DOCSLIB.ORG

Physiology and Molecular Characterization of Metabolism Related Mouse Models for Bone Disease

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Physiology and Molecular Characterization of Metabolism Related Mouse Models for Bone Disease TECHNISCHE UNIVERSITÄT MÜNCHEN Fakultät Wissenschaftszentrum Weihenstephan für Ernährung, Landnutzung und Umwelt Lehrstuhl für Experimentelle Genetik Physiology and molecular characterization of metabolism related mouse models for bone disease Shen Chi Vollständiger Abdruck der von der Fakultät Wissenschaftszentrum Weihenstephan für Ernährung, Landnutzung und Umwelt der Technischen Universität München zur Erlangung des akademischen Grades eines Doktors der Naturwissenschaften genehmigten Dissertation. Vorsitzender: Univ.-Prof. Dr. W. Wurst Prüfer der Dissertation: 1. Univ.-Prof. Dr. M. Hrabé de Angelis 2. apl. Prof. Dr. J. Adamski Die Dissertation wurde am 16.03.2015 bei der Technischen Universität München eingereicht und durch die Fakultät Wissenschaftszentrum Weihenstephan für Ernährung, Landnutzung und Umwelt am 29.07.2015 angenommen. I. Table of contents I. TABLE OF CONTENTS .............................................................................................................. I II. FIGURES AND TABLES ........................................................................................................... IV III. ABBREVIATIONS ................................................................................................................ VII IV. ACKNOWLEDGEMENTS .................................................................................................. XII V. AFFIRMATION ......................................................................................................................... XII 1. SUMMARY/ZUSAMMENFASSUNG .................................................................................... 1 2. INTRODUCTION .......................................................................................................................... 5 2.1 Skeletal development ............................................................................................................... 5 2.1.1 Skeletal system and bone .................................................................................................. 5 2.1.2 Bone function ...................................................................................................................... 6 2.1.3 Bone development.............................................................................................................. 6 2.1.4 Bone cells ............................................................................................................................. 7 2.1.5 Bone modeling and homeostasis ...................................................................................... 8 2.1.6 Tooth enamel and amelogenesis imperfecta (AI) .......................................................... 9 2.2 Adipose tissue and energy metabolism ............................................................................... 11 2.2.1 Adipose tissue .................................................................................................................... 11 2.2.2 Classification of adipose tissue ....................................................................................... 11 2.2.3 Development of adipocytes ............................................................................................. 12 2.2.4 Transcriptional regulation of adipocyte differentiation .............................................. 13 2.2.5 Adipose tissue and energy metabolism ......................................................................... 13 2.2.6 Adipose tissue and metabolic diseases .......................................................................... 15 2.3 The Satb2V234LMdha mouse model .......................................................................................... 17 2.4 The Dll1T720A mouse model .................................................................................................... 19 2.5 Thesis outline ........................................................................................................................... 20 3. MATERIALS AND METHODS ................................................................................................ 21 3.1 Materials ................................................................................................................................... 21 3.1.1 Chemicals and buffers ...................................................................................................... 21 I 3.1.2 Primers and antibodies .................................................................................................... 24 3.1.3 C3H inbred mouse strains ................................................................................................ 26 3.2 Methods .................................................................................................................................... 27 3.2.1 Animal housing and caretaking ....................................................................................... 27 3.2.2 Molecular methods ........................................................................................................... 27 3.2.2.1 Isolation of DNA for sequencing and genotyping ................................................. 27 3.2.2.2 Isolation of RNA for gene expression profiling and qRT-PCR .............................. 27 3.2.2.3 Isolation of protein for Western blot ...................................................................... 28 3.2.2.4 Sequencing and genotyping ..................................................................................... 28 3.2.2.4.1 Next generation sequencing (NGS) .................................................................. 28 3.2.2.4.2 Genotyping .......................................................................................................... 28 3.2.2.5 cDNA synthesis and qRT-PCR ................................................................................... 31 3.2.2.6 Western blot ............................................................................................................... 32 3.2.2.7 Enzyme-linked immunosorbent assays (ELISA) ..................................................... 33 3.2.3 Histological methods ........................................................................................................ 35 3.2.3.1 Tissue preparation for paraffin sections................................................................. 35 3.2.3.2 Hematoxylin and eosin (H&E) staining ................................................................... 36 3.2.3.3 Tartrate-resistant acidic phosphatase (TRAP) staining ........................................ 36 3.2.3.4 Toluidine blue staining .............................................................................................. 36 3.2.4 Standardized methods used in the German Mouse Clinic (GMC) .............................. 37 3.2.4.1 Dysmorphological screening .................................................................................... 37 3.2.4.2 Metabolic screening .................................................................................................. 38 3.2.4.3 Clinical chemical screening ....................................................................................... 38 3.2.4.4 Expression profiling ................................................................................................... 39 3.2.5 Food consumption experiment ....................................................................................... 40 3.2.6 Statistical analyses ............................................................................................................ 40 4. RESULTS ........................................................................................................................................ 41 4.1 Metabolic phenotypes are found in the BAP002 mouse line .......................................... 41 4.1.1 A dominant mutation of Satb2 is identified in the BAP002 mouse line .................... 41 4.1.2 Strong bone phenotypes are observed in Satb2V234L/+ mice ....................................... 45 4.1.2.1 Dysmorphological alterations in Satb2V234L/+ mice ................................................ 45 4.1.2.2 Clinical chemical abnormalities in Satb2V234L/+ mice ............................................. 48 II 4.1.2.3 Histological abnormalities of bone in Satb2V234L/+ mice ....................................... 51 4.1.2.4 Alterations of bone formation markers in Satb2V234L/+ mice ............................... 53 4.1.3 Strong metabolic phenotypes are observed in Satb2V234L/+ mice ............................... 54 4.1.3.1 Altered metabolic rate in Satb2V234L/+ mice ............................................................ 54 4.1.3.2 Reduced adiposity and increased browning of adipose tissue observed in Satb2V234L/+ mice ...................................................................................................................... 61 4.1.3.3 Increased glucose tolerance displayed in Satb2V234L/+ mice ................................. 62 4.1.3.4 Differential eWAT and BAT gene expression between Satb2V234L/+ and Satb2WT mice .......................................................................................................................................... 64 4.2 Differences found in the Dll1T720A mouse line ................................................................ 69 4.2.1 Primary screen in the GMC without wild-type littermates ......................................... 69 4.2.2 Secondary Screen including wild-type littermates revealed transient
Load more

Recommended publications
  • Endoglin Protein Interactome Profiling Identifies TRIM21 and Galectin-3 As
    cells Article Endoglin Protein Interactome Profiling Identifies TRIM21 and Galectin-3 as New Binding Partners 1, 1, 2, Eunate Gallardo-Vara y, Lidia Ruiz-Llorente y, Juan Casado-Vela y , 3 4 5 6, , María J. Ruiz-Rodríguez , Natalia López-Andrés , Asit K. Pattnaik , Miguel Quintanilla z * 1, , and Carmelo Bernabeu z * 1 Centro de Investigaciones Biológicas, Consejo Superior de Investigaciones Científicas (CSIC), and Centro de Investigación Biomédica en Red de Enfermedades Raras (CIBERER), 28040 Madrid, Spain; [email protected] (E.G.-V.); [email protected] (L.R.-L.) 2 Bioengineering and Aerospace Engineering Department, Universidad Carlos III and Centro de Investigación Biomédica en Red Enfermedades Neurodegenerativas (CIBERNED), Leganés, 28911 Madrid, Spain; [email protected] 3 Centro Nacional de Investigaciones Cardiovasculares (CNIC), 28029 Madrid, Spain; [email protected] 4 Cardiovascular Translational Research, Navarrabiomed, Complejo Hospitalario de Navarra (CHN), Universidad Pública de Navarra (UPNA), IdiSNA, 31008 Pamplona, Spain; [email protected] 5 School of Veterinary Medicine and Biomedical Sciences, and Nebraska Center for Virology, University of Nebraska-Lincoln, Lincoln, NE 68583, USA; [email protected] 6 Instituto de Investigaciones Biomédicas “Alberto Sols”, Consejo Superior de Investigaciones Científicas (CSIC), and Departamento de Bioquímica, Universidad Autónoma de Madrid (UAM), 28029 Madrid, Spain * Correspondence: [email protected] (M.Q.); [email protected] (C.B.) These authors contributed equally to this work. y Equal senior contribution. z Received: 7 August 2019; Accepted: 7 September 2019; Published: 13 September 2019 Abstract: Endoglin is a 180-kDa glycoprotein receptor primarily expressed by the vascular endothelium and involved in cardiovascular disease and cancer.
    [Show full text]
  • By Submitted in Partial Satisfaction of the Requirements for Degree of in In
    BCL6 maintains thermogenic capacity of brown adipose tissue during dormancy by Vassily Kutyavin DISSERTATION Submitted in partial satisfaction of the requirements for degree of DOCTOR OF PHILOSOPHY in Biomedical Sciences in the GRADUATE DIVISION of the UNIVERSITY OF CALIFORNIA, SAN FRANCISCO Approved: ______________________________________________________________________________Eric Verdin Chair ______________________________________________________________________________Ajay Chawla ______________________________________________________________________________Ethan Weiss ______________________________________________________________________________ ______________________________________________________________________________ Committee Members Copyright 2019 by Vassily Kutyavin ii Dedicated to everyone who has supported me during my scientific education iii Acknowledgements I'm very grateful to my thesis adviser, Ajay Chawla, for his mentorship and support during my dissertation work over the past five years. Throughout my time in his lab, I was always able to rely on his guidance, and his enthusiasm for science was a great source of motivation. Even when he was traveling, he could easily be reached for advice by phone or e- mail. I am particularly grateful for his help with writing the manuscript, which was probably the most challenging aspect of graduate school for me. I am also very grateful to him for helping me find a postdoctoral fellowship position. Ajay's inquisitive and fearless approach to science have been a great inspiration to me. In contrast to the majority of scientists who focus narrowly on a specific topic, Ajay pursued fundamental questions across a broad range of topics and was able to make tremendous contributions. My experience in his lab instilled in me a deep appreciation for thinking about the entire organism from an evolutionary perspective and focusing on the key questions that escape the attention of the larger scientific community. As I move forward in my scientific career, there is no doubt that I will rely on him as a role model.
    [Show full text]
  • SNP Analysis Reveals an Evolutionary Acceleration of the Human-Specific Micrornas
    CORE Metadata, citation and similar papers at core.ac.uk Provided by Nature Precedings Rapid evolution of the human-specific microRNAs SNP analysis reveals an evolutionary acceleration of the human-specific microRNAs Qipeng Zhang1, 2, Ming Lu1, 2, and Qinghua Cui1, 2 1. Department of Medical Informatics, Peking University Health Science Center, Peking University, 38 Xueyuan Rd, Beijing, China 100083 2. Ministry of Education Key Lab of Molecular Cardiovascular Sciences, Peking University, 38 Xueyuan Rd, Beijing, China 100083 Nature Precedings : hdl:10101/npre.2008.2127.1 Posted 29 Jul 2008 Corresponding author: Cui, Q. ([email protected]) 1 PDF 文件使用 "pdfFactory Pro" 试用版本创建 www.fineprint.cn Rapid evolution of the human-specific microRNAs MicroRNAs are one class of important gene regulators at the post-transcriptional level by binding to the 3’UTRs of target mRNAs. It has been reported that human microRNAs are evolutionary conserved and show lower single nucleotide polymorphisms (SNPs) than their flanking regions. However, in this study, we report that the human-specific microRNAs show a higher SNP density than both the conserved microRNAs and other control regions, suggesting rapid evolution and positive selection has occurred in these regions. Furthermore, we observe that the human-specific microRNAs show greater SNPs minor allele frequency and the SNPs in the human-specific microRNAs show fewer effects on the stability of the microRNA secondary structure, indicating that the SNPs in the human-specific microRNAs tend to be less deleterious. Finally, two microRNAs hsa-mir-423 (SNP: rs6505162), hsa-mir-608 (SNP: rs4919510) and 288 target genes that have apparently been under recent positive selection are identified.
    [Show full text]
  • WO 2017/214553 Al 14 December 2017 (14.12.2017) W !P O PCT
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2017/214553 Al 14 December 2017 (14.12.2017) W !P O PCT (51) International Patent Classification: AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, C12N 15/11 (2006.01) C12N 15/113 (2010.01) CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, (21) International Application Number: HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, PCT/US20 17/036829 KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, (22) International Filing Date: MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, 09 June 2017 (09.06.2017) OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, SC, SD, SE, SG, SK, SL, SM, ST, SV, SY,TH, TJ, TM, TN, (25) Filing Language: English TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (26) Publication Language: English (84) Designated States (unless otherwise indicated, for every (30) Priority Data: kind of regional protection available): ARIPO (BW, GH, 62/347,737 09 June 2016 (09.06.2016) US GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, TZ, 62/408,639 14 October 2016 (14.10.2016) US UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, 62/433,770 13 December 2016 (13.12.2016) US TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, LV, (71) Applicant: THE GENERAL HOSPITAL CORPO¬ MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, RATION [US/US]; 55 Fruit Street, Boston, Massachusetts TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, 021 14 (US).
    [Show full text]
  • The Disruption Ofcelf6, a Gene Identified by Translational Profiling
    2732 • The Journal of Neuroscience, February 13, 2013 • 33(7):2732–2753 Neurobiology of Disease The Disruption of Celf6, a Gene Identified by Translational Profiling of Serotonergic Neurons, Results in Autism-Related Behaviors Joseph D. Dougherty,1,2 Susan E. Maloney,1,2 David F. Wozniak,2 Michael A. Rieger,1,2 Lisa Sonnenblick,3,4,5 Giovanni Coppola,4 Nathaniel G. Mahieu,1 Juliet Zhang,6 Jinlu Cai,8 Gary J. Patti,1 Brett S. Abrahams,8 Daniel H. Geschwind,3,4,5 and Nathaniel Heintz6,7 Departments of 1Genetics and 2Psychiatry, Washington University School of Medicine, St. Louis, Missouri 63110, 3UCLA Center for Autism Research and Treatment, Semel Institute for Neuroscience and Behavior, 4Program in Neurogenetics, Department of Neurology, and 5Department of Human Genetics, David Geffen School of Medicine at UCLA, Los Angeles, California 90095, 6Laboratory of Molecular Biology, Howard Hughes Medical Institute, and 7The GENSAT Project, Rockefeller University, New York, New York 10065, and 8Departments of Genetics and Neuroscience, Albert Einstein College of Medicine, New York, New York 10461 The immense molecular diversity of neurons challenges our ability to understand the genetic and cellular etiology of neuropsychiatric disorders. Leveraging knowledge from neurobiology may help parse the genetic complexity: identifying genes important for a circuit that mediates a particular symptom of a disease may help identify polymorphisms that contribute to risk for the disease as a whole. The serotonergic system has long been suspected in disorders that have symptoms of repetitive behaviors and resistance to change, including autism. We generated a bacTRAP mouse line to permit translational profiling of serotonergic neurons.
    [Show full text]
  • AGPAT3 (NM 001037553) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC222900 AGPAT3 (NM_001037553) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: AGPAT3 (NM_001037553) Human Tagged ORF Clone Tag: Myc-DDK Symbol: AGPAT3 Synonyms: 1-AGPAT 3; LPAAT-GAMMA1; LPAAT3 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC222900 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGCCTGCTGGCCTTCCTGAAGACCCAGTTCGTGCTGCACCTGCTGGTCGGCTTTGTCTTCGTGGTGA GTGGTCTGGTCATCAACTTCGTCCAGCTGTGCACGCTGGCGCTCTGGCCGGTCAGCAAGCAGCTCTACCG CCGCCTCAACTGCCGCCTCGCCTACTCACTCTGGAGCCAACTGGTCATGCTGCTGGAGTGGTGGTCCTGC ACGGAGTGTACACTGTTCACGGACCAGGCCACGGTAGAGCGCTTTGGGAAGGAGCACGCAGTCATCATCC TCAACCACAACTTCGAGATCGACTTCCTCTGTGGGTGGACCATGTGTGAGCGCTTCGGAGTGCTGGGGAG CTCCAAGGTCCTCGCTAAGAAGGAGCTGCTCTACGTGCCCCTCATCGGCTGGACGTGGTACTTTCTGGAG ATTGTGTTCTGCAAGCGGAAGTGGGAGGAGGACCGGGACACCGTGGTCGAAGGGCTGAGGCGCCTGTCGG ACTACCCCGAGTACATGTGGTTTCTCCTGTACTGCGAGGGGACGCGCTTCACGGAGACCAAGCACCGCGT TAGCATGGAGGTGGCGGCTGCTAAGGGGCTTCCTGTCCTCAAGTACCACCTGCTGCCGCGGACCAAGGGC TTCACCACCGCAGTCAAGTGCCTCCGGGGGACAGTCGCAGCTGTCTATGATGTAACCCTGAACTTCAGAG GAAACAAGAACCCGTCCCTGCTGGGGATCCTCTACGGGAAGAAGTACGAGGCGGACATGTGCGTGAGGAG ATTTCCTCTGGAAGACATCCCGCTGGATGAAAAGGAAGCAGCTCAGTGGCTTCATAAACTGTACCAGGAG AAGGACGCGCTCCAGGAGATATATAATCAGAAGGGCATGTTTCCAGGGGAGCAGTTTAAGCCTGCCCGGA
    [Show full text]
  • Transcriptional and Post-Transcriptional Profile of Human Chromosome 21
    Downloaded from genome.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press Methods Transcriptional and post-transcriptional profile of human chromosome 21 Sergey I. Nikolaev,1,5 Samuel Deutsch,1,5 Raphael Genolet,2 Christelle Borel,1 Leila Parand,1 Catherine Ucla,1 Frederic Schu¨tz,3 Genevieve Duriaux Sail,1 Yann Dupre´,1 Pascale Jaquier-Gubler,2 Tanguy Araud,2 Beatrice Conne,1 Patrick Descombes,4 Jean-Dominique Vassalli,1 Joseph Curran,2 and Stylianos E. Antonarakis1,6 1Department of Genetic Medicine and Development, University of Geneva Medical School, CH-1211 Geneva, Switzerland; 2Department of Microbiology and Molecular Medicine, University of Geneva Medical School, CH-1211 Geneva, Switzerland; 3Swiss Bioinformatics Institute, Genopode Builiding, CH-1015 Lausanne, Switzerland; 4Genomics Platform, University of Geneva Medical School, CH-1211 Geneva, Switzerland Recent studies have demonstrated extensive transcriptional activity across the human genome, a substantial fraction of which is not associated with any functional annotation. However, very little is known regarding the post-transcriptional processes that operate within the different classes of RNA molecules. To characterize the post-transcriptional properties of expressed sequences from human chromosome 21 (HSA21), we separated RNA molecules from three cell lines (GM06990, HeLa S3, and SK-N-AS) according to their ribosome content by sucrose gradient fractionation. Poly- ribosomal-associated RNA and total RNA were subsequently hybridized to genomic tiling arrays. We found that ;50% of the transcriptional signals were located outside of annotated exons and were considered as TARs (transcriptionally active regions). Although TARs were observed among polysome-associated RNAs, RT-PCR and RACE experiments revealed that ;40% were likely to represent nonspecific cross-hybridization artifacts.
    [Show full text]
  • Supporting Information
    Supporting Information Friedman et al. 10.1073/pnas.0812446106 SI Results and Discussion intronic miR genes in these protein-coding genes. Because in General Phenotype of Dicer-PCKO Mice. Dicer-PCKO mice had many many cases the exact borders of the protein-coding genes are defects in additional to inner ear defects. Many of them died unknown, we searched for miR genes up to 10 kb from the around birth, and although they were born at a similar size to hosting-gene ends. Out of the 488 mouse miR genes included in their littermate heterozygote siblings, after a few weeks the miRBase release 12.0, 192 mouse miR genes were found as surviving mutants were smaller than their heterozygote siblings located inside (distance 0) or in the vicinity of the protein-coding (see Fig. 1A) and exhibited typical defects, which enabled their genes that are expressed in the P2 cochlear and vestibular SE identification even before genotyping, including typical alopecia (Table S2). Some coding genes include huge clusters of miRNAs (in particular on the nape of the neck), partially closed eyelids (e.g., Sfmbt2). Other genes listed in Table S2 as coding genes are [supporting information (SI) Fig. S1 A and C], eye defects, and actually predicted, as their transcript was detected in cells, but weakness of the rear legs that were twisted backwards (data not the predicted encoded protein has not been identified yet, and shown). However, while all of the mutant mice tested exhibited some of them may be noncoding RNAs. Only a single protein- similar deafness and stereocilia malformation in inner ear HCs, coding gene that is differentially expressed in the cochlear and other defects were variable in their severity.
    [Show full text]
  • Epigenome-450K-Wide Methylation Signatures of Active Cigarette Smoking: the Young Finns Study
    Bioscience Reports (2020) 40 BSR20200596 https://doi.org/10.1042/BSR20200596 Research Article Epigenome-450K-wide methylation signatures of active cigarette smoking: The Young Finns Study Pashupati P. Mishra1,2,3,*, Ismo Hanninen¨ 1,2,3,*, Emma Raitoharju1,2,3, Saara Marttila1,2,3,4, Binisha H. Mishra1,2,3, Nina Mononen1,2,3,MikaKah¨ onen¨ 2,5, Mikko Hurme4,6, Olli Raitakari7,8,9, Petri Tor¨ onen¨ 10, Liisa Holm10,11 and Terho Lehtimaki¨ 1,2,3 Downloaded from http://portlandpress.com/bioscirep/article-pdf/40/7/BSR20200596/887717/bsr-2020-0596.pdf by guest on 27 September 2021 1Department of Clinical Chemistry, Faculty of Medicine and Health Technology, Tampere University, Tampere, Finland; 2Finnish Cardiovascular Research Center-Tampere, Faculty of Medicine and Health Technology, Tampere University, Tampere, Finland; 3Department of Clinical Chemistry, Fimlab Laboratories, Tampere, Finland; 4Gerontology Research Center (GEREC), Tampere University, Tampere, Finland; 5Department of Clinical Physiology, Tampere University Hospital, Tampere, Finland; 6Department of Microbiology and Immunology, Faculty of Medicine and Health Technology, Tampere University, Tampere, Finland; 7Centre for Population Health Research, University of Turku and Turku University Hospital, Turku, Finland; 8Research Centre of Applied and Preventive Cardiovascular Medicine, University of Turku, Turku, Finland; 9Department of Clinical Physiology and Nuclear Medicine, Turku University Hospital, Turku, Finland; 10Institute of Biotechnology, Helsinki Institute of Life Sciences (HiLife), University of Helsinki, Helsinki, Finland; 11Organismal and Evolutionary Biology Research Program, Faculty of Biological and Environmental Sciences, University of Helsinki, Helsinki, Finland Correspondence: Pashupati P. Mishra (pashupati.mishra@tuni.fi) Smoking as a major risk factor for morbidity affects numerous regulatory systems of the human body including DNA methylation.
    [Show full text]
  • Chromosome 21: a Small Land of Fascinating Disorders with Unknown Pathophysiology
    Int. J. Dev. Biol. 46: 89-96 (2002) Chromosome 21: a small land of fascinating disorders with unknown pathophysiology STYLIANOS E. ANTONARAKIS*, ROBERT LYLE, SAMUEL DEUTSCH and ALEXANDRE REYMOND Division of Medical Genetics, University of Geneva Medical School and University Hospitals, Geneva, Switzerland ABSTRACT In the year 2000 we celebrated the sequencing of the entire long arm of human chromosome 21. This achievement now provides unprecedented opportunities to understand the molecular pathophysiology of trisomy 21, elucidate the mechanisms of all monogenic disorders of chromosome 21, and discover genes and functional sequence variations that predispose to common complex disorders. All of that requires the functional analysis of gene products in model organisms, and the determination of the sequence variation of this chromosome. KEY WORDS: Down Syndrome, HC21, molecular pathology, trisomy 21, single nucleotide polymorphism The Sequence of HC21 and the Gene Catalogue gaps in regions with long stretches of repeats in which it was impossible to know if the entire repeat was sequenced. A region of On May 18, 2000, the (almost) entire sequence of 21q was 281 kb from the short arm 21p has also been sequenced and contains published and became freely available (Hattori et al., 2000). This just one gene (TPTE). landmark publication concluded research efforts of many investiga- Only approximately 3% of the sequence encodes for proteins; in tors and laboratories that studied the infrastructure of HC21 over the addition 1.3% encodes for short sequence repeats that may be last 15 years. Other historical landmarks of research on chromosome polymorphic in human populations. About 10.8% of the sequence are 21 include the first description of trisomy 21 in 1959 (Lejeune et al., SINE and 15.5% LINE repeats respectively; an additional 11.7% are 1959), first cloning of a chromosome 21 gene in 1982 (Lieman- other human repeats (total interspersed repeats 38% of the se- Hurwitz et al., 1982), first disease-related gene mutation identified in quence).
    [Show full text]
  • Mouse Models of Inherited Retinal Degeneration with Photoreceptor Cell Loss
    cells Review Mouse Models of Inherited Retinal Degeneration with Photoreceptor Cell Loss 1, 1, 1 1,2,3 1 Gayle B. Collin y, Navdeep Gogna y, Bo Chang , Nattaya Damkham , Jai Pinkney , Lillian F. Hyde 1, Lisa Stone 1 , Jürgen K. Naggert 1 , Patsy M. Nishina 1,* and Mark P. Krebs 1,* 1 The Jackson Laboratory, Bar Harbor, Maine, ME 04609, USA; [email protected] (G.B.C.); [email protected] (N.G.); [email protected] (B.C.); [email protected] (N.D.); [email protected] (J.P.); [email protected] (L.F.H.); [email protected] (L.S.); [email protected] (J.K.N.) 2 Department of Immunology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700, Thailand 3 Siriraj Center of Excellence for Stem Cell Research, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700, Thailand * Correspondence: [email protected] (P.M.N.); [email protected] (M.P.K.); Tel.: +1-207-2886-383 (P.M.N.); +1-207-2886-000 (M.P.K.) These authors contributed equally to this work. y Received: 29 February 2020; Accepted: 7 April 2020; Published: 10 April 2020 Abstract: Inherited retinal degeneration (RD) leads to the impairment or loss of vision in millions of individuals worldwide, most frequently due to the loss of photoreceptor (PR) cells. Animal models, particularly the laboratory mouse, have been used to understand the pathogenic mechanisms that underlie PR cell loss and to explore therapies that may prevent, delay, or reverse RD. Here, we reviewed entries in the Mouse Genome Informatics and PubMed databases to compile a comprehensive list of monogenic mouse models in which PR cell loss is demonstrated.
    [Show full text]
  • Unraveling the Specific Ischemic Core and Penumbra Transcriptome In
    Microarrays 2015, 4, 2-24; doi:10.3390/microarrays4010002 OPEN ACCESS microarrays ISSN 2076-3905 www.mdpi.com/journal/microarrays Article Unraveling the Specific Ischemic Core and Penumbra Transcriptome in the Permanent Middle Cerebral Artery Occlusion Mouse Model Brain Treated with the Neuropeptide PACAP38 Motohide Hori 1,2, Tomoya Nakamachi 2,3, Junko Shibato 2,4, Randeep Rakwal 2,5,*, Seiji Shioda 2,* and Satoshi Numazawa 1 1 Division of Toxicology, Department of Pharmacology, Toxicology and Therapeutics, School of Pharmacy, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555, Japan; E-Mails: [email protected] (M.H.); [email protected] (S.N.) 2 Department of Anatomy, School of Medicine, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555, Japan; E-Mails: [email protected] (T.N.); [email protected] (J.S.) 3 Laboratory of Regulatory Biology, Graduate School of Science and Engineering, University of Toyama, Toyama, Toyama 930-8555, Japan 4 Laboratory of Exercise Biochemistry and Neuroendocrinology, Institute of Health and Sports Sciences, University of Tsukuba, Tsukuba, Ibaraki 305-8574, Japan 5 Organization for Educational Initiatives, University of Tsukuba, 1-1-1 Tennoudai, Tsukuba, Ibaraki 305-8577, Japan * Authors to whom correspondence should be addressed; E-Mails: [email protected] (R.R.); [email protected] (S.S.); Tel.: +81-0-90-1853-7875 (R.R.); +81-0-3-3784-8103 (S.S.); Fax: +81-0-3-3784-6815 (S.S.). Academic Editor: Xin Ma Received: 31 October 2014 / Accepted: 15 January 2015 / Published: 21 January 2015 Abstract: Our group has been systematically investigating the effects of the neuropeptide pituitary adenylate-cyclase activating polypeptide (PACAP) on the ischemic brain.
    [Show full text]