypes on the basis of colour and crude cultural characteristics (e.g. shiny, stringy). Representatives of each morphotype which did not sporulate were subcultured and grown on PDA, and later stored in the set of stock vials at 4 °C. If there was sporulation, single spore isolates were then obtained to ensure purity. A spore suspension was first prepared at a concentration of 103 spores/mL. For cultures which produced obvious spomlating structures such as pink sporodochia, 100 uL of water were placed on sporulating structures of 7-d-old cultures, and a pipette tip was used to gently mix the sporulating structures with the added water. An aliquot of 1 uL was taken from the plate surface and added to 100 uL water in a 1.5 mL tube and gently finger vortexed. A haemocytometer was used to measure the spore concentration which was then adjusted to 10 spores/mL. A 100 uL aliquot was then taken and spread over the surface of a of a fresh PDA plate using a surface-sterilized L-shaped glass rod. After 24 h, the plates were microscopically examined at 100x to look for the presence of isolated spores or colonies. Single spores were transferred with a sterilized glass needle onto fresh PDA, and subcultured again after a few days. All isolates were maintained in a set of stock vials at 4 °C. 2.2.4 Identification of fungal isolates with morphological technique Representatives of different morphotypes were grown on fresh PDA and incubated at room temperature. Fungal colour and texture were observed daily until colonies covered the plates. After the plates were fully covered, features of fungal cultures were continually observed weekly up to six months. Fungal isolates were also observed with light 25 microscopy at 400x to observe the structure of mycelia and spores. Dimensions of hyphae and spores were recorded from three samples per isolate. Pictures were taken by digital camera at 400x magnification, and 1600 by 1200 resolution, and descriptions of each isolate were compared using fungal diagnostic keys, such as that of Barnett and Hunter (1972). 2.2.5 DNA extraction DNA was extracted following Edwards et al. (1991) with some modifications (Huang et al. 2001). To extract DNA from a 7-d-old PDA culture, the target fungal isolates were cultured for one week at 25 °C on PDA plates overlaid with a piece of autoclaved cellophane membrane. Approximately 100 mg of mycelia were harvested with a sterilized spatula avoiding the original PDA inoculum plug, and transferred into a 1.5 mL tube. Approximately 100 mg of autoclaved, acid-washed sea sand was added into the tube to help grind the fungal tissues. An aliquot of 200 uL of extraction buffer (Tris-HCl 200 mM, EDTA 25 mM, NaCl 250 mM, sodium dodecyl sulfate 0.5% (w/v)) was added into the 1.5 mL tube. The mixture was finger vortexed for a few seconds. A Mastercraft Lithium Ion Screwdriver (3.6V, Canada) was used to mechanically disrupt fungal cells for 80 s at 220 rpm. Another 200 uL of extraction buffer was added and mixed by finger vortexing for a few seconds. The tube which contained mycelia and DNA extraction buffer was incubated at room temperature for 2 - 3 h, after which it was spun at 12,000 x g in a Spectrofuge 16M centrifuge (Mandel Scientific Company, Guelph, Ontario, Canada) for 10 min. The supernatant was transferred to a fresh 1.5 mL tube and centrifuged at 12,000 x g for 2 min. The supernatant was then transferred to another fresh 1.5 mL tube. 26 To precipitate the DNA, an equal volume of isopropanol which had been stored at -20 °C was added and finger vortexed immediately. After the mixture of supernatant and isopropanol were stored at -20 °C for at least 10 min, it was centrifuged at 12,000 x g for 10 min and the supernatant discarded. The remaining pellet was washed twice with 200 uL of cold 70% (v/v) ethanol. To hasten drying of the pellet, the tube was placed upside down approximately 20 min with air blowing into the tubes. After the pellet had dried, 200 uL PCR water (nuclease free water, Fisher Scientific, USA) was added into tubes, and a pipette tip was used to break up the pellet. Tubes were placed at 4 °C for 1 h to overnight to allow the DNA to dissolve. The extracted DNA was stored at -20 °C. 2.2.6 Primer design and selection The ITS region of DNA is commonly used to separate fungal taxa at species and genus levels (White et al. 1991). Forward primers ITS1 (5'-TCCGTAGGTGAACCTGCGG) or ITS5 (5'-GGAAGTAAAAGTCGTAACAAGG) and reverse primer ITS4 (5'- TCCTCCGCTTATTGATATGC) target the fungal DNA region between the 18S and 28S genes of the multicopy ribosomal genes (White et al. 1991). These primers were selected to test DNA from fungi associated with boxwood disease. A single partial beta-tubulin sequence of Pseudonectria rousseliana (anamorph V. buxi, accession DQ522522) was found in the GenBank database. To compare it with the putative V. buxi isolates found in the current research, forward and reverse primers targeting the beta-tubulin gene of V. buxi were designed as follows. To assess the position of the partial sequence of P. rousseliana in an entire beta-tubulin gene, the sequence of P. rousseliana was compared with a complete beta-tubulin sequence of Giberrella fujikuroi 27 (GFU27303) with CLUSTAL X and found to be in the 1100 bp to 1800 bp range. Primers were then designed by aligning the sequence of G. fujikuroi and eight other sequences from closely related fungi by CLUSTAL X. Potential priming sites were selected from conserved regions just outside the 1100 bp and 1800 bp range and tested with GENRUNNER (v 3.02; Hastings Software) for dimer formation and other problems. 2.2.7 PCR amplification The PCR was performed in a total volume of 15 uL containing lx PCR buffer (50 mM Tris - HC1, pH 8.5); 2.5 mM MgS04; 0.2 mM dNTP; 0.5 uM of each primer separately; 0.6 U Tsg DNA polymerase (Biobasic, Scarborough, ON); and 1 uL of DNA extract, all gently mixed by finger vortexing. Amplifications were performed in a Mastercycler Personal (No. 5332 45205; Eppendorf, Hamburg, Germany) or MyCycler thermal cycler (No. 580BR 10624; Biorad, USA), with an initial denaturation step of 94 °C for 2 min, followed by 35 cycles of 94 °C for 30 s, annealing temperature for 1 min, 72 °C for 1 min, and a final extension at 72 °C for 10 min (Hsiang and Wu 2000). The annealing temperatures for ITS and beta-tubulin gene were 55 °C and 45 °C, respectively. 2.2.8 DNA concentration To assess the concentration of DNA extraction or PCR products, 1 % ultra pure agarose gels (Invitrogen, Carlsbad, California, USA) mixed with Tris-Borate-EDTA buffer (TBE) (90 mM Tris base, 90 mM boric acid and 2 mM EDTA) were used. To measure the size (bp) and concentration (ng/uL) of the DNA or PCR products, 5 uL of O'GeneRuler™ DNA Ladder Mix (Fermentas, USA) was loaded in a well of 1% ultra pure agarose gel. DNA 28 templates or PCR products aliquots of 5 uL were gently mixed with 1 uL of 6 x orange loading dye solution and loaded in wells. Electrophoresis was done at 50 or 100 V and 0.8 A in a Mupid 21 electrophoretical chamber (Helixx Technologies, Toronto, Ontario, Canada). Gels were stained with ethidium bromide (EtBr) solution at a concentration of 2 - 4 ug/mL for 5 min. An ultraviolet (UV) transilluminator from Syngene (Synoptics, Cambridge, Cambridgeshire, U.K.) was used for DNA band visualization. To examine the results, a GBC video camera CCTV (South Hackensack, New Jersey, USA) was used. If the gels were overexposured to EtBr, they were destained in tap water for 5 to 10 min. To record the results, an attached videocopy processor P67U (Mitsubishi Electric, Cypress, California, USA) was used to print hard copy of images. To save an electronic version of images, a desktop computer with attached frame-grabber card (Integral Technologies, Indianapolis, IN) was used to retain black and white jpeg files (resolution 800 x 600). 2.2.9 DNA sequencing and result analysis To identify the species of fungal isolates associated with the boxwood disease, PCR products of fungal DNA templates and primers were submitted for nucleic acid sequencing at the Lab Services Division (LSD) of the University of Guelph, where they use the capillary DNA device 3730 DNA Analyzer (Applied Biosystems, Foster City, California, USA). Sequencing results were received from LSD as two types of files: SEQ text files and chromatogram files. The SEQ file was reformatted as FASTA, and unknown 'N' bases were deleted from the beginning and end of each sequence. The unknown bases in the middle of sequences were clarified by more closely examining the peaks in the chromatogram file with Chromas Lite 2.0 (Technelysium Ltd. Tewantin, Queensland, Australia), or retained 29 as 'N' when they could not be corrected. For PCR products which were sequenced with both forward and reverse primers, a consensus sequence was generated with DNA Baser (Heracle BioSoft, Romania) by comparing the DNA sequencing and chromatograms with forward and reverse-complement sequences. Sequencing results were compared against the GenBank NR database with BLASTN. The match with the highest score (e values below 10"150) and with annotated genus and species were selected as potential matches for each sequence. To confirm the ITS sequence results of V. buxi (Isolate 08126), two other isolates presumed to be V. buxi were also subjected to ITS sequencing. The three isolates were 08126 from Georgetown, Ontario, 09012 from St. Catherines, Ontario and 10113 from Fraser Valley, B.C. DNA of isolates 08126 and 09012 were sequenced with both forward and reverse primers ITS1 and ITS4 to obtain consensus sequences. Isolate 10113 was only sequenced with primer ITS 1. To analyze the status of Volutella species in GenBank, 'Volutella' and 'Pseudonectria' were searched on the website of National Center for Biotechnology Information (NCBI; http://www.ncbi.nlm.nih.gov/). These published sequencing results of Volutella species were compared with closely related fungal DNA sequences generally in the same order Hypocreales. Multiple sequences were aligned with MUSCLE (Version 3.6; Edgar 2004). This alignment was then used in CLUSTAL X 1.83 (Thompson et al. 2007) to generate a Neighbor-Joining bootstrap tree with 1000 bootstrap replications which was visualized with Tree View 1.6.1 (Page 1996). 2.2.10 Koch's postulates 30 To test the pathogenicity of putative causal agents of the boxwood disease, fungal isolates were transferred onto fresh PDA plates and grown for 7 d to produce inoculum. Apparently healthy field-grown boxwood leaves were collected from plants in front of the University Center at the University of Guelph and washed with deionized water. PDA plates were lined with 9-cm-diameter filter paper (Qualitative P5, Fisher Scientific, Pittsburgh, USA). Aliquots of 2 mL of autoclaved deionized water were added to filter paper to maintain high humidity for infection. Washed leaf tissues were placed onto the Petri plates, abaxial or adaxial side up. For inoculation, either spore suspensions or mycelial plugs were used. The following concentrations: 104, 105 and 106 spores/mL, were first tested for their ability to induce disease, and a concentration of 106 spores/mL was selected. An aliquot of 0.14 mL was applied onto each leaf surface with a small finger pump sprayer. If a fungus did not sporulate, then a 5-mm-diameter mycelial PDA plug from a 7-d-old culture was placed on the top of boxwood leaf. The symptoms or signs were observed daily. After 5 to 7 d, if the symptoms or signs of the boxwood disease were observed on the inoculated leaves, attempts were made to reisolate the fungus and compare it to the original isolate. 2.3 Results 2.3.1 Disease samples Diseased tissues of boxwood from nurseries ranged in symptoms from yellow leaves on green stems to entirely dead shoots (Figure 2.2). Some leaves and branches were dry and dead, but usually the plants were still alive. On diseased plants, 90% of leaves and stems had pink fruiting bodies, and approximately 20% of the stems had epidermal black 31 streaks on the petioles or the stems attached to the petioles. Pink fruiting bodies were sometimes found on the surface of black streaks. Approximately 10% of diseased plants had both pink fruiting bodies and black streaks. Pink fruiting bodies were always found on the abaxial surface of leaves rather than the adaxial surface. 2.3.2 Morphological characteristics of fungal isolates A total of 312 fungal isolates were isolated from approximately 80 symptomatic boxwood samples which were collected from Southern Ontario nurseries by July 2009, and these were classified into eight morphotypes. Their cultural features on PDA at 25 °C were as follows: red; black with black dots; pure white; red-grey; white-yellow; light purple; yellow-orange or pink-orange (Figure 2.4). Some common ubiquitous fungi and contaminants were not considered as boxwood-associated fungi, including species of Penicillium, Aspergillus and Cladosporium. Among the fungal morphotypes of the 312 isolates, the single largest group was 46% for a pink-orange fungus. The culture of this fungus was pure white for the first 2 to 3 d on PDA at 25 °C. After 3 d, it started to produce a pink-orange colour in the middle and the first sporodochia were observed. After 5 to 7 d, the outer edge had whitish hyphae and the pink fruiting bodies were distributed uniformly in the centre parts of each mycelium. By 7 d, mycelia covered 75% to the full 9-cm-diameter of a Petri plate (Figure 2.5). Light yellow to pink pigment could be seen on the underside of cultures beneath sporodochia with greater intensity under older hyphae. Representative isolates from the eight morphotypes of fungi were observed with microscopy. The pink-orange fungus had a verticillate structure of hyphae and elliptical 32 spores, 6 - 9 x 2 - 3.5 um. The red fungus had hyphal colour ranging from rose to red to magenta, thick-walled chlamydospore-like hyphae but no conidia in culture. The black fungus with black dots on PDA had oval-shaped conidia, 2.5 - 3.75 x 5 um. The pure white fungus had yeast-like, smooth shiny colonies, with oblong conidia, 3 x 1 um. The red-grey fungus had grayish to rose colonies with oblong conidia, 12x4 um. The white-yellow fungus was white at the beginning for first 2 to 3 d and yellow in the middle 3 to 4 d later, and had a verticillate structure with elliptical conidia, 5x2.5 um. The light-purple fungus had chlamydospores, and resembled a Fusarium spp. Conidia of the yellow-orange fungus were brown and divided into many cells, 15-25 um diameter. 2.3.3 Molecular identification of morphotypes The eight morphotypes of fungi were subjected to DNA sequencing of the ITS regions to confirm identity (Table 2.1). Based on sequencing results isolate 08126, representing the pink-orange morphotype, had a 98% top match with Volutella ciliata (AJ301967). The red fungus had a 98% top match with Fusarium tricinctum Nees (EF611095). The black fungus with black dots had a 99% top match with Phoma herbarum Westend (AB456575). The pure white fungus had a 98% top match with Acremonium spp. (GU226831). The red-grey fungus had a 97% top match with Colletotrichum gloeosporioides (Penz.) Penz. & Sacc. (FJ478081). The white-yellow fungus had a 100% match with Bionectria ochroleuca (Schwein.) Schroers & Samuels (GU256754). The light purple fungus had a 98% top match with Fusarium oxysporum E.F. Sm. & Swingle (GU445374). The yellow-orange fungus had a 100% top match with Epicoccum nigrum Link (GU065617). Sequencing results are presented in Appendix 2.1. 33 Although the BLAST results of the pink-orange fungus showed the top matching species was V. ciliata (AJ301967), it had a 96% second match with V. buxi (FJ555527). By searching 'Volutella' on the NCBI database, ITS sequences of other V. ciliata and other Volutella species were found. However, besides AJ301967 and FJ555527, no sequence of other Volutella species was on the top BLAST results (up to e-value le-170) for the pink-orange fungus. 2.3.4 Volutella species comparison against the database on GenBank The three ITS sequences of the pink-orange fungus produced in this work (referred to as "in-house") were identical at 100% in their overlapping range (463 bp). The DNA fragment lengths of isolates 08126, 09012 and 10113 were 498 bp, 463 bp and 524 bp, respectively (Appendix 2.2). The DNA sequencing results were compared against the GenBank databases. All three fungal isolates had a 98% top match with V. ciliata (AJ301967) and a 96%) second match with Volutella buxi (FJ555527) (Appendix 2.3). After searching for 'Volutella' on the NCBI database, 41 fungal ITS sequences were downloaded and aligned with the three in-house ITS sequences of V buxi (Isolates 08126, 09012 and 10113) using MUSCLE (Table 2.2). The multiple sequence alignment was used to generate a dendrogram with CLUSTAL X. The Neighbor-Joining dendrogram with Leptodiscella africana (FR751089) as the outgroup showed the relationships of Volutella species and other fungal species based on ITS regions (Figure 2.6). Aside from the outgroup, the 43 sequences were found in two major clades. In the first clade with 100% bootstrap support, an isolate of Volutella colletotrichoides (AJ301962) was found with 12 isolates of Gibellulopsis nigrescens. In the second major clade which had a 96% bootstrap 34 support, there were a dozen Volutella species, but these were scattered among a variety of subclusters with other genera such as Mariannaea, Nectria, Cosmospora, Stibella, Geosmithia, Lanatonectria and Fusarium. To confirm the identification results of the pink-orange fungus, primers were designed to amplify a part of the beta-tubulin gene: btub_F750: 5'-AACAACTGGGCCAAGGGTC andbtub_R1400: 5'-GAAGAGTTCTTGTTCTGGA. The alignment file for primer design is presented in Appendix 2.4. DNA from isolate 10113 of V. buxi was amplified with the designed primers to give a fragment length of 706 bp. The sequence results were compared against the GenBank NR database using BLAST, and the top match was 97% (578/596 bp) with P. rousseliana (DQ522522) which is the teleomorph of V. buxi. The BLAST results are presented in Appendix 2.5. 2.3.5 Testing Koch's postulates Boxwood detached leaves were inoculated with representative of the eight morphotypes of fungi which were identified as: Volutella buxi, Fusarium lateritium, Phoma herbarum, Acremonium spp., Colletotrichum gloeosporioides, Bionectria ochroleuca, Fusarium oxysporum and Epicoccum nigrum. Boxwood leaves inoculated with V. buxi had pink fruiting bodies on the leaf surfaces 3 d after inoculation. None of other seven fungi were found to cause disease symptoms on boxwood leaves at up to 12 d after inoculation. Volutella buxi was re-isolated from inoculated leaves. After 3 d, aerial hyphae in the middle of colonies turned pink or orange which had the same appearance as the pink-orange fungal morphotype isolated from the diseased boxwood symptoms. Therefore, according the results of the Koch's postulates test, the causal agent of the 35 boxwood disease was confirmed as V. buxi. On the inoculated wounded leaves, pink sporodochia of V. buxi were observed 3 d later. Sporodochia first appeared on the petioles and then spread toward the distal part of the leaves. By 7 d, the abaxial surfaces of wounded leaves were fully covered with sporodochia. The inoculated leaves did not dry or turn yellow by 7 d (end of observation), probably because of the high relative humidity conditions in Petri plate, unlike leaves from the nurseries which were usually brown and dried where pink sporodochia were visible. 2.4 Discussion In 2008, an outbreak of boxwood bight was reported by Southern Ontario nurseries. Diseased tissues ranged in symptoms from yellow leaves on green stems to entirely dead shoots. Pink fruiting bodies were found on abaxial surfaces of leaves and stems. Some leaves and branches which were infected with the disease were dry and dead, but usually the upper parts of plants were still alive. These observations are in agreement with previous descriptions (White 1931, Rossman 1993; Batdorf 2003 and Hartman 2001). From the diseased samples collected from Ontario nurseries, approximately 20% of the stems had black streaks, which is not mentioned in journal publications nor in extension publications as a symptom of Volutella blight, except for OMAFRA publication 383 (OMAFRA 2009). In this "Nursery and Landscape Plant Production and IPM" guide, a picture of black streaks is shown as a major symptom of Volutella blight (OMAFRA 2009), but as mentioned above, not all infected plants show these black streaks. The major indication of Volutella blight of boxwood is pink sporodochia on leaves and stems. Another complication with black streaks, is that in the U.K., a boxwood disease caused 36 by Cylindrocladium buxicola was found with black streaks on the stems from the bottom to the top of plants (Henricot et al. 2008), as well as black spots on leaves. However, in this study, black streaks only were found on part of stems and petioles near infected leaves, and no black spots were found on leaves. No C. buxicola was isolated from boxwood samples collected from Ontario or B.C. Therefore, the black streak symptoms in Canada were not associated with Cylindrocladium blight, but with Volutella blight. Isolations from black streaks nearly always yielded V. buxi, even when there were no sporodochia associated with the diseased plant, which occurred about half of the time black streaks were present. Eight general morphotypes of fungi were observed from approximately 80 samples of diseased boxwood tissues collected from Southern Ontario nurseries (Georgetown and St. Catherines) by July 2009. Out of 312 isolates, 144 (46%) were the pink-orange fungal morphotype which was the most frequently isolated. The pink-orange fungus was isolated from yellow leaves associated with pink fruiting bodies and black streaks. The other seven morphotypes of fungi had a much lower frequency of isolation ranging from 3% to 11%, but none of these proved to be pathogenic. The morphology of the pink-orange fungus was similar to previous descriptions of the pathogen V. buxi causing Volutella blight (Jacobi et al. 2003; Dodge 1944c). Formation of verticillate structures of the pink-orange fungus was observed in agreement with the studies by Dodge (1944c). Therefore, the pink-orange fungus was suspected as the causal agent of the boxwood disease because the high isolation frequency and pink fruiting bodies on the diseased boxwood samples from Ontario nurseries. To identify the eight morphotypes, morphological and molecular biological techniques were used in this study. Comparison of morphological features with fungal keys can often 37 only provide an initial identification of fungi to a taxonomic level higher than species. For example, the verticillate structure of the pink-orange fungus is the feature of many fungi, such as Fusarium and Verticillium. Because DNA sequencing of ITS regions and beta-tubulin are commonly found in fungal species identification studies, they were used in this study. Aside from the pink-orange fungus, ITS sequencing results of seven morphotypes of fungal species as follows: Fusarium tricinctum, Phoma herbarum, Acremonium spp, Colletotrichum gloeosporioides, Bionectria ochroleuca, Fusarium oxysporum and Epicoccum nigrum. ITS sequencing results of the pink-orange fungus (Isolate 08126) showed a top match with two Volutella species with 98% (490/498 bp) and 96% (474/490 bp) on GenBank, V. ciliata (AJ301967) and V. buxi (FJ555527), respectively. The results showed the pink-orange fungus was a species of Volutella. According to previous publications, fungus V. buxi can cause Volutella blight on boxwood. Volutella buxi isolates 09012 and 10113 collected from different locations were used to confirm the ITS sequencing results. Both of them were identical with isolate 08126. To further confirm the identification of V. buxi, partial beta-tubulin gene of isolate 10113 was sequenced and showed a 97% top match with Pseudonectria rousseliana (DQ522522)(teleomorph of V buxi). These results showed that the pink-orange fungus is Volutella buxi. However, ITS sequencing of the pink-orange fungus had a higher match with V. ciliata (AJ301967) than V. buxi (FJ555527) based on the comparison of GenBank database. By analyzing the ITS sequencing of Volutella species and other closely related fungal species, some published Volutella spp. and three in-house V. buxi were separated into different clusters. This result may indicate that some of sequences of Volutella species from 38 GenBank are incorrectly labeled. On the inoculated detached leaves, pink sporodochia of V. buxi were observed 3 d later. Sporodochia first appeared on the petioles and then spread toward the distal part of the leaves. By 7 d, the abaxial surface of wounded leaves was fully covered with sporodochia. The inoculated leaves did not dry or turn yellow for by the end of the observation period (7 d), probably because of the high relative humidity conditions in Petri plate. However, in the field, pink sporodochia are most often associated with dry yellowed leaves of this boxwood disease. Among the eight fungal morphotypes recovered from 312 isolates associated with diseased boxwood, only V. buxi was satisfied Koch's postulates which confirmed that it is the causal agent of the boxwood disease, now identified as Volutella leaf and stem blight. 39 Table 2.1 Number and frequency of morphotypes recorded based on 312 fungal isolates associated with Volutella leaf and stem blight of boxwood. Species from the eight major morphotypes were identified with morphological and molecular biological techniques. Fungal species Morphology Frequency of isolation Number Percentage Volutella buxi Pink-orange 144 46% Fusarium lateritium Red 22 7% Acremonium spp. Pure white 34 11% Bionectria ochroleuca White-yellow 22 7% Phoma herbarum Black with black dots 9 3% Colletotrichum gloeosporioides Red-grey 25 8% Fusarium oxysporum Light purple 31 10% Epicoccum nigrum Yellow-orange 25 8% Total 312 100% 40 Table 2.2 A list of 41 accession numbers and species names of ITS sequences collected from GenBank by searching for 'Volutella', and then used to in phylogenetic analysis. Accession number Species AB099509 Nectria mariannaeae AB111493 Mariannaea elegans var. punicea AB112029 Mariannaea camptospora AB237663 Nectria cinnabarina AB551198 Gibellulopsis nigrescens AB551200 Gibellulopsis nigrescens AB551216 Gibellulopsis nigrescens AJ292440 Verticillium nigrescens AJ301962 Volutella collletotrichoides AJ301966 Volutella ciliata AJ301967 Volutella ciliata AM922222 Verticillium nigrescens AY138847 Nectria mauritiicola DQ914740 Volutella ciliata EF029211 Volutella sp. EF121860 Lanatonectria flavolanata EF121861 Cosmospora consors EF121863 Cosmospora gigas EF121864 Cosmospora cupularis EF543844 Cephalosporium serrae EF543845 Cephalosporium serrae EF543851 Verticillium nigrescens EU436549 Volutella sp. EU860058 Fusarium merismoides EU860059 Fusarium merismoides EU860060 Fusarium merismoides EU860077 Fusarium ciliatum FJ197965 Volutella sp. FJ474072 Cosmospora coccinea FJ474073 Cosmospora episphaeria FJ555527 Volutella buxi FM986798 Geosmithia microcorthyli FN598959 Cosmospora consors FR751089 Leptodiscella africana GU327447 Volutella sp. GU726751 Cosmospora vilior GU726755 Cosmospora villior HM054159 Cosmospora meliopsicola HM061314 Cosmospora vilior HM216212 Stilbella aciculosa HQ115693 Gibellulopsis nigrescens 41 ITS5 HTSI ITS3 j-tK ITS2 ITS4 Figure 2.1 Eukaryotic ribosomal DNA (rDNA) gene showing primer locations in the ribosomal cassette consisting of the small subunit (SSU), large subunit (LSU), and internal transcribed spacers (ITS). Gray boxes represent highly conserved regions. Primers are positioned above (forward primers) or below (reverse primers) their sequence positions (White ef al. 1991). 42 "T. •j" V 7* •*! .* F .y ,*. ,• -*^i * •-•• A . I *> . ' i -. • 'r • :^i 'i v» -.«- Ii - •• Figure 2.2 Boxwood plants infected with boxwood blight. 43 Vi"'-- v .-•"i,.,"> -'.,r . ..--j-V,.,'," 5, ,| , ; ~ . --,•*-*^-i-^"*'V"(',r w .,;..., . \fe--i-i.-. . >'.'...'-jit .r..-j?.»i« .« ' -r"-i.-i :"••'' .j *'*"£ 'w^-eS" . ""'..'-'-"';" '!; ',?' •"-""'. ':•'. * '^-c--- ""^jf; •"• -- '•"••">-' V Vi;,-•:*••'• -.-.**• — .. •••• * v«. X1"«tji^,J|•':. -•?£ * '„* «'r'. ' . '• ..•fV-fc^jrv^.-^-.-- -.• •••'. -; . It** _ r.-I-™-:-*" '.V •*#*"• i.-1' i'v«i*?Siit-^-i • '•••-"I-"1'' - ^,r— *V ••:'' . j*~ «„ ' ,iE. ' %4- ';i .•'••• " • ; • Figure 2.3 Black streaking was observed on some boxwood stems. 44 J .. i /,.. wtiiiM Figure 2.4 Eight morphotypes of fungi associated boxwood blight grown on PDA plates at 25 °C for 7 d: (a) Pink-orange; (b) Red; (c) Pure white; (d) White-yellow; (e) Black with black dots; (f) Red-grey; (g) Light purple; (h) Yellow-orange. 45 Figure 2.5 Volutella buxi grown on PDA plates at 25 °C for 7 d. 46 FR751089 Leptodiscella africana AJ301962 Volutella colletotrichoid.es iqo_EF543844 Cephalosporium serrae 1000 ' EF543845 Cephalosporium serrae JQQQHQI 15693 Gibellulopsis nigrescens 980 AM922222 Gibellulopsis nigrescens 980 AJ292440 Gibellulopsis nigrescens 7*4 EF543851 Gibellulopsis nigrescens —I 995 AB551216 Gibellulopsis nigrescens 1.538 AB551198 Gibellulopsis nigrescens " 814 AB551200 Gibellulopsis nigrescens • AB111493 Mariannaea elegans var. punicea —[100P- AB099509 Nectria mariannaeae L2?° AB112029 Mariannaea camptospora EU436549 Volutella sp. 9901957 HM216212 Stilbella aciculosa •— EF121861 Cosmospora consors 959 465__rrnnftEF029211 Volutella sp. l±y FN598959 Cosmospora consors ~ 415r DQ914740 Volutella ciliata flOOO FJ197965 uncultured Volutella 241 1.877 AJ301966 Volutella ciliata 1770 GU327447 uncultured Volutella FM986798 Geosmithia microcorthyli EF121860 Lanatonectriaflavola — AJ301967 Volutella ciliata 922— FJ555527 Volutella buxi 979 09012 Volutella buxi 948 10113 Volutella buxi 947 08126 Volutella buxi AY138847 Nectria mauritiicola AB237663 Nectria cinnabarina EU860058 Fusarium merismoides EU860059 Fusarium merismoides 1°00EU860060 Fusarium merismoides EF121863 Cosmospora gigas F121864 Cosmospora cupularis EU860077 Fusarium ciliatum B,S_FJ474073 Cosmospora episphaeria I- uivins/fiso /"„. ...™„„..,. . „/;„„..,v.„ HM054159 Cosmospora meliopsicolaM 487 FJ474072 Cosmospora coccinea J5656:3 HM061314 Cosmospora vilior Us53: 6 _|qq1GU726751 Cosmospora vilior GU726755 Cosmospora vilior 0.1 Figure 2.6 Genetic distance dendrogram of ITS sequences of Volutella buxi (Isolates 08126, 09012 and 10113), other Volutella spp. and other fungal species in the GenBank database, rooted with Leptodiscella africana. This tree was constructed using the Neighbor-Joining method with CLUSTAL X. Numbers at internal branch points represent bootstrap support expressed as a percent of 1000 replicates. GenBank accession numbers were shown before the species names, except for those which were sequenced in this study (Isolates 08126, 09012 and 10113). 47 CHAPTER THREE BIOLOGICAL CHARACTERISTICS, PATHOGENICITY AND GENETIC VARIATION IN VOLUTELLA BUXI 3.1 Introduction The fungus Volutella buxi, anamorph of Pseudonectria rousseliana, is the causal agent of Volutella leaf and stem blight on boxwood, hereon referred to as Volutella blight. It is one of the most important fungal pathogens of boxwood, and can cause severe losses and affect the appearance of boxwood. Diseased leaves and stems turn yellow and die back. Pink sporodochia of V. buxi have been observed on diseased leaves and stems. Volutella blight has been reported in many countries, such as the USA (1931), the U.K. (1850 and 1919), Canada (2006 and 2010), Italy, Spain, Germany, England (1883) and Switzerland (1963). However, many characteristics of V. buxi have not been well studied, such as the optimal growth conditions, the infection process, pathogenicity and population structure. Furthermore, the variation in susceptibility or resistance among boxwood cultivars has not been well investigated. 3.1.1 Biological characteristics and disease development of Volutella spp. After winter, the first noticeable indication of Volutella blight of boxwood is that the branches do not start to grow in spring (White 1931 and Hartman 2001). After that, younger foliage turns gray-green to straw colour. In later spring, infected branches may die back (White 1931 and Hartman 2001). Pink sporodochia can be found on undersurface (abaxial) of dry boxwood leaves (Griffith and Henfrey 1883; Rossman 1993 and Batdorf 2003). In southern Ontario nurseries, pink sporodochia of V. buxi can be observed after two months propagation in controlled environments at 25 °C. The disease has also been 48 observed on mature plants in field plantings. In 2009, some nurseries reported losses of rooted cuttings of different boxwood cultivars at 10% for 'Green Mountain', 58% for 'Green Gem', 40% for 'Green Velvet' and 30% for 'Green Mound'. Although the biological characteristics and disease development of Volutella buxi have not been well studied, colony appearance of V. buxi and some features of other Volutella species have been described. On potato dextrose agar (PDA), the mycelium of V. buxi is whitish at the beginning and becomes light pink or peach in the middle of colonies (Dodge 1944c). Mycelia of V. pachysandrae are orange or salmon and slimy when grown at 24 °C on PDA (Safrankova 2005). Older and damaged parts of plants were found to be most susceptible to infection by V. pachysandrae (Safrankova 2005). Brown spots can be seen after 5 to 9 d infection for V. pachysandrae (Safrankova 2005). Perithecia and their ascospores can be produced within older sporodochia of V. pachysandrae (Safrankova 2005). The spores of V. pachysandrae can be spread by air and splashing water (Safrankova 2005). High humidity helps the development of the fungus, such as dense plantings, frequent precipitation and irrigation (Safrankova 2005). Presumably, these morphological and etiological characteristics are also shared by V. buxi, but that remains to be investigated. 3.1.2 Boxwood cultivars Four cultivars of boxwood hybrids are commonly used in Ontario nurseries: 'Green Gem', 'Green Velvet', 'Green Mountain' and 'Green Mound' (Jennifer Llewellyn personal communication). They were originally selected by Sheridan Nurseries in Oakville, Ontario, Canada in 1966 (Batdorf 2004). All four cultivars originated from open-pollinated 49 seedlings with the female parent Buxus sempervirens 'Suffruticosa' and the male parent B. sinica var. insularis (Batdorf 2004). The cultivar 'Pincushion' (B. sinica var. insularis) has also been used commonly in Ontario nurseries but is not as common as the other four (Batdorf 2004). Cultivars 'Chicagoland green', 'Green Beauty' and 'Green Velvet' are commonly used in nurseries in B.C. (Dr. J. Elmhirst, personal communication). The four cultivars in the 'Green' series, 'Green Gem', 'Green Velvet', 'Green Mountain' and 'Green Mound', can be grown in USDA Plant Hardiness zones 5b to 9, but they are all very susceptible to boxwood leaf miners and psyllids (Batdorf 2004). In nursery catalogs, cultivar 'Green Gem' is called B. microphylla 'Green Gem'. Although 'Green Gem' can survive at -29 °C in winter, it is very sensitive to environmental conditions. The leaves of 'Green Gem' may turn red or discolor if grown in poor soil or exposed to sun and wind in winter. 'Green Velvet' is one of the top three best selling ornamental plants in Canada (Batdorf 2004). The male parent of the 'Green' series, B. sinica var. insularis, also called Korean boxwood or Korean littleleaf boxwood, is one of the fastest growing Buxus species in nurseries, and well known for its cold hardiness (Batdorf 2004, p232). Cultivar 'Pincushion' of B. sinica var. insularis is considered resistant to insects. The female parent of the 'Green' series, B. sempervirens 'Suffruticosa', grows slowly, and in comparison to B. sinica var. insularis, it has a larger size and more leaves. The leaf shape of B. sinica var. insularis is elliptical to obovate; in comparison, B. sempervirens leaves are ovate (Batdorf 2004, p241). Buxus microphylla var. japonica was first described as Japanese boxwood in 1890 (Batdorf 2004, p62). A cultivar of this species, 'Green Beauty', was originally selected by 50 Sheridan Nurseries, Toronto, Canada in 1957. It has been used as a substitute for 'Suffruticosa' because of the dark green foliage and more than twice the growth rate of 'Suffruticosa' (Batdorf 2004, p67). Buxus microphylla var. koreana 'Glencoe', also called 'Chicagoland Green' for commercial purposes, was introduced by Chicagoland Grows Inc. in 1994. It is extremely tolerant to cold winters, and was found without winter injury even at -33 °C (Batdorf 2004, p255). Because the 'Green' series are open-pollinated seedlings with similar parental lineages, they may have similar susceptibility to infection by V. buxi, but this needs testing. 3.1.3 Genetic diversity of Volutella buxi An evaluation of genetic diversity in a fungal population can be used to better understand the ability of the species to adapt and survive (Mahoney and Springer 2009). A high level of genetic variation within a species is reflective of better adaptability, and vice versa (Mahoney and Springer 2009). The disease caused by V. buxi has been observed in Southern Ontario for over 10 years and has also been reported in other countries in North America and Europe (White 1931; Berkeley and Broome 1850; Moreau 1919); Saccordo 1883; Bezerra 1963; Joshi and Jeffries 2006 and 2010). However, it is not known whether the fungus is native to Canada, has been in Canada a long time, or whether it was recently introduced. By examining the genetic diversity and differences between isolates of V. buxi from different nurseries, different geographical regions, and from different cultivars of boxwood, the population structure and possibly, the origin of V. buxi in Canada can be better understood. Several methods can be used to assess the genetic diversity of fungal communities, 51 such as RAPDs (Random Amplification of Polymorphic DNA), microsatellite markers (Refoufi 2008), AFLPs (Amplified Fragment Length Polymorphism) and ISSR (Inter Simple Sequence Repeats) (Bornet and Branchard 2001). RAPD primers usually contain 8 to 10 oligonucleotides, and this technique is faster and cheaper than the other three methods mentioned because it does not need previous DNA sequence information, but the results using the RAPD technique may lack consistency and stability (Refoufi 2008). The AFLP method is highly sensitive, but it requires prior DNA sequence information and is more expensive and technically challenging to perform. The technique involving microsatellite markers is less expensive than AFLP, but it also needs prior DNA sequence information (Refoufi 2008). The ISSR technique was developed in 1994, and it involves molecular markers with two, three or four nucleotides in multiple tandem repeats. ISSR can provide highly polymorphic patterns without requiring the information on genomic sequences, and it is economical and easy to employ (Bornet and Branchard 2001). 3.1.4 Objectives The purpose of this research was to better characterize the pathogen V. buxi which causes Volutella blight on boxwood. Optimal growth temperatures of V. buxi were assessed. Growth rates of V. buxi isolates collected from different nurseries were compared at the optimal growth temperature. Spore germination of V. buxi was evaluated on both artificial media and boxwood tissues. Volutella blight resistance was assessed on different ages of detached leaves, on different boxwood cultivars and on wounded or non-wounded leaves. Furthermore, genetic variation among V. buxi isolates was tested by ISSR to investigate the population structure of V. buxi and infer its time of origin into Canada and 52 give insights into the reproductive and dispersal patterns of the fungus. 3.2 Materials and Methods 3.2.1 Boxwood plants and fungal isolates To evaluate Volutella blight resistance in boxwood, detached leaves of the boxwood cultivar 'Green Gem' were collected from the garden in front of the University Center of the University of Guelph on the same day as start of the experiment. Healthy potted plants up to 30-cm-tall were obtained from Ontario nurseries. Cuttings of 'Green Mountain' collected from nurseries in Georgetown in July 2009, were replanted in 3-inch pots with Sunshine mix #1 (SunGro Horticulture Canada Ltd., Seba Beach, Alberta). All healthy plants were placed in a 25 °C room under 24 h light (50 umol/m2/s) and watered once a week with fertilizer solution, which was prepared by adding fertilizer 20-8-20 at 1.25 g/L water, and adjusting to pH 6.0. Boxwood plants with obvious symptoms of Volutella blight were collected from different nurseries in Southern Ontario and B.C., and isolates were obtained from these plant samples, following isolation procedures stated in Chapter 2, Section 2.2.3. 3.2.2 Growth rates of Volutella buxi isolates Mycelial growth of V. buxi was evaluated with nine isolates at six temperatures. Agar plugs, 5 mm in diameter, were taken from actively growing colonies on PDA and transferred into screw-cap test tubes (21 x 150 mm) containing 6 mL of PDA. All tubes had been autoclaved and set at a small angle to ensure that make PDA filled the entire side of a tube but without protruding from the opening which would have enhanced contamination 53 (Figure 3.1; Hsiang and Wu 1999). Inoculated tubes were placed in incubators at 10,15,20, 25, 30 and 35 °C. Four replicate tubes were used for each isolate. The extent of growth was measured every 2 d for up to 24 d. Mycelial growth of 32 Ontario isolates of V. buxi was also assessed at 25 °C with the same method. Five replicate tubes were used for each isolate. The extent of growth was measured every 2 d for 16 d. Survival of V. buxi in dead plant tissues was also assessed. Autoclaved sand was placed to a depth of 5 mm in 9-cm-diameter Petri plates. Six dried infected leaves with visible pink sporodochia were collected from diseased boxwood plants, dried and placed in each Petri plate. Three replicate plates were used in this test. All plates were sealed with Parafilm and placed at 25 °C. A single leaf was removed from each plate every month, and isolations were made following isolation procedures stated in Chapter 2, Section 2.2.3. 3.2.3 Pathogenicity and resistance 3.2.3.1 The infection process To assess spore germination rate of V. buxi, 7-d-old cultures which produced obvious sporulating structures were used to prepare spore suspensions. An aliquot of 100 uL of 103 spores/mL spore suspension was evenly spread out on water agar. To obtain a thin and translucent media for observing spore germination, 10 mL of autoclaved 1% water agar was used per 9-cm-diameter Petri plate, to form a layer less then 2 mm deep. Three isolates of V. buxi were used in spore germination tests, and this was repeated three times. The plate was checked by microscopy every 2 h to observe spore germination up to 3 d, with starting times staggered by 12 h so that off hours for the first set could be measured for the second 54 set. To assess the infection process of V. buxi on plant tissues, detached leaves of boxwood cultivar 'Green Velvet' which had no visible signs or symptoms of Volutella blight were used in this test. Petri plates were lined with a piece of 9-cm-diameter filter paper (Qualitative P5, Fisher Scientific, Pittsburgh, USA). An aliquot of 2 mL of autoclaved deionized water was added to filter paper to maintain high humidity needed for infection. Washed leaf tissues were placed onto the Petri plates, abaxial or adaxial side up. The epidermis of the leaves was slightly scratched with a sterilized needle to make wounds, with single scratches in a 0.5 cm2 area. And then each leaf was sprayed with 0.14 mL of a 106 spores/mL spore suspension of V. buxi. After inoculation, spore germination rate was checked every 24 h, and details of the germination and infection process were recorded up to 5 d. Inoculated leaves were checked at 100x magnification until spore germination was seen up to 5 d after inoculation. The leaves were placed in acetic alcohol (25% glacial acetic acid, 75% alcohol) for 48 h to clear the chlorophyll (Busch and Walker 1958; Lubani and Linn 1962). The acetic alcohol was removed after 24 h and replaced with a fresh solution for another 24 h. The cleared leaves were removed and placed on a glass slide with the adaxial surface up in drops of 0.05% trypan blue (w/v) in lactophenol (20% phenol, 20% lactic acid, 40% glycerine and 20% water) for 24 - 48 h. After 48 h, leaves were placed in 1.5 mL of lactophenol for 12 - 24 h to remove excess stain, and mounted on glass slides in drops of lactophenol. To enhance staining, the glass slides were placed on a hot plate and heated for 15 - 45 min at 40 °C (Khan and Hsiang 2003). 55 3.2.3.2 Resistance Boxwood leaves were placed on a Petri plate which was lined with a piece of autoclaved 7-cm-diameter filter paper. The size of leaves ranged from 1 x 0.5 cm to 2.5 x 1.5 cm. Autoclaved deionized water (2 mL) was added to the filter paper to prevent drying. A spore suspension of V. buxi at a concentration of 106 spores/mL was sprayed on leaves at 0.14 ml per leaf. All plates were sealed with Parafilm and placed at 25 °C with 24 h light (50 umol/m /s). To measure the disease severity of infected leaves, the density of sporodochia was recorded from 0 (no sporodochia) to 9 (fully covered by sporodochia). The following cultivars were assessed for resistance: 'Green Velvet', 'Green Gem', 'Green Mountain', 'Green Mound' and 'Pincushion'. The detached leaves were placed abaxial side up or adaxial side up on plates and inoculated with the spore suspension, and this was repeated five times per cultivar. To test if differences in susceptibility by age of leaves, one-month-old and one-year-old of leaves were used in this experiment. One-year-old leaves were harvested from one-year-old boxwood plants. One-month-old leaves were harvested from new growth of one-year-old boxwood plants. Four leaves of each age were placed in one Petri plate. Eight detached leaves were placed per plate. Three plates were used for each test. Each detached leaf was inoculated by spraying 0.14 mL of a spore suspension (106 spores/mL). This experiment was repeated two times. Disease was also evaluated on wounded and non-wounded whole plants of 'Green Velvet' and one-month-old rooted cuttings. Wounding was done by cutting three leaves in half on each of the wound treatment plants. These three leaves were then inoculated by spraying with of a spore suspension (106 spores/mL) until runoff. For the non-wounded 56 treatments, leaves were not cut and three target leaves were sprayed similarly. All plants were covered with a plastic bag. This experiment was repeated three times. 3.2.4 Primer screening and PCR amplification for ISSR No previous research was found regarding genetic variation in V. buxi. RAPD and ISSR were assessed in this study. A preliminary test assessed 65 UBC RAPD primers with four isolates of V. buxi. RAPD reactions was done in a total volume of 12.5 uL containing 1 x PCR buffer (50 mm Tris-HCl, pH 8.5), 200 uM of each dNTP, 2.5 mM MgCl2, 0.4 uM of each primer, 0.6 U Tsg DNA polymerase, and 1-10 ng template DNA. DNA amplification was done in a MyCycler thermal cycler (No. 580BR 10624) (Biorad, USA), with an initial denaturation step of 94 °C for 1.5 min, followed by 35 cycles of 94 °C for 40 s, 37 °C for 45 s, 72 °C for 1.5 min; 94 °C for 45 s and a final extension at 72 °C for 5 min. To design ISSR primers, ones previously used to amplify Fusarium spp. were used since both Volutella and Fusarium belong to the family Nectriaceae. Four ISSR primers (AG)g, (CAC)5, CT(GA)8 and (CT)s-RG) previously used to assess Fusarium oxysporum and F. poae (Bayraktar et al. 2008 and Dinolfo et al. 2010) were chosen for primer screening of V. buxi. Three isolates of V. buxi collected from different nurseries and different boxwood cultivars were used to test the primers. These were isolates 09038 from Georgetown, 09012 from St Catherines and 10113 from B.C. The annealing temperatures of primers were tested with a gradient thermal cycler (MyCycler™ Thermal Cycler System #170-9703, Bio-Rad, USA), with a temperature range from 36 to 53 °C at eight intervals. Four DNA concentrations were tested as follows: crude extraction (approximately 60 ng/uL), 10 fold dilution, 100 fold dilution and 500 fold dilution. Different concentrations 57 of DNA were amplified with each primer with the MyCyler thermal cycler at appropriate annealing temperatures. ISSR reactions was done in a total volume of 25 uL containing 1 x PCR buffer (50 mm Tris-HCl, pH 8.5), 200 uM of each dNTP, 2.5 mM MgCl2, 0.4 uM of each primer, 0.6 U Tsg DNA polymerase, and 1-10 ng template DNA. DNA amplification was done in the My Cycler thermal cycler, with an initial denaturation step of 94 °C for 1.5 min, followed by 35 cycles of 94 °C for 40 s, annealing temperature for 45 s, 72 °C for 1.5 min, 94 °C for 45 s and a final extension at 72 °C for 5 min (Wolfe 2000). A 100 fold dilution of DNA extracted with the Edwards method (0.6 ng/mL) was used in the ISSR test. Primers (AG)g and (CAQ5 were chosen because polymorphic banding patterns were present with tested isolates. The annealing temperatures of the two primers were 48 and 53 °C, respectively. To assess the results of the ISSR test, DNA amplification products were separated in 1.5% agarose gels (UltraPure™, Invitrogen®, Carlsbad, USA). PCR products (5 uL) were mixed with 1 u.L of 6x loading dye (R0611, Fermentas, USA). An aliquot of 6 uL DNA marker (GeneRuler 1 kb DNA ladder, Fermentas, Canada) was used to measure band sizes. Electrophoresis was done at 50 or 100 V and at 0.8 A in a Mupid 21 electrophoretical chamber (Helixx Technologies, Toronto, Ontario, Canada). Gels were stained with an ethidium bromide (EtBr) solution at a concentration of 2 - 4 ug/mL for 5 min. An ultraviolet (UV) transilluminator from Syngene (Synoptics, Cambridge, Cambridgeshire, U.K.) was used for DNA band visualization. To examine the results, a GBC video camera CCTV (South Hackensack, New Jersey, USA) was used. If the gels were overexposed to EtBr, they were destained in tap water for 5 to 10 min. To record the results, an attached videocopy processor P67U (Mitsubishi Electric, Cypress, California, USA) was used to 58 print hard copy of images. To save an electronic version of images, a desktop computer with attached frame-grabber card (Integral Technologies, Indianapolis, IN) was used to retain black and white jpeg files (resolution 800 x 600). 3.2.5 DNA extraction and ISSR data analysis For DNA extraction, isolates were grown on PDA overlaid with autoclaved cellophane to allow easy harvesting of hyphae. DNA extraction followed Edwards et al. (1991) as discussed in Section 2.2.5. Mycelia of each isolate were placed in 1.5 mL tubes at -20 °C until used for DNA extraction. A total of 98 isolates of V. buxi was analyzed with the selected primers. After running out the amplified DNA on gels, the gel images were recorded and scored for the presence or absence of bands, with only the most intense bands scored under the assumption of positional homology. Only fragments that were reproducible in at least two replicate PCR reactions and reproducible using different DNA extractions from the same isolates were included for further analysis. Prior to further analysis, data of monomorphic bands were omitted. The computer program WinDist (Yap and Nelson 1996) was used to compute genetic distances, based on the Dice similarity coefficient, where distance=l-2nxy/(nx+ny). The Dice similarity coefficient (Nei and Li 1979) is commonly used to assess binary data (Fuentes et al. 1999). Another program, Phylip 3.5 (Felsenstein 1989), was used to generate a lower-triangular matrix and to construct a dendrogram with Unweighted Pair Group Method with Arithmetic Mean (UPGMA). To present the results, TreeView 1.6.6 (Page 1996) was used to visualize the UPGMA dendrogram. The alignment data were subjected to bootstrap analysis with 1000 replications using the program Winboot (Yap and Nelson 1996), and these bootstrap values 59 were manually drawn on the final dendrogram. The similarity scale bar was also drawn manually on the dendrogram. 3.2.6 Statistical analysis The mycelial growth and disease ratings of Volutella buxi were subjected to analysis of variance with SAS PROC GLM (SAS Institute, Cary, NC, USA). When significant treatment effects were found, means were separated by the test of least significant difference (LSD; p = 0.05). The CONTRAST statement was used to compare the means of mycelial growth of V. buxi between the isolates from nurseries at Georgetown and St. Catherines. An example of the SAS statements can be found in Appendix 3.1. 3.3 Results 3.3.1 Sample collection and fungal isolates Eight boxwood cultivars were collected from nurseries in Ontario and B.C, and are listed as follows: 'Green Velvet', 'Green Gem', 'Green Mountain', 'Green Mound', 'Pincushion', 'Chicagoland Green', 'Green Beauty' and an unknown cultivar (Table 3.1). In all inoculation experiments, only apparently healthy boxwood tissues were used. Boxwood samples infected with Volutella blight were collected from Ontario and B.C. Collection locations and dates are listed in Table 3.1. A description of disease samples is presented in Section 2.3.1. A total of 148 isolates of V. buxi were collected from 2008 to 2010 which are listed in Appendix 3.2. The isolation procedure is explained in Section 2.2.3. The single spore isolation method is detailed in Section 2.2.3. All isolates from diseased boxwood samples which were collected in different of seasons from 2008 to 2010 60 were capable of sporulating in culture. 3.3.2 Temperature effects on Volutella buxi Nine isolates of V. buxi (Ontario isolates 08128, 08129, 08130, 08131, 08132, 08133, 08134, 08136 and 08137) were grown at various temperatures (10, 15, 20, 25, 30 and 35 °C) to determine their growth temperature optima. The mycelial growth by day 16 was used to assess the optimal growth temperature of V. buxi. Mean growth rates of nine isolates at each temperature did not show significant differences (p=0.15); however, differences in mycelial growth rate were observed among various temperatures (p<0.0001, Table 3.3). At 10 °C or 35 °C, growth after 16 d was the lowest at 5.2 or 4 mm, respectively. At 15 and 30 °C, mycelial growth after 16 d was suboptimal at 24.7 and 27.7 mm, respectively. Isolates grew the fastest at 20 or 25 °C, with 67.4 and 78.1 mm after 16 d, respectively, which were not significantly different. Therefore, the optimal growth temperate of V. buxi was judged to be from 20 to 25 °C (Figure 3.2), and 25 °C was used for further testing of more isolates. To assess mycelial growth at 25 °C, 32 isolates were used, which was the total number available at the time of the experiment in August 2009. Out of the 32 isolates, 12 were collected from nurseries at St. Catherines, Ontario, and 20 were collected from nurseries close to Georgetown, Ontario (80 km apart). Among 32 isolates of V. buxi, mycelial growth were significantly different by 16 d at 25 °C (p<0.0001) between and within nurseries, ranging from 2.6 mm/day to 6.7 mm/day. The survival test with dead dried leaves placed on dry sand showed that the fungus could survive for the full six month duration of the test. Leaves sampled monthly yield V. buxi cultures. 61 3.3.3 Pathogenicity and resistance In order to assess spore germination rate of V. buxi, dilute spore suspensions (103 spores/mL) were placed on water agar and observed every 2 h. Approximately 40 to 50% of the spores started to germinate by 12 h (Figure 3.3). By 24 h, 80% of the spores germinated, and some germ tubes began to branch and form a verticillate structure (Figure 3.3). On detached leaves, germ tubes were seen after 18 h inoculation. After 3 d, verticillate structures were seen on detached leaves (Figure 3.4). Boxwood detached leaves were inoculated with a spore suspension of V. buxi (106 spores/ml) to assess the resistance to Volutella blight by different age tissues, on different boxwood cultivars and on wounded or non-wounded tissues. Age of boxwood tissue had a significant impact on susceptibility, where one-month-old boxwood leaves were more susceptible to infection than one-year-old leaves. The disease ratings of one-month-old and one-year-old leaves were 5.9 and 1.6, respectively (LSD=1.3). Different cultivars also had different susceptibility to infection. Among five boxwood cultivars ('Green Gem', 'Green Velvet', 'Green Mound', 'Green Mountain' and 'Pincushion'), 'Green Gem' was observed as the most susceptible cultivar to be infection with Volutella blight, where 'Pincushion' was the least (Table 3.5). Wounded leaves were more susceptible than non-wounded leaves. All three wounded leaves on three plants were infected by V. buxi which had pink sporodochia on the abaxial surface of leaves (Figure 3.5). Three non-wounded leaves were not observed pink sporodochia. 62 3.3.4 Disease development during inoculation progress On the inoculated wounded leaves, sporodochia would begin to appear after 2 to 3 d near the wound site or the petiole. Sporodochia first appeared on the petioles or the wound site, and then spread toward the distal part of the leaves. By 7 d, the abaxial surface of wounded leaves was fully covered with sporodochia. The inoculated leaves did not dry or turn yellow for several weeks, probably because of the high relative humidity conditions in the growth room, and nor were dry dead branches observed during this time. 3.3.5 Genetic variation in Volutella buxi To assess the genetic diversity in V. buxi, 65 UBC RAPD primers and four ISSR primers were screened with three or four isolates. None of the RAPD primers provided consistent polymorphic markers. Two ISSR primers (AG)g and (CAC)s were used in this study. From 98 isolates of V. buxi, a total of 778 fragments were amplified with primers (AG)gand (CAC)s. Out of 98 isolates (Table 3.2), 86 which showed polymorphic bands with primers (AG)s and (CAC)s were chosen to be analyzed. The remaining isolates which showed no bands were omitted. A total 423 fragments were generated with primer (AG)8 and 355 fragments with primer (CAC)5. The average numbers of bands were 4.8 and 4.1, found with primers (AG)g and (CAQ5, respectively. Most fragments produced with primer (AG)8 were in a size range from 400 to 2,000 bp. The highest number of fragments from a single primer (CAC)5 was five in a size range from 1,000 to 2,000 bp. The data were recorded as binary format and analyzed by Windist to produce a genetic distance matrix. This matrix was used in Phylip to produce an UPGMA dendrogram which was visualized using TreeView (Figure 3.6). The dendrogram showed 63 that most of isolates of V. buxi had low genetic variation with more than 90% genetic similarity. Because isolates of V. buxi collected from different cultivars and different locations did not segregate into different clusters, this implied that the isolates were not differentiated into separate groups on the basis of location or cultivar, hence showing no geographic specialization nor host specialization. 3.4 Discussion Although some colony characteristics of V. buxi were described in previous research, most biological characteristics and the disease development of Volutella buxi have not been well studied. Dodge (1944c) described the mycelium of V. buxi as whitish at the beginning becoming light pink or peach in the middle of colonies, which is the same as observations in this study. But colony colour is not sufficient for identification because the cultural appearance of V. buxi is similar to Colletotrichum gloeosporioides and C. musae (Photita et al. 2005). To better understand the growth conditions of V. buxi, mycelial growth at different temperatures were assessed. The optimal growth temperature of V. buxi was from 20 to 25 °C. Below 10 °C or above 35 °C, V. buxi grew significantly slower. This is the first report of the optimal growth temperature of V. buxi. Among 32 isolates, there were significant different in growth rate of V. buxi at 25 °C by 16 d between and within two different nurseries (Georgetown and St. Catherines). The magnitude of this difference in growth rate is surprising considering the low level of genetic variation detected by ISSR markers, and deserves further study. Spores of V. buxi started to germinate by 12 h on water agar and by 18 h on detached 64 leaves at 25 °C. Verticillate structures of V. buxi were observed by 24 h on water agar and by 3 d on detached leaves. When disease was first noticed on inoculated tissues, sporodochia of V. buxi were always found at wound sites, whether cut petioles of detached leaves or the cut edges on attached leaves. From there, they spread over the other parts of the leaves until the entire abaxial surfaces were fully covered with sporodochia. Furthermore, the common temperature in nursery propagation rooms is around 25 °C which is the same at the fungal optimal growth temperature. The moist soil and air conditions in propagation rooms are also favorable for fungal growth and spread. Under such conditions, Volutella blight can be observed within two months on rooted cuttings in propagation rooms. After inoculation, sporodochia were found on scratch wound sites of both adaxial and abaxial surfaces, and on cut surfaces, whether leaves or petioles. However, non-wounded intact tissues were never seen to form sporodochia after inoculation, Therefore, wounds may be the major penetration points for V. buxi, since even with natural openings such as stomates on the abaxial surfaces, non-wounded leaves did not become infected after inoculation. Furthermore sporodochia on adaxial surfaces were confined to the wound region, and did not spread over adaxial surfaces from the wound sites, but led to the production of sporodochia on the abaxial surfaces. Wound sites on abaxial surfaces lead to the production of sporodochia at the wound sites, and more sporodochia were formed in adjacent areas, but not on the adaxial surface. Perhaps sporodochia do not form regularly on adaxial surfaces of infected leaves because of the thicker cuticle compared to abaxial surfaces. Another difference is that adaxial surfaces were not observed microscopically to have stomates, while the abaxial surfaces had many stomates. However, stomates were not 65 seen to be associated with direct sporodochial production. Disease also can be found on mature boxwood plants (3 to 4-year-old) in the field perhaps because of annual trimming in summer, because in the inoculation test, no disease was observed on non-wounded leaf tissues on rooted cuttings. Differential susceptibility of wounded tissues of other plants has been reported in previous research. Wounded stems of Pachysandra terminalis had different susceptibility to infection by Volutella pachysandricola, depending on the time of year that wounds were inflicted (Hudler et al. 1990). Compared to 11-d-old wounds, wounded and inoculated P. terminalis in April or May was more susceptible than in June, July and September in New York (Hudler et al. 1990). Volutella buxi may have a similar life cycle, and perhaps the host plants share similarity susceptibility periods as V. pachysandrae on pachysandra. On damaged parts of plants, boxwood tissues were found to be most susceptible to infection. Pink sporodochia were seen 3 to 5 d after infection, which is faster than V. pachysandrae. Different cultivars had different susceptibility to infection by V. buxi. The cultivar 'Green Gem' was more susceptible to infection by Volutella blight than 'Green Velvet', 'Green Mountain', 'Green Mound' or 'Pincushion'. Interestingly, cultivar 'Pincushion' of B. sinica var. insularis was reported as resistant to insects (Batdorf 2004), and in this study, the least amount of Volutella blight was found on the leaves of 'Pincushion'. Further assessment with more isolates of V. buxi from more locations (other provinces or countries) may provide better confirmation of resistance toward Volutella blight by 'Pincushion'. The •results of susceptibility on different cultivars in this study were consistent with nursery reports of losses due to Volutella blight where 'Green Gem', 'Green Velvet', 'Green Mound' 'Green Mountain' had losses of 58%, 40%, 30% and 10%, in 1-yr-old rooted 66 cuttings at a nursery in 2009. Age of boxwood tissue also had a significant impact on susceptibility. In this study, one-month-old boxwood leaves were found to be more susceptible to infection than one-year-old leaves. This result is in agreement with previous studies where young plants were found to be more susceptible (Agrios 2005). Possibly order boxwood leaves have more lignin in their cell walls to prevent pathogen penetration into plants (Mamza et al. 2008). Hudler et al. (1990) found that Pachysandra terminalis is more susceptible to infection with Volutella pachysandricola when plants were exposed to deicing salt in the soil than when grown under favorable conditions. This result may indicate that growth conditions, such as soil drainage and fertilization, can also impact the susceptibility of boxwood to Volutella blight, but more study is required to examine the effects of fertility or adverse growth conditions on Volutella blight infection. Analysis of 86 isolates of V. buxi from two locations in Ontario and one location in B.C. using two ISSR primers showed that there was no specialization based on cultivar origin or geographical origin. Banding patterns of the two primers showed that 86 isolates of V. buxi had very low levels of genetic diversity, and there were many isolates with identical banding patterns, even from different cultivars, and different locations, including different provinces. Low genetic variation of V. buxi among different locations may suggest a relatively recent origin in Canada. The Canadian Plant Disease Survey has only reported Volutella blight of boxwood in 2005 and 2009 (CPS 2006 and 2010). Anecdotal reports from Ontario nurseries are that the disease was rare or absent until 10 or 15 years ago, and has been 67 increasing in incidence and severity since that time. Within Canada, there are only reports of boxwood blight from Ontario and B.C. More surveys are needed to find out whether Volutella blight has reach other provinces in Canada, and whether with global climate change, this disease may become more important across Canada on landscape plantings. Low genetic variation of V. buxi within cultivar origin or geographical origin suggests that asexual reproduction is most common in V. buxi in Canada. Whether sexual reproduction is involved in the disease cycle of Volutella blight in Canada requires further study. 68 Table 3.1 Boxwood plants records with collection date, location, and number of each cultivar as 3-inch potted plants or cuttings. Collection Location Cultivars Description Date (numbers of plant samples) Boxwood plants infected by Volutella buxi Sept 2008 Georgetown Green Gem(7) Potted Feb 2009 Georgetown Green Velvet (20) Cuttings Green Mound(20) May 2009 St. Catherines Green Velvet( 15) Cuttings Green Mountain (15) July 2009 Georgetown Green Velvet (54) Potted Green Gem (36) Green Mountain (90) Cuttings Feb, 2010 St. Catherines Green Velvet (30) Cuttings July 2010 Georgetown 'Green Velvet (3) Cuttings July 2010 B.C. Green Velvet (5) Cuttings Chicagoland Green (5) Green Beauty(5) unknown cultivar (5) Aug 2010 Georgetown Green Velvet(5) Cuttings Healthy plants (no visible signs or symptoms of Volutella leaf and stem blight) Oct 2009 Georgetown Green Mound (18) Potted Jan 2010 Niagara-on-the-lake Pincushion (16) Potted Apr 2010 Georgetown 'Green Velvet (108) Potted 69 Table 3.2 Number of Volutella buxi isolates collected from Georgetown, St. Catherines and B.C. from boxwood cultivars 'Chicagoland Green', 'Green Beauty', 'Green Mound', 'Green Mountain' and 'Green Velvet'. Location Cultivar — B.C. St. Catherines Total Georgetown 13 0 13 Chicagoland Green 0 9 0 9 Green Beauty 0 0 0 3 Green Mound 3 0 3 27 Green Mountain 24 _5 5 46__ Green Velvet 36 27 8 98 Total of cultivars 63 70 Table 3.3 Mean mycelial growth of three Volutella buxi isolates at 10,15, 20, 25, 30 and 35 °C. A 5-mm-diameter plug from a 7-d-old culture was used to inoculate each tube and the tubes were incubated for 16 d. Each isolate by temperature combination was repeated three times. Temperature (°C) Growth rate (mm/16 d) 10 5.2 C* 15 24.7 B 20 67.4 A 25 78.1 A 30 27.7 B 35 4.0 C * Means followed by the same letter are not significantly different according to Fisher's Protected Least Significant Difference test (p = 0.05). 71 Table 3.4 Mean mycelial growth during 16 d at 25 °C of 32 Volutella buxi isolates collected from Georgetown and St. Catherines. There were five replicates for each isolate. Isolate number of Volutella buxi Mycelia growth (mm/16 d) 08126 (Georgetown) 42.0 08127(Georgetown) 42.4 08125 (Georgetown) 59.6 08134 (Georgetown) 73.3 08128 (Georgetown) 74.8 08138 (Georgetown) 75.6 09004 (St. Catherines) 79.0 09005 (St. Catherines) 79.6 08141 (Georgetown) 79.8 08146 (Georgetown) 79.8 09013 (St. Catherines) 79.8 08136 (Georgetown) 80.0 08137 (Georgetown) 82.4 08143 (Georgetown) 82.4 08131 (Georgetown) 83.6 08132 (Georgetown) 84.8 08133 (Georgetown) 85.0 09006 (St. Catherines) 87.0 09003 (St. Catherines) 87.6 09012 (St. Catherines) 87.8 09014 (St. Catherines) 88.2 08147 (Georgetown) 90.8 09010 (St. Catherines) 91.8 09009 (St. Catherines) 93.4 08129 (Georgetown) 95.2 08130 (Georgetown) 95.8 08135 (Georgetown) 95.8 09007 (St. Catherines) 98.0 09008 (St. Catherines) 98.6 09011 (St. Catherines) 101.2 08140 (Georgetown) 101.4 08139 (Georgetown) 107.0 *Means were compared using Fisher's least significant difference test (LSD) at p=0.05 where LSD=22.9. 72 Table 3.5 Detached leaves of each boxwood cultivar were inoculated with a 0.14 ml of spore suspension of Volutella buxi (10 spores/mL) and incubated at 25 °C for 5 d. The infected leaves were rated for disease severity from 0 (low) to 9 (high). This experiment was repeated five times. Boxwood cultivars Means of disease rating Green Mountain 2.4 Green Mound 2.0 Green Gem 3.2 Green Velvet 2.8 Pincushion (18 *Means were compared using Fisher's least significant difference test (LSD) at p=0.05 where LSD=2.35. 73 Figure 3.1 Screw-cap test tubes filled with PDA were used for the temperature growth test for Volutella buxi. An inoculated plug from an actively growing culture was placed at the mouth of each tube. 74 100 9s 90 § 80 "S 70 w 60 % 50 2 40 S 30 13 20 o £ ,0 0 5 10 15 20 25 30 35 40 Temperature (°C) Figure 3.2 Mean mycelial growth of three isolates of Volutella buxi at 10,15,20,25, 30 and 35 °C in screw-cap test tubes for 16 d. Each isolate by temperature combination was repeated three times. Bars show standard error. 75 ' "lllli\ '' I:* •vJ ss-wJf'Jli ^ "- #/^i«f\/f- BR*""* v~i&A''' IP' ^ Figure 3.3 Conidial germination of Volutella buxi at 12 h (top) and 24 h (bottom) on water agar (lOOx). Scale bar represents 100 um. 76 fei-SsS 1 W'M •?:-:m rw- :w i^:' Figure 3.4 Growth of Volutella buxi after 3 d on the surface of a boxwood leaf where verticiUate structures can be observed. Scale bar represents 100 um. 77 Figure 3.5 Attached leaves on whole plants of 'Green Velvet' were cut in half and inoculated by spraying a 106 spores/mL spore suspension of Volutella buxi until runoff and covering with plastic bags. Pink sporodochia appeared on inoculated cut leaves by 3 d. These pictures were taken at 5 d after inoculation. 78 Green Velvet_Georgetown Green Velvet_Georgetown Green Velvet_Georgetown Green Velvet_Georgetown Green Velvet_Georgetown Green Mountain_Georgetown Green Mountain_Georgetown Green Mountain_Georgetown Green Mountain_Georgetown Green Mountain_Georgetown Green Mountain_Georgetown Green Mountain_Georgetown Green Mountain_Georgetown Green Velvet _St. Catherines Green Velvet St. Catherines Chicagoland G~reen_B.C. Chicagoland Green_B.C. Chicagoland Green_B.C. Green Beauty_B.C. Green Beauty B.C. Green Velvet_3-C. Green Velvet_Georgetown Green Mountain_Georgetown Green Mountain_Georgetown Green Mound_Georgetown Green Velvet_Georgetown Green Mountain_Georgetown Green Velvet_Georgetown Green Velvet_Georgetown Green Ve1vet_Georgetown Green Velvet_Georgetown Green Velvet„Georgetown Green Velvet_Georgetown Green Mound Georgetown Green Mountain _St. Catherines Green Mountain _St. Catherines Green VeIvet_Georgetown Green Velvet Georgetown Chicagoland G>een_B.C. Chicagoland Green_B.C. Green Beauty_B.C. Green Velvet_B.C. Green Velvet_Georgetown Green Velvet_Georgetown Green Velvet_Georgetown Green Velvet_Georgetown Green Velvet_Georgetown Green Beauty_B.C. Green Velvet _St. Catherines Green Velvet _St. Catherines Green Velvet_Georgetown Green Velvet_Georgetown Green Velvet_Georgetown Green Velvet__Georgetown Green Velvet„Georgetown Green Velvet_Georgetown Green Velvet_Georgetown Green Mountain_Georgetown Green Velvet_Georgetown Chicagoland Green__B.C. Chicagoland Green_B.C. Green Velvet_B.C Green Velvet_Georgetown Green Velvet _St. Catherines Green Mound_Georgetown Green Beauty_B.C. Green Beauty B.C. Chicagoland G~reen__B.C. Green Velvet_Georgetown Green Velvet_Georgetown Green Velvet„Georgetown Green Mountain_Georgetown Green Velvet_Georaetown Green Mountain _St. Catherines Green Velvet„Georgetown Green Velvet Georgetown Chicagoland G>een_B.C. Green Beauty B.C. Green VelveCB.C. Green Velvet_Georgetown Green Mountain_Georgetown Green Velvet_B.C. Green Velvet Georgetown Chicagoland Green__B.C. Green Beauty__B.C. Green Velvet _St. Catherines 0.81 Figure 3.6 UPGMA dendrogram of 86 isolates of Volutella buxi from five cultivars of boxwood, and two nurseries in Ontario and one nursery in B.C. based on two ISSR primers (AG)s and (CAC)s. The scale is based onNei and Li's coefficient of similarity. Major nodes supported by bootstrap values greater than 50% are indicated by star (*). 79 CHAPTER FOUR EFFECTS OF FUNGICIDES ON VOLUTELLA BLIGHT DEVELOPMENT 4.1 Introduction Production of ornamentals is an important commercial enterprise. In the U.S., the floriculture and nursery industries are considered the fourth largest crop group, and diseases are one the top of the limiting production factors (Daughtrey and Benson 2005). Therefore, management for healthy plants is very important for the ornamental industries. Fungicides are commonly used to control fungal diseases of ornamental plants. From 1960 to 1995, although the percentage of fungicides used for ornamentals compared to the total market decreased from 40% to 19.3% in the global market, the total cost of fungicides increased from 340 million to 5.8 billion dollars (Dehne and Oerke 1998). In Canada, all fungicides must be registered by the Pest Management Regulatory Agency (PMRA) of Health Canada. Although Volutella leaf and stem blight of boxwood has been known since the late 1800's and has been reported in Canada, no fungicide is registered for controlling this disease in Canada (PMRA label search website). Daconil 2787 and Daconil Ultrex (both containing the active ingredient chlorothalonil) are registered in Canada for controlling Volutella blight on pachysandra, caused by Volutella pachysandrae (PMRA 2008b). Because V. buxi and V. pachysandrae are closely related, it is likely that Volutella leaf and stem blight caused by V. buxi on boxwood, hereon referred to as Volutella blight may also be sensitive to Daconil. Bordeaux mixture containing lime sulphur was mentioned as a control method early on for Volutella blight (White 1931), and according to Malinoski & Davidson (2009), copper fungicides and lime sulphur applications can be used for severe infections of Volutella blight, but diseased branches 80 cannot be cured. Although no fungicides are currently registered for controlling Volutella blight in Canada, Bordeaux mixture (Green earth BORDO), copper fungicide (Copper Spray), and lime sulphur (Green earth lime sulphur) are available in Canada (PMRA label search website) for other diseases. 4.1.1 Fungicides used for ornamentals in Canada In Ontario, there are over a dozen fungicidal active ingredients used to control diseases of ornamental nursery plants (OMAFRA 2009). None of these are registered to control Volutella blight of boxwood (OMAFRA 2009; PMRA label search website). However, some fungicides are recommended for control other diseases of ornamentals. For example, Banner MAXX, Phyton-27, Heritage and Daconil can be used to manage leaf spot diseases caused by Alternaria, Colletotrichum, Entomosporium and Myrothecium (Chase 2000), and should also show effects against Volutella blight. Other foliar ascomycetous diseases such as apple scab caused by Venturia inaequalis can be controlled by Banner MAXX, Daconil 2787, Dithane DG and Nova 40W (OMAFRA 2009). Black spot on rose can be managed by Banner MAXX, Clean Crop Copper. 53W, Daconil 2787 and Senator 70WP (OMAFRA 2009). The following seven fungicides are some of the more commonly used ones in Canadian nurseries. The benzimidazoles resemble the secondary plant metabolite colchicine which can inhibit the spindle formulation by binding to tubulin (Davidse 1986). Senator, a commercial formulation of thiophanate-methyl, which is registered in Canada, belongs to the same chemical group as benomyl and has the same mode of action. The benzimidazoles are xylem-mobile (translocated upward with water) systemic fungicides which are 81 effective against plant diseases caused by ascomycetous fungi (Corwin et al. 2007). Senator is commonly used to control many turfgrass and ornamental plant diseases (PMRA 2009a). To control stem, crown and root rots caused by Fusarium and Rhizoctonia on greenhouse potted ornamentals, the recommended rate is 850 g/1000 L water with repeated application after 15 d as required (PMRA 2009a). A formulation of iprodione was first registered as Rovral fungicide wettable powder in 1979 in Canada and then registered as Rovral Green in 1996 by Bayer CropScience Inc. Iprodione is a locally systemic fungicide which can move into plants but not through the plants. It belongs to the family of dicarboximide fungicides (DCOFs) and these affect fungal morphology with some minor effects on some cellular processes, such as cell division, and biosynthesis of RNA, DNA and proteins (Koller 1988). Because of its ability to inhibit mycelial growth and spore germination of fungi, iprodione is registered for use on diseases of field, fruit and ornamental crops which are caused by species of Botrytis, Monilinia, Sclerotinia, Alternaria, Fusarium, Helminthosporium, Phoma, Rhizoctonia, and Typhula (PMRA 2009b). Iprodione can be used to manage Cylindrocladium root rot on greenhouse azaleas at a rate of 125 - 690 mL/100 L water with 7 to 14 d intervals, and Rhizoctonia root rot on euonymus at a rate of 100 mL/100 L with soil drench at transplanting (Hagan 2011). Propiconazole is used for managing various turf and crop diseases and is a very potent fungicide against Ascomycetes and Basidiomycetes. It belongs to the sterol biosynthesis demethylation inhibitor (DMI) fungicide group, and is the mixture of four stereoisomers of 1 -[2-(2,4-dichlorophenyl)-4-propyl-1,3-dioxolan-2-yl]methyl]-1,2,4-triazole (DEFRA 1993). In Canada, it was registered under the commercial names Tilt in 1986 and Banner 82 MAXX in 2002. For nursery crops, propiconazole can be applied every 14 d and a maximum 4 times per year. To prevent anthracnose on dogwood caused by Discula destructiva and on maples caused by Aureobasidium apocryptum, propiconazole was recommended for use at a rate of 28 mL/100 L water with a 14 d interval and up to four applications per year. To prevent black spot caused by Diplocarpon rosae on roses, propiconazole was recommended for use at a rate of 33 mL/100 L water with a 14 d interval and up to four applications per year (PMRA 2009c). Myclobutanil was first registered under the commercial name Nova 40W in 1992 by Dow AgroScience Canada Inc. It is a demethylation inhibitor (DMI) fungicide like propiconazole, which acts by inhibiting sterol biosynthesis. Myclobutanil is a systemic fungicide which is used for protecting and curing diseases caused by Ascomycetes and Basidiomycetes on various crops (Robert and Hutson 1999). It is recommended for control of fungal diseases on nursery grown ornamentals, crops and fruit trees (PMRA 2010). As a systemic fungicide, myclobutanil can be used currently after infection has occurred. To control powdery mildew of apple, roses, gerbera and chrysanthemums, an application rate of 340 g/ha Nova is recommended, with up to 6 applications per growing season. To manage anthracnose and Septoria leaf spot on dogwood, myclobutanil is recommended for use at a rate of 0.34 g/L water right after initial infection with a 14 d interval and up to six applications per year (PMRA 2010). Copper has been used as a fungicide since ancient times (Westcott 2007). It is found in Bordeaux mixture which was first discovered for use against downy mildew of grape in the 1870s in the Bordeaux region of France (Westcott 2007). In Canada, copper was first registered in 1955 under the commercial name PENTOX. Phyton-27 Bactericide and 83 Fungicide, which contains 5% copper, was registered in 1990 for the management of diseases of ornamental plants. To control the pathogen Botrytis cinerea, which causes diseases of gerbera and hibiscus, Phyton-27 is recommended for use at a concentration of 125 - 200 mL/ 100 L water (PMRA 2011). This fungicide can also control B. cinerea on cut flowers, at a concentration of 0.2 - 0.3 iriL/L water with a pH of 5.5 to 6.5 and by dipping the cuttings for 4 s (PMRA 2011). Mancozeb was first registered as Dithane M-45 in 1968 for controlling many vegetable blights, such as Botrytis leaf blight of onion (PMRA 2008a). It is commonly used worldwide because of its protectant activity and because no resistance has been observed. This lack of fungicide resistance may be related to the multi-site contact activity (Ferguson 2006). It can control potato early and late blights at a concentration of 1.1 - 2.24 kg/ha with a 7 to 10 d interval (PMRA 2008a). It can also control anthracnose {Gloeosporium spp.) of ash, oak and sycamore at a concentration of 2.75 - 3.5 kg/1000 L water with a 10 - 14 d interval (PMRA 2007b). Chlorothalonil is a non-systemic fungicide first registered in 1966 in the U.S. In Canada, it was registered as Bravo in 1979 and Daconil 2787 in 1980. In the U.S., it was the third most common fungicide in 1997 behind sulfur and copper. It is effective in controlling fungal diseases on vegetables, fruit trees, ornamentals, turfgrasses and field crops. However, chlorothalonil has been detected in ambient air on Prince Edward Island on a potato farm (White et al. 1990). The chemical 4-hydroxy-2,5,6-trichloroisophthalonitrile, a breakdown product of chlorothalonil, is 30 times more toxic (Cox 1997). In Canada, it is labeled for diseases on ornamentals and conifers, such as Cylindrosporium leafspots on ash, Septoria leafspot on dogwood, 84 Botrytis gray mould on lily, Alternaria leafspot on carnation, Volutella leaf blight on pachysandra and Lophodermium needlecast (PMRA 2008b). 4.1.2 Objectives To better manage Volutella blight on boxwood, the sensitivity of Volutella buxi to different fungicides should first be tested. To evaluate the sensitivity of a large number of V. buxi isolates to fungicides, a preliminary experiment with several fungicides is needed to assess threshold sensitivity. The purposes of the fungicide trials were as follows: (1) to test which fungicides are effective for controlling Volutella blight; and (2) to test pre- and post-infection efficacy of fungicides (i.e. preventive and curative activity). 4.2 Materials and Methods 4.2.1 Boxwood plants and fungal isolates Intact whole boxwood plants were obtained from Ontario nurseries. These one-year-old 'Green Velvet' plants had no visible signs or symptoms of Volutella blight. They were placed in a 25 °C room under 24 h light (50 umol/m2/s) and watered once a week with fertilizer solution, which was prepared by adding fertilizer 20-8-20 at 1.25 g/L water, and adjusting to pH 6.0. For the fungicide tests in vitro, single spore isolates of Volutella buxi were obtained from samples collected at different nurseries in Ontario. The specific sample collection methods and procedure to obtain single spore isolates are discussed in Section 2.2.3. To inoculate boxwood tissues, spore suspensions of V. buxi were prepared by growing each isolate on PDA plates for 7 d at 25 °C. When pink sporodochia were abundant, 100 uL 85 of autoclaved deionized water per plate was added. Cultures were gently agitated, and spore suspensions were collected, and concentrations adjusted to 10 spores/mL in autoclaved deionized water. The spore suspensions were applied with 2 oz spray bottles by hand pumping until runoff for whole plants, and 0.14 ml for detached leaves. 4.2.2 Fungicide selection To assess the efficacy of fungicides for preventing or curing Volutella blight on boxwood, seven fungicides were chosen based on their use in managing other ornamental plant diseases and their different mode of actions (Table 4.1). A benzimidazole was chosen because it is a systemic fungicide particularly effective against ascomycetous fungi (Corwin et al. 2007). Iprodione is a locally systemic fungicide which is commonly used to control fungal diseases on field, fruit and ornamental crops. Propiconazole is another commonly used systemic fungicide. Copper, mancozeb and chlorothalonil are non-systemic and target multiple sites in fungi. Chlorothalonil was chosen, particularly because it is registered to manage Volutella blight on pachysandra in Canada (PMRA 2008b). Nurseries have previously been testing a mixture of 0.3 g/L Nova 40W (containing myclobutanil) and Phyton-27 (containing copper in the form of picro-cupric-ammonium formate) to control Volutella blight on boxwood, and this was also selected for this test. Common names, trade names, fungicide classes, and site of action are given in Table 4.1. 4.2.3 Fungicide sensitivity on amended agar To assess the efficacy of fungicides to manage Volutella blight, the following three fungicides were used for a preliminary assessment with three Ontario isolates: benomyl 86 (95% active ingredient, technical grade; Du Port, Wilmington, Delaware, USA), Banner MAXX (containing 14.3% propiconazole; Syngenta, Honeywood Research Farm, Plattsville, Ontario, Canada) and Rovral Green (containing iprodione 240 g/L; Bayer CropScience Inc., Canada). To grow fungal isolates, 2% potato dextrose agar (PDA, Becton, Dickinson and Company, MD, USA) was used. PDA was prepared by adding 39 g of PDA powder to 1 L deionized water and autoclaving at 121 °C for 20 min. To facilitate fungicide dilutions, 10 mL stock solutions at 1000 ug/mL were prepared. All stock solutions were kept at 5 °C for a maximum of one week. Each fungicide was assessed at the following concentrations with dilutions from the stock prepared the same day of use. Benomyl and iprodione were added to molten PDA for final concentrations of 0.1, 0, 1 and 10 ug/mL. Propiconazole was added to molten PDA for final concentrations of 0.01, 0.1, 0 and 1 ug/mL. The fungicide solutions were added into autoclaved PDA when the temperature was approximately 50 to 60 °C. Each 9-cm-diameter plate was filled with 10 mL PDA using a sterilized plastic serological pipette and a pipette pump (Bel-Art products, Pequannock, New Jersey, USA) with separate tubing. To reduce the number of plates need, PDA was cut into three 1-cm-width strips with 0.5 cm spacing using a media strip cutter (Figure 4.1) following Hsiang et al. (1997). The excess agar was removed with a surface-sterilized spatula. Each isolate by fungicide combination was repeated three times. The 5-mm-diameter PDA plugs of V. buxi which had been grown for 7 d at 25 °C were placed on strip the PDA agar plates prepared above. All plates were wrapped with Parafilm and incubated at 25 °C until mycelia of V. buxi had fully covered the entire cut strips of the non-amended control plates. The fungal growth was marked every 2 d. 87 After calculating EC50 values (described fully in Section 4.2.5), threshold fungicide concentrations for the presumed sensitive isolates were established for benomyl (10 ug/mL), propiconazole (1 (ig/mL) and iprodione (100 jug/mL). These threshold values were used to test 32 isolates from Ontario using the same strip agar assay. Each isolate by fungicide combination was repeated three times. Mycelial growth of V. buxi was measured and recorded every 2 d until non-amended PDA strips were fully covered by mycelia. 4.2.4 Fungicide test on whole plants in 25 °C room To assess preventive or curative efficacy of fungicides on whole plants of boxwood, a susceptible cultivar, 'Green Velvet' was chosen". These one-year-old plants with no visible symptoms were grown in 3-inch pots and kept in a 25 °C room where the humidity was approximately 80%. To assess the preventive efficacy of fungicides, eight treatments were applied to intact 30-cm-tall boxwood plants 7 d before inoculation with V. buxi spore suspension (106 spores/mL) using spray bottles until runoff (approximately 1.5 mL). To assess the curative efficacy of fungicides, eight treatments were applied once 7 d after inoculation, or applied twice at 7 and 14 d after inoculation. To ensure consistent infection by wounding, the tips of eight leaves per plant were cut off before inoculation. The combination of the eight different fungicide treatments by the treatment application frequencies (single or double) resulted in a total of 24 different treatments which were replicated three times (Table 4.4). The 108 plants were randomly placed into flats (11 x 21 inches), and each flat of 18 plants was covered with a transparent plastic bag for 3 d to maintain high humidity for infection. On day 7 after fungicide treatment (for preventive trials) or 7 d after inoculation 88 (for curative trials), disease was rated as a product of the number of symptomatic leaves (0 to 8) and the average proportion of leaf area symptomatic (ranging form 0 to 1 representing 0% to 100%). Therefore, the range of disease ratings was from 0 (no disease) to 8 (all eight leaves fully symptomatic). The ratings were transformed to percent where 8=100% before statistical analysis. Disease rating was repeated 7 d later. 4.2.5 Statistical analysis For the inhibition test on a range of fungicide concentrations, EC50 values (the effective concentration required to inhibit diameter growth by 50%) were calculated based on inhibition (=l-(the mean colony diameter on amended media divided by the mean colony diameter on unamended media)) in percent (Hsiang et al. 1997). The extent of mycelial growth between day 4 and day 5 was subjected to probit analysis using SAS 9.1 (SAS Institute, Cary, NC, USA) (Sokal and Rohlf 1969) to produce EC50 values. An example of a PROC PROBIT SAS job can be found in Appendix 4.1. The EC50 values calculated from three replicates for each of the three isolates in this test were used to establish threshold inhibitory concentrations for each fungicide. For inhibition tests based on single threshold concentrations, the mycelial growth was measured between day 2 and day 4 and divided by two for a daily rate. The fungicide growth inhibition data and the disease ratings were subjected to analysis of variance using SAS PROC GLM. When a significant treatment effect was found, means were compared using Fisher's least significant difference test (LSD) at p=0.05. An example of the SAS statements can be found in Appendix 4.2. 89 4.3 RESULTS 4.3.1 Boxwood samples and fungal isolates of Volutella buxi For the fungicide test on whole boxwood plants, 108 one-year-old 'Green Velvet' plants in 3-inch pots without obvious indications of disease were collected from Southern Ontario nurseries in spring 2010, and maintained for up to 4 weeks before use. In this study, a total of 32 isolates of Volutella buxi were obtained from diseased boxwood from different nurseries in Southern Ontario and B.C. (Appendix 3.2) 4.3.2 EC50 values and threshold concentrations of fungicides For three isolates from Ontario (Isolates 08133, 08141 and 08143, all presumed to be sensitive) which were tested on a range of fungicide concentrations, growth rates were calculated by subtracting diameters of mycelial growth on day 2 from day 4 and dividing by two to obtain a daily growth rate. Based on three replicates and probit analysis (example SAS statements in Appendix 4.1), the overall mean EC50 values were as follows: benomyl, 0.80 ug/mL; propiconazole, 0.13 ug/mL and iprodione, 14.53 ug/mL (Table 4.2). Based on these results, threshold concentrations were established for each fungicide for subsequent tests against a larger number of isolates as follows: benomyl, 10 ug/mL; propiconazole, 1 ug/mL; and iprodione, 100 ug/mL. To assess fungicide sensitivity, 32 Ontario isolates (Isolates 08116 to 08118, 08125 to 08144 and 09006 to 09013) were grown on PDA amended with these three fungicides at the threshold concentrations. All isolates were found to be almost fully inhibited by threshold fungicide concentrations. Mycelia did not grow on PDA plates amended with 10 ug/mL of benomyl nor on 1 ug/mL of propiconazole. On PDA plates amended with 100 90 |ag/mL of iprodione, minor hyphal growth was observed. 4.3.3 The efficacy of fungicides on boxwood plants in 25 °C room For each plant, eight leaves were wounded by cutting in half prior to inoculation. All eight wounded leaves became infected with Volutella blight by 3 d after inoculation. Inoculated boxwood plants without fungicide treatment had significantly higher disease severity than fungicides treatments and the water check where no disease was seen. In general, lower disease ratings were observed on plants which were pre-treated with fungicides before inoculation in contrast to post-treatments (Table 4.4). Compared to plants which were pre-treated with fungicides, more disease was observed on plants treated with Rovral than other fungicides. Significantly lower disease levels were observed on plants pre-treated with Banner MAXX, Senator or Phyton-27 + Nova 40W. Among all plants treated with fungicides, disease levels were significantly higher on the plants which were post-treated with Rovral and Dithane 7 d after the inoculation. In general, disease ratings were not significantly different among post-applied fungicides 7 d after inoculation, or applied twice at 7 and 14 d after inoculation. Compared to all post-application of fungicides, plants which were treated with Rovral and Dithane displayed higher disease levels than other fungicides, whereas low disease levels were observed on plants post-treated with Banner MAXX, Senator or Daconil. 4.4 Discussion Some fungicides which are registered for plant diseases in Canada have been recommended in the past to manage diseases caused by Volutella species, such as 91 Bordeaux mixture, copper, and lime sulphur (White 1931; Malinoski and Davidson 2009). Common fungicides used against woody ornamental diseases in Canada are listed in Table 4.1. Among these, six were assessed in this study on whole plants (Table 4.4). Three fungicides, one each from most commonly used fungicides classes, were first tested in vitro in amended agar tests to assess establish threshold concentrations for further testing. EC50 values of these three fungicides were benomyl, 0.80 |ug/mL; propiconazole, 0.13 |ag/mL and iprodione, 14.5 ug/mL. These values were compared to EC50 in other fungi. Mean EC50 values for benomyl in the fungus Verticilliumfungicola var.fungicola ranging from 11.93 to 22.8 (j,g/mL were considered moderately sensitive (Potocnik et al. 2008). Mean EC50 values for Cladobotryum spp. against benomyl and iprodione which were 0.97 ug/mL and 2.30 |Lig/mL, respectively were considered highly sensitive (Potocnik et al. 2008). Therefore, these tested isolates of V. buxi, which were uniform in their response to these three fungicides, were considered sensitive. Based on these results, threshold concentrations were established for further testing. Threshold concentrations for testing of a larger number of isolates from Ontario were set as follows: benomyl at 10 p.g/mL, propiconazole at 1 p.g/mL and iprodione at 100 ug/mL. Previous studies which have used threshold concentrations of these fungicides to assess sensitivity of filamentous ascomycetes include the following: benomyl against Botrytis elliptica (1 |Lig/mL) and Fusarium proliferatum (1 (ig/mL); iprodione against B. elliptica (10 (ig/mL); propiconazole against Gloeosporium spp. (1 ug/mL) (Falk 1996; Hsiang et al. 2001 and Frost 2008). Benomyl in this study was used at a higher threshold (10 ug/mL rather than 1 ug/mL in previous studies) because the EC50 for three isolates of V. buxi was found to be 0.80 ug/mL. Similarly iprodione in this study was used at a higher 92 threshold (100 (ig/mL rather than 10 ug/mL in previous studies) because the EC50 for three isolates of V. buxi was found to be 14.5 |Lig/mL. The 32 isolates tested all came from Ontario from two locations (Georgetown and St. Catherines) and in a geographical area 100 km by 40 km (Figure 4.2). When tested at these threshold concentrations, they were all found to be highly sensitive to these three fungicides. For the fungicide test on whole plants, a disease rating system was first developed. Based on resistance test of boxwood plants which described in Chapter 3, wounded tissues were much more susceptible to infection than non-wounded tissues. Non-wounded tissues did not become infected in any of the inoculation tests. To obtain consistent disease development in inoculation process, eight leaves of each plant were cut in half before they were sprayed with inoculum of V. buxi. Therefore, disease was rated as a product of the number of symptomatic leaves (0 to 8 among the eight cut leaves) and the average proportion of symptomatic leaf area (ranging from 0 to 1 representing 0% to 100%). The range of disease ratings was from 0 (no disease) to 8 (all eight leaves fully symptomatic). In this test, only plants treated with inoculum showed any disease. Six fungicidal treatments were tested on whole boxwood plants (Table 4.4). All treatments showed inhibitory effects on disease development of V. buxi. Boxwood plants treated with fungicides 7 d before they were inoculated (preventive treatment) showed lower disease ratings than post-treated (curative treatments). Disease ratings were not significantly different between single or double post fungicidal treatments. The results show that all the fungicides tested were more effective in preventing Volutella blight than curing the disease. However, curative treatments at 7 d after infection also showed significant reduction of disease. After infection has occurred, multiple applications of fungicides may not 93 necessarily reduce disease development further than a single application. In addition to the one-year-old whole plant tests at the University of Guelph, there were two other fungicide trials which took place at one of the nurseries near Georgetown, Ontario. The same eight treatments were used (Table 4.3) on one-month-old cuttings and on one-year-old plants in a propagation room. The treatments were applied on the same day as spore inoculation or 10 d after inoculation. However, in the commercial production environment, the uninoculated controls also showed extensive disease, and many of the rooted cuttings did not survive, so these tests were abandoned. In the growth room test at the University of Guelph on one-year-old plants, Volutella blight showed less sensitivity toward iprodione compared to the other five fungicidal treatments. Daconil 2787 and Daconil Ultrex are recommended for managing Volutella blight on pachysandra which is caused by the related pathogen V. pachysandrae; in this study, Daconil 2787 showed strong inhibitory effects on disease development of Volutella blight on boxwood as well. In the propagation process in nurseries, boxwood cuttings are sometimes dipped into fungicides such as Phyton-27 before planting. However, pink sporodochia of V. buxi can be observed on these treated rooted cuttings after two months in production environments. In the fungicide test on whole plants, the mixture of Phyton-27 and Nova 40W showed efficacy on preventing and curing Volutella blight. These results were in agreement with the recommendation of using Bordeaux mixture, copper, and lime sulphur to manage Volutella blight on boxwood (White 1931 and Malinoski and Davidson 2009). Benomyl which has been used in the past for managing many ornamental diseases had inhibitory effects on reducing boxwood disease. Fungicide test data on whole plants were in agreement with the fungicide tests in vitro. 94 Benomyl, propiconazole, iprodione showed inhibitory effects against V. buxi on amended agar and whole plants. Pre-applied fungicides were more effective than post-applied on whole plants. All tested fungicidal treatments, myclobutanil + copper, mancozeb, chlorothalonil, iprodione, thiophanate-methyl and propiconazole, showed strong activity for preventing Volutella blight. Although the differences were not statistically significant, propiconazole was found to have the lowest numerical disease rating on boxwood leaves either pre-treated or post-treated with fungicides. These fungicides can be used in an integrated control program to reduce infection by V. buxi, and losses due to Volutella blight. 95 Table 4.1 Fungicides commonly used in Ontario nurseries (from OMAFRA 2009). Fungicide class Common name Commercial name Target site Benzimidazoles benomyl Benlate, Tersan (3-tubulin assembly in thiophanate-methyl Senator, Easout mitosis Dicarboximides iprodione Rovral MAP/Histidine-kinase in osmotic signal transduction DMI propiconazole Banner MAXX C14-demethylase in (Demethylation myclobutanil Nova 40W sterol biosynthesis Inhibitors) Inorganic copper Phyton-27 Multi-site contact activity Dithiocarbamates mancozeb Dithane Chloronitriles chlorothalonil Daconil 2787 (phthalonitriles) 96 Table 4.2 EC50 values for three isolates of Volutella buxi based on probit analysis of mycelial growth rates on PDA amended with benomyl or iprodione at 0.1, 0, 1 and 10 ug/mL or propiconazole at 0.01, 0.1, 0 and 1 ug/mL at 25 °C for 16 d. Each isolate by fungicide combination was repeated three times. EC50 (ng/mL) isolate benomyl propiconazole iprodione 08133 0.84 0.13 11.6 08141 0.92 0.14 11.1 08143 0.65 0.12 20.9 Mean EC50 0.80 0.13 14.5 97 Table 4.3 Fungicides which were used against Volutella leaf and stem blight on whole plants of boxwood in 25 °C room. Treatment Chemical name Product/L water Active ingredient concentratio n/L water Untreated control Water ~ — Inoculated control Spore suspension -- -- Phyton-27 + Nova 40W 40% myclobutanil + 5.5% 0.3g + 0.3g 0.12 g + copper 0.02 g Dithane DG 75WP 75% mancozeb 3g 2.25 g Daconil 2787F 40% chlorothalonil 2.4 mL 0.96 mL Rovral Green 240 g/L iprodione 24 g 6g Senator 70WP 70% thiophanate-methyl 0.14 g o.i g Banner MAXX 14.3% propiconazole 0.35 mL 0.05 mL Note: Mix fungicide products with 1 L of water and spray until runoff. Each plant was treated with -0.15 ml of each treatment with spray bottles. 98 Table 4.4 Efficacy of fungicidal treatments before (7 d) or after inoculation (7 d or 7 d plus 14 d) and incubated under 24 h light (50 umol/m2 //s ) at 25°C. A spore suspension of V. buxi (106 spores/mL) and fungicidal treatments were applied to each plant until runoff. Disease was rated (0 to 8) at 7 d after inoculation or first fungicide application as a product of the number of symptomatic leaves (0 to 8) and the average proportion of symptomatic leaf area (ranging from 0 to 1 representing 0% to 100%). The disease ratings were translated to percent where 8=100. Disease rating (% disease)a Treatment Preventive Curative treatmentb Curative treatment Ic treatment IId Inoculated 96 100 96 Phyton-27 + Nova 40W 3 25 20 Dithane DG 75WP 9 43 24 Daconil 2787F 8 14 11 Rovral Green 16 38 29 • Senator 3 25 16 Banner MAXX 1 16 8 a Disease was evaluated on a 0= no disease to 100= 100% disease with six replicates per treatment. Means were compared using Fisher's least significant difference test (LSD) at p=0.05 where LSD=10.4. b The preventive treatments were applied once 7 d before inoculation, and disease was rated 7 d after inoculation c This first curative set of treatments was applied 7 d after inoculation and disease was rated 7 d after fungicide application which was 14 d after inoculation d This second curative set of treatments was applied 7 d and again 14 d after inoculation and disease was rated 7 d after last fungicide application which was 21 d after inoculation 99 Figure 4.1 Picture of a cut agar plate. The three-strip agar assay was used to reduce number of plates used. Each strip of agar is inoculated with a different isolate of Volutella buxi, and each isolate was replicated three times. 100 Southern Ontario 100 km Figure 4.2 Map of Ontario, Canada, showing nurseries at Georgetown, St. Catherines and Niagara-on-the-Lake where collections of Volutella buxi were made. 101 CHAPTER FIVE GENERAL DISCUSSION Since the late 1990s, a disease of boxwood has been observed in nurseries, and disease severity seems to have been increasing. In 2008, several nurseries in Southern Ontario had an outbreak of this boxwood disease, which was the impetus for the start of this study. Although diseased plants were still alive, the appearance of landscape boxwood plants was affected due to yellow foliage and dead branches, and in the nurseries the disease required extensive culling especially on recently rooted cuttings. In addition to the dead leaves and twigs, pink fruiting bodies could be found on stems and abaxial surface of leaves. Black streaks were also sometimes found on petioles and stems. Four boxwood cultivars commonly grown in local nurseries, 'Green Mound', 'Green Gem', 'Green Mountain' and 'Green Velvet', were all susceptible to this disease. Prior to this study, some major boxwood fungal diseases had been reported, including Volutella leaf and stem blight caused by V. buxi, Cylindrocladium leaf spot caused by Cylindrocladium buxicola, Macrophoma leaf spot caused by Macrophoma candollei and Phytophthora root rot caused by Phytophthora spp. A boxwood blight caused by Cylindrocladium buxicola is also found with black streaks on the stems (Henricot et al. 2008) and this fungus has been found in association with V. buxi (Henricot et al. 2000). However, in this study, C. buxicola was not isolated from diseased boxwood samples collected from Ontario or B.C. Therefore, the black streak symptoms in Canada on boxwood are not related to Cylindrocladium blight, but rather are associated with Volutella blight, at least in the Ontario and B.C. nurseries sampled. Based on morphological and molecular biological techniques, eight different morphotypes of fungi associated with the boxwood disease were identified. The 102 pink-orange fungus Volutella buxi was isolated and successfully fulfilled Koch's postulates to be confirmed as the causal agent of the boxwood disease. Another seven fungal taxa, Fusarium tricinctum, Phoma herbarum, Acremonium sp., Colletotrichum gloeosporioides, Bionectria ochroleuca, Fusarium oxysporum and Epicoccum nigrum were also isolated from symptomatic boxwood tissues, but these did not successfully fulfill Koch's postulates, and hence were not considered causal agents of the disease. To confirm the morphological identification, DNA sequencing of ITS regions and beta-tubulin gene was used in this study. However, ITS sequencing results of the V. buxi (Isolate 08126) showed top matches with two Volutella species on GenBank with 98% identity (490/498 bp) for V ciliata (AJ301967) and 96% (474/490 bp) identity for V. buxi (FJ555527). Because the top match for V. buxi on GenBank was V ciliata and not V buxi, more DNA sequences of V. buxi were obtained and analyzed to confirm the results. ITS sequences of three isolates (Isolates 08126, 09012 and 10113) from different locations (Georgetown, St. Catherines and B.C.) were found to be identical. To further confirm this results, the partial beta-tubulin sequence of isolate 10113 was obtained, and found to have a 97%o (578/596 bp) top match with Pseudonectria rousseliana (DQ522522), which is the teleomorph of V. buxi. The next best match was Fusarium sp. (EU926356) at 91%). These results showed that fungal species responsible for the boxwood disease is Volutella buxi, and there may be some incorrect annotations on GenBank for this species. To further investigate the issue with possibly incorrect annotations, a phylogenetic study using ITS sequences from Volutella and related species was conducted using three in-house isolates of V buxi, nine published Volutella spp. and 33 other fungal species which had a close genetic relationship with Volutella spp. This dendrogram (Figure 2.6) showed 103 species of Volutella distributed in two major well supported clades. Volutella colletotrichoid.es (AJ301962) was found with 12 isolates of Gibellulopsis nigrescens in the first clade. In the second major clade, a dozen Volutella species were scattered among a variety of subclusters with other genera such as Mariannaea, Nectria, Cosmospora, Stibella, Geosmithia, Lanatonectria and Fusarium. These results demonstrate that the genus Volutella is in need of revision. Since the type species, V. ciliata, is found in a clade closer to other genera than V buxi, then V. buxi probably belongs in another genus or the other genera need reclassification. More genomic sequences are required to clarify this issue. To better characterize the pathogen V. buxi which causes Volutella blight on boxwood, more morphological and disease development features were studied in this project. Characteristics of V. buxi on culture media are in agreement with previous descriptions in the literature. On PDA at 25 °C, V. buxi was white at the beginning (Dodge 1944c). After 3 d, it started to produce a pink-orange colour in the middle. Pink sporodochia were spread evenly in the centre of half area of each mycelium. By 7 d, mycelia had covered 75% to the full 9-cm-diameter of a Petri plate. However, colony color is not sufficient for identification because the cultural appearance of V. buxi is similar to Colletotrichum gloeosporioides and C. musae (Photita et al. 2005). Microscopic features of V. buxi were also in agreement with previous studies (Griffith and Henfrey 1883; Dodge 1944c; Rossman 1993). Spores of V. buxi were elliptical, 6-9><2-3.5 urn. The hyphae of V. buxi have verticillate branches. In this study, spore germination rate was assessed. Spores started to germinate by 12 h and form verticillate structure by 24 h on water agar at 25 °C. To better characterize disease development, detached leaves were inoculated with spore 104 suspensions of V. buxi and incubated at 25 °C. Spores started to germinate by 18 h and form verticillate structure by 3 d on leaves. To better understand Volutella blight resistance of boxwood, assessments were conducted on different ages of tissues, on different boxwood cultivars and on wounded or non-wounded tissues. We found that (1) one-month-old boxwood leaves were more susceptible to infection than one-year-old leaves; (2) compared to 'Green Velvet', 'Green Mound', 'Green Mountain', 'Green Gem' was the most susceptible cultivar, whereas 'Pincushion' was the least; and (3) wounded leaves were more susceptible than non-wounded leaves. The results of cultivar resistance tests were in agreement with a report from a southern Ontario nursery, in which the losses due to Volutella blight in 2008 for 'Green Gem', 'Green Velvet', 'Green Mound' and 'Green Mountain' were '58%, 40%, 30%o and 10%>, respectively. On the inoculated wounded leaves, pink sporodochia of V. buxi were observed 3 d later at 25 °C. Sporodochia first appeared on the wound sites and then spread over the abaxial surface of the leaves. By 7 d, the abaxial surfaces of wounded leaves were fully covered with sporodochia. No sporodochia were observed on non-wounded surfaces of leaves. The inoculated leaves did not dry or turn yellow by the end of the observation period (7 d), probably because of the high relative humidity conditions in Petri plate. In controlled environments at 25 °C and under high humidity conditions at nurseries, pink sporodochia of V. buxi can be observed within two months after initial propagation. Based on these inoculation results and observations, wounds may be the major penetration point for V. buxi. When growing boxwood in nurseries, wounds are difficult to avoid due to cuttings, trimming, and insect and winter injury. Therefore, some cultural methods of managing 105 control Volutella blight are understandable. To reduce sporulation of V. buxi, diseased branches and leaves should be removed as soon as possible. To reduce humidity, overwatering should be avoided and shrubs should be thinned to allow better air circulation (Jacobi et al. 2003; Relf 1997). The life cycle of Volutella buxi and the disease cycle of Volutella blight have not been thoroughly investigated. Based on published details of the disease cycle of V. pachysandrae (Safrankova 2007), and observations of Volutella blight and V. buxi from the current work, the putative life cycle of V. buxi is described as follows. In the external environment when temperatures warm up in the spring, conidia of V. buxi are produced on overwintered mycelium in diseased tissues. These spores are dispersed by air or splashing water (rain or irrigation) and will infect boxwood tissues throughout the spring, especially younger new foliage which is more susceptible than older overwintered foliage. The fungus will grow through foliar tissues and into woody tissue. In summer with drier warmer conditions, conidial production is reduced, but with wet weather of over several days duration, the fungus can grow out from infected tissues, produce spores and cause more infections. In fall, with wetter cooler conditions, the fungus is again active and will produce spores to cause more infection. Symptoms of Volutella blight can be observed on infected tissues, such as yellow foliage and dead branches. In winter, hyphae become dormant inside leaves and stems of dead boxwood tissues until the following spring. The disease cycle under managed conditions differs because enclosed environments offer protection from desiccation as well as more humid or wet conditions that are favorable for plant growth, but also fungal growth. The boxwood propagation cycle in a typical Ontario nursery is described as follows. In September to November each year, 106 cuttings are made from 5-yr-old mother plants planted in the field. Cuttings usually have the bottom 2-3 inches (5 to 7.5 cm) stripped of leaves. Afresh cut is made on the bottom, and then dipped into a rooting hormone and fungicide (such as Phyton-27 at a rate of 5ml/L). Prepared cuttings are stuck into flats containing rooting media such as Berger BM6 media. Flats with newly stuck cuttings are placed into a propagation room with floor heat and environmental controls until rooted and hardened off (about 8 to 9 months which is the following summer). The propagation room is controlled at a minimum humidity (e.g. 84%) and an optimal root zone temperature around 20 °C. The following summer, rooted cuttings are then either planted out in field beds or are potted into 3.5" pots. If planted into the field, boxwood is grown there for 3 to 4 years. Once large enough, the plants are lifted out of the ground and transported bare-root for sale. If these plants are kept within nurseries, they will become the next generation of mother plants. If rooted plants are potted into a 3.5" pot, they are transplanted to 3-gallon pots after two growing seasons, and then are grown anther one to two growing seasons for sale. If these potted plants are kept within nurseries, they will become the next generation of mother plants. During all stages of growth, boxwood plants are trimmed annually in late summer to fall. During this propagation cycle, there are various stages where Volutella blight might enter the system, and even become enhanced by cultural operations. (1) For the rooted cuttings, if mother plants which are collected from the field have some infection, possible non-symptomatic and latent, hyphae of V. buxi would be inside plant tissues, even if care is made to remove diseased tissue. (2) When cuttings are dipped in fungicides before propagation, the foliar portions are not 107 protected. However, V. buxi is strongly restricted to entry through wounds, so if wounding of above ground parts is minimized during these controlled environment operations, infection levels might be decreased. (3) With latent or non-symptomatic infections, V. buxi still can grow out from infected live tissues, produce spores, cause infections and be transported by air and splashing water. The infection process is faster in controlled environments at 21 °C and under high humidity in propagation room than in the external environment, since in Petri plates, the entire disease cycle from infection to spore production can occur in three days. Furthermore, we found that from dead dried leaves, the fungus is still viable after six months, and hence debris can be a source of inoculum, in addition to infected non-symptomatic live tissues. (4) In cases where there is a high risk of disease (e.g. high inoculum pressure), repeated applications of fungicides are likely needed because spores will be constantly produced under the moist warm growth conditions in controlled environments. There was an outbreak of Volutella blight caused by V. buxi on boxwood in Southern Ontario in 2008, and it was also observed in nurseries in B.C. from 2009 to 2010. However, prior to this study, the origin and mode of reproduction of V. buxi in Canada had not been investigated. These were assessed by using two ISSR primers with 86 isolates from Ontario and B.C. The results showed that there was no specialization based on cultivar origin or geographical origin. The sexual stage of V. buxi (P. rousseliana) was not observed during this study. Meanwhile, a high level of similarity in banding patterns observed among 86 isolates implying that V. buxi may have a relatively recent origin in Canada and a predominant asexual mode of reproduction. Fungicides as a disease management method were assessed in this study. In Canada, 108 no fungicides are registered for control of Volutella blight on boxwood. Because benomyl, propiconazole, iprodione showed inhibitory effects against V. buxi on amended agar, fungicides which are commonly used against woody ornamental diseases in Ontario were tested on whole boxwood plants. Six fungicide treatments, Phyton-27 + Nova 40W, Senator, Banner MAXX, Dithane, Rovral and Iprodione, showed strong activity for preventing Volutella blight, and some curative activity. Daconil 2787 which is recommended for managing Volutella blight on Pachysandra (V. pachysandrae) was also found to have strong preventive activity against Volutella blight on boxwood. Some suggestions for future research with V buxi and Volutella blight follow. The taxonomic and phylogenetic status of V. buxi and other Volutella species needs clarification, and sequencing of more genes from these species is needed. Although some evidence is presented here on the low genetic variation in V. buxi, a greater number of multilocus genetic markers are needed to confirm this result. To better investigate whether V. buxi was introduced into Canada recently, a study of isolates from outside of Canada is also needed. In this study, fungicides were tested in Petri plates, growth rooms and propagation rooms, but some testing in the field is also required. With climate change and more restrictive regulations on synthetic pesticide use, plant diseases such as Volutella blight of boxwood may become more important in nurseries and the landscape. NOTE: After preparation of this thesis, a publication was found regarding the taxonomy of Volutella buxi, where this anamorph was considered invalid, and the teleomorph was renamed as Pseudonectria buxi, but no new anamorphic name was given (Grafenhan et al. 2011). 109 REFERENCES Agrios, G.N. (2005). Plant pathology. Oxford. U.K.: Elsevier Academic Press. Arslan, K., Akgul, H., Ergul, C, Huseyin, E., Ozturk, G. and Bulca, B. (2009). A geometric description of the perithecia of the Pseudonectria rousseliana (Mont.) Wollenw. Journal of Biological and Environmental Sciences 3(9), 67-70. Atkins, S.D. and Clark, I.M. (2004). Fungal molecular diagnostics: a mini review. Journal of Applied Genetics 45, 3-15. Ayers, G. (1969). The effects of moisture and temperatue on growth and spore germination in some fungi. Journal of Stored Products Research 5(2), 127-141. Batdorf, L.R. (2003). Caring for box. (pp. 21). England: Sage Press. Batdorf, L.R. (2004). Boxwood: An illustrated encyclopedia. Virginia: The American Boxwood Society. Barnett, H.L. and Hunter, B.B. (1972). Illustrated genera of imperfect fungi, (pp. 66). Minneapolis: Burgess Publishing Company. Bayraktar, H., Dolar, F.S. and Maden, S. (2008). Use of RAPD and ISSR markers in detection of genetic variation and population structure among Fusarium oxysporum f. sp. ciceris isolates on Chickpea in Turkey. Journal of Phytopathology 156, 146-154. Beard, C, Loughman, R., Smith, A. and Speijers, J. (2009). Baseline sensitivity to three triazole fungicides in Pyrenophora tritici-repentis. Australasian Plant Pathology 38, 168-172. Berkeley, M.J. and Broome, C.E. (1850). Notices of British fungi (pp. 465-466). The Annals and Magazine of Natural History. London: R. and J.E. Taylor. Bezerra, J.L. (1963). Studies on Pseudonectria rousseliana. Acta botanica neerlandica 12, 58-63. Bornet, B. and Branchard, M. (2001). Nonanchored Inter Simple Sequence Repeat (ISSR) Markers: Reproducible and Specific Tools for Genome Fingerprinting. Plant Molecular Biology Reporter 19: 209-215. Bowley, S.R. (2008). A hitchhiker's guide to statistics in plant biology (pp. 72). Guelph: Ampersand Printing. Busch, L.V, and Walker, J.C. (1958). Studies of cucumber anthracnose. Phytopathology 48, 302-304. no Cahill, D.M., Rookes, J. E., Wilson, B. A., Gibson, L. and McDougall, K. L. (2008). Phytophthora cinnamomi and Australia's biodiversity: impacts, predictions and progress towards control. Australian Journal of Botany 56, 279-310. Caron, D. and Tatnall, D.V. (2004). Animals in the garden. University of Delaware Cooperative Extension, from Chase, A. R. (2000, January). Fungicides for control of ornamental leaf spots. Western connection. Vol. 2(5). from Chiang, T.Y. and Schaal, B.A. (2000). Molecular evolution and phylogeny of the atpB-rbcL spacer of chloroplast DNA in the true mosses. Genome 43(3), 417-426. Chilton, J.E. (1954) Volutella Species on Alfalfa. Mycologia 46(6), 800-809. Choi, Y.W., Hyde, K. D. and Ho, W.W.H. (1999). Single spore isolation of fungi. Fungal Diversity 5,29-38. Cooke, M.C. (1884). Notes on Hypocreaceae. Grevillea 17, 13. Corwin, B., Tisserat, N., and Fresenburg, B. (2007). Identification and Management of Turfgrass Diseases: Plant protection programs (pp. 7). University of Missouri. Cox, C. (1997). Fungicide Factsheet: Chlorothalonil. Journal of Pesticide Reform 17 (4), 14-20. CPS (The Canadian Phytopathological Society) (2007). Canadian Plant Disease Survey 87, 1-142. CPS (The Canadian Phytopathological Society) (2008). Canadian Plant Disease Survey 88, 1-135. CPS (The Canadian Phytopathological Society) (2009). Canadian Plant Disease Survey 89, 1-149. Crepel, C. and Inghelbrecht, S., (2003). First report of blight on Buxus spp. caused by Cylindrocladium buxicola in Belgium. Plant Disease 97, 1536. Damm, U., Woudenberg, J.H.C., Cannon, P.F. and Crous, P.W. (2009). Colletotrichum species with curved conidia from herbaceous hosts. Fungal Diversity 39, 45-87. Dasgupta M.K. (1988). Principles of Plant Pathology (pp. 18). New Delhi, India: Allied Publisher Private Limited. in Daughtrey, M.L. and Benson, D.M. (2005). Principles of plant health management for ornamental plants. Annual Review of Phytopathology 43, 141-169. Davidse, L.C. (1986). Benzimidazole fungicides: Mechanism of action and biological impact. Annual Review Phytopathology 24, 43-65. DEFRA (Department for Environment, Food and Rural Affairs) (1993). Evaluation on: Propiconazole uses in wood preservation. Advisory Committee on Pesticides 80, 8. from < http ://www.pesticides. gov. uk/psd_pdfs/Evaluations/0 8 0_propiconazole .pdf>. Dehne, H.-W. and Oerke, E.-C. (1998). Impact of diseases and disease control on crop production. In: Fungicidal activity: chemical and biological approaches to plant protection (pp. 1-22). Edited by Hutson, D.H. and Miyamoto, J. New York: Wiley. Dinolfo, M.L, Stenglein, S.A., Moreno, M.V., Nicholson, P., Jennings, P. and Slerno, G.L. (2010). ISSR markers detect high genetic variation among Fusarium poae isolates from Argentina and England. European Journal of Plant Pathology 127, 483-491. Dobrowolski, M.P., Shearer, B.L., Colquhoun, I.J., O'Brien, P.A., and Hardy, G.E. StJ. (2008). Selection for decreased sensitivity to phosphite in Phytophthora cinnamomi with prolonged use of fungicide. Plant Pathology 57, 928-936. Dodge, B.O. (1944a). A new Pseudonectria on Pachysandra. Mycologia 36, 532-537. Dodge, B.O. (1944b). Boxwood blights and Hyponectria buxi. Mycologia 36, 215-222. Dodge, B.O. (1944c). Volutella buxi and Verticillium buxi. Mycologia 36, 416-425. Domsch, K.H., Gams, W. and Anderson, T.-H. (1980). Compendium of soil fungi (pp. 846-847). London: Academic Press. Domsch, K.H. and Gams, W. (1972). Fungi in agricultural soils. John Wiley and Sons, Inc. Halsted Press Division, New York. Durrieu, G. (2001). Correspondence-More about box rust (Puccinia buxi). Mycologist 15, 144. Due, A.L., Parsons, L.R. and Pair, J.C. (2000). Growth, survival, and aesthetic quality of boxwood cultivars as affected by landscape exposure. HortScience 35, 205-208. Edgar, R.C. (2004). MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research 32, 1792-1797. Edwards, K., Johnstone, C. and Thompson, C. (1991). A simple and rapid method for the preparation of plant genomic DNA for PCR analysis. Nucleic Acids Research 19, 1349. 112 Eken, C, Demirci, E. and Verkley, G. J.M. (2002). First report of Volutella colletotrichoides in Turkey. Plant Pathology 51, 812. Ellis, M.B. and Ellis, J.P. (1985). Microfungi on land plants: An identification handbook (pp. 101-102). New York: Macmillan Publ. Co. Falk, S.P. Pearson, R.C., Gadoury, D.M. Seem, R.C. and Sztejinberg, A. (1996). Fusarium proliferatum as a biocontrol agent against grape downy mildew. Phytopathology 86, 1010-1017. Farr, D.F., Bills, G.F., Chamuris, G.P., Rossman, A.Y. (1989). Fungi on plants and plant products in the United States. Minnesota: APS PRESS. Felsenstein, J. (1989). PHYLIP - Phylogeny inference package (Version 3.2). Cladistics 5, 164-166. Ferguson, G. (2006). Effects of Mancozeb on biocontrol agents. Ministry of Agriculture, Food and Rural Affairs (OMAFRA), from Frost, K.W. (2008). Identification and pathogenicity of some fungi associated with lowbush blueberry (pp. 81). The University of Marine, from < http://www.library.umaine.edu/theses/pdf/FrostKE2008.pdf> Date assessed: 19 May 2011 Fuentes, J.L., Escobar, F., Alvarez, A., Gallego, G, Duque, M.C., Ferrer, M., Deus, J.E. and Tohme, J.M. (1999). Analyses of genetic diversity in Cuban rice varieties using isozyme, RAPD and AFLP markers. Euphytica 109(2), 107-115. Grafenhan, T., Schroers, H.-J., Nirenberg, H.I. and Seifert, K.A. (2011). An overview of the taxonomy, phylogeny, and typification of nectriaceous fungi in Cosmospora, Acremonium, Fusarium, Stilbella, and Volutella. Studies in Mycology 68, 79-113. Griffith, J.W. and Henfrey, A. (1883). The micrographic dictionary: A guide to the examination and investigation of the structure and nature of microscopic objects (pp. 812). London: van Voorst. Hagan, A.K. (2011). Commercial ornamentals: disease control-woody trees, shrubs, and perennial ground covers, Abelia-Hydrangea. Alabama Cooperative Extension System IPM1032, from Hansen, M.A., (2000). Major diseases of boxwood. Virginia Cooperative Extension. 450-614, from Harkness, H.W. (1886). Fungi in the pacific coast (pp. 163). Bulletin of the California. 113 Academy of Sciences. George Spaulding &Co. Printers. Hartman, J. (2001). Boxwood-Volutella stem and leaf blight. Inspector finding in Kentucky. University of Kentucky (pp. 3), from Henricot, B., and Culham, A., (2002). Cylindrocladium buxicola, a new species affecting Buxus spp., and its phylogenetic status. Mycologia 94, 980-997. Henricot, B., Sierra, A.P. and Prior, C. (2000). A new blight disease on Buxus in the U.K. caused by fungus Cylindrocladium. Plant Pathology 49, 805. Henricot, C, Gorton, C, and Denton, J. (2008). Studies on the control of Cylindrocladium buxicola using fungicides and host resistance. Plant Disease 92, 1273-1279. Hsiang, T. and Wu, C. (2000). Genetic relationships of pathogenic Typhula species assessed by RAPD, ITS-RFLP and ITS sequencing. Mycological Research 104(1), 16-22. Hsiang, T., Yang, L. and Barton, W. (1997). Baseline sensitivity and cross-resistance to demethylation-inhibiting fungicides in Ontario isolates of Sclerotinia homoeocarpa. European Journal of Plant Pathology 103, 409-416. Hsiang, T., Hsieh, T.F., and Chastagner, G.A. (2001). Relative sensitivity to the fungicides benomyl and iprodione of Botrytis elliptica from Taiwan and the Northwestern USA. Plant Pathology Bulletin 10, 93-95. Huang, J., Hsieh, T.F, Chastagner, G.A. and Hsiang, T. (2001). Clonal and sexual propagation in Botrytis elliptica. Mycological Research 105(7), 833-842. Hudler, G.W., Neal, B.G arid Banik, M.T. (1990). Effects of growing conditions on wound repair and disease resistance in Pachysandra terminalis. Phytopathology 80, 212-211. Jacobi, J., Mullen, J. and Williams, J.D. (2003). Growing boxwoods in Alabama. Alabama Cooperative Extension ANR-222, from Jo, Y.K. (2005). Management of dollar spot and gray leaf spot on turfgrass. The Ohio State University, from Joshi, V. and Jeffries, M. (2006). Diseases diagnosed on commercial crops submitted to the BCMAL plant diagnostic laboratory in 2005. Canadian Plant Disease Survey 86, 7-13. Joshi, V. and Jeffries, M. (2010). Diseases diagnosed on commercial crops submitted to the BCMAL plant diagnostic laboratory in 2009. Canadian Plant Disease Survey 90, 7-15. 114 Kays, J.S. and Dutky, E. (2000). Wildlife damage management: reducing Vole damage to plants. Maryland Cooperative Extension, Fast sheet 654, from < http://www.britford.org/mediaA/bles.pdf> Date assessed: 19 May 2011. Khan, A. and Hsiang, T. (2003). The infection process of Colletotrichum graminicola and relative aggressiveness on four turfgrass species. Canadian Journal of Microbiology 49(7), 433-442. Kobayashi, T. (2007). Index of fungi inhabiting woody plants in Japan. Host, Distribution and Literature. Tokyo: Zenkoku-Noson-Kyoikai Publishing Co., Ltd. Koch, R. (1884). Die Aetiologie der Tuberkulose. Mittheilungen aus dem Kaiserlichen Gesundheitsamte 2, 1-88. Koller, W (1988). Sterol demethylation inhibitors: mechanism of action and resistance. In: Delp CJ (ed): Fungicide Resistance in North America (pp 79-88). St. Paul, Minnesota. APS Press. Li, M., Wang, S.B., Fan, M.Z., Li, Z.Z. and Huang, Y.P. (2006). Genetic diversity of Beauveria bassiana (Bals.) Vuill. in forest ecosystem assessed by inter-simple sequence repeat (ISSR) markers. Hereditas 28(8), 977-983. Lubani, K.R. and Linn, N.B. (1962). Entrance and invasion of the asparagus plant by urediniospore germ tubes and hyphae of Puccinia asparagi. Phytopathology 52, 115-119. Ma, Z.H., Yoshimura, M.A. and Michailides, T.J. (2003). Identification and Characterization of Benzimidazole Resistance in Monilinia fructicola from Stone Fruit Orchards in California. Applied and Environmental Microbiology 69(12), 7145-7152. Mahoney, C.L. and Springer, D.A. (2009). Genetic diversity. New York: Nova Science Pub Inc. Malinoski, M.K. and Davidson, J.A. (2009). IPM series: Boxwood. Maryland Cooperative Extension. Home and Garden Mimeo #HG52, from < http://www.hgic.umd.edu/content/documents/hg52revised8_2010.pdf> Date assessed: 19 May 2011. Mamza, W.S., Zarafi, A.B. and Alabi,0. 2008. Incidence and severity of leaf blight caused by Fusarium pallidoroseum on varied age of Castor (Ricinus communis) inoculated using different methods. African Journal of General Agriculture, 119-122 Martin K.J. and Rygiewicz, P.T. (2005). Fungal-specific PCR primers developed for analysis of the ITS region of environmental DNA extracts. BMC Microbiology 5, 710-715. Martinez-Rossi, N.M. and Azevedo, J.L. (1987). Detection of point-mutation mutagens in Aspergillus nidulans: comparison of methionine suppressors and arginine resistance 115 induction by fungicides. Mutation Research 176, 29-35. Massee, G. (1895). British fungus-flora, a classified text-book of mycology (pp. 475). London: George Bell & Sons. Moreau, F. (1919). Sur une Tuberculariacee parasite du Buis, le Volutella Buxi (Corda) Berk. [A Tuberculariaceae parasite on box, Volutella Buxi] Bull. Trimest. Soc. Myc. France 35, 12-14. Narayanan, S.A. (1962). Volutella kamatii sp. no v. from India. Mycopathologia 18, 147-148. Nei, M. and Li, W.H. (1979). Mathematical model for studying genetic variation in terms of restriction endonucleases. Proceedings of the National Academy of Sciences of the United States of America 76, 5269-5273. Nisa, M. (1985). Isolation and structural studies on the chemical constituents of Buxus papilosa and Calotropis procera. University of Karachi, from Njambere, E.N.N., Attanayake, R.N. and Chen, W.D. (2010). Applications of molecular markers and DNA sequences in identifying fungal pathogens of cool season grain legumes. In: Molecular identification of fungi (pp. 79-91). Edited by Gherbawy, Y. and Voigt, K. New York: Springer-Verlag Berlin Heidelberg. Olariaga, I., Hoyo, M.R, Gomez-Bolea, A. and Salcedo, I. (2007). Typification and description of Typhula buxi. Mycotaxon 100, 27-35. OMAFRA (Ontario Ministry of Agriculture, Food and Rural Affairs) (2009). Nursery and landscape plant production and IPM. Publication 383 (pp. 101). Alberta: Queen's Printer. Page, R.D.M. (1996). TREEVIEW: An application to display phylogenetic trees on personal computers. Computer Applications in the Biosciences 12, 357-358. Palmer, J.D. (1986). Isolation and structural analysis of chloroplast DNA. Methods in Enzymology 118, 167-186. Parry, D.W. (1990). Plant pathology in agriculture (pp. 5). Cambridge: Cambridge University Press. Pataky, N. (2003). Boxwood injury. University of Illinois Extension, Retrieved April 30, 2003 from Petrini, L. and Candoussau, F. (1993). Neotypification of Roselliania buxi. Mycotaxon 49, 303-305. 116 Pherson, C. (2005). Boxwood-5wx^ microphylla. Landscape & Irrigation 29, 38. Photita, W, Taylor, P.W.J., Ford, R., Hyde, K.D. and Lumyong, S. (2005). Morphological and molecular characterization of Colletotrichum species from herbaceous plants in Thailand. Fungal Diversity 18, 117-133. PMRA (Pest Management Regulatory Agency) (2008a). Dithane M-45 80% WP fungicide label. Health Canada. Ottawa, Ontario, Canada, from < pr-rp.hc-sc.gc.ca/l_l/pr_web.vel?p_ukid=8793> Date assessed: 19 May 2011. PMRA (Pest Management Regulatory Agency). (2008b). Daconil 2787 flowable fungicide label. Health Canada. Ottawa, Ontario, Canada, from < pr-rp.hc-sc.gc.ca/l_l/pr_web.vel?p_ukid=4842> Date assessed: 19 May 2011. PMRA (Pest Management Regulatory Agency) (2009a). Senator 70WP fungicide label. Health Canada. Ottawa, Ontario, Canada, from PMRA (Pest Management Regulatory Agency) (2009b). Rovral Green GT flowerable fungicide label. Health Canada. Ottawa, Ontario, Canada, from PMRA (Pest Management Regulatory Agency) (2009c). Banner MAXX fungicide label. Health Canada. Ottawa, Ontario, Canada, from PMRA (Pest Management Regulatory Agency) (2010). Nova 40W agricultural fungicide label. Health Canada. Ottawa, Ontario, Canada, from < pr-rp.hc-sc.gc.ca/l_l/ pr_web.vel?p_ukid= 11454 > Date assessed: 19 May 2011. PMRA (Pest Management Regulatory Agency) (2011). Phyton-27 bactericide & fungicide label. Health Canada. Ottawa, Ontario, Canada, from < pr-rp.hc-sc.gc.ca/l_l/pr_web.vel?p_ukid=11598 > Date assessed: 19 May 2011 Potocnik, I., Milijasevic, S., Rekanovic, E., Todorovic, B. and Stepanovic, M. (2008). Sensitivity of Verticillium fungicola var. fungicola, Mycogone perniciosa and Cladobotryum spp. to fungicides in Serbia. Pesticide Phytomedicine 23(17), 33-41. Preece, T.F. (2000). The strange story of box rust, Puccinia buxi, in Britain. Mycologist 14 (3), 104-106. Refoufi, A. and Esnault, M.-A. (2006). Genetic diversity and population structure of Elytrigia pycnantha (Godr.) (Triticeae) in Mont Saint-Michel Bay using microsatellite markers. Plant Biology 8(2), 234 -242. 117 Relf, D. (1997). Diseases of boxwood. Virginia Cooperative Extension 3(7), from < http://www.ext.vt.edu/departments/envirohort/factsheets2/shrubs/feb91pr2.html>. Date assessed: 19 May 2011 Roberts, T.R. and Hutson, D.H. (1999). Metabolic pathways of agrochemicals: part two: insecticides and fungicides (pp. 1069). Cambridge, U.K.: The Royal Society of Chemistry. Rossman, A.Y. and Samuels, G.J. (1993). Leuconectria clusiae gen. nov and its anamorph Gliocephalotrichium bulbilium with notes on Pseudonectria. Mycologia 85(4), 685-704. Saccordo, P.A. (1883). Sylloge Fungorum II (pp. 452). Safrankova, I. (2005). First report of Volutellapachysandricola on Pachysandra terminalis in the Czech Republic. Plant Pathology 54, 808. Safrankova, I. (2007). Volutella leaf blight and stem canker on Japanese pachysandra in the Czech Republic. Plant Protection Science 43, 10-12. Samuels, G.J. (1977). Nectria consors and its Volutella conidial state. Mycologia 69, 255-262. Sanger, R, Nicklen, S. and Coulson, A.R. (1977). DNA sequencing with chain-terminationing inhibitors. Proc. Natl. Acad. Sci. 74, 5463-5467. Scow, K.M., Schwartz, E., Johnson, M.J. and Macalady, J.L., (2001). Microbial biodiversity, measurement of Encyclopedia of Biodiversity (pp. 177-190). San Diego: Academic Press. Shukla, B.N. and Chand, J.N. 1975. Effect of leaf age on bacterial blight of sesamum. Indian Phytopathology 20, 304-305. Stevens, F.L. (1913). The Fungi which cause plant disease (pp. 204). New York: The Macmillan Company. Sinclair, W.A. and Lyon, H.H. (2005). Diseases of trees and shrubs (pp. 364). New York: Coinstock Publishing Associates, Cornell University Press Sokal, R.R. and Rohlf, F. J. (1969). Biometry, The principles and practice of statistics in biological research. San Francisco: W. H. Freeman and Company. Soni, S.K. (2007). Microbes: A source of energy of 21st century (pp. 271). India: New India Publishing Agency. Stothard, P. (2000). The sequence manipulation suite: JavaScript programs for analyzing and formatting protein and DNA sequences. Bio Techniques 28, 1102-1104. 118 Thompson, J.D., Gibson, T.J., Plewniak, R, Jeanmougin, F. and Higgins, D.G. (1997). The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 25, 4876-4882. Thseng, F.M., Chen, J.S. and Ko, W.H. (2004). The relationship between branch canker and twig dieback of tea caused by Macrophoma theicola. Journal of Phytopathology 152, 423-426. Wang, S., Miao, X., Zhao, W., Huang, B., Fan, M., li, Z. and Huang, Y. (2005). Genetic diversity and population structure among strains of the entomopathogenic fungus, Beauveria bassiana, as revealed by inter-simple sequence repeats (ISSR). Mycological Research 109 (12), 1364-1372. Webster, J. and Weber, R.W.S. (2007). Introduction of fungi. Cambridge: Cambridge University Press. Westcott, C. (2007). Westcott'splant disease handbook. New York: Springer. White, R.P. (1931). Diseases of Boxwood. New Jersey Agricultural Experiment Station Circular 230. White, T.J., Bruns T., Lee, S. and Taylor, J. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: PCR Protocols/a Guide to Methods and Applications (pp. 315-322). Edited by Innis, M.A., Gelfand, D.H., Sninsky, J.J. and White, T.J. New York: Academic Press. White, L.M., Ernst, W.R., Julien, G., Garron, C. and Leger, M. (2006). Ambient air concentrations of pesticides used in potato cultivation in Prince Edward Island, Canada. Pest Management Science Pest 62, 126-136. Wolfe, A.D. (2000). ISSR resource website, from Wollenweber H.W (1931). FwranwOT-Monographie. Fungi parasitici et saprophytici. Zeitschrift fur Parasitenkunde 3, 269-516. 119 APPENDICES Appendix 2.1 ITS regions of eight different morphotypes of fungi collected from diseased boxwood. >Volutella buxi (Isolate 08126) CCTGTGAACATACCTCTTGTTGCCTCGGCGGGACCGCCCCGGCGCCTTCGGGCTGCCGGG CCCAGGCGCCCGCCGGAGGACCATCAAACTCTTGTATTTTATTTCAGGAATCTTCTGAGT ATACAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAA GAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAACCATCGAATCTT TGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAA CCCTCAAGCCCCTTTGGGCTTGGTGTTGGGGATCGGCCCGCCCCGTGCGGCGCCGGCCCC GAAATCTAGTGGCGGTTTCGCCTGCAGCCTCCTCTGCGTAGTAGCAATATCTCGCACCGG AACGCAGCGTGACCACGCCGTAAAACCCCCAACTTCTGAAAGGTTGACCTCGGATCAGGT AGGACTACCCGCTGAACT >Fusarium tricinctum GATCAGCCCGCGCCCCGTAAAACGGGACGGCCCGCCAGAGGACCCAAACTCTAATGTTTC TTATTGTAACTTCTGAGTAAAACAAACAAATAAATCAAAACTTTCAACAACGGATCTCTT GGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTC AGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTGGTATTCCGGCGGGCATGCCT GTTCGAGCGTCATTTCAACCCTCAAGCCCCCGGGTTTGGTGTTGGGGATCGGCTCTGCCC TTCTGGGCGGTGCCGCCCCCGAAATACATTGGCGGTCTCGCTGCAGCCTCCATTGCGTAG TAGCTAACACCTCGCAACTGGAACGCGGCGCGGCCATGCCGTAAAACCCCAACTTCTGAA TGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGGAGG GAA >Acremonium sp. CAGGGGGCCGCCGGANGCTCCAAACTCTTGTCTTTTAGTGTATTTCTGAGTGGCATAAGC AAATAAATCAAAACTTTCAGCAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCANC AAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAC ATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCTGAGCGTCATTTCAACCCTCAGGA CCCGTTCGCGGGACCTGGCGTTGGGGATCAGCCTGCCCCTGGCGGCGGCTGGCCCTGAAA TCCAGTGGCGGTTCCCTCGCGAACTCCTCCGTGCAGNAATTAAACCTCTCGCGGCAGGAT AGCGGTTGAACCACGCCGTTAAACCCCCCACTTCTCAAGGNTGACCTCAGATCAGGTAGG AATACCCGCTGAACTTA >Bionectria ochroleuca TTACCGAGTTTACAACTCCCAAACCCATGTGAACATACCTACTGTTGCTTCGGCGGGATT GCCCCGGGCGCCTCGTGTGCCCCGGATCAGGCGCCCGCCTAGGAAACTTAATTCTTGTTT TATTTTGGAATCTTCTGAGTAGTTTTTACAAATAAATAAAAACTTTCAACAACGGATCTC TTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAAT TCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGC CTGTCTGAGCGTCATTTCAACCCTCATGCCCCTAGGGCGTGGTGTTGGGGATCGGCCAAA GCCCGCGAGGGACGGCCGGCCCCTAAATCTAGTGGCGGACCCGTCGTGGCCTCCTCTGCG AAGTAGTGATATTCCGCATCGGAGAGCGACGAGCCCCTGCCGTTAAACCCCCAACTTTCC AAGGTTGACCTCAGATCAGGTAGGAATACCCGCTGAACTTAAGCATATC I- 120 Appendix 2.1 (continued) >Phoma herbarum TAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCTAGAGTTGTAGGCTTTGC CTGCTATCTCTTACCCATGTCTTTTGAGTACCTTCGTTTCCTCGGCGGGTCCGCCCGCCG ATTGGACAATTTAAACCATTTGCAGTTGCAATCAGCGTCTGAAAAAACTTAATAGTTACA ACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAA GTAGTGTGAATTGCAGATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTG GTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCTTCAAGCTTTGCTTGGTGTT GGGTGTTTGTCTCGCCTCTGCGTGTAGACTCGCCTCAAAACAATTGGCAGCCGGCGTATT GATTTCGGAGCGCAGTACATCTCGCGCTTTGCACTCAGAACGACGACGTCCAAAAGTNCA TTTTTACACTCTGACCTCGGATCAGG >Colletotrichum gloeosporioides TTTGTNATATTGTCCGAATTGCCGCATTACCCCCCCCCCCCTCCGNATCCCCGNGCGAGA CGTTAGTACTACGCAAAGGAGGCTCCGGGAGGCCCGCCACTACCTTTAAGGGCCCACGTC GGCCGTGGGGCCCCAAAACCAAGCGGTGCTTGAGGGTTGAAATGACGCTCGAACAGGCAT GCTCGCCAGAATGCTGGCGAGTNCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTC TGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGA TCCGTTGTTAAAAGTTTTAATTATTTGCTTGTGCCACTCAGAAGAGACGTCGTGTAAATA GAGTTTGGTTTCCTCCGGCGGGCGCCCCGTCCCCGTGGTGGGGGCCGGCGCCGGGAGGGG AGNCCCGCGAGAGGCTTCCCCTGCCCGCNCGAAGCAACGGTTAGGTACGTTCACAAAGGG TTATAGAGCGGTAACTCAGTAATGATCCCTCCGCAGGTTCACCTNNGGAACTANCCAGCN NNAGCTACCAATCATTAATGATCCTTCAGCAGGTTCACCTACGGAA >Fusarium oxysporum GTGAACATANCACTTGTTGCCTCGGCGGATCAGNCCGCTTCCCGGTAAAACGGGACGGCC CGCCAGAGACCCCTAAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATAAATAAA TCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGC GATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGC CCGCCAGTATTCTGGCGGGANTGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACAGCTT GGTGTTGGGACTCGCGTTAATTCGCGTTCCTCAAATTGATTGGCGGTCACGTCGAGCTTC CATAGCGTAGTAGTAAAACCCTCGTTACTGGTAATCGTCGCGGCCC >Epicoccum nigrum TTACCTAGAGTTTGTAGACTTCGGTCTGCTACCTCTTACCCATGTCTTTTGAGTACCTTC GTTTCCTCGGCGGGTCCGCCCGCCGATTGGACAACATTCAAACCCTTTGCAGTTGCAATC AGCGTCTGAAAAAACATAATAGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATC GATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCG AATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA TTTGTACCTTCAAGCTCTGCTTGGTGTTGGGTGTTTGTCTCGCCTCTGCGTGTAGACTCG CCTTAAAACAATTGGCAGCcGGCGTATTGATTTCGGAGCGCAGTACATCTCGCGCTTTGC ACTCATAACGACGACGTCCAAAAGTACATTTTTACACTCTTGACCTCGGATCAGGTAGGG ATACCCGCTGAACTTAAGCATATCATA 121 Appendix 2.2 ITS sequencing results of three isolates of Volutella buxi (Isolates 08126, 09012 and 10113). The ITS of isolates 08126 and 09012 were sequenced with primers ITS1 and ITS4. The ITS of isolate 10113 was only sequenced with primer ITS1. >Volutella buxi (Isolate 08126) ITS consensus sequence CCTGTGAACATACCTCTTGTTGCCTCGGCGGGACCGCCCCGGCGCCTTCGGGCTGCCGGG CCCAGGCGCCCGCCGGAGGACCATCAAACTCTTGTATTTTATTTCAGGAATCTTCTGAGT ATACAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAA GAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAACCATCGAATCTT TGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAA CCCTCAAGCCCCTTTGGGCTTGGTGTTGGGGATCGGCCCGCCCCGTGCGGCGCCGGCCCC GAAATCTAGTGGCGGTTTCGCCTGCAGCCTCCTCTGCGTAGTAGCAATATCTCGCACCGG AACGCAGCGTGACCACGCCGTAAAACCCCCAACTTCTGAAAGGTTGACCTCGGATCAGGT AGGACTACCCGCTGAACT >Volutella buxi (Isolate 09012) ITS consensus sequence TACCTCTTGTTGCCTCGGCGGGACCGCCCCGGCGCCTTCGGGCTGCCGGGCCCAGGCGCC CGCCGGAGGACCATCAAACTCTTGTATTTTATTTCAGGAATCTTCTGAGTATACAAACAA ATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGA AATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAACCATCGAATCTTTGAACGCACAT TGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCAAGCCC CTTTGGGCTTGGTGTTGGGGATCGGCCCGCCCCGTGCGGCGCCGGCCCCGAAATCTAGTG GCGGTTTCGCCTGCAGCCTCCTCTGCGTAGTAGCAATATCTCGCACCGGAACGCAGCGTG ACCACGCCGTAAAACCCCCAACTTCTGAAAGGTTGACCTCGGA >Volutella buxi (Isolate 10113) ITS sequenced with primer ITS1 CCCTGTGACATACCTCTTGTTGCCTCGGCGGGACCGCCCCGGCGCCTTCGGGCTGCCGGG CCCAGGCGCCCGCCGGAgGACCATCAAACTCTTGTATTTTATTTCAGGAATCTTCTGAGT ATACAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAA GAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAACCATCGAATCTT TGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAA CCCTCAAGCCCCTTTGGGCTTGGTGTTGGGGATCGGCCCGCCCCGTGCGGCGCCGGCCCC GAAATCTAGTGGCGGTTTCGCCTGCAGCCTCCTCTGCGTAGTAGCAATATCTCGCACCGG AACGCAGCGTGACCACGCCGTAAAACCCCCAACTTCTGAAAGGTTGACCTCGGATCAGGT AGGACTACCCGCTGAACTTAAGCATATCAATAAGCCGGAGGGAA 122 Appendix 2.3 BLAST result of the ITS sequence of Volutella buxi (Isolate 08126) against the NCBI database showing top 12 matches and top two alignments. >Kftwx/_Isolate08126 CCTGTGAACATACCTCTTGTTGCCTCGGCGGGACCGCCCCGGCGCCTTCGGGCTGCCGGG CCCAGGCGCCCGCCGGAGGACCATCAAACTCTTGTATTTTATTTCAGGAATCTTCTGAGT ATACAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAA GAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAACCATCGAATCTT TGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAA CCCTCAAGCCCCTTTGGGCTTGGTGTTGGGGATCGGCCCGCCCCGTGCGGCGCCGGCCCC GAAATCTAGTGGCGGTTTCGCCTGCAGCCTCCTCTGCGTAGTAGCAATATCTCGCACCGG AACGCAGCGTGACCACGCCGTAAAACCCCCAACTTCTGAAAGGTTGACCTCGGATCAGGT AGGACTACCCGCTGAACT Accession Description Max Total Query E Max score score coverage value ident AJ301967 Volutella ciliata ITS, strain BBA 874 874 100% 0.0 98% 69459 FJ555527 Volutella buxi ITS 813 813 97% 0.0 96% EU860077 Fusarium ciliatum ITS, strain F-202 665 665 100% 0.0 91% HM054144 Cosmospora vilior ITS, strain 7093 664 664 100% 0.0 91% HM054159 Cosmospora meliopsicola ITS, strain 662 662 100% 0.0 91% 5186 HM484537 Cosmospora coccinea ITS, strain 658 658 100% 0.0 90% A.R. 2741 FJ474072 Cosmospora coccinea ITS, strain 656 656 100% 0.0 90% CBS 114050 HQ248209 Hypocreales sp. ITS, PCT.07 652 652 100% 0.0 90% HM054160 Cosmospora vilior ITS, strain 7497 652 652 100% 0.0 90% HM239926 Uncultured Ascomycota ITS, clone 652 652 100% 0.0 90% 315 GU726751 Cosmospora vilior ITS, isolate 652 652 100% 0.0 90% Guardbridgel4 EF121860 Lanatonectria flavolanata ITS, 652 652 100% 0.0 90% isolate H975161 123 Appendix 2.3 (continued) >emb|AJ301967.1| Volutella ciliata 18S rRNA gene, 5.8S rRNA gene, 28S rRNA gene (partial), internal transcribed spacer 1 (ITS1) and internal transcribed spacer 2 (ITS2), strain BBA 69459 Length=2865 Score = 874 bits (473), Expect = 0.0 Identities = 490/498 (98%), Gaps = 1/498 (0%) Strand=Plus/Plus Query 1 CCTGTGAACATACCTCTTGTTGCCTCGGCGGGACCGCCCCGGCGCCTTCGGGCTGCCGGG 60 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I Sbjct 1780 CCTGTGAACATACCTCTTGTTGCCTCGGCGGGATCGCCCCGGCGCCTTCGGGCTGCCGGA 1839 Query 61 CCCAGGCGCCCGCCGGAGGACCATCAAACTCTTGTATTTTATTTCAGGAATCTTCTGAGT 120 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I Sbjct 184 0 CCCAGGCGCCCGCCGGAGGACCATCAAACTC-TGTATTTTATTTCAGGATTCTTCTGAGT 18 98 Query 121 ATACAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAA 180 I I I I I I I I I I I I I I II I I I ! I I I I I I I I ! I i I I I I I I I I I I I II ! I I I I I I I I I I I I I I I Sbjct 18 9 9 ATACAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAA 1958 Query 181 GAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAACCATCGAATCTT 24 0 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I II I I I I I I I I I I II I I I I I I I I I I I I I I I Sbjct 1959 GAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAACCATCGAATCTT 2018 Query 241 TGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAA 300 I I I I I I I I I I II I I II I I I I I II I I I I I I I I I I I I I I I I I I I I I I I I I II I I I I I I II I I Sbjct 2019 TGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAA 2078 Query 301 CCCTCAAGCCCCTTTGGGCTTGGTGTTGGGGATCGGCCCGCCCCGTGCGGCGCCGGCCCC 3 60 I I I I I I I I I II I I I I I II I I I II I I I I I I I I I I I I I I I I I II I I I I I I I II I I I I I I I I I Sbjct 207 9 CCCTCAAGCCCCTTTGGGCTTGGTGTTGGGGATCGGCCCGCCCCGTGCGGCGCCGGCCCC 2138 Query 361 GAAATCTAGTGGCGGTTTCGCCTGCAGCCTCCTCTGCGTAGTAGCAATATCTCGCACCGG 420 I I I I I I I I I I I I I I I I I I I II I I I I I I I I I I I I I I I I II I I I I I I I II I I I I I I I I II Sbjct 213 9 GAAATCTAGTGGCGGTCACGCCTGCAGCCTCCTCTGCGTAGTAGCAATATCTCGCACCGG 2198 Query 421 AACGCAGCGTGACCACGCCGTAAAACCCCCAACTTCTGAAAGGTTGACCTCGGATCAGGT 4 80 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I II Sbjct 2199 AACGCAGCGCGGCCACGCCGTAAAACCCCCAACTTCTGAAAGGTTGACCTCGGATCAGGT 2258 Query 481 AGGACTACCCGCTGAACT 4 98 I I I I I I I I I I I I I I I I I I Sbjct 2259 AGGACTACCCGCTGAACT 227 6 124 Appendix 2.3 (continued) >gb|FJ555527.1| Volutella buxi internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence Length=512 Score = 813 bits (440), Expect = 0.0 Identities = 474/490 (97%), Gaps = 3/490 (1%) Strand=Plus/Plus Query 11 TACCTCTTGTTGCCTCGGCGGGACCGCCCCGGCGCCTTCGGGCTGCCGG-GCCCAGGCGC 69 I I 1 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I MINI I I I I I I I I I I I I I I I I I I Sbjct 1 TACCTCTTGTTGCCTCGGCGGGACCGCCCCGGTGCCTTCTGGCTGCCGGAG-CCAGGCGC 5 9 Query 70 CCGCCGGAGGACCATCAAACTCTTGTATTTTATTTCAGGAATCTTCTGAGTATACAAAAC 129 I I I I I I I I I I I I I I! I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I II I I I I I I I I I I Sbjct 60 CCGCCGGAGGACCATCCAACTCTTGTATTTTATTTCACGAATCTTCTGAGTATACAAAAC 119 Query 130 AAATGA-ATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAG 188 I I I I I I I I I I I I I I I I I II I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I Sbjct 120 AAATGATCTCAAAACTTTCAACAAGGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAG 17 9 Query 18 9 CGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAACCATCGAATCTTTGAACGCA 248 I I I I I I I I I I I I I I I I I I I I I I I I II I I I I I II I I I II I I II I I I I I I I I I I I I I I I I Sbjct 180 CGAAATGCGATAAGTAATGTGAATTGGAGAATTCAGTGAACCATCAAATCTTTGAACGCA 23 9 Query 24 9 CATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCAAG 308 I I I I I I I I I I I I I I I II I I I I I I I I II I I I I I I I I I I I I I I I I I I I I II I I I II I I I I I Sbjct 24 0 CATTGCGCCCGCCAGTATTCTGGGGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCAAG 299 Query 309 CCCCTTTGGGCTTGGTGTTGGGGATCGGCCCGCCCCGTGCGGCGCCGGCCCCGAAATCTA 368 I I I II I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I Sbjct 300 CCCCTTTGGGCTTGGTGTTGGGGATCGGCCCGCCCCGTGCGGCGCCGGGCCCGAAATCTA 359 Query 369 GTGGCGGTTTCGCCTGCAGCCTCCTCTGCGTAGTAGCAATATCTCGCACCGGAACGCAGC 428 I I I I I I I I I I I I I II I I I II I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I II I I Sbjct 3 60 ATGGCGGTTTCGCCTGCAGCCTCCTCTGCGTAGTAGCGATATCTCGCACCGGAACGCAGC 419 Query 429 GTGACCACGCCGTAAAACCCCCAACTTCTGAAAGGTTGACCTCGGATCAGGTAGGACTAC 488 I I I I I I I I I I I I I I I I I II I I I I I I I I I I I I I II I I I I I I I I II I I I I I I I I I I I I I I I Sbjct 420 GTGACCACGCCGTAAAACCCCCAACTTCTGAAAGGTTGACCTCGGATCATGTAGGACTAC 47 9 Query 48 9 CCGCTGAACT 4 98 I I I I I I I I I I Sbjct 4 80 CCGCTGAACT 48 9 125 Appendix 2.4 List of nucleotide sequences and alignment used to design primers for the amplification of the Pseudonectria rousseliana beta-tubulin gene. The sequence of P. rousseliana (DQ522522) was compared with a complete beta-tubulin sequence of Gibberella fujikuroi (GFU27303). Box showed the position of forwarded and reverse primers. GenBank Accession Species HQ141666 Fusarium langsethiae HQ141668 Gibberella zeae HM034845 Muscodor albus GFU27303 Gibberella fujikuroi AB273716 Glomerella acutata EU860012 Fusarium merismoides EU926355 Fusarium domesticum EU926356 Fusarium sp. DQ522522 Pseudonectria rousseliana EU926357 Fusarium lunatum EU926356 TCTTCCGTCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGAAACAAC 624 EU926357 TCTTCCGTCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGAAACAAC 620 EU926355 TCTTCCGTCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGAAACAAC 597 HQ141666 TTTTCCGACCCGACAACTTCGTTTTCGGTCAATCCGGTGCCGGAAACAAC 555 HQ141668 TTTTCCGACCCGACAACTTCGTTTTCGGTCAATCCGGCGCCGGAAACAAC 545 GFU27303 TCTTCCGTCCCGACAACTTCGTTTTCGGTCAGTCCGGTGCTGGA^ACAACl 1142 EU860012 TCTTCCGTCCCGACAACTTCGTCTTCGGTCAATCTGGTGCCGGCAAGAAC 588 AB273716 TTTTCCGCCCCGACAACTTCGTCTTTGGCCAGTCCGGTGCCGGCAACAAC 839 DQ522522 HM034845 TCTTCCGCCCCGACAACTTCGTCTTCGGCCAGTCTGGTGCTGGCAACAAC 81i EU926356 TGGGCCAAGGGTCACTACACTGAGGGTGCCGAGCTTGTCGACCAGGTTCT 674 EU926357 TGGGCCAAGGGTCACTACACTGAGGGTGCCGAGCTTGTCGACCAGGTTCT 670 EU926355 TGGGCCAAGGGTCATTACACTGAGGGTGCCGAGCTCGTCGACCAGGTCCT 647 HQ141666 TGGGCCAAGGGTCATTACACTGAGGGAGCTGAACTTGTCGACCAAGTTCT 605 HQ141668 TGGGCCAAGGGTCATTACACCGAGGGTGCTGAACTTGTCGACCAAGTTCT 595 GFU27303 rGGGCCAAGGGTCA3TACACTGAGGGTGCCGAACTTGTCGACCAGGTTCT 1192 EU860012 TGGG(JCAAGGGT(JACTACACTGAGGGTGCCGAGCTCGTCGACCAGGTCCT 638 AB273716 TGGGCCAAGGGTCACTACACCGAGGGAGCTGAGCTTGTCGACCAGGTTCT 889 DQ522522 GACCAGGTCCT 11 HM034845 TGGGCCAAGGGTCATTACACCGAGGGTGCCGAGCTTGTCGACAACGTCCT 868 EU926356 CGATGTCGTCCGCCGCGAGGCTGAGGGCTGTGACTGCCTCCAGGGTTTCC 7 2 4 EU926357 CGATGTCGTCCGCCGCGAGGCTGAGGGCTGTGACTGCCTCCAGGGTTTCC 7 20 EU926355 CGATGTCGTCCGCCGCGAGGCTGAGGGCTGTGACTGCCTTCAGGGTTTCC 697 HQ141666 CGATGTCGTCCGCCGTGAGGCCGAGGGCTGTGACTGCCTCCAGGGTTTCC 655 HQ141668 CGATGTCGTCCGCCGTGAGGCCGAGGGCTGTGACTGCCTCCAGGGTTTCC 64 5 GFU27303 CGACGTCGTCCGCCGTGAGGCTGAGGGCTGCGATTGCCTCCAGGGTTTCC 12 4 2 EU860012 CGACGTCGTCCGACGTGAGGCTGAGGGCTGTGACTGCCTCCAGGGTTTCC 68 8 AB273716 CGATGTCGTCCGTCGCGAGGCCGAGGGCTGCGACTGCCTCCAGGGCTTCC 939 DQ522522 CGATGTCGTCCGCCGCGAGGCTGAGGGCTGCGACTGCCTCCAGGGCTTCC 61 HM034845 CGATGTCGTCCGTCGTGAGGCTGAGGGCTGCGACTGCCTTCAGGGCTTCC 918 *** ******** ** ***** ******** ** ***** ***** **** 126 Appendix 2.4 (continued) EU926356 AGATCACCCACTCTCTGGGTGGTGGTACCGGTGCCGGTATGGGTACGCTG 7 7 4 EU926357 AGATCACCCACTCTCTTGGTGGTGGTACCGGTGCCGGTATGGGTACGCTG 7 7 0 EU926355 AGATCACCCACTCTCTGGGTGGTGGTACCGGTGCTGGTATGGGTACGCTG 7 4 7 HQ141666 AAATCACCCACTCTCTTGGTGGTGGTACCGGTGCCGGTATGGGTACCCTG 7 05 HQ141668 AAATCACCCACTCTCTTGGTGGTGGTACCGGCGCCGGTATGGGTACCCTG 695 GFU27303 AGATCACCCACTCTCTCGGTGGTGGTACCGGTGCCGGTATGGGTACTCTG 12 92 EU860012 AGATCACCCACTCCCTTGGTGGTGGTACCGGTGCCGGTATGGGTACTCTG 7 38 AB273716 AGATCACCCACTCTCTTGGTGGTGGTACCGGTGCCGGTATGGGTACCCTC 98 9 DQ522522 AGATCACCCACTCTCTGGGTGGTGGTACCGGTGCCGGTATGGGTACTCTG 111 HM034845 AGATCACCCACTCGCTCGGTGGTGGTACCGGTGCCGGTATGGGTACGCTG 968 * *********** ** ************** ** *********** ** EU926356 CTCATCTCCAAGATCCGTGAGGAGTTCCCCGACCGAATGATGGCCACCTT 82 4 EU926357 CTCATCTCCAAGATCCGTGAGGAGTTCCCCGACCGAATGATGGCCACCTT 820 EU926355 CTCATCTCCAAGATCCGTGAGGAATTCCCCGACCGAATGATGGCCACCTT 7 97 HQ141666 TTGATCTCCAAAATCCGTGAGGAGTTCCCCGACCGTATGATGGCAACTTT 7 55 HQ141668 TTGATCTCCAAGATCCGTGAGGAATTCCCCGACCGTATGATGGCAACTTT 7 4 5 GFU27303 CTCATTTCCAAGATCCGCGAGGAATTCCCTGACCGAATGATGGCCACCTT 134 2 EU860012 CTCATCTCCAAGATCCGCGAGGAGTTCCCCGACCGAATGATGGCCACCTT 7 88 AB273716 CTGATTTCCAAGATCCGTGAGGAGTTCCCCGACCGCATGATGGCCACCTT 1039 DQ522522 CTCATCTCCAAGATCCGCGAGGAGTTCCCCGACCGCATGATGGCCACCTT 161 HM034845 TTGATCTCCAAGATCCGTGAGGAGTTCCCCGACCGCATGATGGCCACCTT 1018 •k -k -k k ~k ~k -k -k -k -k k k ~k -k -k ~k 'k -k kr ~k ~k -k ~k -k -k kr ~k -k kr-k-kkr-kk-k'k -k ~k -k -k EU926356 CTCCGTCGTCCCCTCTCCCAAGGTCTCCGACACCGTTGTCGAGCCCTACA 87 4 EU926357 CTCCGTTGTCCCCTCCCCCAAGGTCTCCGACACCGTTGTCGAGCCCTACA 87 0 EU926355 CTCCGTTGTCCCCTCCCCCAAGGTCTCTGACACCGTTGTCGAGCCCTACA 8 4 7 HQ141666 CTCCGTCGTTCCTTCTCCCAAGGTCTCCGACACCGTTGTTGAGCCCTATA 8 05 HQ141668 CTCCGTCGTTCCTTCCCCCAAGGTCTCCGACACCGTTGTCGAGCCCTACA 7 95 GFU27303 CTCCGTCGTTCCCTCCCCCAAGGTCTCTGACACCGTCGTTGAGCCCTACA 1392 EU860012 CTCCGTCATGCCTTCTCCCAAGGTTTCCGACACCGTTGTTGAGCCCTACA 838 AB273716 CTCCGTCGTTCCCTCTCCCAAGGTTTCCGACACCGTCGTCGAGCCCTACA 108 9 DQ522522 CTCCGTTGTCCCCTCCCCCAAGGTTTCTGACACCGTTGTCGAGCCCTACA 211 HM034845 CTCCGTCGTCCCCTCTCCCAAGGTCTCCGACACCGTCGTCGAGCCCTACA 10 68 ****** * ** ** ******** ** ******** ** ******** * EU926356 ACGCCACCCTCTCCGTCCACCAGCTGGTCGAGAACTCTGACGAGACCTTC 924 EU926357 ACGCCACCCTCTCCGTCCACCAGCTGGTCGAGAACTCTGACGAGACCTTC 920 EU926355 ACGCCACCCTCTCCGTCCACCAGCTGGTCGAGAACTCCGACGAGACCTTC 8 97 HQ141666 ACGCCACCCTTTCCGTCCATCAGCTGGTCGAGAACTCTGACGAAACCTTC 855 HQ141668 ACGCCACCCTCTCCGTCCATCAATTGGTCGAGAACTCCGACGAAACTTTT 8 4 5 GFU27303 ATGCCACCCTCTCCGTCCACCAGCTGGTCGAGAACTCCGATGAGACCTTC 14 4 2 EU860012 ACGCCACCCTCTCCGTCCACCAGCTGGTCGAGAACTCTGATGAGACCTTC 888 AB273716 ACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCCGACGAGACCTTC 1139 DQ522522 ACGCCACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGACGAGACCTTC 2 61 HM034845 ACGCCACCCTCTCCGTCCACCAGCTGGTCGAGAACTCCGACGAGACCTTC 1118 * ***** ** ******** ** ************* * * * * * * * * 127 Appendix 2.4 (continued) EU926356 TGTATCGATAACGAGGCCCTCTACGACATCTGCATGCGTACCCTCAAGCT 97 4 EU926357 TGTATCGATAACGAGGCCCTCTACGACATCTGCATGCGCACCCTCAAGCT 97 0 EU926355 TGTATCGATAACGAGGCCCTCTACGACATCTGCATGCGCACTCTCAAGCT 94 7 HQ141666 TGTATCGACAATGAGGCCCTCTACGACATTTGCATGCGCACTCTCAAGCT 905 HQ141668 TGTATCGACAATGAGGCCCTCTACGACATTTGCATGCGCACCCTCAAGCT 8 95 GFU27303 TGTATCGATAACGAGGCCCTCTACGATATCTGCATGCGCACCCTGAAGCT 14 92 EU860012 TGTATCGACAACGAGGCTCTCTACGACATTTGCATGCGTACCCTCAAGCT 938 AB273716 TGCATTGACAACGAGGCTCTCTACGACATCTGCATGCGTACCCTCAAGCT 118 9 DQ522522 TGCATTGACAACGAGGCTCTCTACGACATCTGCATGCGCACCCTCAAGCT 311 HM034845 TGTATTGACAACGAGGCCCTCTACGACATCTGCATGCGTACCCTCAAGTT 1168 * * ** ** ** ***** ******** ** ******** ** ** *** * EU926356 GTCCAACCCCTCGTACGGCGACCTCAACTACCTCGTCTCCGCCGTCATGT 1024 EU926357 GTCCAACCCCTCGTACGGCGACCTCAACTACCTCGTCTCCGCCGTCATGT 1020 EU926355 GTCCAACCCCTCTTACGGCGATCTTAACTACCTCGTCTCTGCCGTCATGT 9 97 HQ141666 GTCCAACCCCTCTTACGGCGACCTGAACTACCTTGTCTCCGCCGTCATGT 955 HQ141668 GTCCAACCCCTCTTACGGCGACCTGAACTACCTTGTCTCTGCCGTCATGT 94 5 GFU27303 GTCCAACCCCTCCTACGGTGACCTCAACTACCTCGTTTCTGCTGTTATGT 154 2 EU860012 GTCCAGCCCCTCTTACGGCGACTTGAACTACCTCGTCTCCGCCGTCATGT 98 8 AB273716 CTCCAACCCCTCTTACGGCGACCTGAACCACCTCGTCTCCGCCGTCATGT 123 9 DQ522522 GTCCAACCCCTCTTACGGTGACCTGAACTACCTCGTCTCCGCCGTCATGT 361 HM034845 GTCCAACCCCTCGTATGGCGACCTGAACCACCTTGTCTCCGCCGTCATGT 1218 **** ****** ** ** ** *** **** ** ** ** ** **** EU926356 CCGGTGTCACCACCTGCCTTCGATTCCCCGGTCAGCTGAACTCTGACCTC 107 4 EU926357 CCGGTGTCACCACCTGCCTTCGATTCCCTGGTCAGCTGAACTCTGACCTC 1070 EU926355 CTGGCGTCACCACCTGCCTCCGATTCCCCGGTCAGCTGAACTCTGATCTC 104 7 HQ141666 CCGGCGTTACGACCTGTCTCCGTTTCCCCGGTCAGCTGAACTCTGACCTC 1005 HQ141668 CCGGCGTCACTACCTGTCTCCGTTTCCCCGGTCAGCTGAACTCTGACCTC 9 95 GFU27303 CCGGTGTCACCACCTGTCTCCGTTTCCCCGGTCAGCTGAACTCCGATCTC 1592 EU860012 CAGGTGTCACCACCTGTCTCCGATTCCCTGGTCAGCTTAACTCTGATCTC 1038 AB273716 CCGGTGTCACCACCTGCCTCCGTTTCCCCGGTCAGCTGAACTCTGACCTG 12 8 9 DQ522522 CTGGTGTCACCACCTGCCTGCGATTCCCCGGTCAGCTCAACTCTGATCTC 411 HM034845 CTGGCGTCACCACCTGTCTGCGTTTCCCCGGTCAGCTGAACTCTGATCTG 12 68 * ** ** ** ***** ** ** ***** ******** ***** ** ** EU926356 CGAAAGCTCGCCGTCAACATGGTTCCCTTCCCTCGTCTGCACTTCTTCAT 1124 EU926357 CGAAAGCTCGCCGTCAACATGGTTCCCTTCCCTCGTCTGCACTTCTTCAT 1120 EU926355 CGAAAGCTCGCCGTCAACATGGTTCCCTTCCCTCGTCTGCACTTCTTCAT 10 97 HQ141666 CGAAAGCTCGCCGTGAACATGGTGCCTTTCCCCCGTCTGCACTTCTTCAT 1055 HQ141668 CGAAAGCTCGCCGTCAACATGGTGCCCTTCCCCCGTCTGCACTTCTTCAT 104 5 GFU27303 CGAAAGCTCGCCGTCAACATGGTGCCTTTCCCTCGTCTACACTTCTTCAT 1642 EU860012 CGAAAGCTTGCCGTCAACATGGTTCCTTTCCCTCGTCTGCACTTCTTCAT 108 8 AB273716 CGCAAGCTCGCCGTCAACATGGTTCCTTTCCCCCGTCTCCACTTCTTCAT 1339 DQ522522 CGAAAGCTGGCCGTCAACATGGTTCCTTTCCCTCGTCTGCACTTCTTCAT 4 61 HM034845 CGCAAGTTGGCTGTCAACATGGTGCCCTTCCCCCGTCTCCACTTCTTCAT 1318 * * * * * ** ** ******** ** ***** ***** *********** 128 Appendix 2 (continued) EU926356 GGTCGGCTTCGCCCCCCTGACCAGCCGTGGTGCCCACTCTTTCCGTGCTG 117 4 EU926357 GGTCGGCTTCGCCCCCCTGACCAGCCGTGGTGCCCACTCTTTCCGTGCTG 117 0 EU926355 GGTCGGCTTTGCCCCCCTGACCAGCCGTGGTGCCCACTCTTTCCGCGCTG 114 7 HQ141666 GGTCGGATTCGCTCCTTTGACCAGCCGTGGTGCTCACTCTTTCCGCGCTG 1105 HQ141668 GGTCGGATTCGCTCCCTTGACCAGCCGTGGTGCTCACTCTTTCCGCGCTG 10 95 GFU27303 GGTTGGATTTGCTCCTCTGACCAGCCGTGGTGCTCACTCTTTCCGCGCTG 1692 EU860012 GGTCGGCTTCGCCCCCTTGACCAGCCGTGGTGCCCACTCCTTCCGCGCTG 1138 AB273716 GGTCGGCTTCGCTCCCCTGACCAGCCGTGGCGCCCACTCCTTCCGCGCTG 138 9 DQ522522 GGTCGGCTTCGCCCCCCTGACCAGCCGTGGTGCCTACTCCTTCCGCGCTG 511 HM034845 GGTCGGCTTTGCTCCTTTGACCAGCCGTGGCGCCGGTGCTTTCCGCGCTG 1368 *** ** ** * * ** ************* ** * * * * * * * * * EU926356 TCAGCGTTCCTGAGCTCACCCAGCAGATGTTCGACCCCAAGAACATGATG 1224 EU926357 TCAGCGTTCCTGAGCTCACCCAGCAGATGTTCGACCCCAAGAACATGATG 122 0 EU926355 TCAGCGTTCCTGAGCTCACCCAGCAGATGTTCGATCCCAAGAACATGATG 1197 HQ141666 TCAGCGTTCCTGAGCTGACCCAGCAAATGTTCGACCCCAAGAACATGATG 1155 HQ141668 TCAGCGTTCCTGAGCTCACCCAGCAGATGTTCGACCCCAAGAACATGATG 114 5 GFU27303 TCAGCGTTCCTGAGTTGACCCAACAGATGTTCGACCCCAAGAACATGATG 17 42 EU860012 TCAGCGTTCCCGAGTTGACTCAGCAGATGTTCGACCCCAAGAACATGATG 118 8 AB273716 TCAGCGTTCCCGAGCTCACCCAGCAGATGTTCGACCCCAAGAACATGATG 14 3 9 DQ522522 TCAGCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATG 561 HM034845 TCACCGTTCCTGAGTTGACCCAGCAGATGTTTGACCCCAAGAACATGATG 1418 * * ****** * ** ** ** ** ***** ** *************** EU926356 GCTGCTTCTGACTTCCGCAACGGTCGCTACCTGACCTGCTGTGCCATCTT 127 4 EU926357 GCTGCTTCTGACTTCCGCAACGGTCGCTACCTGACCTGTTGTGCTATCTT 127 0 EU926355 GCTGCTTCTGACTTCCGCAACGGTCGCTACCTGACCTGCTCTACCATCTT 12 4 7 HQ141666 GCTGCCTCCGACTTCCGCAACGGTCGTTACCTGACCTGCTCTGCCATCTT 1205 HQ141668 GCTGCCTCTGACTTCCGCAACGGTCGTTACCTGACCTGCTCTGCCATCTT 1195 GFU27303 GCTGCTTCGGACTTCCGCAATGGTCGCTACCTGACCTGCTCAGCCATTTT 17 92 EU860012 GCTGCTTCCGACTTCCGAAACGGTCGTTACCTGACCTGCTCTGCCATCTT 1238 AB273716 GCCGCCTCTGACTTCCGCAACGGTCGTTACCTGACCTGCTCTGCCATCTT 14 8 9 DQ522522 GCTGCTTCCGACTTCCGCAACGGTCGCTACCTGACCTGCTGCGCCATCTT 611 HM034845 GCTGCTTCTGACTTCCGCAACGGTCGCTACCTCACATGCTCTGCCATCTT 14 68 ** ** ** ******** ** ***** ***** ** ** * * * * * * EU926356 GTGAG TCTATCCATGAACTTACCTGCCAAGAGT TGACTGCTAAC 1318 EU926357 GTGAG TCTATCCATGAATTTACCTGCCAAGAGT TGACTGCTAAC 1314 EU926355 GTGAG T-TATCC-TGAGATTATCCGCTAGGAAA TAATCGCTAAC 128 9 HQ141666 HQ141668 GFU27303 GTGAG TGAACCCGATTTGCGCATGGAAATTATT TACTGACTTTG 18 36 EU860012 GTGAG TATTCCTTGAACCAAATTGGCTGAAACT TGCTTGCTAAC 1282 AB273716 GTAAG TTGACTACAATGCCCCTAGAGTGCGAATGAATGCTAACTTTG 153 6 DQ522522 GTGAG 616 HM034845 GTAAGCTATATGCTTGTATCCACAGACCAGACAACCTAATGCTGACTCAT 1518 129 Appendix 2.4 (continued) EU926356 TATCTTGTAGCCGTGGCCGTGTCGCCATGAAGGAGGTCGAGGACCAGATG 1368 EU926357 TATCTTGTAGCCGTGGCCGTGTCGCCATGAAGGAGGTCGAGGACCAGATG 1364 EU92 6355 AATCCTACAGCCGTGGCCGTGTCGCCATGAAGGAGGTCGAGGACCAGATG 1339 HQ141666 CCGTGGCCGTGTTGCCATGAAGGAGGTTGAGGACCAGATG 1245 HQ141668 CCGTGGCCGTGTCGCCATGAAGGAGGTTGAGGACCAGATG 1235 GFU27303 AA CAGCCGTGGCCGTGTCGCTATGAAGGAGGTCGAGGATCAGATG 1881 EU860012 AAAATCATAGCCGTGGTCGTGTCGCCATGAAGGAGGTCGAGGACCAGATG 1332 AB273716 TTGTTCCCAGCCGTGGTAAGGTCGCCATGAAGGATGTCGAGGACCAGATG 1586 DQ522522 HM034845 TCTTCTCTAGCCGTGGCAAGGTCTCTATGAAGGAGGTCGAAGACCAGATG 1568 EU926356 CGCAACATCCAGAACAAGAACTCTTCTTACTTCGTTGAG 1407 EU926357 CGCAACATCCAGAACAAGAACTCTTCTTACTTCGTTGAG 1403 EU926355 CGCATGATCCAGAACAAGAACTCTTCCTACTTCGTCGAGTG 1380 HQ141666 CGCAACGTC 1254 HQ141668 CGCAACGTC 1244 GFU27303 CGCAACGT XAGAACAAGAACTCTTCTTA^TTCGTTGAATGGATTCCCAA 1931 EU860012 CGCAACGTCCA^AA^AAGAACTCCTCTTACTTCGTCGAGTGGATTCCCAA 1382 AB273716 CGCAATGTCCAGAACAAGAACTCGTCCTACTTCGTCGAGTGGATTCCCAA 1636 DQ522522 HM034845 CGCAACGTCCAGAACAAGAATTCATCCTACTTCGTCGAGTGGATTCCCAA 1618 130 Appendix 2.5 BLAST result of a partial beta-tubulin sequence of Pseudonectria rousseliana (Isolate 10113) against the NCBI database showing top 10 matches and top two alignments. >Pseudonectria rousseliana sequence amplified with btub_F750 and btub_R1400. CCGTCGCGAGGCTGAGGGCTGCGACTGCCTCCAGGGCTTCCAGATCACCCACTCTCTGGG TGGTGGTACCGGTGCCGGTATGGGTACTCTGCTCATCTCCAAGATCCGCGAGGAGTTCCC CGACCGCATGATGGCCACCTTCTCCGTTGTCCCCTCTCCCAAGGTCTCCGACACCGTTGT CGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCCGACCAGACCTT CTGCATTGACAACGAGGCTCTCTACGACATCTGCATGCGCACCCTCAAGCTGTCCAACCC CTCTTACGGTGACCTCAACTACCTGGTCTCCGCCGTCATGTCCGGTGTCACCACCTGCCT GCGTTTCCCCGGTCAGCTCAACTCTGATCTCCGAAAGCTCGCCGTCAACATGGTTCCTTT CCCCCGTCTGCACTTCTTCATGGTCGGCTTCGCCCCCCTGACCAGCCGTGGTGCCCACTC TTTCCGCGCTGTCAGCGTTCCTGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGAT GGCTGCTTCCGACTTCCGCAACGGTCGCTACCTGACCTGCTCCGCCATTTTGTGAGTAAC CCTGTTCGTGCTGATGTGCCTGTACATGATGCTAACGCAATCATAGCCGTGGCCGTGTTG TCATGAAGGAGGTCGAGGACCAGATGCGCATGGTCCAGACAGAAAC Accession Description Max Total Query E Max score score coverage value ident DQ522522 Pseudonectria rousseliana 1002 1002 84% 0.0 96% beta-tubulin gene, strain CBS 114049 EU926356 Fusarium sp. beta-tubulin gene, 957 957 97% 0.0 91% CBS 110312 EU860032 Fusarium merismoides var. violaceum 942 942 99% 0.0 91% beta-tubulin gene, strain F-167 EU926355 Fusarium domesticum beta-tubulin 939 939 99% 0.0 91% gene, strain CBS 102407 EU926354 Fusarium domesticum beta-tubulin 939 939 99% 0.0 91% gene, strain CBS 244.82 EU926353 Fusarium domesticum beta-tubulin 939 939 99% 0.0 91% gene, strain CBS 116517 EU926357 Fusarium lunatum beta-tubulin gene, 935 935 97% 0.0 91% strain CBS 632.76 AY780137 Fusarium ambrosium beta-tubulin 935 935 99% 0.0 91% gene, strain SMH1999 EU860012 Fusarium merismoides var. violaceum 924 924 99% 0.0 90% strain F-241,347 beta-tubulin gene, partial sequence AB553614 Fusarium solani beta-tubulin gene, 917 917 99% 0.0 90% YS31a 131 Appendix 2.5 (continued) >gb|DQ522522.1| Pseudonectria rousseliana strain CBS 114049 beta-tubulin gene, partial cds Length=616 Score = 1002 bits (542), Expect =0.0 Identities = 578/596 (97%), Gaps = 0/596 (0%) Strand=Plus/Plus Query 1 CCGTCGCGAGGCTGAGGGCTGCGACTGCCTCCAGGGCTTCCAGATCACCCACTCTCTGGG 60 III II I I I I I I I I II I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I II I II Sbjct 21 CCGCCGCGAGGCTGAGGGCTGCGACTGCCTCCAGGGCTTCCAGATCACCCACTCTCTGGG 80 Query 61 TGGTGGTACCGGTGCCGGTATGGGTACTCTGCTCATCTCCAAGATCCGCGAGGAGTTCCC 120 I I I I I I I I I I I I I I I I I I I I I I I I II I I I I I I I I I I II I I I I I I I I I I I I I I I I I I I I I I Sbjct 81 TGGTGGTACCGGTGCCGGTATGGGTACTCTGCTCATCTCCAAGATCCGCGAGGAGTTCCC 14 0 Query 121 CGACCGCATGATGGCCACCTTCTCCGTTGTCCCCTCTCCCAAGGTCTCCGACACCGTTGT 180 I I I I I I II I I I I I I I I I I I II I I I I I I I II I II I I I I I I I I I I I II I I II I I I I I II Sbjct 141 CGACCGCATGATGGCCACCTTCTCCGTTGTCCCCTCCCCCAAGGTTTCTGACACCGTTGT 200 Query 181 CGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCCGACCAGACCTT 240 I I I I I I I I I I I I I I I I I I II I I I I I I I I I I I II I I I I I M I I I I I I I I I I I I I I II I Sbjct 201 CGAGCCCTACAACGCCACCCTTTCCGTCCACCAGCTGGTCGAGAACTCCGACGAGACCTT 2 60 Query 241 CTGCATTGACAACGAGGCTCTCTACGACATCTGCATGCGCACCCTCAAGCTGTCCAACCC 300 I I I I I I I I I I I II I I I I I I II I I I I II I I I I I I I I I I I I I I I I II I I I I I I II I I I I M I Sbjct 2 61 CTGCATTGACAACGAGGCTCTCTACGACATCTGCATGCGCACCCTCAAGCTGTCCAACCC 320 Query 301 CTCTTACGGTGACCTCAACTACCTGGTCTCCGCCGTCATGTCCGGTGTCACCACCTGCCT 360 I I I I II I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I II I I I I I Sbjct 321 CTCTTACGGTGACCTGAACTACCTCGTCTCCGCCGTCATGTCTGGTGTCACCACCTGCCT 380 Query 361 GCGTTTCCCCGGTCAGCTCAACTCTGATCTCCGAAAGCTCGCCGTCAACATGGTTCCTTT 420 III I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I II I I I I I I I I I I I I I II I I I I I I I I Sbjct 381 GCGATTCCCCGGTCAGCTCAACTCTGATCTCCGAAAGCTGGCCGTCAACATGGTTCCTTT 440 Query 421 CCCCCGTCTGCACTTCTTCATGGTCGGCTTCGCCCCCCTGACCAGCCGTGGTGCCCACTC 480 III I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I Sbjct 441 CCCTCGTCTGCACTTCTTCATGGTCGGCTTCGCCCCCCTGACCAGCCGTGGTGCCTACTC 500 Query 481 TTTCCGCGCTGTCAGCGTTCCTGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGAT 540 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I II I I I I II I I I I I I I I I I I I I I I I I I Sbjct 5 01 CTTCCGCGCTGTCAGCGTTCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGAT 560 Query 541 GGCTGCTTCCGACTTCCGCAACGGTCGCTACCTGACCTGCTCCGCCATTTTGTGAG 596 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I MINI I I I I I I I Sbjct 561 GGCTGCTTCCGACTTCCGCAACGGTCGCTACCTGACCTGCTGCGCCATCTTGTGAG 616 132 Appendix 2.5 (continued) >gb|EU926356.1| Fusarium sp. CBS 110312 beta-tubulin gene, partial cds Length=1407 Score = 957 bits (518), Expect =0.0 Identities = 639/696 (92%), Gaps = 13/696 (2%) Strand=Plus/Plus Query 1 CCGTCGCGAGGCTGAGGGCTGCGACTGCCTCCAGGGCTTCCAGATCACCCACTCTCTGGG 60 III I II I I I I I I I I I I I I I I I I II I I I I II I I I I I I I I I I I I I I I I I I I I I I I II I I Sbjct 684 CCGCCGCGAGGCTGAGGGCTGTGACTGCCTCCAGGGTTTCCAGATCACCCACTCTCTGGG 7 4 3 Query 61 TGGTGGTACCGGTGCCGGTATGGGTACTCTGCTCATCTCCAAGATCCGCGAGGAGTTCCC 120 I I I I I I I I I I I I I I I I I I I I I II I I I I I I II I I I I I I I I I I I I I I I I I I I II I II I I I Sbjct 744 TGGTGGTACCGGTGCCGGTATGGGTACGCTGCTCATCTCCAAGATCCGTGAGGAGTTCCC 803 Query 121 CGACCGCATGATGGCCACCTTCTCCGTTGTCCCCTCTCCCAAGGTCTCCGACACCGTTGT 180 I I I I I I II I I I I I I I I I I I I II II I I I I I I I I I I I I I I I I I I I II I I I I I I I I I I I II Sbjct 804 CGACCGAATGATGGCCACCTTCTCCGTCGTCCCCTCTCCCAAGGTCTCCGACACCGTTGT 8 63 Query 181 CGAGCCCTACAACGCCACTCTCTCCGTCCACCAGCTGGTCGAGAACTCCGACCAGACCTT 24 0 I I I I I I I I I I I II I I I I I I II I I I I I I I I I I I I I I I I I I II II I I I I III I I I I I I I Sbjct 864 CGAGCCCTACAACGCCACCCTCTCCGTCCACCAGCTGGTCGAGAACTCTGACGAGACCTT 923 Query 241 CTGCATTGACAACGAGGCTCTCTACGACATCTGCATGCGCACCCTCAAGCTGTCCAACCC 300 Ml II II II I I I I I I I I I II I I I I I I I I I I I I I II I I I I I I I II I I I II I II I II Sbjct 924 CTGTATCGATAACGAGGCCCTCTACGACATCTGCATGCGTACCCTCAAGCTGTCCAACCC 983 Query 301 CTCTTACGGTGACCTCAACTACCTGGTCTCCGCCGTCATGTCCGGTGTCACCACCTGCCT 360 III II I I I I I I I I I I I I I I II I I I II I I I I I I I II I I I I I I II I I I I I I I I I I I I I I Sbjct 984 CTCGTACGGCGACCTCAACTACCTCGTCTCCGCCGTCATGTCCGGTGTCACCACCTGCCT 104 3 Query 361 GCGTTTCCCCGGTCAGCTCAACTCTGATCTCCGAAAGCTCGCCGTCAACATGGTTCCTTT 420 II I I I I I I I I I I I I I I II I I II I I I II I I I I I I I I I I I I II I I I I I I I I I II I II Sbjct 1044 TCGATTCCCCGGTCAGCTGAACTCTGACCTCCGAAAGCTCGCCGTCAACATGGTTCCCTT 1103 Query 421 CCCCCGTCTGCACTTCTTCATGGTCGGCTTCGCCCCCCTGACCAGCCGTGGTGCCCACTC 4 80 III I I I I I I I II I II I I I I I I I I I I I I I I I I I I I I I I I I I I II I I I I I I I I I I I I I I I I Sbjct 1104 CCCTCGTCTGCACTTCTTCATGGTCGGCTTCGCCCCCCTGACCAGCCGTGGTGCCCACTC 1163 Query 481 TTTCCGCGCTGTCAGCGTTCCTGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGAT 54 0 II I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I II I I I I I I II I I I I I I I I I I II I Sbjct 1164 TTTCCGTGCTGTCAGCGTTCCTGAGCTCACCCAGCAGATGTTCGACCCCAAGAACATGAT 1223 Query 541 GGCTGCTTCCGACTTCCGCAACGGTCGCTACCTGACCTGCTCCGCCATTTTGTGAGTA-A 5 9 9 I I I I I I I I I I I I I I I I I I I I II I I I I I I II I I I I I I I I I I I I I I I II I I I I I I I Sbjct 1224 GGCTGCTTCTGACTTCCGCAACGGTCGCTACCTGACCTGCTGTGCCATCTTGTGAGTCTA 1283 Query 600 CCC-TGTTCGTGCTGATGTGCCT-GTACATGA-TGCTAACGCAATCAT—AGCCGTGGCC 654 II I I II II I I II II I I I I I I I I I I I I I I I I I I I I I I I I Sbjct 1284 TCCATGAAC-T—T-ACCTGCCAAG-AGTTGACTGCTAACT-A-TCTTGTAGCCGTGGCC 1336 Query 655 GTGTTGTCATGAAGGAGGTCGAGGACCAGATGCGCA 690 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I Sbjct 1337 GTGTCGCCATGAAGGAGGTCGAGGACCAGATGCGCA 1372 133 Appendix 3.1 An example of SAS statements used to analyze mycelial growth data of Volutella buxi. data first; input IDS repl rep2 rep3 rep4 rep5; growth = repl; rep = 1; output; growth = rep2; rep = 2; output; growth = rep3; rep = 3; output; growth = rep4; rep = 4; output; growth = rep5; rep = 5; output; cards; 8125 40 40 134 42 42 8126 45 40 41 39 45 8127 47 40 40 40 45 run; proc glm; class growth ID; model growth=ID; means ID/LSD lines; contrast 'Sheridan vs St.' ID 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 -5 -5 -5 -5 -5 -5 -5 -5 -5 -5 -5-5; run; 134 Appendix 3.2 A total of 148 isolates of Volutella buxi were collected from different locations and boxwood cultivars in this study. Among them, 32 were chosen for temperature and fungicide test, and 86 which showed polymorphic bands with primers (AG)8 and (CAQ5 were chosen for genetic diversity analysis. Isolates which were chosen for each experiment are indicated. Temperature and ISSR Date ID location Boxwood cultivars fungicide test 09/01 08116 Georgetown Green Mountain X 09/01 08125 Georgetown Green Mountain X X 09/01 08117 Georgetown Green Mountain 09/01 08118 Georgetown Green Mountain 09/01 08126 Georgetown Green Mountain X X 09/01 08127 Georgetown Green Mountain X 09/02 08128 Georgetown Green Velvet X X 09/02 08130 Georgetown Green Mound X X 09/02 08131 Georgetown Green Velvet X X 09/02 08133 Georgetown Green Mound X X 09/02 08137 Georgetown Green Velvet X X 09/02 08141 Georgetown Green Velvet X X 09/02 08147 Georgetown Green Mound X X 09/02 08129 Georgetown Green Velvet X 09/02 08132 Georgetown Green Mound X 09/02 08134 Georgetown Green Mound X 09/02 08135 Georgetown Green Mound X 09/02 08136 Georgetown Green Mound X 09/02 08138 Georgetown Green Velvet X 09/02 08139 Georgetown Green Velvet X 09/02 08140 Georgetown Green Velvet X 09/02 08142 Georgetown Green Velvet 09/02 08143 Georgetown Green Velvet X 09/02 08146 Georgetown Green Velvet 09/05 09004 St. Catherine Green Velvet X X 09/05 09007 St. Catherine Green Velvet X X 09/05 09012 St. Catherine Green Mountain X X 09/05 09006 St. Catherine Green Velvet X 09/05 09003 St. Catherine Green Velvet X 09/05 09005 St. Catherine Green Velvet X 09/05 09008 St. Catherine Green Velvet X 09/05 09009 St. Catherine Green Mountain X 09/05 09010 St. Catherine Green Mountain X 09/05 09011 St. Catherine Green Mountain X 09/05 09013 St. Catherine Green Mountain X 09/05 09014 St. Catherine Green Mountain X 09/08 09039 Georgetown Green Velvet X 09/08 09041 Georgetown Green Velvet X 135 Appendix 3.2 (continued) Temperature and ISSR Date ID location Boxwood cultivars fungicide test 09/08 09042 Georgetown Green Velvet X 09/08 09048 Georgetown Green Velvet X 09/08 09049 Georgetown Green Velvet X 09/08 09050 Georgetown Green Velvet X 09/08 09051 Georgetown Green Velvet X 09/08 09052 Georgetown Green Velvet X 09/08 09055 Georgetown Green Velvet X 09/08 09056 Georgetown Green Velvet X 09/08 09059 Georgetown Green Velvet X 09/08 09062 Georgetown Green Velvet X 09/08 09064 Georgetown Green Velvet X 09/08 09065 Georgetown Green Velvet X 09/08 09066 Georgetown Green Velvet X 09/08 09067 Georgetown Green Velvet X 09/08 09068 Georgetown Green Velvet X 09/08 09069 Georgetown Green Velvet X 09/08 09070 Georgetown Green Velvet X 09/08 09071 Georgetown Green Velvet X 09/08 09072 Georgetown Green Velvet X 09/08 09073 Georgetown Green Velvet X 09/08 09074 Georgetown Green Velvet X 09/08 09075 Georgetown Green Velvet X 09/08 09076 Georgetown Green Velvet X 09/08 09077 Georgetown Green Velvet X 09/08 09078 Georgetown Green Velvet X 09/08 09079 Georgetown Green Velvet X 09/08 09080 Georgetown Green Velvet X 09/08 09081 Georgetown Green Velvet X 09/08 09082 Georgetown Green Mountain X 09/08 09091 Georgetown Green Mountain X 09/08 09092 Georgetown Green Mountain X 09/08 09093 Georgetown Green Mountain X 09/08 09096 Georgetown Green Mountain X 09/08 09097 Georgetown Green Mountain X 09/08 09099 Georgetown Green Mountain X 09/08 09100 Georgetown Green Mountain X 09/08 09102 Georgetown Green Mountain X 09/08 09103 Georgetown Green Mountain X 09/08 09104 Georgetown Green Mountain X 09/08 09105 Georgetown Green Mountain X 09/08 09106 Georgetown Green Mountain X 09/08 09108 Georgetown Green Mountain 09/08 09109 Georgetown Green Mountain X 136 Appendix 3.2 (continued) Temperature and ISSR Date ID location Boxwood cultivars fungicide test 09/08 09110 Georgetown Green Mountain 09/08 09111 Georgetown Green Mountain 09/08 09112 Georgetown Green Mountain 09/08 09113 Georgetown Green Mountain 09/08 09083 Georgetown Green Mountain 09/08 09086 Georgetown Green Mountain 09/08 09088 Georgetown Green Mountain 09/08 09089 Georgetown Green Mountain 09/08 09090 Georgetown Green Mountain 09/08 09094 Georgetown Green Mountain 09/08 09095 Georgetown Green Mountain 09/08 09037 Georgetown Green Velvet 09/08 09038 Georgetown Green Velvet 09/08 09040 Georgetown Green Velvet 09/08 09043 Georgetown Green Velvet 09/08 09044 Georgetown Green Velvet 09/08 09045 Georgetown Green Velvet 09/08 09046 Georgetown Green Velvet 09/08 09047 Georgetown Green Velvet 09/08 09053 Georgetown Green Velvet 09/08 09054 Georgetown Green Velvet 09/08 09057 Georgetown Green Velvet 09/08 09058 Georgetown Green Velvet 09/08 09060 Georgetown Green Velvet 09/08 09061 Georgetown Green Velvet 09/08 09063 Georgetown Green Velvet 09/08 09084 Georgetown Green Mountain 09/08 09085 Georgetown Green Mountain 09/08 09087 Georgetown Green Mountain 09/08 09098 Georgetown Green Mountain 09/08 09101 Georgetown Green Mountain 09/08 09107 Georgetown Green Mountain 10/08 10108 St. Catherines Green Velvet X 10/08 10109 St. Catherines Green Velvet 10/08 10113 B.C. Green Velvet X 10/08 10114 Georgetown Green Velvet X 10/08 10116 B.C. Chicagoland Green X 10/08 10117 B.C. Chicagoland Green X 10/08 10120 B.C. Chicagoland Green X 10/08 10122 B.C. Chicagoland Green X 10/08 10123 B.C. Chicagoland Green X 10/08 10126 B.C. Chicagoland Green X 10/08 10127 B.C. Chicagoland Green X 137 Appendix 3.2 (continued) Temperature and ISSR Date ID location Boxwood cultivars fungicide test 10/08 10128 B.C. Chicagoland Green X 10/08 10129 B.C. Chicagoland Green X 10/08 10130 B.C. Chicagoland Green X 10/08 10132 B.C. Green Beauty X 10/08 10133 B.C. Green Beauty X 10/08 10134 B.C. Green Beauty X 10/08 10135 B.C. Green Beauty X 10/08 10136 B.C. Green Beauty X 10/08 10137 B.C. Green Beauty X 10/08 10138 B.C. Green Beauty X 10/08 10139 B.C. Green Beauty X 10/08 10140 B.C. Green Velvet X 10/08 10141 B.C. Green Velvet X 10/08 10142 B.C. Green Velvet X 10/08 10143 B.C. Green Velvet X 10/08 10144 B.C. Green Velvet X 10/08 10145 St. Catherines Green Velvet X 10/08 10146 St. Catherines Green Velvet X 10/08 10147 St. Catherines Green Velvet X 10/08 10118 B.C. Chicagoland Green 10/08 10121 B.C. Chicagoland Green 10/08 10131 B.C. Chicagoland Green 10/08 10110 St. Catherines Green Velvet 10/08 10111 St. Catherines Green Velvet 10/08 10112 St. Catherines Green Velvet 10/08 10119 B.C. Chicagoland Green 10/08 10124 B.C. Chicagoland Green 10/08 10125 B.C. Chicagoland Green 138 Appendix 4.1 An example of SAS statements used to calculate EC50 values of benomyl. data temp; input isolate$ cone hour96 hour 144; diam= hour 144 - hour96 ; output; cards; 08133 0.1 18 40 08133 0.1 18 40 run; data temp; set; * the command SET tells SAS to bring in the last data set which was * named by the DATA command. The default set (when no set is * specified) is the most recent data set. SET names can be specified.; number = 1; if cone = 0 then delete; * get rid of the 0 ppm values since they're in the denominator calculations for response = inhibition. I've also run the job including the 0 ppm values (with transform lconc=logl0(conc+.0001) and found the results to be the same; lconc=log 10(conc); * take the log of concentration, note that if the 0 values were still in the data set, one should add the next nonzero value e.g. 0.0001 so that one doesn't have problems with log(0); * the divisor of radmean was from the 0 ppm value for each isolate; * this following part of the SAS program is stored in a spreadsheet so that it can be changed easily to replace the isolate names and the growth rate on unamended PDA which is the denominator for radmean; if isolate = "08133" then response = l-(diam/14.3); if isolate = "08141" then response = l-(diam/16.3); if isolate = "08143" then response = l-(diam/16); if response <= 0 then response = 0; * this resets all stimulated (non inhibitory) responses to 0; run; proc sort; by isolate ; run; proc probit loglO; by isolate; model response/number=conc /lackfit inverseel itprint; run; 139 Appendix 4.2 An example of SAS statement used to analyze the disease rating in fungicide tests on whole plants at 25 °C. data first; options pagesize=150 linesize=70; * linesize is how many columns, and pagesize is how many lines on one page; input trt $ numl percentage 1 num2 percentage2 num3 percentage3; rating=(numl!|spercentagel)/100; time = "pre "; output; rating=(num2*percentage2)/100; time = "postl"; output; rating=(num3*percentage3)/100; time = "post2"; output; cards; untrt 0 0 0 0 0 0 untrt 0 0 0 0 0 0 untrt 0 0 0 0 0 0 untrt 0 0 0 0 0 0 untrt 0 0 0 0 0 0 untrt 0 0 0 0 0 0 run; data temp; set; * data temp and then set allows you to manipulate the variables; trmt = trt||time; run; proc glm; class trmt; model rating=trmt; means trmt/LSD lines; run; 140