Graf1 Regulates Myo6 Dependent Mitochondrial Actin Remodeling

GRAF1 REGULATES MYO6 DEPENDENT MITOCHONDRIAL ACTIN REMODELING

Zachary Opheim

A thesis submitted to the faculty of the University of North Carolina at Chapel Hill in partial fulfillment of the requirements for the degree of Master of Science in the Department of Pathology and Laboratory Medicine in the School of Medicine.

Chapel Hill 2019

Approved by:

Joan Taylor

Chris Mack

Jon Homeister

ABSTRACT

Zachary Opheim: GRAF1 Regulates MYO6 Dependent Mitochondrial Actin Remodeling (Under the direction of Joan Taylor)

Cardiomyocytes are long lived cells that require a constant supply of ATP generated by mitochondria. Mitochondrial dysfunction results in various diseases, highlighting the importance of mitochondrial quality control. Here we demonstrate that

GRAF1 regulates mitochondrial quality via interaction with MYO6, a known regulator of mitophagy. Recent studies revealed MYO6 promotes the formation of actin “cages” around damaged mitochondria in response to stress. We show GRAF1 and MYO6 colocalize to depolarized mitochondria. Additionally, we reveal GRAF1 and MYO6 interact and is dependent upon actin polymerization. Knockdown of GRAF1 results in clustered mitochondrial network morphology following mitochondrial depolarization and subsequent recovery. Furthermore, we observe a lack of MYO6 dissociation from mitochondria following knockdown of GRAF1. In addition, GRAF1 was found to promote mitochondrial function in growth conditions requiring mitochondrial dependent oxidative phosphorylation. Our novel findings suggest that GRAF1 regulates the dissociation of actin cages around damaged mitochondria to promote their eventual degradation.

iii

TABLE OF CONTENTS

LIST OF FIGURES……………………………………………………………………………..vi

LIST OF ABBREVIATIONS…………………………………………………………………...vii

CHAPTER 1: INTRODUCTION………………………………………………………………..1

1.1 Autophagy……………………………………………………………………………1

1.2 Mitochondrial control pathways……………………………………………………3

1.3 PINK1/Parkin-mediated mitophagy…………………………………………….....4

1.4 Mitochondrial dynamics and mitophagy……………………………………….....5

1.5 Mitophagy and the cardiovascular system……………………………………….7

1.6 RhoA and actin dynamics……………………………………………………….....8

1.7 Actin, myosins, and autophagy……………………………………………………9

1.8 MYO6……………………………………………………………………………….10

1.9 GRAF1……………………………………………………………………………...11

CHAPTER 2: RESULTS………………………………………………………………………13

2.1 GRAF1 regulates cardiomyocyte viability and forms rings around

mitochondria……………………………………………………………………………13

2.2 GRAF1 colocalizes and interacts with MYO6………………………………….13

2.3 GRAF1 restores mitochondrial morphology following mitochondrial insult…15

2.4 GRAF1 regulates MYO6 dissociation from mitochondria……………………..16

2.5 GRAF1 regulates mitochondrial function during OXPHOS…………………...17

CHAPTER 3: DISCUSSION………………………………………………………………….18

CHAPTER 4: METHODS……………………………………………………………………..32

REFERENCES…………………………………………………………………………………36

LIST OF FIGURES

Figure 1 - Mitochondrial Control Pathways…………………………………………………23

Figure 2 - GRAF1 regulates cardiomyocyte cell viability and forms rings around mitochondria……………………………………………………………………………………24

Figure 3 - MYO6 colocalizes with GRAF1 on Parkin positive structures………………..25

Figure 4 - GRAF1 interacts with MYO6 and is dependent on actin polymerization…….26

Figure 5 - GRAF1 restores mitochondrial morphology following CCCP treatment……..27

Figure 6 - GRAF1 restores mitochondrial morphology in cardiomyocytes………………28

Figure 7 - GRAF1 regulates MYO6 dissociation from mitochondria……………………..29

Figure 8 - GRAF1 regulates mitochondrial function………………………………………..30

Figure 9 - Schematic model of GRAF1 and MYO6 dependent actin cages…………….31

LIST OF ABBREVIATIONS

ATG Autophagy related protein

CCCP Carbonyl m-chlorophenyl hydrazine

DFCP-1 Double FYVE domain containing protein 1

DMSO Dimethyl sulfoxide

DRP-1 Dynamin related protein 1

EAD Endosome assisted degradation

ER Endoplasmic reticulum

ESCRT Endosomal sorting complexes required for transport

FIS1 Mitochondrial fission protein 1

GAP GTP-ase activating protein

GEF Guanine exchange factor

I/R Ischemia reperfusion

LC3 Microtubule associated protein 1 light chain 3

LIR LC3 interacting motif

MDV Mitochondrial derived vesicle

MFN Mitofusin

vii

MI Myocardial infarction

MYO1C Myosin IC

MYO6 Myosin VI

NMM2A Non-muscle myosin IIA

NRCM Neonatal rat cardiomyocyte

OMM Outer mitochondrial membrane

OPA1 Optic atrophy protein 1

OXPHOS Oxidative phosphorylation

PDH Pyruvate dehydrogenase

PINK1 PTEN induced kinase 1

PI3K Phosphatidylinositol 3-kinase sIR Simulated ischemia reperfusion

UBD Ubiquitin binding domain

ULK1 Unc51-like autophagy activating kinase

viii

CHAPTER 1: INTRODUCTION

Heart failure is a leading cause of death in the United states and accounts for

610,000 deaths per year1. Half of the deaths from heart failure are attributed to myocardial infarction (MI). Damage from MI results in cell death of irreplaceable cardiomyocytes due to ischemia from blockage of the coronary blood supply.

Cardiomyocytes constantly work to supply the body with oxygen and nutrients and are one of the most metabolically active cell types. Furthermore, cardiomyocytes rely on oxygen-dependent ATP production from mitochondria as their main source of energy.

Upon ischemia, nutrients and oxygen supply are blocked to cardiomyocytes. Ischemic cardiomyocytes undergo a rapid decline of intracellular ATP concentration and increased intracellular calcium concentration, resulting in mitochondrial dysfunction and depolarization2. These findings highlight the importance of mitochondrial function in vulnerability to and recovery from MI and other cardiovascular diseases. Therefore, understanding the mechanism regulating mitochondrial health and function may allow for promising therapeutic targets to provide cardioprotection in the setting of MI or ischemia/reperfusion injury (I/R).

1.1 Autophagy

Autophagy is a conserved intracellular degradation/recycling system fundamental for cellular homeostasis and metabolism. Autophagy is important for cell survival during nutrient stress as degraded amino and fatty acids recycled from cellular constituents such as organelles and macromolecules by autophagy can be used to generate ATP

1 and other necessary cellular components3. Autophagy is activated by a multitude of stimuli, including nutrient deprivation, hypoxia, oxidative stress, and protein aggregates.

Initiation and various steps of autophagy are regulated by autophagy-related (ATG) proteins in a sequential manner.

Autophagosome biogenesis begins with the activation of the unc51-like autophagy activating kinase 1 (ULK1) comlplex. Once activated, the ULK complex phosphorylates the class-III phosphatidylinositol 3-kinase (PI3K) complex 4,5. The PI3K complex is responsible for generating phostatidylinositol 3-phosphate on emerging membrane sources termed omegasomes, which are marked by double FYVE domain- containing protein (DFCP1). Omegasomes are cupped shaped membrane extensions from the endoplasmic reticulum (ER) that mark the site of autophagosome formation4.

The Atg8-phosphatidylethanolamine ubiquitin pathway is responsible for the lipidation of microtubule-associated protein 1 light chain 3 (LC3), a critical component of the autophagy machinery. Further downstream, the C-terminus of LC3 is cleaved, generating LC3-I which is further modified by conjugation with phosphatidylethanolamine to form LC3-II. Once processed, LC3-II is localizes to both membranes of the autophagosome and facilitates linkage of the autophagic machinery with the expanding autophagosome4. Finally, the autophagosome fuses with the lysosme where cargo is degraded.

Autophagy was initially described as a non-specific, bulk degradative process, however recent studies indicate selective forms of autophagy that specifially target protein aggregates, bacteria, or organelles such as the ER, peroxisomes and mitochondria for degradation6,7. Mitochondrial autophagy, or mitophagy is the selective

2 degradation of damaged mitochondria and is a critical quality control mechanism, especially for highly metabolic and post-mitotic cells such as cardiomyocytes.

1.2 Mitochondrial control pathways

To ensure proper mitochondrial homeostasis and function, cells utilize various pathways to regulate mitochondrial quality depending on the extent of mitochondrial insult. Several “first-line” of defense mechanisms exist to maintain mitochondrial function before complete degradation of the entire mitochondria ensues. Upon low levels of oxidative stress, mitochondrial derived vesicles (MDV) are recruited to discrete sites on the mitochondria (Fig. 1A) in a PTEN Induced Kinase I (PINK1) dependent manner, however this mechanism occurs at a more localized level than PINK1/Parkin- mediated mitophagy (described in detail below)8. Experimental evidence suggests any oxidized mitochondrial proteins can serve as cargo for MDVs, however the main targets are VDAC (membrane pore protein), core2 (complex III subunit) and the matrix protein pyruvate dehydrogenase (PDH)9. Finally, MDVs deliver oxidized cargo to be degraded in the lysosome or peroxisome depending on cargo content10.

Another mitochondrial quality control pathway termed “piecemeal mitophagy” targets specific regions of damaged mitochondria (Fig. 1B). Localized damaged regions of individual mitochondria are targeted by ER-specific structures enriched with the omegasome marker DFCP-111. The omegasome contact sites serve as a recruitment signal for LC3 which in turn leads to autophagosomal engulfment along oxidized portions of mitochondria11. To complete the process, the dynamin related protein 1

(DRP-1) is recruited to the impaired mitochondrial tubule and promotes fission of the oxidized portion, as inhibition of DRP-1 blocks piecemeal mitophagy11. Both MDVs and

3 piecemeal mitophagy function to regulate mitochondrial quality basally and both mechanisms are dependent on DRP-1, have cargo-selectivity, and dispose of damaged mitochondrial proteins without engulfment of the entire organelle12.

Recently, a pathway termed endosome assisted degradation (EAD) has been revealed to promote clearance of damaged whole mitochondria (Fig. 1C). Upon mitochondrial depolarization, Parkin mediated ubiquitination of mitochondrial substrates recruits the endosomal sorting complexes required for transport (ESCRT) machinery on

RAB5 positive early endosomes13. The ESCRT machinery promotes invagination and scission of the early endosome and allows for engulfment of the damaged mitochondria, where it is eventually trafficked to the lysosome and degraded13. EAD, MDVs and piecemeal are all dependent on Parkin, but EAD differs as it requires endosomal machinery and engulfs the entire mitochondria. Importantly, EAD occurs much more rapidly than PINK1/Parkin-mediated mitophagy as endosomes do not need to be synthesized de-novo, unlike autophagosomes. This evidence suggests that EAD serves as a primary quality control pathway to degrade damaged mitochondria before

PINK/Parkin-mediated mitophagy is fully activated. Although many pathways regulate mitochondrial clearance, PINK1/Parkin-mediated mitophagy is one of the most well studied (Fig 1D).

1.3 PINK1/PARKIN-Mediated Mitophagy

For proper mitochondria quality control, damaged mitochondria must first be distinguished from healthy mitochondria. Normally, PINK1 is cystosolic and localizes to healthy mitochondria through its mitochondrial targeting sequence. PINK1 is then translocated into the mitochondrial matrix where PINK1 is sequentially cleaved by

4 mitochondrial matrix protease and the rhomboid-like serine protease in the inner membrane14. After cleaveage, PINK1 is degraded in the cytosol by the ubiquitin proteosome system, thereby repressing mitophagy15. However, when mitochondrial membrane polarization is disrupted, PINK1 is unable to be imported into mitochondria, thus avoiding cleavage. Once stabilized on the outer mitochondrial membrane (OMM),

PINK1 is activated through autophosphorylation16. Activated PINK1 recruits the E3 ubiquitin ligase Parkin to damaged mitochondria via phosphorylation of Parkin and ubiquitin substrates, allowing Parkin to become fully activated17–19. Subsequently,

Parkin ubiquitinates multiple targets on the OMM20. Ubiquitination of target OMM proteins facilitates recrutiment of autophagy/mitophagy receptors such as p62/SQSTM1 that recognize ubiquitinated proteins. P62 and other adaptor proteins are able to interact with LC3 through their LC3 interacting regions (LIR), and direct the autophagosome to engulf damaged mitochondria marked by PINK1 and Parkin, ultimately leading to degradation of damaged mitochondria in the lysosome21.

1.4 Mitochondrial dynamics and mitophagy

Mitochondria are dynamic organelles that require a balance of fission and fusion depending on the metabolic needs of the cell. Mitochondrial fission results in smaller, fragmented mitochondria more efficient at generating reactive oxygen species, enhance the induction of mitophagy or accelerate cell proliferation. Fusion of mitochondria produces an interconnected network that increases oxidative potential and contact with other organelles22. Furthermore, fusion can promote the mixing of mitochondrial matrix content and diffusion of dangerous mitochondrial DNA mutations or oxidized proteins22.

The dynamin related GTPases mitofusions (MFN1 and MFN2) and optic atrophy protein 1 (OPA1) are the key regulators of mitochondrial fusion. MFN1/2 are located on the OMM and are critical for fusion as cells deficient in either have fusion defects characterized by small and fragmented mitochondria23. Furthermore, MFN1/2 plays other roles such as modulation of metabolism, ER-mitochondria contact, and regulation of mitophagy24. OPA1 is targeted to the inner mitochondrial membrane, where it is the target of multiple mitochondrial proteases required for OPA1 cleavage25. Cleavage of

OPA1 results in short (S-OPA1) and long (L-OPA1) isoforms, both of which are required for fusion26. Upon mitochondrial depolarization, L-OPA1 is further processed. L-OPA1 cleavage inhibits mitochondrial fusion and promotes fragmented mitochondria and eventually mitophagy27. Conversely, DRP1 and mitochondrial fisssion 1 protein (FIS1) regulate mitochondrial fission24. DRP1 is recruited to mitochondria with the aid of FIS1, whereupon DRP1 acts to constrict the mitochondria during early steps of fission28.

Importantly, mitochondrial dynamics are clinically relevant to a variety of cardiovascular and metabolic disease such as I/R injury, heart failure, and type 2 diabetes29.

Dysregulation of mitochondrial fission and fusion results in an accumulation of damaged mitochondria, as up or downregulation of these processes leads to a reduction in metabolic output, thus highlighting the importance of mitochondrial fission and fusion.

Mitochondrial fission and fusion are also important for mitophagy. Photo-labeling experiments revealed mitochondria exist in a heterogenous population dependent on membrane potential. Mitochondria with higher potential were seen to undergo increased rates of fusion, compared to depolarized mitochondria, which appeared fragmented and were eventually degraded by mitophagy, indicating that mitochondrial fission can

6 promote mitophagy30. However, MFN1/2 knockout MEFs do not have impaired mitophagy, suggesting mitochondrial fission is not enough to drive mitophagy. In addition, fragmented mitochondria are not sufficient to recruit autophagy receptors to initiate mitophagy, as they must also be dysfunctional31. Moreover, it is thought that autophagosomes are better able to engulf fragmented mitochondria compared to elongated or networked mitochondria. Additional evidence for the importance of fission and fusion for the intiation of mitophagy is that MFN2 serves as a phosphorylation target of PINK1. PINK1 phosphorylation of Thr111 and Ser442 on MFN2 promotes Parkin to ubiquitinate MFN232. Ubiquitination of MFN2 will lead to its eventual degradation and block damaged mitochondria from undergoing fusion with the healthy mitochondrial network.

1.5 Mitophagy and the cardiovascular system

Mitophagy is essential for cardiomyocyte homeostasis and defects in mitochondrial clearance result in dysfunctional mitochondria and contractile defects in the heart. Mice deficient in PINK1 display mitochondrial dysfunction, increased oxidative stress and pathological hypertrophy at 2 months of age33. Moreover, mice lacking Parkin have normal mitochondria while young, but accumulate abnormal mitochondria with age34, indicating the importance of mitophagy in cardiac health and function. Furthermore, mitophagy plays an even more important role in the heart upon stress. Parkin and PINK1 knockout mice displayed increased sensitivity to MI and I/R respectively35,36. Additionally, cardioprotective ischemic preconditioning is attenuated in Parkin knockout mice, highlighting the importance of mitophagy in response to myocardial stress37.

Mitophagy also plays an essential role in the pathogenesis of various cardiometabolic diseases such as atherosclerosis, cardiomyopathy, endothelial cell dysfunction and diabetes38. Reactive oxygen species generated by mitochondria results in modification of proteins, lipids, and mitochondrial DNA leading to impaired ATP generation. Furthermore, lipid overload in cells results in defects in β-oxidation, leading to toxic lipid intermediates and eventual insulin resistance39. Metabolic diseases also affect mitochondrial morphology as excess cellular nutrients result in a fragmented mitochondrial network. Collectively, these studies highlight the importance of mitochondrial homeostasis in metabolic disease40.

Since mitochondrial homeostasis is critically important in highly metabolic tissues such as the heart, skeletal muscle and adipose, it is not surprising that defects in mitophagy can lead to metabolic diseases in these tissues. Muscle-specific autophagy deficient mice results in atrophied muscle fibers, loss of muscle mass, adipose tissue browning and insulin sensitivity41. Defects in mitophagy have been observed in diabetic vascular endothelial cells, resulting in fragmented mitochondria and increased oxidative stress38. Importantly, mitochondrial function and morphology can be restored with pharmacological agents that promote autophagy, indicating components of the mitophagic machinery may provide important therapeutic targets for the treatment of metabolic diseases38.

1.6 RhoA and actin dynamics

The RhoA family of GTPases are critical regulators of actin dynamics. RhoA serves as molecular switch to regulate actin polymerization. GTP bound or active RhoA is able to induce the polymerization of actin fibers to promote various cell proccesses dependent

8 on the actin cytoskeleton such as migration, cell morphogenesis and adhesion signaling42. RhoA functions through its downstream mediators mDia and ROCK. mDia stimulates actin nucleation43. In conjunction, ROCK inhibits actin polymerization by phosphorylation of LIM kinase, leading to its activation43. Active LIM kinase inhibits the actin severing protein cofilin to prevent actin fiber breakdown43. ROCK also phosphorylates myosin light chain phosphatase to induce myosin light chain contractilty44.

Regulation of RhoA activity is modulated by Rho GEFs (guanine exchange factors) which activate RhoA and Rho GAPs (GTP-ase activating protein) which turn off RhoA activity.

Therefore, Rho GEFs are able to promote actin polymerization while Rho GAPs induce actin depolymerization.

1.7 Actin, myosins and autophagy

A role for actin in the process of autophagy was elucidated when autophagosome formation was blocked with treatment of actin depolymerizing agents such as cytochalasin D and latrunculin B45. RhoA has also been shown to promote autophagsome formation during starvation induced autophagy and this requires activity of its downstream kinase ROCK146. During autophagy initiation, actin nucleators and polymerizing factors such as WHAMM and ARP2/3 respectively, are recruited to the early autophagosome and act as a framework for the autophagosome to expand and induce membrane curvature47.mFinally, actin plays a role in the final steps of autophagy by promoting fusion of the autophagosome with the lysosome. Local assembly of actin by ARP2/3 promotes the efficient fusion of autophagosomes and lysosomes. In-vitro studies reveal autophagosome-lysosome fusion to be dependent on actin dynamics, as inhibition of actin polymerization blocks fusion48. Actin is extremely important in supporting the

9 nascent autophagosome, expansion, transport, and fusion of the autophagsome with the lysosome.

Members of the non-muscle myosin motor proteins also work in concert with actin to regulate autophagy in the cell. Non-muscle myosins function to transport and sort various vesicles, protein complexes and membranes along actin based structures. Of the

39 human myosins, 3 have been shown to function in autophagy: non-muscle myosin IIA

(NMM2A), myosin IC, (MYO1C) and myosin VI (MYO6). NMM2A is recruited to the golgi netowork upon autophagy initiation where it acts with actin to form ATG9 containing vesicles and deliver crucial membrane source to the expanding autophagosome49.

MYO1C is important for lipid raft recyling and trafficking, therefore in part governing the membrane composition of autophagosomes which is crucial for autophagosome-lysosme fusion50,51. MYO6 functions to link endocytosis with autophagy as it is able to bind to adaptors on early endosomes and various autophagy receptors on the autophagosome membrane, thus bringing these two membrane sources into contact for fusion52.

1.8 MYO6

MYO6 is an unconventional myosin that hydroylzes ATP to move along actin in the minus, or pointed-end direction53. Although MYO6 plays a role in autophagy, it is also involved in selective autophagy. Previous studies have shown MYO6 is able to bind to multiple autophagy/mitophagy receptors such as TAX1BP1, NDP52, and Optineurin to promote autophagy of bacterial pathogens54–56. Autophagy receptors contain LIR motifs to bind LC3 and many contain ubiquitin binding domains (UBD) that allow autophagy receptors to bridge the autophagosome marked by LC3 with ubiquitinated autophagic cargo or mitochondria. Importantly, MYO6 and its adapter TOM1 were found to interact

10 with Parkin in response to mitochondrial stress, providing evidence that MYO6 may be involved in mitophagy57. Finally, a more recent study revealed that MYO6 is able to form a complex with Parkin through its UBD and is recruited to damaged mitochondria56. They reveal MYO6 promotes the formation of an actin “cage” that resembles a ring-like structure around damaged mitochondria to prevent refusion with healthy mitochondria56.

These findings led Kruppa and colleagues to propose a model by which MYO6 bound to mitochondria functions as a tether between mitochondria and the actin cytoskeleton to faciliate actin cage formation around depolarized mitochondria. However, the answer to the question of how actin cages are removed or disassembled to allow encapsulation by the autophagosome remains unknown.

1.9 GRAF1

GRAF1 (GAP for Rho Associated with FAK) is a member of the Rho GAP family that functions to limit RhoA activity. GRAF1’s multi-domain structure allow GRAF1 to regulate lipid and actin dynamics. The BAR-PH domain in concert function to regulate

GRAF1 in an autoinhibitory fashion to block GRAF1’s GAP domain58. Furthermore, the

BAR domain is responsible for GRAF1 membrane binding and bending. The GAP domain is able to turn off RhoA activity through promoting GTP-hydrolysis, leading to actin depolymerization. The C-terminal SH3 domain is responsible for protein binding such as with FAK and Dynamin59,60. Therefore, GRAF1 is perfectly suited to regulate actin and membrane dynamics necessary during mitophagy.

Our lab has shown GRAF1 is expressed in highly metabolic tissues such as the brain, brown adipose tissue, and striated muscle. Moreover, we have revealed GRAF1 regulates myoblast fusion in a GAP and BAR domain-dependent manner in vitro,

11 indicating GRAF1 dependent actin remodeling and membrane sculpting drive myogenesis61. In addition, depletion of GRAF1 in X. laevis tadpoles results in cardiomyopathy, reduced mobility, and small, irregular shaped mitochondria. Unstressed

GRAF1 depleted mice appear normal but exhibit cardiac and skeletal muscle degeneration in response to stress. Recently, our lab has observed a role for GRAF1 positive regulation of PINK1/Parkin-mediated mitophagy (unpublished). Upon GRAF1 knockdown in HeLa cells, we observe a marked increase in mitochondrial markers compared to control in response to mitochondrial stress, indicating a defect in mitochondrial degradation (unpublished). Finally, mass spectrometry analysis of GRAF1 in response to oligo/antimycin (electron transport chain inhibitors) revealed GRAF1 binds to multiple unconventional myosins: MYO10, MYH14, MYO5A, and MYO5B

(unpublished). Since GRAF1 is a known regulator of actin dyanmics through its negative regulation of RhoA activity, our recent findings that GRAF1 is a positive regulator of

PINK1/Parkin-mediated mitophagy, and that GRAF1 binds to unconventional myosins in response to mitochondrial stress, we hypothesize that GRAF1 may function to depolymerize or promote dissociation of MYO6 dependent actin cages to regulate mitophagy.

CHAPTER 2. RESULTS

2.1 GRAF1 regulates cardiomyocyte viabiliy and forms rings around mitochondria.

Our lab has previous evidence that GRAF1 plays a role in positive role in

PINK1/Parkin-mediated mitophagy (unpublished). Therefore we wanted to test if GRAF1 plays a role in regulating cardiomyocyte viability during stress. To this end we subjected neonatal rat cardiomyocytes (NRCMs) to a protocol of simulated ischemia reperfusion injury (sIR). sIR consited 2 hours of hypoxia (0.1% O2) followed by 8 hours of reperfusion.

We hypothesized depletion of GRAF1 will result in increased cell death in NRCMs following sIR due to GRAF1’s effects on mitochondrial homeostasis. As expected, we saw an increase in cell death following sIR in GRAF1 depleted NRCMs following sIR while no difference was observed in normoxic (Norm) conditions (Fig. 2A), indicating GRAF1 regulates cardiomyocyte viability in response to sIR.

We next wanted to observe GRAF1 localization in response to mitochondrial stress. To this end, we stained NRCMs with endogenous GRAF1 and HSP60, a mitochondrial matrix protein, and observed their localization using confocal microscopy in the prescence or absence of carbonyl cyanide m-chlorophenyl hydrazone (CCCP), a proton gradient uncoupler to induce mitochondrial stress. Strinkingly, we observed

GRAF1 “ring” like structures around HSP60 puncta, which closely resemble the

MYO6/actin rings observed by Kruppa et al.56 in response to 2h CCCP (Fig. 2B). These results reveal GRAF1 is recruited to mitochondria during mitochondrial depolarization.

2.2 GRAF1 colocalizes and interacts with MYO6.

As we saw that GRAF1 interacts with unconventional myosins in response to mitochondrial depolarization by mass spectrometry (unpublished), we wanted to test if

GRAF1 colocalizes with MYO6 in response to CCCP treament. We transfected Parkin expressing HeLa (Parkin-Hela) cells, a widely used cell model to study mitophagy with

GFP-MYO6 and treated the cells with dimethyl sulfoxide (DMSO) as control or 10µM

CCCP for 2h to induce mitochondrial depolarization. We hypothesized mitochondrial stress will increase the colocalization of GRAF1 and MYO6. Using confocal microscopy, we saw a diffuse and cytosolic staining pattern of endogenous GRAF1, GFP-MYO6, and

Parkin with DMSO treatment (Fig. 3A). However, upon 2h CCCP treatment, we observed striking colocalization between endogenous GRAF1 and GFP-MYO6 on Parkin positive structures (Fig. 3B). These results suggest that upon mitochondrial depolarization,

GRAF1 and MYO6 colocalize on Parkin positive mitochondria.

To further confirm if GRAF1 and MYO6 interact we performed immunoprecipitation experiments. To this end, we transfected Cos7 cells with GFP-MYO6 and FLAG-GRAF1 and used GFP antibody to pulldown MYO6. Surpisingly, we observed GRAF1 and GFP-

MYO6 interaction basally and this was independent of mitochondrial depolarization (Fig.

4A), as we hypothesized that mitochondrial depolarization would enhance their interaction. Furthermore, since GRAF1 regulates actin polymerization through its effects on RhoA and MYO6 is able to bind actin, we wanted to test if GRAF1-MYO6 interaction is dependent on actin dynamics. Therefore, we treated Cos7 cells with latrunculin B, an actin depolymerizing agent and performed immunoprecipitation to observe GRAF1-

MYO6 interaction. Indeed, blocking actin dynamics with latrunculin B greatly dimished the interaction between GRAF1 and MYO6 (Fig. 4B). These results indicate that GRAF1 and

MYO6 are able to form a complex independently of mitochondrial depolarization and this interaction is dependent on actin dynamics in Cos7 cells.

2.3 GRAF1 restores mitochondrial morphology following insult

Kruppa et al. propose that MYO6 dependent actin cages function to sequester damaged mitochondria so they are unable to refuse with healthy mitochondria. Upon inhibition of actin cage formation, Kruppa et al. observed an increase in healthy

“networked” mitochondria compared to untreated cells that had a high population of

“clustered” or unhealthy mitochondria following treatment with CCCP and 3 hours of washout56. Therefore, we hypothesized that GRAF1 will promote an increase in network mitochondria following mitochondrial insult and washout. To this end, we used siRNA transfection to knockdown GRAF1 in Parkin-HeLa cells and quantified mitochondrial morphology as either “clustered”, “intermediate”, or “network” (examples shown in Fig.

5A) following 2h CCCP treament and washout. We observed an increase of clustered mitochondria with a concomitant decrease in network mitochondria in GRAF1 knockdown cells most strikingly at 3 and 4 hours after washout compared to control (Fig. 5B-C). These results suggest GRAF1 functions to promote dissolution of actin cages following mitochondrial insult.

We next wanted to test if GRAF1 also regulates mitochondrial morphology following CCCP treatment and washout in cardiomyocytes. To this end, we depleted

GRAF1 in NRCMs and followed the experimental protocol as described above. However, we only examined 4 hours post washout and we also quantified mitochondrial morphology as clustered or diffuse as our HSP60 antibody did not have a network/tubular mitochondrial staining pattern (examples shown in Fig. 6B). As predicted, GRAF1

15 depleted NRCMs had an increased in clustered and decrease in diffuse HSP60 staining compared to controls following 2h CCCP treatment and 4h washout (Fig. 6A-B), indicating

GRAF1 also regulates mitochondrial morphology following mitochondrial depolarization and washout.

2.4 GRAF1 regulates MYO6 dissociation from mitochondria

Since we observed an increase in clustered mitochondria in GRAF1 depleted cells following CCPP treatment and washout, we wanted to test if GRAF1 regulates MYO6 localization to mitochondria. We hypothesized that GRAF1 dissociation of MYO6 dependent actin cages will “release” MYO6 from mitochondria, thus decreasing MYO6 localization with mitochondria. To this end, we depleted GRAF1 in Parkin-HeLa cells and used confocal microscopy to quantify the colocalization of GFP-MYO6 and mitochondria stained with TOM20. With DMSO treatment, we saw little to no colocalization of GFP-

MYO6 with TOM20 in control cells (7A-B). Surprisingly, we saw a significant increase in

GFP-MYO6/TOM20 colocalization with DMSO treatment in GRAF1-deficient cells, indicating basal defects in mitophagy upon GRAF1 depletion (Fig 7A-B). After 2 hours of

CCCP treatment, localization of GFP-MYO6 and TOM20 was observed at similar levels in both control and GRAF1 knockout cells (Fig. 7A and 7C). As expected, after a 4 hour washout, GRAF1 depleted cells had a significantly increased colocalization of GFP-

MYO6 and TOM20 compared to control cells (Fig 7A and 7D). These results reveal

GRAF1 functions to promote MYO6 dissociation from depoloarized mitochondria.

2.5 GRAF1 regulates mitochondrial function during OXPHOS

As we observed GRAF1 regulating mitochondrial morphology following insult, we next wanted to ask if GRAF1 regulates mitochondrial function. Furthermore, we wanted

16 to test if GRAF1 is important for mitochondrial function during growth conditions that require mitochondrial dependent oxidative phosphorylation (OXPHOS) to generate energy. In glucose containing media, cells derive most of their ATP from from glycolysis, however when introduced to galactose, cells must switch to mitochondrial dependent

OXPHOS to generate ATP, allowing us to examine if GRAF1 is necessary for mitochondrial function under OXPHOS conditions. For these experiments we switched to

HEK293T cells as our preliminary studies revealed that Parkin-Hela cells fail to grow in galactose containing media (data not shown). GRAF1 was depleted using siRNAs in

HEK293T cells (Fig. 8A) and mitochondrial function was measured at various timepoints following culture in glucose or galactose containing media. We measured the overall ATP levels and activity of complex II (electron transport chain) using Cell-TiterGlo and WST1 assays respectively. We hypothesized that GRAF1 deficient cells would have reduced mitochondrial function follwing culture in galactose containing media and no difference in glucose. As expected, we observed a significant decrease in total Complex II activity (Fig.

8B) and ATP levels (Fig. 8C) in GRAF1 depleted HEK293T cells cultured in galactose media (red bars). While complex II activity and ATP levels were decreased in GRAF1 knockdown cells cultured in glucose media at days 3 and 4 compared to control, the the decrease was insignificant and levels were comparable to control by day 5 (Fig 8B and

8C black bar). These results indicate that GRAF1 is important to maintain healthy and functional mitochondrial population for cell growth in OXPHOS dependent conditions.

CHAPTER 3. DISCUSSION

During mitochondrial stress, MYO6 dependent actin cages form around damaged mitochondria to prevent refusion with healthy mitochondria. However, the mechanism regulating the depolymerization of actin cages surrounding damaged mitochondria remains unknown. Here we show that GRAF1 interacts with MYO6, promotes mitochondrial network reformation following insult, regulates MYO6 detachment from mitochondria and is important for mitochondrial function during OXPHOS.

Previously our lab revealed GRAF1 bound to several unconventional myosins following mitochondrial depoloraization. Furthermore, GRAF1 is also known to bind to the unconventional myosin, MYO16. In this study we report GRAF1 is able to interact with MYO6 in Cos7 cells basally and with CCCP treatment. Recently, the Buss group utilizied proximity labelling proteomics to map the MYO6 interactome62. Although they did not uncover GRAF1 in their study, they observed MYO6 binding to protein members responsible for early endosome positioning and mobiliy dependent on RHO mediated actin polymerization. Furthermore, they confirm MYO6 is able to bind to the RHOGEF

LARG, which activates RhoA activity. This line of evidence suggests GRAF1 may interact with MYO6 through a complex that may be localized to endosomes, as GRAF1 is also known to be localized to endosomes, or a complex responsible for regulation of

RhoA activation. Since both GRAF1 and MYO6 have been shown to localize on endosomes, they may be trafficked to mitochondria simultaneously. However, this leads to the question of the order of events. Is MYO6 first recruited to Parkin positive

18 mitochondria then GRAF1 to dissociate the actin cages or are they recruited in tandem and GRAF1 is sequentially activated once the cages need to be removed?

We show GRAF1 restores mitochondrial morphology following CCCP treatment and washout in both Parkin-HeLa and NRCM cells. Clearly actin plays a critical role in mitophagy as Kruppa et al. show actin cages form around depolarized mitochondria to sequester them from the healthy population56. Recently, Moore et al. report rapid cyclic actin assembly and disassembly around the cell mitochondria. Moore and colleagues propose that disassembly of mitochondrial localized actin promotes rapid mitochondrial fusion63. Both these studies propose actin polymerization around mitochondria prevents their refusion with otherwise healthy mitochondria. We show that upon GRAF1 knockdown, there is a decrease in networked mitochondria following CCCP and washout, indicating GRAF1 depleted cells may have smaller mitochondria and thus reduced fusion due to the prescence of anti-fusogenic actin cages. Our results agree with these models as we observe GRAF1 promotes a networked mitochondrial morphology following depolarization, although we did not quantify mitochondrial area.

Upon GRAF1 knockdown, we saw an increase in MYO6 association with the mitochondrial marker TOM20 following CCCP treatment and washout compared to control. Similarly, Kruppa et al. observed a decrease in MYO6 localization to mitochondria when actin polymerization was inhibited or when MYO6’s ubiquitin binding domain (responsible for mitochondrial targeting) was mutated56. Although we observe a basal increase in MYO6-TOM20 localization in GRAF1 knockdown cells (Fig. 7A-B), indicating basal mitophagic defects, MYO6 remains localized to mitochondria even after

4 hours after washout in GRAF1 depleted cells. From these findings, we propose that 1)

GRAF1 binding to MYO6 on depolarized mitochondria is able to displace MYO6 from its role as a tether from damaged mitochondria to the actin cytoskeleton, leading to collapse of the actin cage or 2) GRAF1 dependent depolymerization of actin cages leads to MYO6 dissociation from damaged mitochondria.

We also reveal GRAF1 regulates mitochondrial function during OXPHOS conditions. These results are consistent with what Kruppa et al. report when they disrupt mitophagy via MYO6 knockdown56. Although, they use cell confluency as their endpoint marker, we utilized WST-1 (mitochondrial complex II activity) and CellTiter-Glo (total

ATP) as our endpoints. After 5 days we observed a significant decrease in the WST-1 measurement in GRAF1 deficient cells grown in galactose and a slighlty decreased but insiginficant change with glucose. These findings are in agreement with Kruppa et al. as they report lagging growth in MYO6 knockdown HEK293T cells that eventually reaches confluency levels comparable to control.

A major limitation of this study is we had difficulty imaging actin in Parkin-HeLa cells. We were unable to observe actin cage formation in Parkin-HeLa which may be due to lack of resolution with a LSM-700 confocal microscope, while Kruppa et al identified actin cage structures around mitochondria in HA-Parkin expressing HeLa cells using super resolution microscopy56. Furthermore, we did not observe an increase in GRAF1 and MYO6 interaction upon CCCP treatment in Cos7 cells as we expected, indicating they may interact basally, even though we saw little colocalization between

GRAF1 and MYO6 using microscopy in Parkin-HeLa cells. Additionally, we were unable to detect any interaction between GRAF1 and MYO6 in Parkin-Hela cells as we hypothesized that Parkin expression would be able to increase GRAF1-MYO6

20 interaction (data not shown). The best model for this study would be to observe endogenous GRAF1 and MYO6 interaction in NRCMs, however we do not have any

MYO6 antibodies and NRCMs are difficult to transfect with plasmids. Finally, when quantifying mitochondrial morphology in NRCMs, we had difficulty observing network like staining using our TOM20 antibody, therefore we used HSP60, a mitochondrial matrix protein that has a punctate staining pattern, hence we quantified mitochondrial morphology as either clustered or diffuse.

One important unaddressed question in our study is if the GAP domain of

GRAF1 is responsible for regulation of mitochondrial quality control. GRAF1’s GAP domain is critical for turning off RhoA activity. Therefore, understanding if the GAP domain is involved will reveal if RhoA activity is important for actin cage assembly around mitochondria. One approach is to transfect GRAF1 depleted Parkin-HeLa cells with GAP mutant GRAF1 and observe if GAP mutant GRAF1 is able to rescue GRAF1 deficency in regards to mitophagy. Although Kruppa et al. report RhoA is not important for actin cage assembly, they show cdc42 inhibition blocks cage formation56, suggesting

GRAF1 may act on cdc42 instead of RhoA in this specific process.

More direct approaches to quantifiy if GRAF1 regulates the formation or dissasembly of actin cages directly, and not through measuring mitochondrial morphology/network will also be required for future studies. Using confocal microscopy we had difficulty observing actin cages around mitochondria in Parkin-HeLa and

NRCMs. Therefore, a critical next step would be to use super resolution microscopy to quantify actin cage formation and dynamics in the prescence or absence of GRAF1.

Additionally, it will be central to address how CCCP or other inducers of mitochondrial

21 stress effect changes in actin dynamics or sarcomere structure in muscle cells and if these changes are dependent on GRAF1. It has been reported that when apoptosis or mitochondrial depolarization is induced in human breast cancer cells G-actin is responsible for mitochondrial fission and downstream mitophagy64. By performing actin fractionation experiments we can test if GRAF1 regulates the ratio of globular and filamentous actin in response to mitophagy and perfom imaging studies to observe changes in sarcomere organization upon GRAF1 depletion in NRCMs. Finally, as mentioned previously that actin polymerization is important for autophagosome- lyososme fusion48, it will be interesting to see if GRAF1 is transiently localized at these sites to promote depolymerization post fusion.

In summary, we provide evidence that GRAF1 regulates mitochondrial quality control through its ability to promote MYO6 dependent actin cage dissociation (Fig. 9).

We reveal GRAF1 binds to MYO6 in an actin dependent manner, restores mitochondrial morphology following mitochondrial depolarization and regulates mitochondrial function during OXPHOS. These studies further our understanding of the importance GRAF1 and its regulation of actin dynamics in regards to mitochondrial quality control.

Figure 1. Mitochondrial control pathways. Various mitochondrial quality control pathways are depicted, in order of damage required to trigger the given pathway. (A) Oxidized proteins trigger local recruitment of mitochondrial derived vesicles (MDVs) and subsequent scission mediated by DRP-1. Known cargo include translocase of the outer membrane 20 (TOM20) and pyruvate dehydrogenase (PDH). (B) Localized mitochondrial stress induces piecemeal mitophagy. This requires omegasome recruitment from the ER and subsequent DRP-1 mediated fission of the damaged mitochondrial segment. (C) Mitochondrial depolarization can induce endosome- assisted degradation, resulting in early endosomal recruitment (marked by RAB5) and engulfment of damaged mitochondria. Importantly, this pathway is faster than mitophagy. (D) Global depolarization triggers mitophagy of the entire organelle. Adapted from McLelland et al., Current Opinion in Physiology 2018, 3:25–33.

Figure 2. GRAF1 regulates cardiomyocyte viability and forms rings around mitochondria. (A) NRCMs were depleted of GRAF1 and subjected to normoxia (Norm) or simulated ischemia-reperfusion (sI/R). Cell death was measured by LDH release. Data is representative of 3 independent experiments. ****p<0.0001 (B) NRCMs were treated with DMSO control or 10µM CCCP for 2h. Cells were then fixed and immunostained for endogenous GRAF1 and mitochondria stained with HSP60. Images were acquired by confocal microscopy. Arrows point to examples of GRAF1 “rings” around HSP60 puncta.

Figure 3. MYO6 colocalizes with GRAF1 on Parkin positive structures.

Parkin-HeLa cells were transfected with GFP-MYO6, 24h after cells were treated with DMSO (A) control or (B) 10µM CCCP for 2h. Cells were fixed in 4% PFA and immunostained for endogenous GRAF1 and Parkin. Images were acquired by confocal microscopy and are representative of 3 independent experiments.

Figure 4. GRAF1 interacts with MYO6 and is dependent on actin polymerization. (A) Cos7 cells were transfected with indicated plasmids for 24h, then treated with DMSO or 10µM CCCP for 2h or (B) 1µM Latrunculin-B with for 2h. Lysates were collected after treatment and immunoprecipitated with antibodies against FLAG and immunoblotted for GFP. Blots are representative of 3 independent experiments.

Figure 5. GRAF1 restores mitochondrial morphology following CCCP treatment. (A) Representative images of clustered, intermediate, and network mitochondrial morphology (B) Control or GRAF1 knockdown Parkin-HeLa cells were treated for 2 h with 10µM CCCP. After washout, cells were fixed at indicated timepoints, stained with TOM20 to visualize mitochondria and imaged by confocal microscopy. Images were scored according to mitochondrial morphology: Network, intermediate, or clustered. Error bars represent S.E.M. GRAF1 knockdown is compared to control of the same time for each morphology. n= 3 experiments with >300 cells counted per condition. * represents p<0.05, **p<0.01, **** p<0.0001 (C) Representative confocal images of mitochondria taken at 0 and 3 hours after washout. Arrowheads represent clustered, white arrows represent intermediate, and yellow arrows represent networked mitochondrial morphologies.

Figure 6. GRAF1 restores mitochondrial morphology in cardiomyocytes. (A) NRCMs were depleted of GRAF1 and treated with 10µM CCCP for 2h or 2h CCCP with a 4h washout. Cells were then fixed and stained with HSP60 and phalloidin to visualize cell outline. Cells were quantified by HSP60 staining pattern as either clustered or diffuse. n=3 experiments with 100 cells counted per condition. Error bars represent S.E.M. **** p<.0001, ns =not significant. (B) Representative confocal images. Arrows represent “diffuse” mitochondria and arrowheads represent “clustered” mitochondria.

Figure 7. GRAF1 regulates MYO6 dissociation from mitochondria. (A) Parkin-Hela cells were depleted of GRAF1 for 72 hours and transfected with GFP-MYO6 for 24 hours. Cells were then treated with DMSO control, 2h 10µM CCCP or 2h CCCP + 4h wash. Cells were then fixed with 4% PFA and immunostained for endogenous TOM20 and imaged with a confocal microscope. TOM20 and GFP-MYO6 colocalization was quantified using the JACOP plugin on IMAGEJ. n= 50 cells per condition obtained from 3 independent experiments. Error bars represent S.E.M. **p<0.01, **** p<0.0001. Representative confocal images of Parkin-HeLa cells immunostained for TOM20 and overexpressing GFP- MYO6 with (B) DMSO, (C) 2h CCCP, (D) 2h CCCP + wash.

Figure 8. GRAF1 regulates mitochondrial function. (A) Western blot confirming knockdown of GRAF1 in HEK293T cells. (B) and (C) HEK293T cells were depleted of GRAF1 and mitochondrial function was assessed by WST-1 assay (B) and CellTiter-GLO (C) at indicated time points in glucose (black) or galactose (red) growth media. n=3 experiments, error bars represent S.E.M. *p<0.05, **** p<0.0001.

Figure 9. Schematic model of GRAF1 and MYO6 dependent actin cages. (A) After mitochondrial depolarization, Parkin (green) is recruited to damaged mitochondria (red) where it ubiquitinates outer membrane proteins, subsequently recruiting MYO6 (purple) through ubiquitin binding. MYO6 then promotes formation of actin cages (red) to isolate damage mitochondria. Next, GRAF1 is recruited to mitochondria via Parkin, and either depolymerizes actin cages or binds to MYO6, destabilizing MYO6/Parkin/interaction resulting in dissociation of actin cages and eventual degradation of damaged mitochondria in the lysosome. (B) Without GRAF1, actin cages are unable to dissociate from damaged mitochondria leading to an accumulation of damaged mitochondria isolated by actin cages that are unable to fuse with the lysosome.

CHAPTER 4. MATERIALS AND METHODS

Cell Culture COS7 and Parkin-HeLa cells were cultured using Dulbecco’s Modified

Eagle Medium (DMEM, Gibco® Life Technologies) supplemented with 10% foetal bovine serum (FBS) and 1% PenStrep (penicillin-streptomycin). HEK293T cells were cultured using DMEM 1x (Corning) media supplemented with 2mM L-Glutamine,1x

MEM Non-Essential Amino Acids (Gibco® Life Technologies), 10% FBS and 1%

PenStrep. Cells were maintained at 37°C in 5% CO2.

NRCM Isolation and Culture NRCMs were isolated from 2- to 3-day-old Wistar rats using the Neonatal Cardiomyocyte Isolation System (Worthington). Cells were plated on fibronectin-coated dishes and cultured in Media 199 supplemented with 15% FBS, 1% penicillin/streptomycin, and 100 μM BrdU for 24 h and then switched to serum-free

Medium 199 with 1% penicillin/streptomycin.

Simulated Ischemia Reperfusion sI/R was initiated by incubating NRCMs in ischemic buffer (125mM NaCl, 8mM KCl, 1.2mM KH2PO4, 1.25mM MgSO4, 1.2mM CaCl2,

6.25mM NaHCO3,20mM 2- deoxyglucose, 5mM Na-lactate, 20mM HEPES, pH 6.6) and placing plates into a hypoxia chamber equilibrated to 0.1% O2 for 2 hours. Reperfusion was initiated by changing to Krebs–Henseleit buffer (110mM NaCl, 4.7mM KCl, 1.2mM

KH2PO4, 1.25mM MgSO4, 1.2mM CaCl2, 25mM NaHCO3, 15mM glucose, 20mM

HEPES pH 7.4) for 8 hours. Normoxic control cells were maintained in Krebs–Henseleit buffer throughout the experiment.

Transfection COS7 cells were transfected using TransIT-LT1 (Mirus Bio). Cells were

60% confluent before transfection in DMEM without FBS and PenStrep. Cells were harvested or treated 24 hours after transfection. Parkin-Hela cells were transfected using Lipofectamine-2000 (Life Technologies) in OPTI-MEM media following manufacturers instructions. Cells were transfected at 90% confluency and treated 24 hours after transfection.

siRNA Transfection For knockdown, Parkin-HeLa and HEK293T cells were transfected with pooled siRNAs targeting GRAF1( 5’ UCUUCACUUU CUAU CACC

AUGGUUA 3’; and 5’ CAUUUCUAUGAAGUAUCCCUGGAAU 3’) using Lipofectamine

RNAiMAX (Thermo-Fisher). For knockdown of GRAF1 in NRCMs, a single siRNA targeting GRAF1 was used (5’ CGGAAGUUUGCAGAUUCCUUAAAUG 3’) using

HiPerFect transfection reagent (Qiagen). A second transfection was performed 48 hours after to ensure efficient knockdown in NRCMs.

Antibodies, Plasmids, and Reagents The following antibodies were used: mouse anti

TOM20 (1:100; Santa Cruz; sc-17764), rabbit anti HSP60 (1:50; Santa Cruz; sc-13115), rabbit anti GRAF1 (1:250; homemade), monoclonal mouse anti FLAG M2 (4ug per immunprecipitation; Sigma; F1804), monoclonal mouse anti FLAG M5 (1:1000; Sigma;

F4042), polyclonal rabbit anti GFP (1:500; Invitrogen; A11122), monoclonal mouse anti

Parkin (1:250; Cell Signaling Technology; 4211), monoclonal rabbit anti GAPDH

(1:1000; Cell Signaling Technology; 5174S), and monoclonal mouse anti B-actin

(1:1000; Cell Signaling Technology; 3700). The following plasmids were used: GFP-

MYO6 (gift from Dr. Cheney, UNC-Chapel Hill), FLAG-GRAF1 (Addgene); FLAG-AB

(Addgene). The following reagents were used: Carbonyl cyanide 3- chlorophenylhydrazone (Sigma) and latrunculin-B (Sigma)

Imagining and Image Analysis Images were acquired with a Zeiss LSM 700 confocal microscope and a Plan Apo 40×/1.4 or APO 63x NA oil objective. Images were analyzed using FIJI ImageJ. Colocalization was quantified using the JACOP plugin and colocalization expressed as the overlap coefficient between TOM20 and MYO6.

Immunofluorescence Following treatment, cells were fixed in 4% paraformaldhyde for

15 minutes at room temperature. Parkin-HeLa cells were permeabilzed with 0.4%

Triton-X in PBS for 3 minutes and NRCMs were permabilized in 0.1M glycine + 0.1% saponin in PBS for 15 minutes. Following permabilization, Parkin-HeLa cells were blocked for 1 hour in 20% normal goat serum and 3% BSA and NRCMs blocked in 10% normal goat serum. Indicated primary antibodies were diluted in appropriate blocking buffer and incubated for 1 hour at room temperature. Indicated secondary antibodies were diluted in PBS and incubated for 1 hour at room temperature. Slides were mounted with Prolong Diamond Antifade Mountant (Invitrogen) using No 1.5 coverslips

(Ted Pella).

Immunoprecipitation and Immunoblotting Protein extracts were prepared from cultured cells using CHAPS (0.8% CHAPS, 10% glycerol, 50mM HEPES, 150mM

NaCl, 1mM EDTA, pH 7.25) lysis buffer supplemented with HaltTM protease and phosphatase inhibitor mixtures (Thermo Scientific), and protein concentration was measured using the Pierce BCA protein assay kit (Thermo Scientific). Protein lysates

(500 μg to 1 mg) were incubated with mouse 4ug per condition anti-M2 FLAG (Sigma

F1804) bound with Dynabeads® Protein G (Life Technologies, Inc.) at 4 °C overnight.

Precipitated protein complexes were eluted by boiling in sample buffer for 5 min. For immunoblotting, protein lysates (10–50 μg of protein) were separated by SDS-PAGE, transferred to PVDF membranes, and blotted with indicated antibodies.

CellTiter-Glo and WST1 Assays HEK293T cells were depleted of GRAF1 as described above. 48 Hours after transfection, cells were reverse transfected with

GRAF1 siRNAs to further ensure efficient knockdown following manufactuerer’s instructions (Lipofectamine RNAiMAX, Thermofisher Scientific). Cells were plated at

15,000 cells per well in a 96 well plate directly into Minimum Essential Medium Eagle

(Simga-Aldrich) supplemented with 10% FBS, 1mM sodium pyruvate, 2mM L-

Glutamine, 1% PenStrep and either 4.5g/L glucose (Sigma) or 10mM galactose

(Sigma). CellTiter-Glo (Promega) and WST-1 (Roche) assays were perfomed following manufacturer’s instructions at indicated times following reverse transfection.

Statsical Analysis All statisical analysis was performed using Two-Way ANOVA followed by a Tukey multiple-comparison post-hoc test. All data are expressed as mean

± S.E.M. and p values <0.05 were considered statisically significant. All experiments were repeated in triplicate or more.

REFERENCES 1. Mozaffarian, D. et al. Heart disease and stroke statistics-2015 update : A report from the American Heart Association. Circulation 131, (2015). 2. Buja, L. M. Myocardial ischemia and reperfusion injury. Cardiovasc. Pathol. 14, 170–175 (2005). 3. Mizushima, N. Autophagy : process and function. Genes Dev. 21, 2861–2873 (2007). 4. Saha, S., Panigrahi, D. P., Patil, S. & Bhutia, S. K. Autophagy in health and diease: A comprehensive review. Biomed. Pharmacother. 104, 485–495 (2018). 5. Hurley, J. H. & Young, L. N. Mechanisms of Autophagy Initiation. Annu. Rev. Biochem 86, 225–244 (2017). 6. Komatsu, M. & Ichimura, Y. Selective autophagy regulates various cellular functions. Genes to Cells 15, 923–933 (2010). 7. Johansen, T. & Lamark, T. Selective autophagy mediated by autophagic adapter proteins. Autophagy 7, 279–96 (2011). 8. Greene, A. W. et al. Mitochondrial processing peptidase regulates PINK1 processing, import and Parkin recruitment. EMBO Rep. 13, 378–385 (2012). 9. Soubannier, V. et al. A Vesicular Transport Pathway Shuttles Cargo from Mitochondria to Lysosomes. Curr. Biol. 22, 135–141 (2012). 10. Sugiura, A., Mclelland, G., Fon, E. A. & Mcbride, H. M. A new pathway for mitochondrial quality control : mitochondrial-derived vesicles. EMBO J. 33, 2142– 2156 (2014). 11. Yang, J. Y. & Yang, W. Y. Bit-by-bit autophagic removal of parkin-labelled mitochondria. Nat. Commun. 4, 1–8 (2013). 12. Le Guerroue, F. et al. Autophagosomal Content Profiling Reveals an LC3C- Dependent Piecemeal Mitophagy Pathway Short Article Autophagosomal Content Profiling Reveals an LC3C-Dependent Piecemeal Mitophagy Pathway. Mol. Cell 68, 786–796 (2017). 13. Hammerling, B. C. et al. A Rab5 endosomal pathway mediates Parkin-dependent mitochondrial clearance. Nat. Commun. (2017). doi:10.1038/ncomms14050 14. Eiyama, A. & Okamoto, K. PINK1 / Parkin-mediated mitophagy in mammalian cells. Curr. Opin. Cell Biol. 33, 95–101 (2015). 15. Yamano, K. & Youle, R. J. PINK1 is degraded through the N-end rule pathway. Autophagy 9, 1758–1769 (2013). 16. Okatsu, K. et al. PINK1 autophosphorylation upon membrane potential dissipation is essential for Parink recruitment to damaged mitochondria. Nat. Commun. 3, 1010–1016 (2012).

17. Youle, R. J. & Narendra, D. P. Mechanisms of mitophagy. Nat. Publ. Gr. 12, 9–14 (2011). 18. Kane, L. A. et al. PINK1 phosphorylates ubiquitin to activate Parkin E3 ubiquitin ligase activity. J. Cell Biol. 205, 143–153 (2014). 19. Koyano, F. et al. Ubiquitin is phosphorylated by PINK1 to activate parkin. Nature 510, 162–166 (2014). 20. Geisler, S. et al. PINK1 / Parkin-mediated mitophagy is dependent on VDAC1 and p62 / SQSTM1. Nat. Cell Biol. 12, 119–131 (2010). 21. Narendra, D. P., Kane, L. A., Hauser, D. N., Fearnley, I. M. & Youle, R. J. p62 / SQSTM1 is required for Parkin-induced mitochondrial clustering but not mitophagy ; VDAC1 is dispensable for both. Autophagy 6, 1090–1106 (2010). 22. Archer, S. L. Mitochondrial Dynamics — Mitochondrial Fission and Fusion in Human Diseases. N. Engl. J. Med. 369, 2236–2251 (2013). 23. Chan, D. C. Mitochondrial Fusion and Fission in Mammals. Annu. Rev. Cell Dev. Biol 22, 79–99 (2006). 24. Vasquez-Trincado, C. et al. Mitochondrial dynamics , mitophagy and cardiovascular disease. J. Physiol. 3, 509–525 (2016). 25. Delettre, C. et al. Mutation spectrum and splicing variants in the OPA1 gene. Hum. Genet. 109, 584–591 (2001). 26. Song, Z., Chen, H., Fiket, M., Alexander, C. & Chan, D. C. OPA1 processing controls mitochondrial fusion and is regulated by mRNA splicing, membrane potential, and Yme1L. J. Cell Biol. 178, 749–755 (2007). 27. Ni, H. M., Williams, J. A. & Ding, W. X. Mitochondrial dynamics and mitochondrial quality control. Redox Biol. 4, 6–13 (2015). 28. Bossy-Wetzel, E., Barsoum, M. J., Godzik, A., Schwarzenbacher, R. & Lipton, S. A. Mitochondrial fission in apoptosis , neurodegeneration and aging. Curr. Opin. Cell Biol. 15, 706–716 (2003). 29. Quintana-Cabrera, R. et al. The cristae modulator Optic atrophy 1 requires mitochondrial ATP synthase oligomers to safeguard mitochondrial function. Nat. Commun. 9, (2018). 30. Twig, G. et al. Fission and selective fusion govern mitochondrial segregation and elimination by autophagy. EMBO J. 27, 433–446 (2008). 31. Ding, W. & Yin, X. Mitophagy : mechanisms, pathophysiological roles, and analysis. Biol. Chem. 393, 547–564 (2012). 32. Chen, Y. & Dorn II, G. W. PINK1-Phosphorylated Mitofusin 2 Is a Parkin Receptor for Culling Damaged Mitochondria. Sci. Rep. 340, 471–476 (2013). 33. Billia, F. et al. PTEN-inducible kinase 1 (PINK1)/Park6 is indispensable for normal

heart function. Proc. Natl. Acad. Sci. 108, 9572–9577 (2011). 34. Kubli, D. A., Quinsay, M. N. & Gustafsson, Å. B. Parkin deficiency results in accumulation of abnormal mitochondria in aging myocytes. Commun. Integr. Biol. 6, 13–14 (2013). 35. Kubli, D. A. et al. Parkin Protein Deficiency Exacerbates Cardiac Injury and Reduces Survival following Myocardial Infarction *. J. Biol. Chem. 288, 915–926 (2013). 36. Siddall, H. K. et al. Loss of PINK1 Increases the Heart’s Vulnerability to Ischemia- Reperfusion Injury. PLoS One 8, (2013). 37. Huang, C. et al. Preconditioning involves selective mitophagy mediated by parkin and p62/SQSTM1. PLoS One 6, (2011). 38. Evans, T. D., Sergin, I., Zhang, X. & Razani, B. Target acquired : Selective autophagy in cardiometabolic disease. Sci. Signal. 10, 1–18 (2017). 39. Koves, T. R. et al. Mitochondrial Overload and Incomplete Fatty Acid Oxidation Contribute to Skeletal Muscle Insulin Resistance. Cell Metab. 7, 45–56 (2008). 40. Liesa, M. & Shirihai, O. S. Review Mitochondrial Dynamics in the Regulation of Nutrient Utilization and Energy Expenditure. Cell Metab. 17, 491–506 (2013). 41. Masiero, E. et al. Autophagy Is Required to Maintain Muscle Mass. Cell Metab. 10, 507–515 (2009). 42. Narumiya, S. & Thumkeo, D. Rho signaling research: history, current status and future directions. FEBS Lett. 592, 1763–1776 (2018). 43. Dee, R. A., Mangum, K. D., Bai, X., Mack, C. P. & Taylor, J. M. Druggable targets in the Rho pathway and their promise for therapeutic control of blood pressure. Pharmacol. Ther. 193, 121–134 (2019). 44. Narumiya, S., Tanji, M. & Ishizaki, T. Rho signaling, ROCK and mDia1, in transformation, metastasis and invasion. Cancer Metastasis Rev. 28, 65–76 (2009). 45. Aplin, A., Tuttle, D. L., Lenk, S. E. & Dunn, W. A. Cytoskeletal Elements Are Required for the Formation and Maturation of Autophagic Vacuoles. J. Cell. Physiol. 152, 458–466 (1992). 46. Aguilera, M. O., Berón, W. & Colombo, M. I. The actin cytoskeleton participates in the early events of autophagosome formation upon starvation induced autophagy. Autophagy 8, 1590–1603 (2012). 47. Mi, N. et al. CapZ regulates autophagosomal membrane shaping by promoting actin assembly inside the isolation membrane. Nat. Cell Biol. 17, 1112–1123 (2015). 48. Lee, J. et al. HDAC6 controls autophagosome maturation essential for ubiquitin- selective quality-control autophagy. EMBO J. 29, 969–980 (2010).

49. Miserey-Lenkei, S. et al. Rab and actomyosin-dependent fission of transport vesicles at the golgi complex. Nat. Cell Biol. 12, 645–654 (2010). 50. Brandstaetter, H., Kendrick-jones, J. & Buss, F. Myo1c regulates lipid raft recycling to control cell spreading , migration and Salmonella invasion. J. Cell Sci. 125, 1991–2003 (2011). 51. Koga, H., Kaushik, S. & Cuervo, A. M. Altered lipid content inhibits autophagic vesicular fusion. FASEB J. 8, 3052–3065 (2010). 52. Tumbarello, D. A. et al. Autophagy receptors link myosin VI to autophagosomes to mediate Tom1-dependent autophagosome maturation and fusion with the lysosome. Nat. Cell Biol. 14, 1024–1035 (2012). 53. Buss, F., Spudich, G. & Kendrick-jones, J. MYOSIN VI : Cellular Functionand Motor Properties. Annu. Rev. Cell Dev. Biol 20, 649–676 (2004). 54. Morriswood, B., Ryzhakov, G., Puri, C., Arden, S. D. & Roberts, R. T6BP and NDP52 are myosin VI binding partners with potential roles in cytokine signalling and cell adhesion. J. Cell Sci. 120, 2574–2585 (2009). 55. Sahlender, D. A. et al. Optineurin links myosin VI to the Golgi complex and is involved in Golgi organization and exocytosis. 169, 285–295 (2005). 56. Kruppa, A. J. et al. Myosin VI-Dependent Actin Cages Encapsulate Parkin- Positive Damaged Mitochondria. Dev. Cell 44, 484-499.e6 (2018). 57. Sarraf, S. A. et al. Landscape of the PARKIN-dependent ubiquitylome in response to mitochondrial depolarization. Nature 496, 372–376 (2013). 58. Eberth, A. et al. A BAR domain-mediated autoinhibitory mechanism for RhoGAPs of the GRAF family. Biochem. J. 417, 371–377 (2009). 59. Hildebrand, J. D., Taylor, J. M. & Parsons, J. T. An SH3 Domain-Containing GTPase-Activating Protein for Rho and Cdc42 Associates with Focal Adhesion Kinase. Mol. Cell. Biol. 16, 3169–3178 (1996). 60. Lundmark, R. et al. Report The GTPase-Activating Protein GRAF1 Regulates the CLIC / GEEC Endocytic Pathway. Curr. Biol. 18, 1802–1808 (2008). 61. Lenhart, K. C. et al. GRAF1 promotes ferlin-dependent myoblast fusion. Dev. Biol. 393, 298–311 (2014). 62. Loughlin, T. O., Masters, T. A. & Buss, F. The MYO 6 interactome reveals adaptor complexes coordinating early endosome and cytoskeletal dynamics. EMBO Rep. 19, (2018). 63. Moore, A. S., Wong, Y. C., Simpson, C. L. & Holzbaur, E. L. F. Dynamic actin cycling through mitochondrial subpopulations locally regulates the fission-fusion balance within mitochondrial networks. Nat. Commun. 7, 1–13 (2016). 64. Li, G. et al. Mitochondrial fission and mitophagy depend on cofilin-mediated actin depolymerization activity at the mitochondrial fission site. Oncogene 37, 1485–

1502 (2018).