Analysis of Shigella Flexneri Cell Surface Virulence Factors

Analysis of Shigella flexneri Cell Surface Virulence Factors

Min Yan Teh B. Sc. (Honours)

Submitted for the degree of Doctor of Philosophy

Discipline of Microbiology and Immunology The School of Molecular and Biomedical Science The University of Adelaide September 2012

Declaration

This work contains no material which has been accepted for the award of any other degree or diploma in any university or other tertiary institution to Min Yan Teh and, to the best of my knowledge and belief, contains no material previously published or written by another person, except where due reference has been made in the text.

I give consent to this copy of my thesis, when deposited in the University Library, being made available for loan and photocopying, subject to the provisions of the Copyright Act 1968.

The author acknowledges that copyright of published works contained within this thesis resides with the copyright holder(s) of those works.

I also give permission for the digital version of my thesis to be made available on the web, via the University’s digital research repository, the Library catalogue, the Australasian Digital Theses Program (ADTP) and also through web search engines, unless permission has been granted by the University to restrict access for a period of time.

Adelaide, Australia, September 2012

______Min Yan Teh

Abstract

The IcsA autotransporter (AT) is a key virulence protein of Shigella flexneri, a human pathogen that causes bacillary dysentery through invasion of colonic epithelium. IcsA is a polarly distributed, outer membrane protein that confers motility to intracellular bacteria by engaging the host actin regulatory protein, neural Wiskott-Aldrich syndrome protein (N- WASP). The activated N-WASP in turn activates Arp2/3 complex, which initiates de novo actin nucleation and polymerisation to form F-actin comet tails and allow actin-based motility (ABM). The N-terminal surface-exposed IcsA passenger -domain (aa 53-758) is responsible for N-WASP interaction, where multiple IcsA regions: aa 185-312 (N-WASP interacting region [IR] I), aa 330-382 (N-WASP IR II) and aa 508-730 (N-WASP IR III), have been suggested to be interacting with N-WASP from previous linker-insertion mutagenesis (IcsAi). A putative autochaperone (AC) region (aa 634-735) located at the C-terminal end of IcsA passenger domain, which forms part of the self-associating AT (SAAT) domain, has been suggested to be required for IcsA biogenesis. IcsAi proteins with linker insertion mutations within the AC region had a significant reduction in production when expressed in smooth lipopolysaccharide (S-LPS) S. flexneri.

This thesis investigated the biogenesis of IcsA, seeking to identify factors that affect IcsA

AC mutant production in the S-LPS background. IcsAi AC mutant production was restored to a wild-type comparable levels in the rough LPS (R-LPS) S. flexneri (that lack the O-antigen component). The same phenotypes were observed in S. flexneri (both S-LPS and R-LPS) expressing site-directed mutagenised IcsA AC protein (aa 716-717). Various approaches were performed to identify the factors that caused different IcsA AC mutant production between S- LPS and R-LPS S. flexneri. Both LPS Oag and DegP (a periplasmic chaperone/protease) were identified to affect IcsA AC mutant production in S-LPS strain, as the IcsA AC mutant production was restored in S. flexneri ΔdegP S-LPS strain. In addition, site-directed mutagenesis of residues Y716 and D717 within the AC region showed that these residues are critical for IcsA production and/or stability in the S-LPS background but not in the R-LPS background.

iii

Another aim of this work was to further define N-WASP IRs II and III via site-directed mutagenesis of specific amino acids. Mutant IcsA protein production level, N-WASP recruitment and F-actin comet tail formation by S-LPS and R-LPS S. flexneri were characterised. Residues 330-331, and residue 382 within N-WASP IR II, and residues 716- 717 within N-WASP IR III, were identified to be involved in N-WASP recruitment. It was shown for the first time that N-WASP activation involves interaction with different regions on different IcsA molecules and hence that oligomeric IcsA is needed for this interaction.

Various “GFP-N-WASP” sub-domain proteins and IcsA protein were over-expressed, purified and used in protein binding assays. These provided preliminary data for protein binding assays which investigate the relationship between N-WASP and IcsA.

Another S. flexneri virulence protein, IcsB, which is involved in preventing autophagy activation by intracellular bacteria was investigated. An S. flexneri 2457T ΔicsB mutant was created and characterised in this study. In this background, the icsB mutation had a less of an effect on plaque formation than reported for another S. flexneri background.

Acknowledgement

I would firstly like to thank my supervisor, Associate Professor Renato Morona. He has been a great mentor, an inspiring and supportive supervisor in the past few years. Thank you for your guidance, patience and knowledge as well as giving me the chance to do my PhD in the Morona Lab. I would especially like to thank Luisa Van Den Bosch for her generous technical assistance, guidance and support during my PhD.

To Dr. Elizabeth Tran, my lovely best friend in and out of the laboratory, many thanks for your support, guidance, laughter and the invaluable friendship. Thank you for proof reading my thesis. I will miss you. To Dr. Marcin Grabowicz, Dr. Kerrie May (aka Mr. & Mrs. Grabowicz), Dr. Maggie Papadopoulos, Dr. Alistair Standish and Dr. Tony Focareta, thank you for your advice and experience. Thank you Tony for sharing your stories about cycling on the road and laughter during morning tea. I will always remember how much you liked to tease me!

To Donald Jiang, Mabel Lum and Pratiti Nath, my buddies in MLS, I am grateful to have you guys as my good friends. My PhD life would not be the same without you. Thanks Donald for being the supplier of cakes and desserts over the years. Thanks Mabel for listening to my whining and proof reading my thesis. I will miss having chips and cake break with you and Pratiti. Thanks to past and present members of the lab for making the lab a fun and enjoyable place to work in.

To Dr. Jactty Chew and May Huey Tan, my two best friends who I met in Adelaide. Your friendship is invaluable. Thank you for being a good listener and hang out buddy. You guys are wonderful. To Chun Chun Young, thanks for being such a lovely friend. You are one of the nicest persons I met in Adelaide! To Dr. Chris Wong, thank you for answering my random questions whenever I stepped into your office .

And finally, I thank my parents in Malaysia and brother, Chun Siong in Singapore, for your endless love, support and encouragement. Thank you for supporting my studies in Adelaide. I v

am sorry for not being able to be by your side in the past few years but you know I love you very much! I could not have done this without you.

Abbreviations

Abbreviations acceptable to the American Society from Microbiology are used without dentition in this thesis. Additional and frequently used abbreviations are defined when first used in the text, and are listed below.

Å Angstroms aa Amino acids ABM Actin-based motility AC Autochaperone Ap Ampicillin ApR Ampicillin resistance Arp Actin-related protein AT Autotransporters ATP Adenosine triphosphate bp Base pairs BAM Beta-barrel assembly machinery -ME -mercaptoethanol Cm Chloramphenicol CmR Chloramphenicol resistance CV Column volume DAPI 4’,6’-diamidino-2-phenylindole DNA Deoxyribonucleic acid DMEM Dulbecco’s modified Eagle medium dNTP Deoxynucleoside triphosphate DSP Dithio-bis(succinimidylpropionate) F-actin Filamentous actin FCS Foetal calf serum g Gravitational units G-actin Globular actin GFP Green fluorescent protein vii

GRR Glycine rich repeat h Hour(s) HMW High molecular weight

IcsAi IcsA linker-insertion mutant

IcsA∆ IcsA deletion mutant IcsA ::BIO IcsA with a BIO tag sequence inserted at aa 87 IF Immunofluorescence IL Interleukin IM Inner membrane IPTG Isopropyl- -D-thiogalactopyranoside kb Kilobases kDa Kilodaltons Km Kanamycin KmR Kanamycin resistance L Litre LB Luria Bertani medium LPS Lipopolysaccharide M Molar m mili M cells Membranous epithelial cells min Minutes mRNA Messenger ribonucleic acid NEB New England Biolabs nt Nucleotide N-WASP Neural Wiskott-Aldrich sundrome protein Oag O-antigen OM Outer membrane OMP Outer membrane protein O/N Overnight PAGE Polyacrylamide electrophoresis

viii

PBS Phosphate buffered saline PCR Polymerase chain reaction PMN Polymorphonuclear R-LPS Rough lipopolysaccharide rpm Revolutions per minute RT Room temperature RUs (Oag) Repeat units SAAT Self-associating autotransporter SAP Shrimp alkaline phosphatase sec Second SD Standard deviation SDS Sodium dodecylsulphate S-LPS Smooth lipopolysaccharide Sm Streptomycin ss Signal sequence S-type Short Oag modal length Tc Tetracycline TcR Tetracycline resistance Tp trimethoprim TpR trimethoprim TCA Trichloroacetic acid TTSS Type three secretion system VL-type Very long Oag modal length WASP Wiskott-Alrich syndrome protein WT Wild-type X-gal 5-bromo-4-chloro-3-indolyl-β-D-galactoside ∆ deletion

Contents

Chapter 1: Introduction ...... 1

1.1 Shigella ...... 1 1.2 Pathogenesis ...... 1 1.3 Innate immune response ...... 4 1.4 IcsA protein – identification and regulation ...... 5 1.4.1 IcsA structure and functional domains ...... 7 1.4.2 The N-terminal signal sequence ...... 8 1.4.3 IcsA passenger α-domain ...... 9 1.4.4 The N-WASP interacting regions ...... 10 1.4.5 IcsP cleavage site ...... 11 1.4.6 IcsB and Atg5 binding region ...... 13 1.4.7 IcsA phosporylation region by protein kinase A ...... 13 1.4.8 IcsA polarity ...... 14 1.4.9 IcsA autochaperone region ...... 14 1.4.10 The translocation β-domain ...... 16 1.5 Translocation of IcsA – cytoplasm to cell surface ...... 16 1.5.1 Translocation across the inner membrane ...... 17 1.5.2 Periplasmic transit ...... 17 1.5.2.1 Periplasmic chaperones ...... 18 1.5.2.2 DegP ...... 18 1.5.2.3 Skp ...... 19 1.5.2.4 SurA ...... 21 1.5.3 Translocation across the outer membrane ...... 22 1.6 Shigella Actin-Based Motility...... 25 1.6.1 Requirement of N-WASP for IcsA-mediated actin assembly ...... 26 1.6.2 N-WASP regulation and activation ...... 27 1.6.3 Arp2/3 complex ...... 30 1.6.4 IcsA-mediated N-WASP activation and actin polymerisation ...... 31

1.6.4.1 Role of WIP ...... 33 1.6.4.2 Role of Cdc42 ...... 33

1.6.4.3 Role of PIP2 ...... 33 1.6.4.4 Role of Toca-1 ...... 34 1.6.4.5 Role of N-WASP proline-rich region ligands Nck, Grb2, and profilin ...... 34 1.6.4.6 Role of Abl tyrosine kinase and N-WASP phosphorylation ...... 35 1.6.5 Role of vinculin in Shigella ABM ...... 35 1.6.6 Role of formin in S. flexneri spreading ...... 36 1.7 Lipopolysaccharide of S. flexneri...... 36 1.7.1 Structure of lipopolysaccharide ...... 36 1.7.2 The LPS biosynthesis pathway ...... 39 1.7.3 Role of LPS O-antigen in ABM and intercellular spreading ...... 40 1.8 Autophagy and intracellular survival of S. flexneri ...... 42 1.8.1 IcsB protein and its role ...... 42 1.8.2 The relationship between IcsA, IcsB and Atg5 ...... 44 1.8.3 The interaction between IcsA, IcsB, Atg5 and N-WASP ...... 46 1.9 Project aims ...... 47 Chapter 2: Materials and Methods ...... 49

2.1 Chemicals, Enzymes and Reagents ...... 49 2.1.1 Buffers and Reagents ...... 49 2.1.2 Enzymes and Chemicals ...... 49 2.1.3 Antibodies ...... 49 2.1.4 Oligonucleotides ...... 49 2.2 Bacterial strains, plasmids and growth media ...... 49 2.2.1 Bacterial strains and plasmids ...... 49 2.2.2 Growth media and conditions ...... 50 2.3 DNA Manipulation ...... 50 2.3.1 Preparation of DNA by heating ...... 50 2.3.2 Preparation of DNA using a kit ...... 50 2.3.3 DNA purification ...... 51 xii

2.3.3.1 DNA gel extraction ...... 51 2.3.3.2 Purification of PCR products ...... 51 2.4 DNA Analysis ...... 51 2.4.1 Agarose gel electrophoresis ...... 51 2.5 In vitro DNA cloning ...... 52 2.5.1 Restriction endonuclease digestion of DNA ...... 52 2.5.2 Shrimp Alkaline Phosphate (SAP) treatment ...... 52 2.5.3 Ligation of DNA fragment into cloning vectors ...... 52 2.6 Polymerase Chain Reaction (PCR) ...... 53 2.6.1 General PCR method ...... 53 2.6.2 Specific gene amplification for cloning ...... 53 2.6.3 DNA sequencing ...... 53 2.6.3.1 Capillary Separation (CS) DNA sequencing ...... 53 2.6.3.2 Purified DNA (PD) DNA sequencing ...... 54 2.6.4 Sequencing Analysis ...... 54 2.7 Bacterial transformation ...... 54 2.7.1 Preparation of chemically competent cells ...... 54 2.7.2 Preparation of electro-competent cells ...... 55 2.7.3 Heat shock transformation ...... 55 2.7.4 Electroporation ...... 55 2.7.5 Conjugation ...... 56 2.8 Construction of virulence plasmid and chromosomal gene mutations ...... 56 2.8.1 Mutagenesis of degP chromosomal gene ...... 56 2.8.2 Mutagenesis of virulence plasmid using -red phage mutagenesis system ...... 57 2.8.3 Multi Site-Directed Mutagenesis ...... 57 2.8.4 Single Site-Directed Mutagenesis ...... 57 2.9 Protein Techniques ...... 58 2.9.1 Preparation of whole cell lysate ...... 58 2.9.2 Trichloroacetic acid precipitation of culture supernatants ...... 58 2.9.3 Limited proteolysis with trypsin ...... 58

xiii

2.9.4 SDS Polyacrylamide Gel Electrophoresis (SDS-PAGE) ...... 59 2.9.5 Coomassie Blue staining ...... 59 2.9.6 Western immunoblotting ...... 59 2.9.7 Protein expression ...... 60 2.9.7.1 Induction of IcsP expression with arabinose ...... 60 2.9.7.2 IcsA ::BIO and arabinose induced IcsP over-expression ...... 60

2.9.7.3 IPTG induction of various StrepTagII-“GFP-N-WASP”-His10 domains protein ...... 61

2.9.7.4 Induction of IcsA -MycHis6 expression with arabinose ...... 61

2.9.7.5 IPTG induction of His6-IcsB-IpgA ...... 62 2.9.8 Protein purification ...... 62 2.9.8.1 IcsA ::BIO protein purification using Dynabeads® MyOneTM Streptavidin T1 (Invitrogen) ...... 62

2.9.8.2 Purification of His6-tagged proteins with Ni-NTA agarose (Qiagen) ...... 63

2.9.8.3 Purification of His6-tagged protein with IMAC resin (Bio-Rad) ...... 64 2.9.8.4 Purification of His-tagged proteins using the ÄKTAprime plus system (GE Healthcare) ...... 64 2.9.8.5 Purification of StrepTagII protein ...... 65 2.9.9 Bacterial Cell Fractionation ...... 66 2.9.10 Indirect immunofluorescence of whole bacteria ...... 66 2.9.11 β-galactosidase assay ...... 67 2.9.12 Pull down assay with purified protein ...... 68 2.9.12.1 Pull down assay with whole cell bacteria ...... 68 2.9.12.2 Pull down assay with IcsAα::BIO bound Dynabeads ...... 68 2.10 Antisera techniques ...... 69 2.10.1 Production of polyclonal anti-IcsB-IpgA antisera ...... 69 2.10.2 Purification of antisera by absorption with live bacteria ...... 69 2.10.3 Affinity purification of antisera ...... 70 2.11 Lipopolysaccharide (LPS) techniques ...... 70 2.11.1 Preparation of LPS samples ...... 70

xiv

2.11.2 Analysis of LPS by silver-stained SDS-PAGE ...... 71 2.11.3 LPS depletion-regeneration assay ...... 71 2.12 DSP cross-linking and outer membrane protein oligomers extraction ...... 72 2.13 Tissue Culture ...... 72 2.13.1 Maintenance of cell lines ...... 72 2.13.2 Splitting cells and seeding trays ...... 73 2.13.3 Preparation of bacteria for infection of cells ...... 74 2.13.4 Plaque assay ...... 74 2.13.4.1 Plaque assay using HeLa cells or CV-1 cells ...... 74 2.13.4.2 Plaque assay using MDCK cells ...... 75 2.13.5 Invasion assay ...... 75 2.13.6 Transfection ...... 76 2.13.6.1 Small scale transfection ...... 76 2.13.6.2 Large scale transfection with lipofectamine 2000 ...... 77 2.13.6.3 Large scale transfection with PEI ...... 77 2.14 Pull Down Assays with cell extracts ...... 78 2.14.1 Preparation of cell lysate extracts ...... 78 2.14.2 Preparation of bacteria for pull down assays ...... 78 2.14.3 Pull down assays ...... 79 2.15 Microscopy ...... 79 2.15.1 Mounting medium ...... 79 2.15.2 Microscopy ...... 79 Chapter 3: Absence of O-antigen suppresses Shigella flexneri IcsA autochaperone region mutations ...... 95

3.1 Introduction ...... 95 3.2 Text of manuscript ...... 96 3.2.1 Summary ...... 98 3.2.2 Introduction ...... 99 3.2.3 Methods ...... 102 3.2.3.1 Bacterial strains and plasmids ...... 102 xv

3.2.3.2 Growth media and growth conditions ...... 102 3.2.3.3 DNA methods ...... 102 3.2.3.4 Construction of pBAD33::icsP ...... 102 3.2.3.5 Antibodies and antisera...... 105 3.2.3.6 IcsP protein induction ...... 106 3.2.3.7 Preparation of whole cell lysate ...... 106 3.2.3.8 TCA precipitation of culture supernatant ...... 106 3.2.3.9 Western transfer and detection ...... 106 3.2.3.10 Trypsin accessibility assay ...... 107 3.2.3.11 LPS and silver staining ...... 107 3.2.3.12 LPS depletion-regeneration assay ...... 108 3.2.3.13 Construction of a S. flexneri ΔicsA degP::Cm mutant strain ...... 108 3.2.3.14 Site-directed mutagenesis ...... 108 3.2.3.15 Construction of the icsA-TGA-lacZ reporter ...... 108 3.2.3.16 β-galactosidase assay ...... 109 3.2.3.17 Indirect immunofluorescence of whole bacteria ...... 109 3.2.3.18 Infection of tissue culture monolayers with S. flexneri and IF labelling ...... 110 3.2.4 Results ...... 111

3.2.4.1 IcsAi mutant production is restored in S. flexneri ∆icsA ∆rmlD ...... 111 3.2.4.2 rmlD complementation ...... 113

3.2.4.3 Effect of LPS Oag modulation on IcsAi716 mutant production ...... 113

3.2.4.4 Effect of IcsP on IcsAi expression in S-LPS and R-LPS S. flexneri ...... 115 3.2.4.5 icsA promoter activity ...... 118

3.2.4.6 IcsAi716 mutant production in an S. flexneri degP::Cm ΔicsA S-LPS strain ... 120 3.2.4.7 Expression of DegP, Skp and SurA periplasmic chaperones in S-LPS and R- LPS S. flexneri ...... 121

3.2.4.8 Effect of AC region insertion mutations on IcsAi functionality in S. flexneri icsA rmlD ...... 121

3.2.4.9 Potential effect of insertion mutations on IcsAi protein folding ...... 124 3.2.5 Discussion ...... 126

xvi

3.2.6 Acknowledgements ...... 130 3.2.7 Supplementary Material ...... 131

3.3 IcsAi mutants production in S-LPS and R-LPS S. flexneri ...... 136

3.4 N-WASP recruitment ability of IcsAi mutants ...... 136 3.5 LPS depletion-regeneration assay ...... 136 3.5.1 Optimisation of tunicamycin concentration ...... 137 3.5.2 The importance of PMBN ...... 137 3.6 Construction of PicsA-TGA-lacZ transcriptional reporter plasmid ...... 148 3.7 icsA promoter activity in S-LPS and R-LPS S. flexneri strains ...... 149 3.8 Construction of an S. flexneri degP::Cm ΔicsA mutant ...... 157 3.9 IcsA expression in an S. flexneri degP::Cm ∆icsA mutant ...... 157 3.10 DSP chemical cross-linking ...... 162 3.11 Summary ...... 164 Chapter 4: Identification of Shigella flexneri IcsA residues affecting interaction with N- WASP, and evidence for IcsA-IcsA co-operative interaction ...... 165

4.1 Introduction ...... 165 4.2 Text of manuscript ...... 166 4.2.1 Abstract ...... 168 4.2.2 Introduction ...... 169 4.2.3 Materials and Methods: ...... 172 4.2.3.1 Ethics Statement ...... 172 4.2.3.2 Bacterial strains and plasmids ...... 172 4.2.3.3 Growth media and growth conditions ...... 172 4.2.3.4 DNA methods ...... 172 4.2.3.5 Antibodies and antisera ...... 172 4.2.3.6 Preparation of whole cell lysate ...... 176 4.2.3.7 Western transfer and detection ...... 176 4.2.3.8 Site-directed mutagenesis ...... 177 4.2.3.9 Construction of pSU23-IcsA plasmids ...... 177 4.2.3.10 Plaque assays ...... 177 xvii

4.2.3.11 Indirect immunofluorescence of whole bacteria ...... 178 4.2.3.12 Infection of tissue culture monolayers with S. flexneri and IF labelling...... 178 4.2.4 Results: ...... 180 4.2.4.1 N-WASP interacting region II ...... 180 4.2.4.2 Effect of the G331W mutation on N-WASP recruitment and intercellular spreading ...... 186 4.2.4.3 Effect of the V382R mutation on N-WASP recruitment and intercellular spreading ...... 186 4.2.4.4 N-WASP interacting region III ...... 187 4.2.4.5 Effect of Y716 and D717 mutagenesis on N-WASP recruitment and F-actin comet tail formation ...... 190 4.2.4.6 Effect of the Y716F, Y716G or D717G mutation on IcsA function in intercellular spreading ...... 191 4.2.4.7 Co-expression of mutated IcsA proteins in S. flexneri ...... 194 4.2.4.8 N-WASP activation by the co-expressed IcsA::BIO V382R and IcsA::BIO Y716G D717G ...... 195 4.2.5 Discussion: ...... 199 4.2.7 Supporting Information ...... 209 4.3 Multi site-directed mutagenesis of IcsA N-WASP IR II ...... 218 4.4 N-WASP recruitment by S. flexneri ΔicsA expressing IcsA::BIO T330*G331* proteins ...... 218 4.5 N-WASP recruitment by S. flexneri ΔicsA expressing IcsA::BIO T381*V382* proteins ...... 219 4.6 N-WASP recruitment by S. flexneri ΔicsA ΔrmlD expressing IcsA::BIO Y716*D717* ...... 219 4.7 Trypsin sensitivity of IcsA::BIO Y716F, IcsA::BIO Y716G and IcsA::BIO D717G .. 228 4.8 Construction of pSU23-IcsA plasmids ...... 228 4.9 Expression of IcsA proteins encoded by pSU23 derivatives ...... 229 4.10 N-WASP recruitment by co-expressed IcsA proteins...... 229 4.11 Summary ...... 230 Chapter 5: Expression and purification of N-WASP domains and IcsA protein ...... 245 xviii

5.1 Introduction ...... 245 5.2 Purification of N-WASP and sub-domains GFP fusions ...... 246 5.2.1 Construction of various pTriEx6-“GFP-N-WASP” domain plasmids ...... 246 5.2.2 Construction of pTriEx6-EGFP plasmid ...... 251 5.2.3 IPTG induction of Strep-“GFP-N-WASP”-His proteins and Strep-EGFP-His .....251 5.2.4 Cell fractionation ...... 255 5.2.5 Sequential purification of Strep-“GFP-N-WASP”-His proteins and Strep-EGFP-His ...... 255 5.2.6 Optimisation of pull down assay with whole cell bacteria ...... 262 5.3 IcsA protein purification ...... 272 5.3.1 Purification of IcsAα::BIO from the culture supernatant using Dynabeads...... 272 5.3.2 Pull Down Assay with IcsAα::BIO bound Dynabeads ...... 274 5.3.3 Construction of pBAD/MycHis::IcsAα ...... 276 5.3.4 Induction and fractionation of IcsAα-MycHis protein ...... 277 5.3.5 Purification of IcsAα-MycHis ...... 286 5.3.6 Co-expression of chaperones and IcsAα-MycHis ...... 286 5.3.7 IcsAα-MycHis expression in M63 minimal media and purification ...... 292 5.4 Summary ...... 296 Chapter 6: S. flexneri 2457T icsB mutant construction and characterisation ...... 299

6.1 Introduction ...... 299 6.2 Mutagenesis of S. flexneri icsB in 2457T...... 299 6.3 Construction of S. flexneri 2457T ΔicsA ΔicsB double mutant ...... 307 6.4 Cloning of icsB ...... 307 6.4.1 Cloning of S. flexneri 2457T icsB into pWSK29 ...... 307 6.4.2 Cloning of S. flexneri 2457T icsB-ipgA into pWSK29 ...... 310

6.5 Purification of His6-IcsB-IpgA protein and production of polyclonal anti-IcsB antiserum ...... 310

6.5.1 IPTG induced expression and purification of His6-IcsB-IpgA ...... 311 ...... 313 6.5.2 Production of polyclonal anti-IcsB-IpgA antiserum ...... 314 xix

6.6 Characterisation of S. flexneri 2457T ΔicsB ...... 315 6.6.1 Intercellular spreading of S. flexneri 2457T ΔicsB ...... 315 6.6.2 Effect of autophagy inhibitor on S. flexneri 2457T ΔicsB intercellular spreading 323 6.6.3 Interaction of Atg5 and IcsA in S. flexneri 2457T ΔicsB ...... 325

6.7 Expression of IcsAi mutants in S. flexneri 2457T ΔicsA ΔicsB ...... 328 6.8 Summary ...... 330 Chapter 7: Discussion ...... 333

7.1 Introduction ...... 333

7.2 Production of AC IcsA mutants in S. flexneri ∆icsA ∆rmlD ...... 334 7.2.1 Investigation of the underlying mechanisms for AC IcsA mutant biogenesis ...... 334 7.2.2 Effect of specific residues within AC region on IcsA biogenesis ...... 336 7.2.3 A hypothetical model for IcsA biogenesis ...... 337 7.3 N-WASP activation and recruitment by AC IcsA mutants ...... 337 7.4 Identification of residues involved in N-WASP binding in N-WASP IR II ...... 339 7.5 Co-operative interaction of IcsA proteins in N-WASP activation ...... 340 7.6 Protein purification and protein binding assay ...... 341 7.6.1 Whole cell bacteria and purified “GFP-N-WASP” proteins ...... 341 7.6.2 Purification of IcsAα::BIO protein from the culture supernatant ...... 342 7.6.3 Purification of IcsAα-MycHis protein from E. coli ...... 342 7.7 Construction and characterisation of 2457T icsB mutant, and IcsB-IpgA antiserum production ...... 344 7.7.1 Intercellular spreading of 2457T icsB mutant ...... 344 7.7.2 Interaction of Atg5 with IcsA ...... 345 7.7.3 Investigation on IcsB/Atg5 binding region ...... 346

7.7.4 His6-IcsB-IpgA protein purification and antisera production ...... 346 7.8 Conclusion ...... 347 References...... 349

Chapter One

Introduction

Chapter 1: Introduction

1.1 Shigella

Shigella species is a potent human enteric pathogen that causes bacillary dysentery or shigellosis, a bloody mucoid diarrhoea. A recent review paper has reported that ~125 million endemic cases of shigellosis occur annually in Asia, accompanied by ~14, 000 deaths (Bardhan et al., 2010). Most cases of shigellosis occur in developing countries where poor sanitation systems are prevalent (Niyogi, 2005) and the majority of deaths occur in children under the age of 5 years (Kotloff et al., 1999). Shigella strains can be divided into four species: Shigella dysenteriae, Shigella flexneri, Shigella boydii and Shigella sonnei. These strains are further divided into different serotypes according to the variations in chemical composition of the lipopolysaccharide O-antigen (LPS Oag) (Simmons, 1993). S. flexneri is the most predominant causative agent in both developing and developed countries. It is divided into 13 serotypes and S. flexneri serotype 2a is the prominent strain (Jennison & Verma, 2004; Levine et al., 2007). The genome of S. flexneri 2457T serotype 2a has been fully sequenced (Wei et al., 2003) and is the focus of this study. Genomic analyses of Shigella spp. show that they are evolved from the Escherichia coli family but have acquired a 220 kb virulence plasmid that is required for virulence, and deletion of certain chromosomal genes (Lan & Reeves, 2002; Sansonetti et al., 1982).

This chapter reviews the pathogenesis of Shigella and then focuses on IcsA (VirG) autotransporter (AT) assembly and its role in actin-based motility (ABM). IcsA is one of the key virulence factors of Shigella that is responsible for its dissemination within and between host cells.

1.2 Pathogenesis

S. flexneri is transmitted via the oral-faecal route and shigellosis often occurs through contaminated food or water. Shigella has a low infection dose since as few as 10 organisms is sufficient to cause disease (DuPont et al., 1989). Shigellae are tolerant to acidic conditions

Figure 1.1 Shigella flexneri pathogenesis.

A) Ingested S. flexneri reaches the colon and exploits M cells to cross the colonic epithelium. B) Shigella then induces macrophage pyroptosis and is released into the sub-mucosa, together with IL-1β and IL-18. C) Bacteria actively invade colonic epithelial cells by releasing IpaA, IpaB, IpaC, IpgB1, IpgD and VirA proteins via TTSS, inducing endocytosis of bacteria. D) Internalised bacteria escape the endocytic vacuole, multiply and perform IcsA-mediated actin- based motility within the cytoplasm. E) Motile Shigella forms protrusion that is taken up by the adjacent cells. Shigella becomes enclosed within a double membrane vacuole, and subsequently escapes into the cytoplasm by lysing the membranes. The free bacteria repeat new cycles of replications, motility and intercellular spreading. F) Shigella LPS and peptidoglycan (PG) activate the host cell signaling pathways leading to NF-κB activation and promote IL-8 production. G) The release of proinflammatory substances at sub-mucosa attracts polymorphonuclear (PMN) cells and promotes PMN migration across the epithelium. Migration of the PMN disrupts the integrity of the colonic epithelium and provides an additional pathway for bacterial entry into the sub-mucosa. H) S. flexneri is also able to interfere with tight junctions and gain access into the sub-mucosa.

(Gorden & Small, 1993) which allows them to travel from the oesophagus, stomach, and small intestine to the colon. Shigellosis is often preceeded with watery diarrhoea, which is caused by two S. flexneri 2a enterotoxins (Shigella enterotoxin 1 and 2; ShET1 and ShET2), followed by dysentery (Fasano et al., 1995; Levine et al., 2007; Nataro et al., 1995). ShET1

and ShET2 affect the jejenum and elicit small intestinal secretion without invasion of host cells by Shigellae (Kinsey et al., 1976). Shigellae then pass to the colon and enter the invasive phase of pathogenesis.

The pathogenesis mechanism of S. flexneri is illustrated in Fig. 1.1. Once Shigella reaches the colon, Shigella is able to invade the non-specific but highly endocytic M cells (microfold cells) in the Peyer’s patches (Sansonetti, 2001a). M cells allow Shigella to cross the colonic epithelium barrier, and the transcytosed Shigellae are engulfed by resident macrophages underlying the lymphoid follicles (Sansonetti, 2001b). S. flexneri-infected human macrophages are then directed to undergo pyroptosis (Ashida et al., 2011). Damaged macrophages release bacteria and proinflammatory cytokines such as IL-1β and IL18 (Fernandez-Prada et al., 1997; Sansonetti, 2001a). In addition, another cytokine, TNF-α (tumour necrosis factor-α) is also secreted by human monocytes in response to Shigella infection and contributes to the destructive inflammatory lesions (D'Hauteville et al., 2002).

The released bacteria then invade epithelial cells from the basolateral surface via bacteria- mediated endocytosis. S. flexneri gains access into the epithelial cells by injecting various effector proteins, including IpaA, IpaB, IpaC, IpgB1, IpgD and VirA via a Type III secretion system (TTSS) (Mxi/Spa). These effector proteins induce local reorganisation of actin and microtubule cytoskeleton, which trigger the uptake of bacteria. Once internalised, the bacterium lyses the vacuole membrane quickly by releasing IpaB, and escapes into the cytoplasm (Sansonetti, 2001a; Sansonetti, 2001b). The escaped S. flexneri bacteria avoid the autophagy system and multiply in the cytoplasm, interact with host actin regulatory proteins and form filamentous (F-actin) actin comet tails via the IcsA virulence protein (Lett et al., 1989; Ogawa et al., 2005; Suzuki et al., 1996; Suzuki et al., 1998; Suzuki et al., 2002). In a recent study, Mostowy et al. (2010) discovered a role for the septin family of cytoskeletal proteins in targeting intracellular Shigella to the autophagy pathway. They showed that a septin cage-like structure forms around the cytosolic Shigella, affects cell-to-cell spread of Shigella, and promotes autophagy (Mostowy et al., 2010). Detection of Shigella by host defence systems and the activation of autophagy are further discussed in Section 1.8. The formation of F-actin comet tails generates a propulsive force, which propels the bacterium throughout the cytoplasm (Fig. 1.1). This fundamental mechanism of S. flexneri pathogenesis 3

is known as actin-based motility (ABM) (Goldberg, 2001; Pantaloni et al., 2001). Motile S. flexneri then forms a protrusion into an adjacent cell (with the bacterium at its tip) and is taken up by the adjacent cell. In the new host cell, the bacterium is encapsulated in a double- membrane vacuole which it eventually lyses to escape into the cytoplasm, forms F-actin comet tail and repeats the invasion cycle again (Kadurugamuwa et al., 1991; Prevost et al., 1992). This process is one of the key mechanisms used by S. flexneri to establish shigellosis.

1.3 Innate immune response

Invasion of S. flexneri into the epithelial cells triggers the release of proinflammatory substances such as IL-8 and TNF- , which is due to the activation of a signalling pathway mediated by nucleotide-binding oligomerisation domain protein 1 (Nod1, a peptidoglycan sensor), that in turn activates the nuclear factor-κB (NF-κB, a transcriptional activator of chemokine IL-8), in response to bacterial lipopolysaccharides (LPS) and peptidoglycan (Fig. 1.1) (Girardin et al., 2001; Philpott et al., 2000b; Singer & Sansonetti, 2004). The released IL-1β, IL-18 (by damaged macrophages) and IL-8 recruit polymorphonucleocytes (PMNs) from the blood to the infection site and induce a potent inflammatory response. Infiltration of PMNs disrupts the tight junctions between epithelial cells, destabilising the epithelium and creates a paracellular pathway for invasive Shigella to gain access to the basolateral surface of the epithelial cells (Perdomo et al., 1994). It is also suggested that S. flexneri is capable of weakening the tight junctions of the disrupted epithelium and translocates across the colonic epithelium directly (Sakaguchi et al., 2002). As a result of the influx of Shigellae across the disrupted epithelium, serious inflammation occurs. Despite the transmigration of PMNs leading to tight junctions disruption, PMNs have been reported to be efficient killers of Shigellae as the trapped bacteria are unable to lyse the phagocytes vacuole membrane (Mandic-Mulec et al., 1997; Sansonetti, 2001b).

Mechanisms involved in resolving shigellosis have gradually been revealed. PMNs have been suggested to play a role in the resolution of dysentery, as Shigellae are trapped and killed by PMNs (Mandic-Mulec et al., 1997). On the other hand, IFN-γ which is secreted by lymphocytes such as T cells and NK cells (Natural killer) has been shown to be required to

resolve the primary Shigella infection in humans (Le-Barillec et al., 2005). Furthermore, a recent study showed that the Th17 cells are required to clear secondary Shigella infections, suggesting Th17 cells are involved in adaptive immunity to Shigella infection (Sellge et al., 2010).

IcsA-dependent ABM is important for Shigella because it assists Shigella to evade the host immune response and contributes to the extensive spreading of bacteria throughout the epithelial layer. The massive infection of colonic epithelium provokes strong inflammatory host responses and leads to dysentery/shigellosis. Shigella mutants deficient in ABM (defective in assembling actin due to deletion of the icsA/virG gene) are highly attenuated in humans and all other tested models (mouse and monkey) (Kotloff et al., 1996; Kotloff et al., 2002; Lett et al., 1989; Makino et al., 1986; Sansonetti et al., 1991). To date, no effective vaccine is available as Shigella is highly variable in serotype, which makes the vaccine development very difficult (Jennison & Verma, 2004). Attenuated strains with the icsA gene deletion have been used in recent vaccine developments and are under evaluation in clinical trials (Levine et al., 2007).

1.4 IcsA protein – identification and regulation

The intracellular motility of Shigella was first observed by phase-contrast microscopy but the mechanisms behind bacterial movement were completely unknown until the 1980s when IcsA (VirG) protein was identified and proven to be responsible for the unipolar movement and virulence of Shigella (Bernardini et al., 1989; Lett et al., 1989; Makino et al., 1986; Ogawa et al., 1968). Tn5 transposon insertions within an EcoRI-SalI fragment (~4 kb, termed virG) of the S. flexneri virulence plasmid abolished the intracellular movement of S. flexneri (Makino et al., 1986). In 1989, Lett et al. identified VirG as an 1102 amino acids protein and provided preliminary evidence that VirG is exposed on the bacterial surface. In the same year, Bernardini et al. (1989) also identified the same protein (termed IcsA, as the first identified protein involved in intercellular spread) and showed for the first time, IcsA initiates G-actin polymerisation into F-actin comet tails, allowing S. flexneri intra- and intercellular spreading.

IcsA is an outer membrane (OM) protein that is polarly distributed on the bacterial surface (Goldberg et al., 1993). ABM of S. flexneri has been studied in various model systems such as microscopy of infected tissue culture cells, and incubation in either Xenopus cell extracts or with purified proteins (Egile et al., 1999; Goldberg & Theriot, 1995; Loisel et al., 1999). S. flexneri virulence is dependent on the ability of the bacterium to perform intercellular spreading. The IcsA-mediated ABM efficiency can be assessed by measuring the plaque size in in vitro plaque assays following the infection of tissue culture cell monolayers with S. flexneri (Oaks et al., 1985). Séreny test is another way to assess Shigella virulence, which involves the development of keratoconjunctivitis in guinea pigs and mice following Shigella infection (Wood et al., 1986). The expression of IcsA protein in these assays is critical as mutants lacking IcsA are deficient in intercellular spreading and avirulent (Goldberg & Theriot, 1995). Heterologous expression of IcsA in closely related E. coli K-12 ompT showed that IcsA was sufficient and required to confer actin polymerisation and ABM abilities (Goldberg & Theriot, 1995; Kocks et al., 1995; Monack & Theriot, 2001).

The expression of virulence-plasmid encoded genes, including icsA (eg. ipa and the TTSS apparatus) is tightly regulated by VirF, a temperature regulated transcription factor (active at temperatures >32 °C) (Adler et al., 1989; Dorman & Porter, 1998). The tight gene regulation is affected by a few physiological conditions, such as an optimum temperature of 37 °C, an osmotic stress environment and a pH of 7.4 (Dorman & Porter, 1998). In addition, recent findings report that the expression of icsA is also controlled by the nucleoid protein H-NS, and a 450 nucleotides antisense RNA (RnaG), which acts as a transcriptional attenuator (Giangrossi et al., 2010; Tran et al., 2011). VirB, another gene regulator, is also regulated by VirF (Dorman & Porter, 1998). VirB does not affect IcsA expression directly but activates the expression of IcsP, an OM serine protease which cleaves IcsA at the bacterial surface (Wing et al., 2004). The IcsP protease and IcsA cleavage by IcsP are further discussed in Section 1.4.5.

1.4.1 IcsA structure and functional domains

Figure 1.2 IcsA functional domains.

IcsA has 3 major domains: an extended signal sequence (aa 1-52), a functional passenger domain (aa 53-758) and the translocation domain (aa 759-1102). A glycine-rich repeat region (GRR; aa 140-307) has been reported to interact with N-WASP but a larger region (aa 53- 508) is required for actin polymerisation. Two regions responsible for polar localisation (region #1 aa 1-107; and region #2 aa 507-620) are also shown. The IcsP protease cleaves IcsA between aa 758-759. Amino acid numbering is based on the IcsA (VirG) sequence (Genbank: AF386526).

IcsA is a member of the autotransporter (AT) family (Type Va secretion system) which is the largest family of secreted proteins in Gram-negative bacteria (Henderson et al., 2004; Pallen et al., 2003). Like other AT proteins, IcsA consists of three major domains: an extended N- terminal signal sequence (aa 1-52) which directs protein secretion from the cytoplasm into the periplasm via the Sec apparatus pathway, a functional passenger α-domain (aa 53-758) and a C-terminal translocation β-barrel domain (aa 759-1102) that mediates the translocation of passenger domain across the OM via the BAM (beta-barrel assembly machine) complex (Fig. 1.2) (Henderson et al., 2004; Jain & Goldberg, 2007; Peterson et al., 2010; Suzuki et al., 1995). The exported passenger domain is exposed on the bacterial surface, facing the extracellular millieu, where it interacts with ligands and is anchored in the OM via the β- barrel domain. ATs have various functions in both pathogenic and non-pathogenic bacteria,

such as adhesion, polymerisation of host cell actin, serum resistance, or protease activity (Henderson et al., 2004). IcsA was recently classified to a subgroup of self associating ATs (SAATs) that mediate bacterial aggregation and biofilm formation (Klemm et al., 2006; Meng et al., 2011). Proteolytic cleavage and release of the exported AT from the cell is a common feature of this family (Henderson et al., 2004).

1.4.2 The N-terminal signal sequence The N-terminal signal peptide of an AT is required for directing the cytoplasmic pre-protein to the Sec apparatus (SecYEG) in order to cross the inner membrane (IM) and export the protein into the periplasm (Henderson et al., 2004). The unusual extended 52 amino acids long signal peptide is restricted to ATs of Gram-negative bacteria (Desvaux et al., 2006). This atypical signal sequence can be divided into five regions termed N1 (first positively charged region), H1 (hydrophobic region), N2 (second charged region), H2 (second hydrophobic region) and C (cleavage site) domains signal peptidase I recognition site. N1 and H1 are the highly conserved extended signal peptide regions, while the N2, H2 and C domains are highly variable (Desvaux et al., 2006; Henderson et al., 1998; Henderson et al., 2004). The function of the extended signal peptide of AT in protein biogenesis is still controversial as it may be involved in targeting proteins to co-translational export in a signal recognition particle (SRP)- dependent pathway (Chevalier et al., 2004; Peterson et al., 2003; Sijbrandi et al., 2003). For example, EspP has been reported to interact with SRP or SecB, via the truncated signal peptide or the full length signal peptide, respectively (Peterson et al., 2003; Peterson et al., 2006). However, the translocation of IcsA has been shown to be SRP-independent, and the DnaK cytoplasmic chaperone was identified to be involved in IcsA secretion (Brandon et al., 2003; Janakiraman et al., 2009). On the other hand, other studies indicate that the extended signal peptide is most likely to be involved in regulating the rate of protein secretion from the cytoplasm into periplasm, by preventing the improper folding of protein in the periplasm (Chevalier et al., 2004; Peterson et al., 2006; Szabady et al., 2005).

1.4.3 IcsA passenger α-domain

A NOTE: These figures/tables/images have been removed to comply with copyright regulations. It is included in the print copy of the thesis held by the University of Adelaide Library.

Figure 1.3 Crystal structure of the IcsA autochaperone domain and predicted structure of the IcsA passenger domain. A) Crystal structure of the IcsA autochaperone domain (aa 591-758) at 2.0 Å (Kuhnel & Diezmann, 2011). Protein Data Bank accession no. 3ML3. B) Robetta model of the IcsA passenger domain predicted structure (aa 53-758) created by May (2007) using PyMOL (http://pymol.sourceforge.net, DeLano Scientific). The predicted autochaperone domain (aa 634-735) is presented in gray.

The IcsA passenger α-domain adopts a mature and functional conformation once exported across the OM through the β-barrel translocon in conjunction with the BAM complex. The process of IcsA transportation across the IM and OM is discussed in Section 1.5. The crystal structure of the full length IcsA passenger α-domain has not yet been identified but the C- terminal IcsA autochaperone (AC) region crystal structure (aa 591-758) has recently been determined at 2.0Å resolution (Fig. 1.3A) (Kuhnel & Diezmann, 2011). In addition, the structural arrangement of IcsA passenger α-domain has been predicted by the Robetta server set (May, 2007) (Fig. 1.3B), and the C-terminal region of the Robetta-predicted IcsA structure is similar to the identified AC crystal structure (May, 2007). The IcsA passenger α-domain is predicted to adopt a right-handed parallel β-helical conformation (May, 2007), which is similar to other AT proteins such as Bordetella pertussis P.96 Pertactin, E. coli Hbp and EspP, Helicobacter pylori VacA, and Haemophilus influenzae Hap and IgA-1 (Emsley et al., 9

1996; Gangwer et al., 2007; Johnson et al., 2009; Khan et al., 2011; Meng et al., 2011; Otto et al., 2005). This conformation is predicted to be common among ATs despite the divergent in sequences and functions of various passenger domains (Bradley et al., 2001; Junker et al., 2006).

1.4.4 The N-WASP interacting regions

Figure 1.4 Refined N-WASP interacting regions on IcsA passenger domain. The three N-WASP interacting regions (IR) identified by May and Morona (2008): N-WASP IR I (aa 185-312) that contains the GRR, N-WASP IR II (aa 330-382) that overlaps with the Shigella protein IcsB and the host autophagic protein Atg5 binding region (aa 320-433), and N-WASP IR III (aa 508-730) that contains the autochaperone region (aa 634-735). Amino acid numbering is based on the IcsA (VirG) sequence (Genbank: AF386526).

The Neural Wiskott-Aldrich Syndrome Protein (N-WASP) is a host actin regulatory factor that interacts with IcsA, allowing Arp2/3 complex recruitment and eventually the initiation of actin polymerisation. Activation of N-WASP and its role in ABM of Shigella are discussed in Section 1.6. The N-WASP binding region within the IcsA α-domain is still incompletely defined. A glycine-rich repeat (GRR) region which exists within the IcsA passenger domain (aa 140-307) (Suzuki et al., 1995) has been identified to be involved in interacting with N- WASP, leading to F-actin comet tail formation (Snapper et al., 2001; Suzuki et al., 1998;

Suzuki et al., 2002). IcsA103-433, which contains the GRR is adequate for N-WASP binding in 10

pull down assays (Suzuki et al., 1998). However, in vitro assays suggested that a broader region of IcsA (IcsA53-508) is required for actin polymerisation (Suzuki et al., 1996; Suzuki &

Sasakawa, 2001). Deletion of IcsA509-729 did not abolish F-actin assembly on the S. flexneri surface but S. flexneri expressing this protein were defective in forming F-actin tails, presumably due to the non-polar distribution of IcsA as a result of deletion of the IcsA506-620 polar determining region (Suzuki et al., 1996). However, linker insertion mutants (IcsAi) within the polar determining region of IcsA, identified by May and Morona (2008), were capable of forming F-actin comet tails regardless of the non-polar distribution of IcsAi protein. These data suggest that the sequences within IcsA509-729 could be involved in ABM.

In the same study, IcsAΔ103-507 expressed in a S. flexneri rough-LPS (R-LPS) mutant was observed to recruit N-WASP; presumably the truncated IcsAΔ103-507 protein is more accessible in the rough background. A new second N-WASP interacting region (N-WASP IR II) (aa 330-382) which overlaps with the IcsB/Atg5 binding region (Section 1.8), and N-WASP IR III (aa 508-730) that contains the autochaperone (AC) region (aa 634-735) (Fig. 1.4) were identified in the same study. Furthermore, IcsA53-508 has also been shown to interact with the host vinculin (Suzuki et al., 1996).

1.4.5 IcsP cleavage site IcsP (SopA) is a 36 kDa virulence plasmid-encoded OM serine protease which cleaves IcsA at the Arg758 – Arg759 bond position, releasing a ~ 85 kDa IcsA passenger domain fragment into the culture supernatant (d'Hauteville et al., 1996; Egile et al., 1997; Fukuda et al., 1995; Shere et al., 1997; Steinhauer et al., 1999). IcsP is an ortholog of the E. coli major OM protease OmpT (56 % identical to IcsP) that is absent in Shigella (Lan & Reeves, 2002). IcsP cleaves surface IcsA at a low efficiency, with 80 % of IcsA molecules remaining uncleaved on the Shigella surface (Shere et al., 1997; Steinhauer et al., 1999). In contrast to IcsP, E. coli OmpT protease has been shown to cleave IcsA from the bacterial surface at a higher efficiency so that IcsA becomes undetectable on the cell surface (Goldberg et al., 1993; Nakata et al., 1993). Thus, E. coli K-12 ompT + strains expressing IcsA are defective in ABM, while strains lacking OmpT and expressing IcsA on the cell surface are capable of conferring ABM (Nakata et al., 1993). 11

Inactivation of the icsP gene results in the reduction of released IcsA passenger domain fragment in the culture supernatant compared to the wild-type S. flexneri strain and increased detectable IcsA across the entire cell surface (both lateral region and cell pole), suggesting that IcsP is important for maintaining IcsA polar localisation (d'Hauteville et al., 1996; Egile et al., 1997; Shere et al., 1997; Steinhauer et al., 1999). However, the unipolar IcsA expression in E. coli K-12 ompT – strain showed that the polar localisation of IcsA is independent of virulence plasmid determinants such as IcsP (Sandlin & Maurelli, 1999) and IcsA possesses polarity targeting sequences (Charles et al., 2001). In addition, whether or not IcsP plays a role in ABM of Shigella remains unclear due to the contradictory results reported by Egile et al. (1997) and Shere et al. (1997). Egile et al. showed that a M90T sopA (icsP) (serotype 5a) mutant formed smaller plaques than the wild-type strain while Shere et al. claimed that a 2457T icsP mutant had no difference in spreading efficiency and formed wild- type-comparable plaques. Different cell lines and serotype strains of S. flexneri used to perform plaque assays by each group may explain the different phenotypes shown by the icsP/sopA mutants. A recent unpublished study that directly compared ΔicsP mutations in both serotypes found wild-type equivalent plaque formation between the strains and supports the findings of Shere et al. (1997) (Tran, 2007).

Studies on the IcsP-IcsA relationship have also been performed by utilising the non- cleavable IcsA variants IcsA R758D and IcsA R758D R759D, which are normally termed IcsA* (d'Hauteville et al., 1996; Fukuda et al., 1995; Van Den Bosch & Morona, 2003). Expression of IcsA* on the bacterial surface is increased compared to wild-type IcsA and becomes non-polarly distributed. d'Hauteville et al. (1996) suggested that an IcsA* mutant exhibited abnormal intercellular movement as a consequent of non-polar localisation of IcsA. However, Fukuda et al. (1995) showed that their IcsA* mutant had improved virulence, as it was able to form F-actin aggregation, and spread to adjacent cells and form plaques, suggesting that the IcsA cleavage by IcsP is not essential for ABM.

The presence of IcsP is therefore required for reinforcement of IcsA unipolar surface distribution but is not involved in directing IcsA polar distribution, which occurs in the cytoplasm prior to translocation across the inner and outer membrane of S. flexneri (Charles et al., 2001). 12

1.4.6 IcsB and Atg5 binding region IcsA of S. flexneri is a target of autophagy (Ogawa et al., 2005). Autophagy is one of the host defence mechanisms, which can be provoked upon pathogen infection. However, S. flexneri is able to avoid this mechanism by producing the virulence plasmid-encoded IcsB protein (Ogawa et al., 2005). IcsA has been shown to interact with IcsB and Atg5 (autophagic protein) inside host cells. Both IcsB and Atg5 proteins have been isolated in pull down assays using the same truncated IcsA320-433 fragment but in a competitive manner. It is thus suggested that IcsB inhibits autophagosome formation by competitively binding to IcsA with Atg5 (Ogawa et al., 2005). Interestingly, the binding region of IcsB/Atg5 (aa 320-433) overlaps with the N-WASP interacting region II (aa 330-382) identified by May and Morona (2008). The roles of S. flexneri IcsB and host Atg5 proteins are further discussed in Section 1.8.

1.4.7 IcsA phosporylation region by protein kinase A A phosphorylation consensus sequence “SSRRASS” (aa 756-762) within IcsA is suggested to be a substrate for phosphorylation by host cell cyclic-dependent protein kinase (d'Hauteville & Sansonetti, 1992). A site-directed mutagenised IcsA R759D mutant could not be phosphorylated by protein kinase A in vitro but exhibited increased ABM and improved cell- to-cell spreading in HeLa cells. d’Hauteville & Sansonetti (1992) suggested that phosphorylation of IcsA is part of the host defence mechanism by limiting the intercellular spreading of Shigella within the host cells (d'Hauteville & Sansonetti, 1992). However, subsequent identification of the IcsP cleavage site (R758-R759) challenged the previously described phenotype, which is most likely due to the lack of IcsA cleavage from the bacterial surface (d'Hauteville et al., 1996; Fukuda et al., 1995). Furthermore, phosphorylation of intracellular IcsA has not been demonstrated (d'Hauteville & Sansonetti, 1992; Frischknecht et al., 1999).

1.4.8 IcsA polarity Two regions of IcsA (polar targeting region #1 [aa 1-104] and polar targeting region #2 [506- 620]) have been reported to be capable of independently delivering the nascent protein to the polar region of the cytoplasm prior to translocation across the bacterial membranes (Charles et al., 2001). However, an unpublished study from the Morona laboratory has shown that a non-polar phenotype was observed for individually expressed IcsA fragment containing all or part of polarity targeting region #1 (aa 1-104, 53-104 and 53-505) (Grabowicz, 2010). This result suggested that IcsA1-104 may not be able to independently confer polarity as reported previously (Charles et al., 2001). This is supported by the data of May and Morona (2008) whereby IcsAi (IcsAi532 and IcsAi563) mutants within the IcsA polarity targeting region #2

(IcsA506-620) also showed loss of their polarity phenotype.

Another factor that affects IcsA polar localisation is the S. flexneri phoN2 encoded apyrase which has been implicated in intercellular spreading. A phoN2 mutation resulted in the loss of IcsA unipolarity (Santapaola et al., 2006). Apyrase is a periplasmic enzyme that hydrolyses and depletes host intracellular ATP following S. flexneri invasion, and is required for efficient intercellular spreading (Santapaola et al., 2006). However, it remains unclear how apyrase affects the IcsA polar targeting process as the dNTP-hydrolysing activity of apyrase was not required for IcsA polar localisation and no direct interaction could be detected (Santapaola et al., 2006).

1.4.9 IcsA autochaperone region Many of the ATs (BrkA, EspP, SSP [serine protease], AIDA-1 and IcsA) have another common feature which is the well conserved autochaperone (AC) region at the C-terminal of the α-domains. Mutations or deletion of this AC region resulted in reduced surface AT protein expression or increased sensitivity to protease, suggesting that the AC region is essential for ATs secretion, folding and/or stability (Table 1.1) (Berthiaume et al., 2007; Dutta et al., 2003; May & Morona, 2008; Ohnishi et al., 1994; Oliver et al., 2003a; Oliver et al., 2003b; Yen et al., 2008). For example, Ohnishi et al. (1994) reported that neither the mature SSP protein (an AT of Serratia marcescens with protease activity) nor enzymatic activity could be detected

when the AC region was deleted. However, the processed form of the β-core was detected in the OM. They proposed that the cell surface protein was unable to fold into an active and correct conformation, eventually lead it to be degraded. However, the SSP mutant expression was rescued by the expression of an AC region in trans. The data suggest that the AC region of SSP is required for proper protein folding after being translocated to the cell surface.

Table 1.1 Effect of autotransporter autochaperone mutation on expression and function

Autotransporter Strain Mutation Affected function Source/Reference Shigella (May & Morona, IcsA Insertion Biogenesis flexneri 2008) Serratia (Ohnishi et al., SSP Deletion Protein folding marcescens 1994) Bordetella Increased sensitivity (Oliver et al., BrkA Deletion pertussiss to protease/trypsin 2003b) (Velarde & EspP SPATE Deletion Secretion efficiency Nataro, 2004) Protein folding, (Berthiaume et al., AIDA-1 E. coli Insertion increased sensitivity 2007) to trypsin

Another AT that possesses the AC region is the Bordetella pertussis BrkA. Deletion of the AC region of BrkA did not affect surface protein expression on E. coli UT5600 (OM protease OmpT-deficient strain) but the BrkA mutant protein was susceptible to protease or trypsin digestion, suggesting that the AC region is required for maintaining a stable structure. Again, the unstable deletion mutant could be rescued by providing the AC region in trans, implying this region is essential for BrkA stability (Oliver et al., 2003b).

In another example, deletion of the AC region of EspP (a member of the serine protease ATs of enterobacteriaceae, SPATE) resulted in reduced secretion efficiency (Velarde & Nataro, 2004). Furthermore, insertion mutation in the AC region of E. coli AIDA-I altered its biogenesis. The mature AIDA-I mutant protein had abnormal conformation that was susceptible to trypsin digestion (Berthiaume et al., 2007), suggesting that the AC region is essential in maintaining the correct conformation on the cell surface.

May and Morona (2008) identified a putative AC region (aa 634-735) at the C-terminal of IcsA passenger domain which is part of the N-WASP IR II, and proposed that this AC region is required for IcsA biogenesis. IcsAi mutants with five amino acids insertions within the AC region (IcsAi633, IcsAi643, IcsAi677 and IcsAi716) had markedly reduced protein production in the smooth LPS (S-LPS) background and were defective in N-WASP recruitment and ABM (May & Morona, 2008). The effect of mutation within the IcsA AC region and its ability to recruit N-WASP in the R-LPS background will be investigated in this study.

1.4.10 The translocation β-domain The C-terminal domains of ATs consist of β-sheets in the form of a β-barrel. Like other ATs, the translocation domain of IcsA is comprised of 12 β-strands, aligned in an antiparallel fashion (Barnard et al., 2007; Oomen et al., 2004; Suzuki et al., 1995). AT β-domains are all homologous (~ 200-300 residues) but highly diverse in sequence (Henderson et al., 2004). The IcsA translocation domain is rich in aromatic residues (13.4 %) compared to the passenger domain (7.5 %), which could be the nature of β-barrels as the β-domain of AT is anchored in the OM. Genome-wide analysis of E. coli reveals that the presence of aromatic residues is more prevalent in outer membrane proteins (OMPs) than in cytoplasmic or periplasmic proteins (Bitto & McKay, 2003), which in this case, applies to S. flexneri IcsA. A consensus amino acid motif at the extreme C-terminal of the β-domain is critical in directing the translocation of passenger α-domain by interacting with the BAM complex (Henderson et al., 2004; Robert et al., 2006). The function of the translocator domain is to anchor the passenger α-domain into the OM, and translocate the passenger α-domain from periplasm to the cell surface (Henderson et al., 2004). The export, assembly and structure of the IcsA translocator domain are further discussed in Section 1.5.3.

1.5 Translocation of IcsA – cytoplasm to cell surface

As an AT that is located in the OM, IcsA needs to travel across both the IM and OM of S. flexneri from the cytoplasm into periplasm and eventually be exposed on the bacterial surface.

ATs were initially thought to mediate their own translocation but the identification of the BAM complex and periplasmic chaperones (DegP, Skp and SurA) that are involved in AT translocation suggest that the term ‘autotransporter’ is no longer applicable. Current models for ATs translocation from the cytoplasm to the OM are described below.

1.5.1 Translocation across the inner membrane As described in Section 1.4.2, most of the ATs posses a N-terminal extended signal sequence (52 residues for IcsA), which directs and transports protein across the IM via the Sec apparatus. The Sec translocon consists of SecY, SecE and SecG that form a pore in the IM and is distributed around the bacterial periphery (Brandon et al., 2003; Henderson et al., 2004). This complex interacts with a peripheral membrane protein, SecA, which provides energy for the translocation process by catalysing ATP hydrolysis (Henderson et al., 2004). IcsA has been shown to utilise both SecB and DnaK pathways during translocation from the cytoplasm into periplasm. DnaK is a chaperone which keeps pre-protein in an export- competent state until SecA is available, and translocates the substrate across the IM via the Sec translocon (Henderson et al., 2004; Janakiraman et al., 2009). Once the protein is translocated into the periplasm, the signal sequence is cleaved at the C-domain signal peptidase I recognition site, releasing the protein into the periplasm (Henderson et al., 2004).

1.5.2 Periplasmic transit

The IcsA periplasmic intermediate is transient. The -domain has been suggested to be rapidly inserted into the OM once the IcsA protein is translocated into the periplasm, while the translocation of passenger α-domain across the OM may be the rate-determining step (Brandon & Goldberg, 2001). IcsA intermediates exist as a soluble, partially folded, proteinase K resistant state and may form a single intramolecular disulfide bond (Brandon & Goldberg, 2001). The formation of a disulfide bond is thought to stabilise the protease resistant folded conformation (Brandon & Goldberg, 2001). The soluble intermediate is maintained by periplasmic chaperones Skp, DegP and SurA. Direct interaction of these

chaperones with IcsA has not been demonstrated (in vivo or in vitro) but they are required for proper IcsA presentation on the S. flexneri cell surface (Purdy et al., 2002; Purdy et al., 2007; Sklar et al., 2007b; Wagner et al., 2009). Studies on the effect of periplasmic chaperone depletion on either IcsA or other OMP’s cell surface presentation showed that these chaperones function redundantly, whereby DegP and Skp work in one pathway, and SurA works in another pathway, but both pathways work in parallel (Rizzitello et al., 2001; Sklar et al., 2007b). Whether or not the IcsA periplasmic intermediate is unfolded, partially folded or fully folded during translocation across the OM awaits further investigation (Henderson et al., 2004). Recent studies on various periplasmic chaperones have shed light on their functions in biogenesis of OMPs, which could be implicated in the IcsA translocation mechanism. The roles and functions of periplasmic chaperones are discussed below.

1.5.2.1 Periplasmic chaperones Periplasmic chaperones that have been identified can be classified into three groups: disulfide bond catalysts (Nakamoto & Bardwell, 2004), peptidylprolyl cis/trans isomerases (PPIases) and those with general chaperone activities such as DegP, Skp, and SurA (Duguay & Silhavy, 2004; Sklar et al., 2007b). The presence of the latter chaperones is critical in protecting and targeting OMPs to the BAM complex which mediates the insertion of the β-barrel into the OM and translocation of the AT passenger domain (Ruiz et al., 2006). The genes encoding these chaperones are regulated by the σE envelope stress response or the Cpx two-component signal transduction system (TCSTS) (Duguay & Silhavy, 2004; Raivio & Silhavy, 2001; Rhodius et al., 2006) which are activated in response to the presence of unfolded OMPs (Mecsas et al., 1993; Sklar et al., 2007b; Walsh et al., 2003).

1.5.2.2 DegP DegP, also known as HtrA, is a highly conserved heat shock protein that is temperature- regulated by switching from a chaperone to a protease as temperature elevates (Lipinska et al., 1990; Spiess et al., 1999). However, DegP may act either as a protease or a chaperone at 37 °C (Spiess et al., 1999). Expression of degP in E. coli is regulated by both the sigma factor 18

σE and the Cpx TCSTS (Danese et al., 1995; Danese & Silhavy, 1997; Purdy et al., 2002). An E. coli K-12 degP mutant is sensitive to high temperature (42 °C) and an acidic environment (Lipinska et al., 1989; Purdy et al., 2002).

The crystal structure of DegP has been determined to exist as a hexamer at its resting, proteolytically inactive state (Krojer et al., 2002; Krojer et al., 2008b). DegP is activated in the presence of unfolded proteins and acts to degrade proteins (Krojer et al., 2008b; Sawa et al., 2010). Krojer et al. showed that the proteolytic activity of DegP could only be activated by unfolded proteins. Hence, OMP periplasmic intermediates that can adopt their native conformation are not targeted by the proteolytic DegP (Krojer et al., 2008b). It has been suggested that DegP recognises the C-termini or hydrophobic residues (alanine or serine) of the unfolded proteins via its PDZ1 domain (Hauske et al., 2009; Krojer et al., 2008a).

A degP mutant of S. flexneri is defective in intercellular spreading and has reduced detectable amounts of surface IcsA by immunofluorescene (IF) with IcsA antibody, despite having wild-type IcsA production as detected in Western immunoblotting (Purdy et al., 2002; Purdy et al., 2007). The authors suggested that the IcsA protein insertion or translocation to the bacterial surface in a degP mutant was affected, hence, IcsA was misfolded and in a conformation that was not recognised by anti-IcsA antibody in IF assay (Purdy et al., 2007). Additionally, the authors showed overexpression of Skp but not SurA, suppressed the degP mutant phenotype, restoring intercellular spread ability (Purdy et al., 2007).

1.5.2.3 Skp Skp (seventeen kilodalton protein, 17 kDa) is a small periplasmic chaperone composed of 161 amino acids. Skp has previously been shown to bind a number of E. coli OMPs such as OmpA, OmpC, OmpF, and LamB via affinity chromatography (Chen & Henning, 1996). Direct interaction of Skp to S. flexneri IcsA has not yet been demonstrated but Skp is required for presentation of IcsA effector domain on the bacterial surface and for cell-to-cell spread (Purdy et al., 2007; Wagner et al., 2009).

Skp exists as a homotrimeric periplasmic chaperone which resembles a jellyfish, with three α-helical tentacles protruding from a β-barrel body defining a central cavity (Schlapschy 19

et al., 2004; Walton & Sousa, 2004). The exterior helical surface of Skp is positively charged (mostly Lys and Arg), while the central cavity is less charged and with patches of hydrophobic residues (Walton & Sousa, 2004). Unfolded OMP substrates are predicted to be bound in the central cavity of Skp which assists in protein folding as well as preventing protein aggregation according to the binding model using OmpA as the substrate (Walton & Sousa, 2004). OmpA is one of the best-characterised Skp substrates and has been extensively used as a model to study OMP folding and membrane insertion (Bulieris et al., 2003; Kleinschmidt et al., 1999; Surrey & Jahnig, 1995; Walton et al., 2009). Similar to DegP, the chaperone activity of Skp does not require ATP (Itzhaki et al., 1998; Walton & Sousa, 2004).

Furthermore, Skp is suggested to interact with LPS as the delivery of OMP to the OM via Skp is dependent on LPS (Bulieris et al., 2003; Geyer et al., 1979). Walton and Sousa (2004) reported a putative LPS binding site on the positively charged surface of Skp. Negatively charged LPS (corresponding to the Lipid A head) is hypothesised to bind to the positively charged exterior surface of Skp (Walton & Sousa, 2004). The authors suggested a model whereby Skp interacts with OMP (OmpA) when it emerges from the cytoplasm via the Sec apparatus by binding to the unfolded β-barrel domain of OMP in its central cavity, while the α-domain is folded in its native conformation. The Skp-OMP complex then traverses through the periplasm, interacts with LPS at the OM which changes the conformation of Skp, releases OMP to the BAM complex and followed by the insertion of β-barrel into the OM (Walton & Sousa, 2004; Walton et al., 2009). Free Skp is now recycled back into the periplasm and interacts with newly emerging OMP. Nevertheless, the interaction between Skp and LPS has not been shown in vivo.

A recent finding showed that Skp also interacts with the passenger domain (residue 361) of the wild-type and stalled EspP AT (Ieva et al., 2011). Cross-linking of Skp to the stalled EspP passenger domain at early stage (0.5 min) suggested that Skp binds to EspP before the initiation of translocation (Ieva et al., 2011). In addition, the same study also reported that Skp forms a stable interaction with the β-domain of EspP.

An S. flexneri skp mutant had reduced surface IcsA expression and was defective in ABM but had proper β-domain insertion into the OM, suggesting that the incorporation of β-domain into the OM is independent of skp (Wagner et al., 2009). Wagner et al. also claimed that the 20

disruption of icsP partially restored IcsA expression in a skp mutant (Wagner et al., 2009). These data further support that skp is critical in chaperoning the periplasmic IcsA intermediate. Overexpression of Skp in a S. flexneri degP mutant showed rescued IcsA surface expression to that of wild-type, indicating Skp and DegP have overlapping functions (Purdy et al., 2007). Direct interaction between Skp and IcsA has not been shown.

1.5.2.4 SurA SurA (survival factor A) is a member of the peptidyl-prolyl isomerase family but also has general chaperone activity (Sklar et al., 2007b). DSP chemical cross-linking showed that SurA, but not Skp or DegP, interacts with the BAM complex in vivo (Sklar et al., 2007b). Furthermore, deletion of surA in E. coli leads to a marked decrease in the OMP composition, while the depletion of DegP or Skp does not affect the OM density (Sklar et al., 2007b). Thus, the authors suggested that SurA is the primary periplasmic chaperone used by E. coli in escorting OMPs to the BAM complex in the OM, while DegP and Skp rescue OMPs that fall off the SurA pathway (Sklar et al., 2007b). In S. flexneri, a surA mutant is defective in IcsA surface presentation and plaque formation on HenLe cells (Purdy et al., 2007). Direct interaction between SurA and IcsA has also not yet been reported.

In a cross-linking study that involved EspP passesnger domain where its translocation was stalled, SurA was shown to cross-link with the EspP passenger domain (residue 521 and 361) and BamA (Ieva et al., 2011). Residue 361 of EspP passenger domain was cross-linked to both Skp and SurA, where the cross-linked Skp was observed at 0.5 min, while SurA was observed at a later stage. However, cross-linking of wild-type EspP (residue 361) with BamA or SurA was not observed but was observed with Skp (Ieva et al., 2011). These results suggest that both Skp and SurA interact with the passenger domain at distinct stages of EspP biogenesis, where SurA binds during the translocation reaction (Ieva et al., 2011).

In addition, McKay and colleagues reported that SurA preferentially binds peptides that are high in aromatic amino acids and recognises the Aro-X-Aro (aromatic-any residue- aromatic) tripeptide motifs, which are frequently found in the transmembrane β-barrel domain of OMPs (Bitto & McKay, 2003; Xu et al., 2007). 21

1.5.3 Translocation across the outer membrane

A NOTE: These figures/tables/images have been removed to comply with copyright regulations. It is included in the print copy of the thesis held by the University of Adelaide Library.

Figure 1.5 Proposed models for autotransporter export across the outer membrane.

A) Threading model The unfolded passenger domain in the periplasm (P) is proposed to pass from the N-terminus through the -barrel formed by the translocation domain embedded in the OM. The protein is then folded into an active conformation at the cell surface (E). (Oomen et al., 2004)

B) Hairpin model A hairpin structure is proposed to form inside the -barrel pore between the translocation domain and passenger domain and the protein is pulled from the C-terminus. (Jose et al., 1995; Pohlner et al., 1987)

C) Oligomer model The translocation domains of some ATs is proposed to oligomerise in the OM and form a pore where the passenger domains can pass through. (Veiga et al., 2002)

D) BamA model This model proposes that BamA mediates the insertion of the AT translocation domain into the OM and the passenger domain proceeds through a pore formed by the BAM complex (a hetero-oligomeric complex composed of BamA, BamB, BamC, BamD and BamE). Figure adapted from Grabowicz (2010).

Fully exported AT proteins of Gram-negative bacteria have a membrane-embedded -barrel domain and a functional domain that is completely folded and exposed on the cell surface. The classical translocation model of ATs was thought to be adequate to explain the translocation of the passenger domain across the bacterial membranes via the pore formed by -barrel, independent of other accessory proteins (Pohlner et al., 1987). However, studies on the biogenesis of the OM revealed that the BAM complex (consists of BamA and four lipoproteins: BamB, BamC, BamD, and BamE) is mandatory for the membrane insertion of β-barrel proteins (Rossiter et al., 2011; Sklar et al., 2007a; Voulhoux et al., 2003; Voulhoux & Tommassen, 2004; Wu et al., 2005). In addition, the presence of the BAM complex has recently been shown to be fundamental for the insertion of IcsA -barrel domain into the OM of S. flexneri (Jain & Goldberg, 2007).

A recent finding reported a new translocation and assembly module (TAM) that promotes efficient secretion of ATs in proteobacteria (Selkrig et al., 2012). The TAM complex consists of an Omp85-family protein, TamA (integral OMP) and TamB (integral inner membrane protein). It was shown that the TAM complex is required for secretion of ATs such as Ag43 and EhaA as the precursor form of Ag43 was accumulated in the periplasm in the tamA and tamB E. coli mutant (Selkrig et al., 2012). Therefore, it is proposed that the TAM functions to drive AT passenger domain secretion across the bacterial OM.

Four mechanisms for translocation of the passenger domain of ATs across the OM have been proposed: threading model, hairpin model, oligomer model and BamA model (Figure 1.5) (Bernstein, 2007; Leyton et al., 2012). In the threading model, translocation of the passenger domain starts at the N-terminus of the peptide through the β-barrel pore embedded in an unfolded conformation. However, this model seems implausible because the passenger domain lacks a targeting sequence that targets the peptide to the pore (Oomen et al., 2004) and neither deletion of the N-terminal region nor the fusion of artificial peptides to the translocator domain affects the AT exportation (Henderson et al., 2004; Jose et al., 1996; Maurer et al., 1997; Skillman et al., 2005).

In the hairpin model, a hairpin structure is proposed to form inside the β-barrel pore between the translocator domain and passenger domain interface, which drives the unfolded

passenger domain from periplasm to the cell surface through the β-barrel pore (Jose et al., 1995; Pohlner et al., 1987). However, the β-barrel pore is relatively narrow (10 x 12.5 Å) and it is unlikely for passenger domains that have formed disulphide bonds in the periplasm to be translocated through this channel (Brandon & Goldberg, 2001; Khalid & Sansom, 2006; Oomen et al., 2004; Veiga et al., 1999). A recent crystal structure report showed that the BrkA β-domain (a dimer resulting from crystal packing) forms a β-strand hairpin-like structure inserted into the adjacent monomer, and a hydrophobic cavity has been identified in the AT barrels, demonstrating that it is possible to accommodate a hairpin motif in the central pore (Zhai et al., 2011). In addition, the AC region of BrkA was suggested to be involved in hairpin structure formation and allows the translocation of passenger domain through the - barrel pore (Desvaux et al., 2004; Jacob-Dubuisson et al., 2004). Thus, it was suggested that the hydrophobic cavity might interact with the AC domain to promote protein secretion and folding after the β-barrel has been inserted into the OM by the BAM complex (Zhai et al., 2011).

A third model is the oligomer model, whereby the monomeric -barrel domain is predicted to oligomerise into a group of 8-10 monomers, forming a central hydrophilic pore (~ 2 nm), which allows the translocation of a folded, disulphide-bond-containing passenger domain, as shown for IgA1 protease of Neiserria gonorrhoeae (Veiga et al., 1999; Veiga et al., 2002). However, other translocator domains of ATs are unable to form an oligomeric structure, for example: NalP of Neisseria meningtidis, AIDA-1 and EspP of E. coli (Muller et al., 2005; Oomen et al., 2004; Skillman et al., 2005). In addition, our laboratory has recently shown that IcsA protein multimerises in the OM as shown by reciprocal co-precipitation of differentially epitope-tagged IcsA proteins (May et al., 2012). Hence, oligomerisation of the translocator domains is most likely only applicable to a certain subset of ATs.

The final export model for passenger domain is the BamA model. BamA is a highly conserved protein among Gram-negative bacteria and is involved in the assembly of integral OMPs as well as AT proteins into the OM (Voulhoux et al., 2003). The hypothesis for this model is that the Skp-OMP-LPS complex in the periplasm is recognised by the BAM complex via the C-terminal consensus sequence of the OMP translocator domain. This assists the insertion of the barrel domain into the OM which then allows the translocation of the 24

passenger domain across the OM through the BamA pore (Henderson et al., 2004; Ieva et al., 2008; Ieva & Bernstein, 2009; Oomen et al., 2004; Robert et al., 2006).

1.6 Shigella Actin-Based Motility

ABM is a key mechanism in S. flexneri pathogenesis as described in Section 1.2. Shigella is capable of utilising the host actin regulatory proteins and initiate F-actin comet tail formation via IcsA, thus allowing ABM to occur. The eukaryotic host cells are composed of a supportive actin cytoskeleton framework and N-WASP is a key actin regulator which functions as a link between signaling pathways and de novo actin polymerisation, leading to host cell motility and morphological changes (Goldberg, 2001; Miki & Takenawa, 2003; Snapper et al., 2001; Suzuki et al., 1998; Yarar et al., 1999). A number of actin regulatory proteins have been found associated with Shigella and the F-actin comet tails (eg. N-WASP, Arp2/3 complex, Cdc42, Grb2, profilin, cofilin, Nck, WIP, vinculin, Toca-1 and VASP) (Carlier et al., 2000; Chakraborty et al., 1995; Kadurugamuwa et al., 1991; Leung et al., 2008; Loisel et al., 1999; Moreau et al., 2000; Suzuki et al., 1996). However, the presence of some of these identified proteins is not compulsory for efficient Shigella ABM. Numerous studies have been carried out on the functions of these proteins in ABM, and N-WASP is one of the most extensively studied and critical host factors for Shigella ABM (Goldberg, 2001; Snapper et al., 2001; Suzuki et al., 1998).

In addition to the F-actin comet tail formation, a TTSS effector protein, VirA, is also crucial for Shigella intracellular spreading. The secreted VirA within the host cell was initially thought to degrade tubulin, destabilise the microtubule within the cytoskeleton and promote membrane ruffling (Yoshida et al., 2002; Yoshida et al., 2006). However, the identification of the VirA crystal structure showed that VirA does not have protease activity (Germane et al., 2008). Nevertheless, a virA-null Shigella mutant was less efficient in invasion, suggesting that VirA is important for bacterial uptake into the epithelial cells (Germane et al., 2008). In addition, a recent study has suggested that VirA manipulates calpain activity by promoting an early calpastatin degradation, which is involved in Shigella- infected epithelial cell death (Bergounioux et al., 2012).

1.6.1 Requirement of N-WASP for IcsA-mediated actin assembly The Wiskott-Aldrich syndrome protein (WASP) family proteins have an important role in morphological changes and motility of cells because they initiate de novo actin polymerisation in response to external stimuli (Miki & Takenawa, 2003). Wiskott-Aldrich syndrome is an X-chromosome-linked disease, which is characterised by thrombocytopenia, eczema, and immunodeficiency (Miki & Takenawa, 2003). The WASP protein was given this name because patients who suffer from this disease have a mutation in the WAS gene. There are four other identified WASP-related family members: N-WASP (Neural Wiskott-Aldrich syndrome protein), WAVE/Scar (WASP-family veprolin-homologoues protein/suppressor of cAMP receptor) 1, 2 and 3 (Miki & Takenawa, 2003). N-WASP shares 50% homology to WASP and was first identified by Miki et al. (Fukuoka et al., 1997; Miki et al., 1996).

The importance and necessity of N-WASP in Shigella ABM has previously been demonstrated in several model systems. First of all, actin polymerisation was abolished in an in vitro study whereby E. coli expressing surface IcsA was incompetent in forming F-actin comet tail in N-WASP-depleted Xenopus egg extracts. The formation of F-actin comet tail could be restored by the addition of purified N-WASP protein (Suzuki et al., 1998). In another in vitro study, E. coli (IcsA) pre-incubated with purified N-WASP was able to form F-actin comet tails in platelets extract, which are naturally lacking in N-WASP (Egile et al., 1999). Furthermore, Shigella was able to invade and multiply within the N-WASP-deficient cell line but failed to form F-actin comet tails and cell-to-cell spreading (Snapper et al., 2001). However, F-actin comet tail formation could be restored by expressing N-WASP protein in trans (Snapper et al., 2001). In spite of the ubiquitous distribution of N-WASP, haematopoietic cells such as macrophages and PMNs do not support Shigella F-actin comet tail formation and ABM (Miki et al., 1996; Suzuki et al., 2002). This is due to the low levels of N-WASP expression in these cells, and WASP expression predominates (Suzuki et al., 2002).

1.6.2 N-WASP regulation and activation N-WASP (65 kDa) is ubiquitously distributed, including the colon, and is dominantly expressed in the brain (Miki et al., 1996). N-WASP is composed of a few distinctive domains: an N-terminal WH1 domain (Plekstrin homology, PH and IQ motif) that binds calmodulin, a basic region (B) that binds phosphatidylinositol (4,5) diphosphate [PIP2], a GTPase binding domain (GBD) or Cdc42/Rac interacting binding domain (CRIB) that binds Cdc42, a proline-rich region that binds profilin, a G-actin-binding verprolin homology (V) domain, a cofilin homology (C) which is known to be involved in actin depolymerisation, and an C-terminal acidic domain (A) that binds the Arp2/3 complex (Fig. 1.6) (Miki et al., 1996; Rohatgi et al., 2000).

Figure 1.6 Functional domains of human N-WASP. A schematic diagram of the functional domains of human N-WASP (aa 505) (Fukuoka et al., 1997, Martinez-Quiles., 2001). WASP-homology domain 1 (WH1; aa 34-138), which overlaps a Plekstrin homology domain (PH; aa 1-98) and a calmodulin binding IQ motif (aa 128-147) that bind calmodulin; a basic region (B; aa 184-200) that binds phosphatidylinositol (4,5) diphosphate (PIP2); a GTPase-binding domain (GBD), also known as Cdc42/Rac interactive binding domain (CRIB) (aa 203-222); a proline-rich domain (aa 277-389) that binds SH3-domain containing ligands (Nck, Grb2 or profilin); a verprolin homology (V; aa 405-449) that binds G-actin; a cofilin homology (C; aa 470-489) that involves in actin depolymerisation and an acidic domain (A; aa 486-505) that binds Arp2/3 complex.

N-WASP exists in two forms, inactive N-WASP and active N-WASP. Inactive N-WASP is always auto-inhibited by forming intramolecular bonds between the GBD/CRIB and VCA region, thus, masking the VCA active site (Kim et al., 2000; Miki et al., 1996). As a result, the actin-related protein (Arp)2/3 complex, a seven protein complex that initiates actin nucleation by polymerisation of G-actin monomers is unable to bind the VCA region and be activated (Fig. 1.7). The binding of Cdc42 (a small GTPase of the Rho-subfamily) to the

CRIB domain and PIP2 to the basic region is able to activate N-WASP synergistically (Ma et al., 1998a; Ma et al., 1998b; Rohatgi et al., 2000). The activated N-WASP then exposes the VCA active site, recruits the Arp2/3 complex, and initiates actin polymerisation. Additionally, N-WASP can be activated by the binding of Src homology domain 3 (SH3)-adaptor molecules Nck and Grb2 to the proline-rich domain (Carlier et al., 2000; Miki & Takenawa, 2003; Tomasevic et al., 2007). The Src family and Abl tyrosine kinase can enhance N-WASP activation by phosphorylating the tyrosine residue (Y256) at the GBD/CRIB domain (Burton et al., 2005; Miki & Takenawa, 2003).

N-WASP has been shown to interact with WIP (WASP-interacting protein) through the WH1 domain and forms a WIP-N-WASP complex (Ramesh et al., 1997; Zettl & Way, 2002). Martinez-Quiles et al. proposed that the binding of WIP to N-WASP inhibits N-WASP activation in the absence of activators and stabilises the auto-inhibited conformation of N- WASP (Ho et al., 2004; Martinez-Quiles et al., 2001). In addition, transducer of Cdc42- dependent actin assembly (Toca-1) has been identified to be required for Cdc42 to activate the WIP-N-WASP complex by neutralising the suppression exerted by WIP (Ho et al., 2004). More recently, Toca-1 has been proposed to be involved in the activation of N-WASP during Shigella infection (Fig. 1.7) (Leung et al., 2008).

Activation of N-WASP described above is termed allosteric activation, where N-WASP undergoes conformational change upon ligand binding and exposes the VCA region. Recent findings report that most of the N-WASP ligands (eg. Cdc42, PIP2, Toca-1 and SH3 domain- containing ligands) are both allosteric activators and clustering effectors, which dimerise/oligomerise N-WASP (Higgs & Pollard, 2000; Padrick et al., 2008; Padrick & Rosen, 2010; Rohatgi et al., 2001). As a result, the dimerised/oligomerised N-WASP will

have stronger binding affinity to the Arp2/3 complex (multiple VCA regions) and allow potent recruitment and activation of the Arp2/3 complex (Fig. 1.8).

Figure 1.7 Activation of the WIP-N-WASP complex. Cellular N-WASP forms a complex with WIP and exists in an auto-inhibited conformation due to the intramolecular interaction between the GBD/CRIB and VCA regions. Binding of PIP2 and Cdc42 to the basic domain and GBD/CRIB domain, respectively, disrupts the intramolecular interaction and activates N-WASP synergistically. The activated N-WASP changes conformation, unfolds, and exposes the VCA active site which recruits the Arp2/3 complex. The binding of WIP to WH1 domain of N-WASP serves to stabilise the auto- inhibited comformation and suppress N-WASP activation in the absence of activators. Toca-1 is essential for activation of WIP-N-WASP complex and Cdc42.

A NOTE: This figure/table/image has been removed to comply with copyright regulations. It is included in the print copy of the thesis held by the University of Adelaide Library.

Figure 1.8 Allosteric and oligomeric activation of N-WASP.

Activation of N-WASP from the auto-inhibited state to the active state is known as allosteric activation. The activated and unfolded monomeric N-WASP can recruit the Arp2/3 complex. However, the activated and unfolded N-WASP can be dimerised by a dimeriser such as SH3- containing ligand which binds the proline-rich domain of N-WASP. The active dimeric N- WASP amplifies the affinity of VCA for the Arp2/3 complex. Figure adapted from Padrick and Rosen (2010).

1.6.3 Arp2/3 complex The Arp2/3 complex consists of seven highly conserved polypeptides which are stably assembled, and two of the subunits are Arp2 and Arp3 (Welch et al., 1997). The remaining five subunits are known as ARPC1 (actin-related protein complex-1), ARPC2, ARPC3, ARPC4, and ARPC5 (Goley & Welch, 2006). Crystal structure of the Arp2/3 complex has been determined at 2.0 Å by Robinson et al. (Robinson et al., 2001). The Arp2/3 complex is a cellular factor which stimulates actin nucleation. This is believed to be due to the surface of Arp2 and Arp3 subunits which forms a conventional actin-like barbed end, and may mimic the barbed end of F-actin (Kelleher et al., 1995). The Arp2/3 complex is always in the inactive form and interactions with the WA/VCA domain of nucleation-promoting factor

(NPF) such as SCAR/WASP family proteins and/or pre-existing (mother) actin filaments are required for efficient actin nucleation (Rodal et al., 2005). The activated Arp2/3 complex will then undergo a change in conformation and initiate de novo actin polymerisation. In addition to nucleating new actin filaments, the Arp2/3 complex is capable of forming actin filaments into a branching network by attaching the filament ends to the side of the mother filament at a fixed angle of 70° (Goley & Welch, 2006; Mullins et al., 1998).

1.6.4 IcsA-mediated N-WASP activation and actin polymerisation The exact mechanism as to how IcsA activates N-WASP and the requirement of other host accessory proteins is still not well understood. This section will discuss the current model for IcsA-mediated N-WASP activation and the roles of various host factors in actin polymerisation.

IcsA-mediated N-WASP activation is independent of Cdc42, as IcsA mimics the GTPase Cdc42. This has been demonstrated in Cdc42-deficient HeLa cells, as well as in Shigella- infected HeLa cells treated with a Rho GTPase inhibitor (Mounier et al., 1999; Shibata et al., 2002). Upon binding of IcsA to N-WASP, the intramolecular bonding between the GBD/CRIB and VCA domains is disrupted, causing N-WASP to unfold and expose the VCA region, and recruit the Arp2/3 complex as described in Section 1.6.2 (Fig. 1.9). The IcsA passenger domain, N-WASP and Arp2/3 have been proposed to form a ternary complex and initiate actin polymerisation. N-WASP only interacts with IcsA at the pole of Shigella, while the Arp2/3 complex is distributed at both the bacterium pole and along the F-actin comet tail (Egile et al., 1999). However, the interaction between N-WASP and Arp2/3 complex is not permanent because Arp2/3 is incorporated into the new branch of actin filaments and will eventually detach from the filaments (Egile et al., 1999).

The IcsA protein was first reported to bind to the VCA region of N-WASP, however this idea was later disputed as it was shown that IcsA interacts with the GBD/CRIB and the WH1 domains of N-WASP (Egile et al., 1999; Moreau et al., 2000; Suzuki et al., 2002). As mentioned in Section 1.4.4, a purified IcsA fragment (aa 103-433), which contains the six GRRs is sufficient to bind to N-WASP (Suzuki et al., 1998) but a broader region of IcsA (aa 31

53-508) is required for in vitro actin polymerisation assays (Suzuki et al., 1996; Suzuki & Sasakawa, 2001). In addition, May and Morona (2008) have recently reported three N-WASP interacting regions (IRs) based on IcsA linker insertion mutagenesis studies as described in Section 1.4.4, where 2 regions were found to be novel. These regions are: N-WASP IR I (aa 185-312) which contains the GRRs, N-WASP IR II (aa 330-382) and N-WASP IR III (aa 508-730) (Fig. 1.4).

Figure 1.9 Model of IcsA-mediated activation of N-WASP. Binding of IcsA to N-WASP disrupts the intramolecular interaction between the VCA and GBD/CRIB domains of N-WASP. N-WASP undergoes conformational change, exposes the VCA region and enables the recruitment of the Arp2/3 complex. The IcsA passenger domain, N-WASP and Arp2/3 form a ternary complex which polymerises actin. The formation of F- actin comet tails generates a propulsive force that allows ABM. IcsA has been shown to interact with both the WH1 and GBD/CRIB domains of N-WASP via the N-WASP interacting regions.

1.6.4.1 Role of WIP The recruitment of WIP to intracellular Shigella via the WH1 domain of N-WASP and F-actin comet tails formation have been reported (Moreau et al., 2000). However, the presence of WIP is not essential for in vitro Shigella ABM and WIP does not have a direct effect on Shigella F-actin comet tail formation inside cells (Moreau et al., 2000). As described in Section 1.6.2, WIP serves to suppress N-WASP activation, stabilising the auto-inhibited N- WASP, thus maintaining cell cytoskeleton regulation. In addition, WIP also contains the proline-rich domain which binds SH3-domain containing ligands/activators. Therefore, the WIP-N-WASP complexes will have more SH3-binding sites that might enhance N-WASP activation (Padrick & Rosen, 2010; Ramesh & Geha, 2009).

1.6.4.2 Role of Cdc42 As described in Section 1.6.2, Cdc42 is a Rho family GTPase and is the best characterised activator of N-WASP (Miki & Takenawa, 2003). GTP-bound Cdc42 binds the N-WASP CRIB domain, destabilising its interaction with the VCA region and leads to allosteric activation. In addition, Cdc42 is also a clustering effector when present at high density, leading to N-WASP oligomerisation and enhances the VCA affinity for Arp2/3 complex (Padrick & Rosen, 2010). However, Cdc42 is not required for Shigella ABM because IcsA- mediated N-WASP activation is independent of Cdc42. Nevertheless, Cdc42 is essential for membrane ruffling and efficient uptake of Shigella during invasion and cell-to-cell spreading (Egile et al., 1999; Loisel et al., 1999; Mounier et al., 1999; Shibata et al., 2002).

1.6.4.3 Role of PIP2

PIP2 has two roles in regulating N-WASP and actin polymerisation. Firstly, PIP2 and Cdc42 co-operate and activate the auto-inhibited N-WASP by binding to the basic region and CRIB domain of N-WASP, respectively. The second role is to act upstream by activating Cdc42 (Rohatgi et al., 2000). A more recent study, which identified Toca-1 as an activator of both the Cdc42-mediated actin nucleation and the WIP-N-WASP complex, suggests that the major

role of PIP2 is upstream of N-WASP (Ho et al., 2004). Similar to Cdc42, PIP2 is also a N- WASP oligomeriser at high density (Padrick & Rosen, 2010).

1.6.4.4 Role of Toca-1

In vitro activation by Cdc42 and PIP2 of N-WASP depend on Toca-1 (Ho et al., 2004). Little is known about the role of Toca-1 in activation of N-WASP in mammalian cells. Toca-1 has recently been shown to be involved in the relief of N-WASP auto-inhibition during IcsA- mediated actin polymerisation (Leung et al., 2008) and Toca-1 is not required for the subsequent maintenance of N-WASP once it is activated. Leung et al. (2008) also reported that the type III effector proteins secreted by S. flexneri are responsible in recruiting Toca-1 in vivo.

1.6.4.5 Role of N-WASP proline-rich region ligands Nck, Grb2, and profilin The proline-rich region of N-WASP plays a role in Shigella ABM because over-expression of an N-WASP mutant lacking the proline-rich region led to a substantial reduction in F-actin comet tail formation (Mimuro et al., 2000). A few proline-rich region binding N-WASP activators that contain the SH3 domain are known and generally serve as oligomerisers (Padrick & Rosen, 2010).

Profilin is an actin monomer-binding protein that binds to the N-WASP proline-rich region and recruits free G-actin monomer to the sites of actin assembly (Yang et al., 2000). Profilin is not essential for IcsA-mediated ABM, however, the presence of profilin increases the rate of motility of E. coli expressing IcsA (Goldberg, 2001; Loisel et al., 1999; Mimuro et al., 2000). On the other hand, it is also suggested that profilin improves the Shigella motility by enhancing nucleation by the activated Arp2/3 complex, and is not due to its binding to the proline-rich region of N-WASP (Yang et al., 2000).

Nck is a SH3-domain containing N-WASP activator that is not required for Shigella ABM even though it is being recruited to the Shigella surface and the F-actin comet tails (Miki & Takenawa, 2003; Moreau et al., 2000). This was proven by the over-expression of a dominant 34

negative form of Nck (Nck lacking its SH2 domain) that did not affect the F-actin comet tails of intracellular Shigella (Moreau et al., 2000). In addition, the exclusion of Nck in an in vitro actin polymerisation assay had no effect in F-actin comet tails formation (Loisel et al., 1999).

Grb2 is a SH2/SH3-containing adaptor that binds to the proline-rich region of N-WASP via its SH3 domain (Miki & Takenawa, 2003). Similar to Nck, Grb2 is not essential for IcsA- mediated ABM, however Grb2 enhances the actin polymerisation synergistically with Cdc42 by binding to N-WASP simultaneously and was shown to reduce the delay prior to F-actin comet tail formation in an in vitro assay involving reconstituted proteins and E. coli expressing IcsA (Carlier et al., 2000).

1.6.4.6 Role of Abl tyrosine kinase and N-WASP phosphorylation Phosphorylation of N-WASP has recently been reported and is suggested to be essential for efficient Shigella F-actin comet tails formation (Burton et al., 2005). Abl tyrosine kinase has been shown to phosphorylate Y256 at the CRIB domain to stabilise the activated state of N- WASP and improve actin polymerisation. In an Abl-deficient cell line, Shigella formed shorter F-actin comet tails, as well as a smaller plaque size (Burton et al., 2005). Furthermore, F-actin comet tails could be restored by over-expressing the activated form of N-WASP in an Abl-deficient cell line, supporting its role in N-WASP activation.

1.6.5 Role of vinculin in Shigella ABM Vinculin is another host actin-regulatory protein that interacts with IcsA directly. Inside cells, vinculin is uniformly distributed on the surface of Shigella, throughout the F-actin comet tail and within protrusions (Goldberg, 2001; Kadurugamuwa et al., 1991; Suzuki et al., 1996). Even though vinculin is recruited by intracellular Shigella, the role of vinculin in Shigella ABM is controversial. Shigella within the vinculin-deficient cell line (F9 5.51 cells) was able to form F-actin comet tails and perform cell-to-cell spreading (Goldberg, 1997). In addition, vinculin was not required in in vitro IcsA-mediated ABM assay using purified cytoskeletal proteins (Loisel et al., 1999). However, it was later reported that a small amount of truncated

vinculin was detected in the F9 5.51 cells, which suggests that a minimal amount of vinculin is sufficient to support Shigella ABM (Southwick et al., 2000).

1.6.6 Role of formin in S. flexneri spreading Formins are ubiquitously distributed proteins that have the same function as Arp2/3 complex, to initiate de novo polymerisation of actin. However, formin-mediated actin polymerisation leads to cross-linking of actin polymers in parallel arrays (Pruyne et al., 2002; Sagot et al., 2002). Inhibition or depletion of Diaphanous-related formins Dia1 and Dia2 inhibited the formation of protrusions by S. flexneri (Heindl et al., 2010). It was suggested that Dia1 enhances Shigella protrusion formation by maintaining and remodeling the cellular cortical actin network. As a result, a force is generated by the formation of parallel arrays of polymerised actin and pushes out against the plasma membrane, promoting S. flexneri intercellular spreading (Heindl et al., 2010). However, how Shigella induces switching from the Arp2/3-mediated actin polymerisation to the formin-mediated actin polymerisation at the plasma membrane remains unclear.

1.7 Lipopolysaccharide of S. flexneri

Lipopolysaccharide (LPS) is a major component of the OM that is asymmetrically distributed at the outer leaflet of the Gram-negative bacteria OM (Muhlradt & Golecki, 1975). LPS contributes to the structural integrity of the bacteria and protects the membrane from toxic compounds such as antibiotics and bile salts (Nikaido, 2003). In addition, LPS acts as an endotoxin which provokes the immune system upon invasion of bacteria (Miller et al., 2005). The importance and the role of LPS in Shigella pathogenesis are discussed herein.

1.7.1 Structure of lipopolysaccharide LPS is comprised of three major components: lipid A, core sugars and O-antigen (Oag) polysaccharide chains (Fig. 1.10A) (Raetz & Whitfield, 2002). The intact LPS molecules are

known as smooth LPS (S-LPS) while an LPS molecule lacking Oag is known as rough LPS (R-LPS). The lipid A molecule is anchored into the OM, and the Oag is linked to lipid A via the core sugar. An Oag repeat unit (RU) of almost all S. flexneri serotypes is composed of three rhamnose and one N-acetylglucosamine sugar units (Fig. 1.10B) (Van Den Bosch & Morona, 2003). The length of the Oag LPS molecules is dependent on the activity of the Wzz proteins (Morona et al., 1995). S. flexneri 2a has two modal chain lengths of LPS Oag on the bacterial surface (Fig. 1.11). A short (S) type (12-17 RUs), that is under controlled of the chromosomally encoded WzzSF and a very long (VL) type (> 90 RUs), that is determined by a plasmid encoded WzzpHS-2 (Hong & Payne, 1997; Morona et al., 1995). The expression of these two modal lengths contributes to serum resistance and virulence of Shigella (Hong & Payne, 1997; Morona et al., 2003; Van Den Bosch et al., 1997).

Figure 1.10 The structure of lipopolysaccharide (LPS) and O-antigen (Oag). A) S-LPS is embedded in the OM and consists of three components: the lipid A, the core polysaccharide and the Oag polysaccharide chain. A R-LPS molecule that lacks the Oag polysaccharide chain is shown on the right panel. B) The Y-serotype Oag consists of a tetrasaccharide repeat unit that is composed of an N-acetylglucosamine (GlcNAc) residue and three rhamnose (Rha) residues.

Figure 1.11 Silver-stained SDS-PAGE analysis of S. flexneri LPS. S. flexneri 2a strain 2457T (lane 1) and S. flexneri 2a 2457T ∆rmlD (lane 2) were electrophoresed on an SDS-15%-PAGE gel and silver stained. The very long-type (VL-type) modal length is conferred by WzzpSH-2 and the short-type (S-type) modal length is conferred by WzzSF. n = number of Oag repeat units.

1.7.2 The LPS biosynthesis pathway The structure and the production of different LPS components have been proposed, however, the exact molecular mechanism of LPS biosynthesis and its assembly on the cell surface are still unclear. The current models for LPS biosynthesis pathway involve the MsbA ABC transporter and the Lpt (LPS transport) pathway (Narita & Tokuda, 2009; Raetz & Whitfield, 2002; Ruiz et al., 2008; Ruiz et al., 2009; Sperandeo et al., 2008; Tran et al., 2010).

Individual components of LPS (lipid A, core sugar and Oag) are synthesised at the cytoplasmic face of the IM (Fig. 1.12), where lipid A and core sugar are ligated and form R- LPS (Ruiz et al., 2009). Both R-LPS and Oag are flipped across the IM independently (by the MsbA ABC transporter and Wzx flippase, respectively), ligated together at the periplasmic face of the IM by the WaaL ligase and form a LPS molecule (Raetz & Whitfield, 2002; Ruiz et al., 2009). LPS then interacts with the Lpt pathway, whereby LPS is extracted out from the IM by the ABC transporter composed of LptB, LptF and LptG, and possibly the LptC bitopic membrane protein (Ruiz et al., 2009). In the periplasm, LPS is chaperoned by a periplasmic chaperone, LptA, which then delivers LPS to the LptD/LptE complex located at the OM and assembles LPS at the cell surface (Ma et al., 2008; Tran et al., 2008; Wu et al., 2006). LptD is an OMP, which is inserted by the BAM complex, while LptE is a lipoprotein that binds LPS (Chng et al., 2010b).

Two models have been proposed in transporting LPS from the IM to the OM (Fig. 1.12) (Ruiz et al., 2009). In the soluble-intermediate model, LPS is chaperoned by LptA and delivered to the LptD/LptE assembly site on the OM. In the trans-envelope complex model, LptA oligomerises and connects the Lpt factors, forming a multiprotein complex that spans the periplasm, which serves as a bridge between the IM and OM (Ruiz et al., 2009). The trans-envelope complex model hypothesis is supported by a recent study, whereby all seven Lpt proteins of the trans-envelope complex were isolated from a single membrane fraction (Bowyer et al., 2011; Chng et al., 2010a). In addition to LptA, Skp is suggested to interact with LPS in the periplasm as described in Section 1.5.2.3 (Walton & Sousa, 2004).

A NOTE: This figure/table/image has been removed to comply with copyright regulations. It is included in the print copy of the thesis held by the University of Adelaide Library.

Figure 1.12 Models of LPS export. After being synthesised at the cytoplasmic face of the inner membrane (IM), rough LPS (R- LPS) molecules are flipped across the IM by the MsbA ABC transporter. O-antigens are flipped across the IM by the Wzx flippase and ligated to the R-LPS molecule at the periplasmic face of the IM by WaaL ligase to form a LPS molecule (step not shown). LPS is then extracted out of the IM by the ABC transporter composed of LptC, LptB, LptF and LptG. In the soluble intermediate model, LPS is chaperoned by LptA (a periplasmic chaperone) and delivered to the LptD and LptE assembly site on the OM. In the trans- envelope complex model, LptA oligomerises and connects the Lpt factors, forming a multiprotein complex that spans the periplasm, serving as a bridge between the IM and OM. Figure adapted from Ruiz et al. (2009).

1.7.3 Role of LPS O-antigen in ABM and intercellular spreading The requirement of S-LPS in IcsA-dependent ABM and intercellular spreading has been widely proven to be essential through a series of mutagenesis studies on genes known to be involved in LPS biosynthesis (wzy, galU, rfe, rfb, rmlD) (Hong & Payne, 1997; Okada et al., 1991; Rajakumar et al., 1994; Sandlin et al., 1995; Sandlin et al., 1996; Van Den Bosch et al., 1997). A deep rough Shigella mutant (eg. galU) which produces an incomplete LPS core with no Oag attached, displays circumferential IcsA distribution on the bacterial surface and is

defective in F-actin comet tail formation and cell-to-cell spreading (Okada et al., 1991; Sandlin et al., 1995). R-LPS mutants (eg. rfe) display intermediate IcsA phenotype with both polar and lateral distribution (Okada et al., 1991; Sandlin et al., 1995). These mutants were capable of forming F-actin comet tails but with altered morphology, and either did not form plaques or form very tiny plaques on tissue culture monolayers (Okada et al., 1991; Sandlin et al., 1995; Sandlin et al., 1996; Van Den Bosch et al., 1997).

LPS Oag is proposed to maintain the polarity of IcsA on S. flexneri and the efficiency of ABM and intercellular spread (Robbins et al., 2001; Sandlin et al., 1995). This is shown by R-LPS strains where IcsA is not strictly localised at one pole. It has been suggested that LPS Oag reduces the membrane fluidity and hence, prevents the diffusion of IcsA from the pole towards lateral regions of the bacterium (Robbins et al., 2001; Sandlin et al., 1995). Another possible explanation for the loss of IcsA polarity in R-LPS strains is that the Oag chains mask the detection of laterally located IcsA. Studies from the Morona laboratory have shown that the newly synthesised IcsA protein is found at both the lateral region and the old pole of the bacterium (S-LPS Shigella and E. coli), while the presence of LPS Oag prevents the antibody from binding to IcsA at the lateral region. This can be explained by the higher IcsA gradient at the pole, which was more readily detected by antibody (Morona et al., 2003; Morona & Van Den Bosch, 2003).

As mentioned above, an R-LPS mutant is defective in ABM and it has been shown not to be due to the non-polar localisation of IcsA. This is because S-LPS S. flexneri expressing high levels of non-cleavable IcsA (IcsA*) displayed a similar IcsA localisation to R-LPS strain but were still capable of performing ABM and intercellular spreading (Van Den Bosch & Morona, 2003). Hence, there may be a possible alternative role for LPS Oag in Shigella cell to cell spreading.

A new role for LPS Oag was recently found in a study performed by May and Morona

(2008) whereby LPS Oag was shown to mask the function of certain IcsAi mutants (with mutation outside of the AC region) in N-WASP recruitment and ABM. To date, the effect of LPS Oag on IcsA translocation has not been reported.

1.8 Autophagy and intracellular survival of S. flexneri

Autophagy is a highly conserved cellular degradation process in eukaryotes that balances the growth and development of the cell, as well as being part of the cell’s innate surveillance system by degrading intracellular microbes (Dorn et al., 2002; Kirkegaard et al., 2004; Yorimitsu & Klionsky, 2005). Autophagy maintains the cellular cytoplasmic contents by degrading or recycling undesirable proteins and organelles (Klionsky & Emr, 2000; Ogawa et al., 2005; Yorimitsu & Klionsky, 2005). Cellular components or microbes to be degraded are sequestered into double-membrane vesicles (autophagosome) and fused with lysosomes in response to various stress conditions such as nutrient starvation and microbial invasion (Levine & Klionsky, 2004; Levine, 2005; Reggiori & Klionsky, 2005; Yoshimori, 2004). Shigella is a greatly adapted human pathogen that is able to circumvent this host defense system by secreting the IcsB protein in order to survive inside the cells (Ogawa et al., 2005). The role of the IcsB protein and the mechanism involved in preventing autophagosome formation, which increases the survival rate of intracellular S. flexneri, are discussed herein.

1.8.1 IcsB protein and its role IcsB (52 kDa, 494 amino acids) is a TTSS effector protein of S. flexneri that was first identified by Allaoui et al. as a virulence factor and has recently been reported to play a role in intracellular survival of Shigella (Allaoui et al., 1992; Ogawa et al., 2005). IcsB is encoded by the icsB gene which is located upstream of the ipaBCD genes in the 220 kb virulence plasmid (Allaoui et al., 1992; Ogawa et al., 2003), and was initially proposed to be required for lysis of protrusions during intercellular spread (Allaoui et al., 1992). However, it was later pointed out by other researchers that the icsB mutant created by Allaoui et al. (1992) had a polar effect on the downstream ipa genes and a different phenotype than the icsB mutant created by other groups (Allaoui et al., 1992; Page et al., 1999; Rathman et al., 2000). For example, Rathman et al. showed that there was no difference in phenotype between their newly constructed non-polar icsB mutant and the wild-type strain in intercellular spreading and lysis of the double membrane (Rathman et al., 2000).

In contrast, Ogawa et al. demonstrated a new role for IcsB in Shigella pathogenesis (Ogawa et al., 2005), suggesting that IcsB is responsible for intracellular survival of Shigella by outcompeting the Atg5 protein (autophagic protein) from binding to the IcsA protein (Ogawa et al., 2005). Allaoui et al. reported that IcsB was not required during invasion but played an important role at the post-invasion stage (Allaoui et al., 1992). This statement was supported by Ogawa et al. where the investigators showed that smaller plaques were formed by the ∆icsB YSH6000 mutant compared to the wild-type (YSH6000) or the ∆icsB/pTB-IcsB- IpgA complemented strain in plaque assays (Ogawa et al., 2003). The formation of smaller plaques indicated that the ∆icsB mutant was invasive but failed to perform efficient cell-to- cell spreading. Therefore, it was concluded that IcsB was vital in the later stage of Shigella infection. Ogawa et al. (2003) also reported that IcsB was chaperoned by IpgA, which is encoded by the ipgA gene. The ipgA gene is located immediately downstream of the icsB gene and IpgA is produced as a fusion protein with IcsB (IcsB-IpgA) (Ogawa et al., 2003). This is due to the presence of an amber stop codon in the icsB gene that can be read-through by RNA polymerase. IpgA functions to stabilise IcsB, prevent IcsB degradation and facilitate IcsB secretion via TTSS (Ogawa et al., 2003).

The homolog of IcsB is TTSS effector BopA of Burkholderia pseudomallei which shares 23% similarity, and has a similar function to IcsB in escaping from autophagy (Cullinane et al., 2008). Interestingly, both IcsB and BopA have recently been reported to contain a Rho GTPase inactivation domain at their carboxy termini, which may function as a protease or acyltransferase acting on host molecules (Pei & Grishin, 2009). In addition to binding to IcsA and preventing interaction with Atg5, another recent report showed that IcsB interacts specifically with cholesterol in host cells and facilitates the escape of intracellular Shigella from autophagy (Kayath et al., 2010). The binding of IcsB to cholesterol might lead to accumulation of cholesterol on membrane and affect the fusion of autophagosome with lysosome (Gong et al., 2011). The removal of the cholesterol binding domain of IcsB (aa 288- 351) significantly increased the autophagosome formation and indicated that the binding of IcsB to cholesterol was required for efficient escape from autophagy (Kayath et al., 2010).

Furthermore, an interesting microarray study showed that the expression of both icsA and icsB genes was significantly downregulated during intracellular bacterial growth in HeLa 43

cells and human macrophage-like U937 cells (Lucchini et al., 2005). As both IcsA and IcsB are the critical virulence proteins for Shigella virulence and survival in the host, it is unknown why expression of these genes is downregulated in intracellular bacteria. Nonetheless, it could be one of the bacterial survival strategies that awaits investigation.

1.8.2 The relationship between IcsA, IcsB and Atg5 Autophagy can be triggered by amino acids starvation, hormonal stimulation, drug treatment, as well as intracellular pathogen invasion (Dorn et al., 2002; Kabeya et al., 2000). Intracellular Shigella is detected by the host surveillance system via the surface IcsA protein. According to Ogawa et al., newly invaded Shigella (both wild-type YSH6000 and ΔicsB YSH6000) was able to escape from the vacuole, multiply within the cytoplasm, form F-actin comet tails and perform ABM as per normal in the first 3 hours of invasion (Ogawa et al., 2005). However, the growth of the ΔicsB mutant reached maximum level 4 hours after invasion. The population of the ΔicsB mutant started to decrease after 4 hours and the bacteria were enclosed within multi-layer membranes (autophagosome) as examined by electron microscopy (Ogawa et al., 2005). In addition, a higher population of the ΔicsB mutant than wild-type Shigella that co-localised with GFP-LC3 (autophagosome-specific marker) was observed inside MDCK cells. In atg5-knockout MEF cells, intracellular growth of the ΔicsB mutant was recovered to the wild-type level, which further suggests that the ΔicsB mutant triggers autophagy (Ogawa et al., 2005).

Ogawa et al. reported that the distribution of LC3 and Atg5 tend to be asymmetrical on the ΔicsB mutant bacterial body, which is similar to the distribution of IcsA. They showed that Atg5 specifically interacted with IcsA but not IcsB via in vitro pull down assays and in situ immunofluoresence assays (Ogawa et al., 2005). Additionally, the researchers demonstrated that IcsB inhibited the binding of Atg5 to truncated IcsA proteins in a dose-dependent manner, whereby IcsB has higher binding affinity to IcsA than Atg5. From the same pull down assay, they also showed that both IcsB and Atg5 interacted with the same IcsA truncations, which indicates that they bind to the same region of IcsA (aa 320-433) (Ogawa et al., 2005). Ogawa et al. therefore proposed that as a consequence of Atg5 binding to IcsA,

intracellular Shigella IcsA protein directly triggers autophagy when IcsB is absent. In spite of this, Atg5 is still targeting a small population of wild-type S. flexneri to autophagy (Ogawa et al., 2005). The diagram that illustrates the binding of IcsB and Atg5 to IcsA on Shigella is shown in Fig. 1.13.

Figure 1.13 Proposed model for the binding of IcsB and Atg5 to IcsA of intracellular Shigella. In the presence of IcsB (wild-type Shigella), Atg5 is unable to bind to IcsA because IcsB has higher affinity and binds competitively to IcsA. In the icsB mutant, Atg5 binds to IcsA and triggers autophagy. LC3 is an autophagosome specific marker, indicative of autophagy formation.

Moreover, a recent report by Pei and Grishin suggested that IcsB could prevent the IcsA/Atg5 interaction by proteolysis of Atg5 or via an acyltransferase activity that abolishes the interaction between IcsA and Atg5 (Pei & Grishin, 2009). This has shed light on an additional role of IcsB in bacterial evasion from autophagy. In addition, a newly reported finding suggests that the septin cage-like structure formed surrounding the intracellular S. flexneri is dependent on IcsA-mediated actin polymerisation and promoted autophagy formation. An ΔicsB mutant was compartmentalised in septin cages more effieciently than the WT strain, indicating that both autophagy and septin cage assembly have the same function (Mostowy et al., 2010; Mostowy & Cossart, 2011).

1.8.3 The interaction between IcsA, IcsB, Atg5 and N-WASP As discussed in Section 1.6 and Section 1.8.2, IcsA interacts with both N-WASP and IcsB where the N-WASP IR II (aa 330-382) overlaps with the IcsB/Atg5 binding region (aa 320- 433). However, the specific N-WASP binding/interacting sites within the three N-WASP IRs reported by May and Morona (2008) are yet to be fully identified. The overlapping N-WASP IR II and IcsB binding region is an intriguing finding, as both N-WASP and IcsB have different contributions to the intracellular activities of S. flexneri and yet, both proteins bind to the same region of IcsA. However, it is unknown if IcsB is present and/or required during IcsA-mediated actin polymerisation. N-WASP which has multiple interacting regions within IcsA is recruited during actin polymerisation but it is unclear if N-WASP competes with IcsB in binding to the same region of IcsA (N-WASP IR II), or whether the N-WASP IR I (contains GRR) and N-WASP IR III are sufficient to recruit N-WASP. Moreover, the binding affinity between IcsA and IcsB is also unknown. In addition, as the ΔicsB mutant is able to form F-actin comet tails up to 3 hours after bacterial invasion and Atg5 is required for autophagy formation, it is unclear if Atg5 will be recruited to the ΔicsB mutant that has N- WASP attached and is actively forming F-actin comet tails, or is targeting only the ΔicsB mutant where the IcsA protein is unoccupied.

1.9 Project aims

This thesis investigates several aspects of IcsA structure, function and biogenesis and the specific aims of this study are: 1. To investigate the effect of mutations within the IcsA autochaperone region (on IcsA function and biogenesis) by expressing the IcsA mutants in a S. flexneri ΔicsA ΔrmlD strain.

2. To determine the specific amino acid residues involved in N-WASP binding/interaction within N-WASP IR II and N-WASP IR III.

3. To over-express and purify truncated N-WASP domain proteins and the IcsAα passenger domain.

4. To construct an icsB mutant, characterise its phenotype and investigate the interaction between IcsA, IcsB, N-WASP and Atg5.

Chapter Two

Materials and Methods

Chapter 2: Materials and Methods

2.1 Chemicals, Enzymes and Reagents

2.1.1 Buffers and Reagents All reagents (unless otherwise stated) were prepared with either RO water (Millipore) or MQ water (Millipore, 18.2 MΩcm-1).

2.1.2 Enzymes and Chemicals Restriction endonucleases, T4 DNA Ligase, and Taq polymerase were purchased from New England Biolabs (NEB). Phusion™ High-Fidelity DNA Polymerase was purchased from Finnzyme. Bafilomycin A1 was purchased from Sigma.

2.1.3 Antibodies The antibodies used in this study, and their concentrations/dilutions used in Western immunoblotting (WB) and immunofluorescence (IF) microscopy are listed in Table 2.1. All antibodies were stored at -20 °C and were made up in 50 % (v/v) glycerol.

2.1.4 Oligonucleotides Oligonucleotides used in this study were purchased from Geneworks (Adelaide, South Australia) and are summarised in Table 2.2.

2.2 Bacterial strains, plasmids and growth media

2.2.1 Bacterial strains and plasmids Bacterial strains (E. coli and S. flexneri strains) used and created in this study are listed in Table 2.3 and Table 2.4, respectively. Plasmids used in this study are listed in Table 2.5.

2.2.2 Growth media and conditions All E. coli and S. flexneri strains were maintained in glycerol [30 % (v/v) glycerol, 1 % (v/v) peptone] for long term storage at -80 °C. All bacterial strains were grown for 16 h at 37 °C or 30 °C (for temperature sensitive bacteria) in Luria Bertani (LB) broth [10 g/L Bacto Tryptone Peptone (BD), 5 g/L yeast extract (Difco), 5 g/L NaCl] or LB agar plate (for E. coli) or tryptic soy agar [30 g/L Tryptic Soy Broth (TSB) (BD), 15 g/L Bacto Agar (BD)] supplemented with 0.01 % (v/v) Congo Red [CR] (for S. flexneri), unless otherwise stated, with appropriate antibiotics. For high protein yield, Terrific broth [24 g/L yeast extract, 12 g/L tryptone, 0.4 % (v/v) glycerol, 0.017 mM KH2PO4, 72 mM K2HPO4) was used. On CR agar, virulence plasmid positive Shigella strains appeared red while the virulence plasmid-cured strains appeared as white colonies. For blue/white colonies screening, LB agar plates were supplemented with 20 μg/mL 5-bromo-4-chloro-3-indolyl- -D-galactoside (X-gal, Progen). Where appropriate, antibiotics were added to the following concentrations: Ampicillin (Ap), 100 μg/mL; Chloramphenicol (Cm), 25 μg/mL; Kanamycin (Km), 50 μg/mL; Streptomycin (Strep), 100 μg/mL; Tetracycline (Tc), 10 μg/mL; and Trimethropim (Tp), 10 μg/mL.

2.3 DNA Manipulation

2.3.1 Preparation of DNA by heating Bacterial DNA to be used in a PCR screening was prepared by the boiling method. Bacterial colonies were resuspended in 100 μL sterile MQ water with a sterile loop. Samples were heated at 100 °C for 5 min. Then, the lysed bacteria were centrifuged (13,000 rpm, 1 min, RT, Eppendorf Centrifuge 5415R) and the supernatant was collected. 2 μL of supernatant was used as a template in a PCR reaction.

2.3.2 Preparation of DNA using a kit DNA plasmids were extracted from a 10 mL culture using QIAprep Spin Miniprep kit (Qiagen) as per manufacturer’s instructions.

2.3.3 DNA purification

2.3.3.1 DNA gel extraction 10 μL of loading dye [0.1 % (w/v) bromophenol blue (Sigma), 20 % (v/v) glycerol, 0.1 mg/mL RNase (Sigma)] was added to 50 μL of overnight restriction enzyme treated DNA samples and loaded onto 1 % (w/v) TBE agarose. 50 μL of the DNA sample was loaded into the centre well while 5 μL of DNA sample was added into each of the flanking wells. The DNA samples were electrophoresed at 110 V for 45 min. The agarose gel was then stained with Gel RedTM nucleic acid gel stain (Biotium) [3 x Gel RedTM, 0.1 M NaCl] (30 min, RT). Prior to UV exposure, the centre well was cut and left aside. The remaining gel which contained the flanking wells was exposed to UV light in order to visualise the fluorescent DNA and the desired DNA band was excised. Then, the centre well was aligned with the remaining gel and the target DNA band was excised using the cut- flanking bands as a guide. The DNA was then being extracted using PureLinkTM Quick Gel Extraction kit (Invitrogen) as per manufacturer’s instructions. The eluted DNA was used in ligation reactions.

2.3.3.2 Purification of PCR products QIAquick PCR Purification Kit (Qiagen) was used to isolate all digested DNA fragments and PCR products to be used for cloning. This kit removed all enzymes, oligonucleotides and salts remaining in the PCR products prior to ligation.

2.4 DNA Analysis

2.4.1 Agarose gel electrophoresis Restriction endonuclease digested DNA and PCR product to be electrophoresed were mixed with 0.25 volumes of the loading dye and loaded onto a 1 % (w/v) agarose gel in 1 x TBE buffer. Bacillus subtilis SPP-1 bacteriophage DNA restricted with EcoRI was used as the DNA marker (made in-house by Morona Lab). The SPP-1 sizes (kb) were 8.51, 7.35, 6.11, 4.84, 3.59, 2.81, 1.95, 1.86, 1.51, 1.39, 1.16, 0.98, 0.72, 0.48, 0.36, and 0.09. The gel 51

was electrophoresed at 110 V, 45 min, followed by staining with 3 x Gel RedTM nucleic acid gel stain (Biotium) at RT, 30 min. DNA bands were visualised with Molecular Imager Gel Doc XR (Bio-Rad).

2.5 In vitro DNA cloning

2.5.1 Restriction endonuclease digestion of DNA All restriction digests were carried out as per the manufacturer’s instruction. Restriction digests of plasmid DNA and PCR amplicons for analytical purposes or in vitro cloning (Section 2.5.3) were performed with 1-2 μg DNA with the appropriate enzyme (2 U/μL each) in the commercial buffers (NEB, Buffers 1-4). Restriction endonuclease digests intended for gel extraction (Section 2.3.3.1) were performed with 4-8 μg DNA in an 50 μL reaction volume. Each reaction was incubated at 25 C or 37 C, 16 h.

2.5.2 Shrimp Alkaline Phosphate (SAP) treatment Single restriction endonuclease digested plasmid was SAP treated in order to prevent the re-ligation of the vector. Each reaction contained 5 μL digested plasmid, 1 U of SAP (Roche), and 1 x SAP buffer (Roche) in a 10 μL reaction in MQ water. Reaction was incubated at 37 C, 60 min, followed by inactivation of SAP at 65 °C, 20 min. 3 L of SAP treated plasmid was used in the subsequent ligation reaction (Section 2.5.3).

2.5.3 Ligation of DNA fragment into cloning vectors Ligation reaction was performed according to the method described by the manufacturer (NEB). Ligation with the pGEMT-Easy vector was performed as described by the manufacturer (Promega). Ligation products were transformed into chemically competent DH5 and grown on LB agar supplemented with 20 μg/mL X-gal in dimethylformide (DMF) and 100 μg/mL Ap.

2.6 Polymerase Chain Reaction (PCR)

2.6.1 General PCR method The PCR was carried out in a total volume of 20 μL per reaction tube. The reaction consisted of at least 100 ng DNA template (either plasmids or genomic DNA), 50 μM oligonucleotides, 200 μM dNTPs (Sigma), 0.25 Unit Taq DNA polymerase (NEB), and 1 x ThermolPol Reaction Buffer (NEB). All PCR reactions were performed in an Eppendorf Mastercycler Gradient PCR thermocycler. Every standard PCR reaction involved 25 cycles of denaturation (95 °C, 30 sec), annealing (56 °C, 30 sec) and extension (72 °C, 1 kb/min DNA).

2.6.2 Specific gene amplification for cloning Amplification of a specific gene for cloning was performed in a reaction tube with a final volume of 50 μL and carried out in an Eppendorf Mastercycler Gradient PCR thermocycler. Phusion High-Fidelity DNA Polymerase (Finnzyme) was used to amplify a PCR product. PCR reaction was carried out as outlined by the manufacturer (Finnzyme).

2.6.3 DNA sequencing

2.6.3.1 Capillary Separation (CS) DNA sequencing ABI Prism Big Dye Terminator Version 3.1 was used to perform DNA sequencing in a final volume of 12 μL in an Eppendorf Mastercycler. Each sequencing reaction contained 1 μL DNA plasmid, 1 μL primer and 4 μL Big Dye terminator mix. The sequencing reaction consisted of 27 cycles of DNA denaturation (95 °C, 30 sec), primer annealing (50 °C, 15 sec) and extension (60 °C, 4 min).

The sequencing product was then precipitated using the ethanol/sodium acetate (EtOH/NaAc) method. Briefly, 3 μL 3 M sodium acetate (pH 4.6), 62.5 μL non-denatured 95% ethanol and 14.5 μL MQ water were added to 20 μL sequencing product (volume adjusted by adding 8 μL MQ water) and vortexed. The reaction tubes were left at RT for 1 53

h to allow DNA precipitation. Then, the mixture was centrifuged (13,000 rpm, 20 min, RT, Eppendorf Centrifuge 5415R) and the supernatant discarded. 250 μL of 70 % (v/v) ethanol was added to the pellet, vortexed briefly and centrifuged for another 5 min as above. After the removal of supernatant, the pellet was incubated at 65 °C for 10 min in order to remove the remaining ethanol. Sequencing reactions were analysed by the Australian Genome Research Facility (AGRF), Plant Genomic Centre, University of Adelaide, PMB1 Glen Osmond, Urrbrae SA 5042.

2.6.3.2 Purified DNA (PD) DNA sequencing A mixture of 600 ng-1200 ng DNA plasmid and 1 μL primer was adjusted to 12 μL with MQ water in a 1.5 mL reaction tube. The samples were sent to the Australian Genome Research Facility (AGRF) for DNA sequencing as above.

2.6.4 Sequencing Analysis DNA sequence data obtained from AGRF was analysed and aligned with the native DNA sequence using DNAMAN (Version 4.22).

2.7 Bacterial transformation

2.7.1 Preparation of chemically competent cells

A 16 h culture was diluted at 1:20 in 10 mL LB broth and incubated at 37 C, 2 h, with aeration. Cultures were then centrifuged at 4500 rpm, 10 min, 4 C (3K15 Sigma). The pellet was resuspended in 5 mL ice-cold 0.1 M MgCl2, and re-centrifuged as above. Cells were then resuspended in 1 mL ice-cold 0.1 M CaCl2 and incubated on ice for 1 h, followed by the same centrifugation. Finally, bacterial cells were resuspended in 0.5 mL ice-cold 0.1 M CaCl2 containing 15 % (v/v) glycerol. Chemically competent cells were used fresh or kept at -80 C with 200 μL aliquots.

2.7.2 Preparation of electro-competent cells

A 16 h culture was diluted at 1:20 in 10 mL LB broth and incubated at 37 C, 2 h, with aeration. Cultures were then centrifuged at 4500 rpm, 10 min, 4 C (3K15 Sigma). Bacterial pellet was resuspended in 10 mL ice-cold water, centrifuged, and again, resuspended in 5 mL ice-cold water and re-centrifuged as above. Finally, bacterial cells were resuspended in 200 L ice-cold 10 % (v/v) glycerol and 100 L of cells aliquoted into 1.5 mL reaction tubes. Electro-competent cells were used fresh or kept at -80 C.

2.7.3 Heat shock transformation

Chemically competent cells were thawed on ice for 10 min and mixed with 10 L of ligation product. The DNA/bacterial mixture was incubated on ice for 30 min, followed by heat shock at 37 C (water bath), 3 min, and then 5 min on ice. 1 mL of SOC medium [20 g/L Tryptone (BD), 5 g/L Yeast Extract, 8.6 mM NaCl, 2.5 mM KCl, 20 mM MgSO4] supplemented with 0.2 % (w/v) glucose was then added into the mixture. Transformed cells were then incubated at 37 C or 30 C for 1 h to allow antibiotic resistance expression. The cells were plated onto LB agar with appropriate antibiotics and incubated at either 37 C or 30 C (temperature sensitive strain) for 16 h.

2.7.4 Electroporation

Electrocompetent cells were thawed on ice for 10 min. Approximately 2 L of DNA (Section 2.3.2) was added into 100 L of electrocompetent cells and transferred to a pre- chilled electroporation cuvettes (0.2 cm gap, Bio-Rad). The cells were then electroporated (Bio-Rad Gene Pulser, 2.5 kV, 25 F, Capacitance extender 960 F, Pulse Controller 200 ). 1 mL of SOC supplemented with 0.2 % (w/v) glucose was added into the electroporated cells and incubated at 37 C, 1 h, to allow antibiotic resistance expression. The cells were plated onto LB agar with appropriate antibiotics and incubated at either 37 C or 30 C (temperature sensitive strain) for 16 h.

2.7.5 Conjugation The donor and recipient strains were grown for 16 h at 37 °C with aeration in 10 mL LB with appropriate antibiotics. Cultures were centrifuged (4500 rpm, 10 min, 4 C, 3K15 Sigma), the supernatant discarded and the pellets were resuspended in 10 mL fresh LB. For E. coli recipient strain, 100 μL of the donor strain was mixed with 900 μL of the recipient strain, and 100 μL of the mixture was plated onto sterile 0.22 μm HA gridded membrane filters (Milipore) on LB plates without antibiotics, followed by incubation at 37 °C for 16 h. For S. flexneri recipient strain, 500 μL donor strain was mixed with 5 mL of recipient strain (larger scale to improve conjugation efficiency), and 100 μL of the mixture was plated onto sterile 0.22 μm HA gridded membrane filters (Milipore) on LB plates without antibiotics as described above. The filters were then transferred to 5 mL LB, vortexed to resuspend the bacteria, and diluted 10-3 and 10-4 in LB. 100 L of each dilution was plated onto LB agar containing appropriate antibiotics for the recipient strain and the plasmid. The plates were incubated at 37 °C, 16 h.

2.8 Construction of virulence plasmid and chromosomal gene mutations

2.8.1 Mutagenesis of degP chromosomal gene A S. flexneri degP::Cm ΔicsA mutant was constructed as previously described (Purins et al., 2008) by conjugating S-17-1 λ pir [pCVD442+degP::Cm] (RMA2802) with S. flexneri ΔicsA (RMA2041). Conjugated bacteria were grown on LB agar supplemented with Cm and Tc at 30 °C. Cm/Tc-resistant colonies were selected, cultured overnight (16 h at 30 °C with aeration), and serial dilution was performed from the overnight culture (10-1 to 10-5), followed by growing on LB agar supplemented with 0.6 % (w/v) sucrose, Cm and Tc at 30 °C for 16 h. The Cm/Tc-resistant and Ap-sensitive colonies were selected, one of which was isolated to give MYRM522, and confirmed as described in Section 3.6.

2.8.2 Mutagenesis of virulence plasmid using -red phage mutagenesis system The construction of a non-polar S. flexneri icsB mutant was performed as described by Ogawa et al. (2003) and Datsenko and Wanner (2000) with some modifications.

Primers were designed to PCR amplify the icsB::aphA-3 fragment from pMYRM112 (Section 6.2). The PCR product (50 μL) was purified and concentrated to ~10 μL (Section 2.3.3.2). S. flexneri carrying pKD46 was grown at 30 °C in the presence of 0.2 % (w/v) arabinose and made electrocompetent (combined 2 x 10 mL culture) (Section 2.7.2). The concentrated PCR product was then electroporated into S. flexneri via electroporation (2 mm gap cuvette) (Section 2.7.4). The transformants were grown on LB agar plate containing Km at 37 °C for 16 h. The loss of pKD46 was confirmed by patching the resultant transformants onto LB agar plate containing Ap. Deletion of the icsB gene was confirmed by PCR with appropriate primers and DNA sequencing (Section 6.2).

2.8.3 Multi Site-Directed Mutagenesis The QuikChange® Lightning Multi Site-Directed Mutagenesis Kit (Stratagene) was used to mutate aa 330-331, aa 381-382 and aa 716-717 of the icsA gene. Degenerate primers (Table 2.2) which encode for the degenerate codons were designed by using the Stratagene web-based QuikChange Primer Design Program available online at https://www.genomics.agilent.com. Mutagenesis was performed as per manufacturer’s instructions.

2.8.4 Single Site-Directed Mutagenesis The QuikChange® Lightning Site-Directed Mutagenesis Kit (Stratagene) was performed as per manufacturer’s instructions to mutate specific amino acids. Primer pairs (Table 2.2) were designed by using the Stratagene web-based QuikChange Primer Design Program available online at https://www.genomics.agilent.com.

2.9 Protein Techniques

2.9.1 Preparation of whole cell lysate

Broth cultures grown for 16 h were diluted 1:20 and incubated with aeration at 37 C, 2 h. Cultures equivalent to 5x108 bacteria were centrifuged (13,000 rpm, 1 min, RT, Eppendorf Centrifuge 5415R) and resuspended in 100 L 1 x sample buffer [2 % (w/v) SDS, 10 % (v/v) glycerol, 5 % (v/v) -mercaptoethanol (Sigma), 0.02 % (w/v) bromophenol blue (Sigma), 0.0625 M Tris-HCl, pH6.8]. Unless otherwise stated, samples were heated to 100 C for 5 min prior to electrophoresis.

2.9.2 Trichloroacetic acid precipitation of culture supernatants TCA precipitation of culture supernatant was performed as described previously (May & Morona, 2008). The equivalent of 5x108 bacteria were centrifuged, and the supernatant was treated with 5 % (w/v) ice-cold trichloroacetic acid (TCA), and incubated on ice. The TCA precipitate was then collected by centrifugation (12, 000 rpm, 30 min, 4°C, JA-14, Beckman), and the pellet was washed with ice-cold acetone prior to recentrifugation for 5 min. The pellet was air-dried, resuspended in 100 μL of 1 x sample buffer, and heated at 100°C for 5 min prior to SDS-PAGE.

2.9.3 Limited proteolysis with trypsin Overnight culture (16 h) was diluted 1:20 at 37 °C and incubated with aeration for 2 h. The equivalent of 5x109 bacteria were centrifuged (4500 rpm, 4 °C, 10 min, 3K15 Sigma), and the pellet was resuspended in 250 μL PBS. 50 L of sample (time point = 0 min) was taken prior to the addition of 0.1 μg/mL of trypsin from bovine pancreas (Roche #109819) in MQ. Proteolysis was performed at RT and 50 μL of bacterial samples were collected at 5 min, 10 min, 15 min and 20 min. Further proteolysis was inhibited by the supplementation with 1 mM phenylmethylsulphonyfluoride (PMSF, Sigma) from a 10 mM working stock in ethanol. An equal volume of 2 x sample buffer was added to each sample, heated at 100 °C for 5 min prior to storage at -20 °C. 58

2.9.4 SDS Polyacrylamide Gel Electrophoresis (SDS-PAGE) Proteins from samples prepared in Section 2.9.1 were separated on SDS-PAGE gels in PAGE running buffer [0.025 M Tris-HCl, 0.2 M glycine, 0.1 % (w/v) SDS] at 200 V (either Bio-Rad Mini-Protean System III or Sigma vertical gel electrophoresis unit) for 1-2 h as required. BenchMark Pre-stained Protein Ladder (Invitrogen; 190 kDa, 120 kDa, 85 kDa, 60 kDa, 50 kDa, 40 kDa, 25 kDa, 20 kDa, 15 kDa, 10 kDa); HiMarkTM Pre-stained (Invitrogen; 460 kDa, 268 kDa, 238 kDa, 171 kDa, 117 kDa, 71 kDa, 55 kDa, 41 kDa, 31 kDa); and protein Low molecular weight standards (Pharmacia; 95 kDa [phosphorylase B], 67 kDa [bovine serum albumin], 43 kDa [ovalbumin], 30 kDa [carbonice anhydrase], 20 kDa [soybean trypsin inhibitor], 14.4 kDa [α-lactalbumin]) were used as a guide to estimate protein sizes.

2.9.5 Coomassie Blue staining Proteins separated on SDS-PAGE gel were stained by Coomassie Blue solution [5 % (v/v) perchloric acid, 0.09 % (w/v) Coomassie Blue G250 (Sigma)] for 16 h at RT with agitation, followed by destaining with 5 % (v/v) glacial acetic acid until the background staining was removed. Low molecular weight marker (Pharmacia) was usually used as a guide to estimate protein size.

2.9.6 Western immunoblotting Proteins separated on SDS-PAGE gel were transferred to a nitrocellulose membrane (NitroBind, Pure nitrocellulose, 0.45 m, GE Water & Process Technologies) for 1-2½ h as desired at 200 mA in transfer buffer [0.025 M Tris, 0.2 M glycine, 5 % (v/v) methanol]. The membrane was blocked with 5 % (w/v) skim milk in TTBS [0.016 M Tris-HCl, 0.12 M NaCl, 0.05 % (v/v) Tween20 (Sigma)] with agitation at RT, 20 min, followed by overnight incubation with primary antibody in the presence of 2.5 % (w/v) skim milk in TTBS at RT. The concentrations of primary antibodies used are stated in Table 2.1. The membrane was then washed 3 times with TTBS, 10 min each, and incubated with secondary antibody (HRP-conjugated goat anti-mouse or HRP-conjugated goat anti-rabbit 59

antibody) for 2 h with agitation at RT. The membrane was washed 3 times with TTBS, 5 min each, then, 3 times with TBS [0.016 M Tris-HCl, 0.12 M NaCl], 5 min each. For detection, Chemiluminescent Peroxidase Substrate-3 (Sigma) was used as described by the manufacturer. The membrane was then either exposed to a X-ray film or to Kodak Image Station 4000MM Pro (Carestream Molecular Imaging) to visualise the bands of interest. The film was developed using a Curix 60 automatic X-ray film processor (Agfa).

2.9.7 Protein expression

2.9.7.1 Induction of IcsP expression with arabinose

Bacterial strains harbouring [pBAD33::icsP] were grown at 37 C, 16 h, with aeration and supplemented with 0.3 % (w/v) glucose to suppress IcsP expression. Then, the strain was diluted 1:20 in 10 mL LB broth, grown at 37 C with aeration for 2 h and supplemented with 0.3 % (w/v) glucose. The culture was centrifuged (4500 rpm, 10 min, RT, 3K15 Sigma), the supernatant discarded, the pellet washed with 10 mL warm LB broth to remove any glucose residue and re-centrifuged as above. The pellet was resuspended in 10 mL warm LB and separated into two 5 mL aliquots. One aliquot served as the no IcsP induction control by supplementing it with 0.3 % (w/v) glucose while IcsP expression was induced with the addition of 0.2 % (w/v) arabinose into another aliquot and incubated for 1 h at 37 C with aeration. A600nm of bacterial culture was measured and whole cell lysates with a concentration of 5x108 bacteria were prepared as described in Section 2.9.1.

2.9.7.2 IcsAA ::BIO and arabinose induced IcsP over-expression

Strain RMA2986 (UT5600 strain harbouring [pBAD33::icsP] [pIcsA ::BIO] [pBRR1MCS::birA]) was grown at 37 C, with aeration for 16 h (in LB containing Ap, Km, Cm, 0.3 % [w/v] glucose). The strain was then diluted 1:20 in 100 mL Terrific broth, 37 C, and grown with aeration for 2 h (containing Ap, Km, Cm, 0.3 % [w/v] glucose). The culture was centrifuged (8000 rpm, 20 min, RT, Rotor HFA 14.290, Heraeus Sepatech), the pellet washed 1 x with 10 mL warm Terrific broth, re-centrifuged (3000

rpm, 20 min, RT, Heraeus Labofuge 400R Centrifuge), and resuspended in 2 mL warm Terrific broth. IcsP expression was induced at 37 C for 1 h with aeration by adding 0.2 % (w/v) of arabinose. The expressed IcsP protein cleaved the surface biotinylated-IcsA and released it into the culture supernatant. Bacterial cells were centrifuged (3000 rpm, 20 min, RT, Heraeus Labofuge 400R Centrifuge) and the supernatant was collected.

2.9.7.3 IPTG induction of various StrepTagII-“GFP-N-WASP”-His10 domains protein

StrepTagII-“GFP-N-WASP”-His10 fusion proteins (GFP-WH1; GFP-CRIB; GFP-WH1-

CRIB; GFP-N-WASP) and StrepTagII-EGFP-His10 were expressed from the pTriEx-6 vector (Novagen), which encodes a StrepTagII and His10 tags at N- and C- termini, respectively. Various [pTriEx-6 + “GFP-N-WASP”] and [pTriEx-6 + EGFP] constructs were electroporated into the expression strain, Rosetta2(DE3) (Novagen), that carries the [placIq] (TcR) plasmid (MYRM249). [placIq] helps to suppress the leaky expression from pTriEx6. Strains were grown at 37 C, 16 h, with aeration (in LB containing Ap and Tc), then diluted 1:20 in 250 mL LB (containing Ap only) and grown at 37 C for 2½ h with aeration. Protein expression was induced with 1 mM IPTG at RT for 4 h with aeration. Bacterial cells were then centrifuged (8000 rpm, 10 min, 4 C, Rotor JA-10, Beckman) and lysed by sonication with ten 30-s pulses. Unbroken cells were removed by low speed centrifugation (5000 rpm, 10 min, 4 °C, Rotor HFA 22.50, Heraeus Sepatech). The supernatant was collected and centrifuged at high speed (35, 000 rpm, 1 h, 4 °C, Rotor Ti 80, Beckman Coulter OptimaTM L-100 XP Ultracentrifuge). The supernatant was then collected and used in His-tagged protein purification with the ÄKTAprime plus system (GE Healthcare) (Section 2.9.8.4) and StrepTagII protein purification (Section 2.9.8.5).

2.9.7.4 Induction of IcsAA -MycHis6 expression with arabinose

E. coli [Top 10 or BL21(DE3)] strains carrying [pBAD/MycHis::icsA ] were grown overnight in LB (37 °C) or M63 minimal media (25 °C) [100 mM KH2PO4, 15 mM

(NH4)2SO4, 1.7 μM FeSO4.7H2O, pH 7.0, 1 mM MgSO4, 0.2 % (v/v) glycerol], 61

supplemented with 0.3 % (w/v) glucose. The strains were then diluted 1:20 in either LB or M63 minimal media (supplemented with 0.3 % [w/v] glucose) and grown to mid- exponential phase at 37 °C or 25 °C, respectively. The cultures were washed, resuspended in fresh media (LB or M63 minimal media) and the protein expression was induced with 0.2 % (w/v) arabinose at 37 °C for 2 h (strain grown in LB) or at 25 °C for 16 h (strain grown in M63 minimal media). The bacterial cultures were then lysed and used in protein purification as described in Section 2.9.8.3 and Section 2.9.8.4.

2.9.7.5 IPTG induction of His6-IcsB-IpgA BL21(DE3) carrying [pTB101-IcsB-IpgA] was grown overnight at 37 C, 16 h, with aeration in Terrific broth, then diluted 1:20 in 1 L Terrific broth and grown at 37 C for 2 h with aeration. Protein expression was induced with 1 mM IPTG at 37 C for 3-4 h with aeration. The induced culture was centrifuged (8000 rpm, 10 min, 4 °C, Rotor JA-10, Beckman), the supernatant discarded. The pellet was resuspended in 5 mL of lysis buffer

(50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, pH 8.0) and passed twice through a French press chamber (FRENCH pressure cell press, SLM Aminco Instruments) pre- cooled to 4 °C. Broken cell debris were removed by centrifugation (4500 rpm, 15 min, 4 °C, Sigma 3K15). The supernatant was ultracentrifuged (35, 000 rpm, 1 h, 4 °C, Rotor Ti 80, Beckman Coulter OptimaTM L-100 XP Ultracentrifuge). The supernatant which contained the soluble proteins was collected and used to purify the His6-IcsB-IpgA protein (Section 2.9.8.2).

2.9.8 Protein purification

2.9.8.1 IcsAA ::BIO protein purification using Dynabeads® MyOneTM Streptavidin T1 (Invitrogen)

The induction and release of IcsA ::BIO protein into the culture supernatant was performed as described in Section 2.9.7.2. The collected supernatant was dialysed against 3 L of Buffer W [100 mM Tris-HCl pH 8.0, 150 mM NaCl, 1 mM EDTA] at 4 °C for 16 h 62

with constant stirring. The dialysing tube (Selbys type 453103 dialysis tube; MWCO 8000- 10, 000 Da) was then transferred to a fresh Buffer W and the dialysis process was continued for another 4 h under the same conditions.

The dialysed supernatant sample was recovered and incubated with Dynabeads® MyOneTM Streptavidin T1 (Invitrogen). The recommended protocol by the manufacturer was performed for purification of the biotinylated IcsA protein (IcsAα::BIO). Briefly, 20 μL (200 μg) of Dynabeads was transferred to a 2 mL tube with screw lid, left on a magnetic stand for 2 min, the storage buffer was removed and equilibrated 3 times with 20 μL Buffer W. Between each wash, the tube was left on magnetic stand for 2 min which pulled the beads to one side of the tube and facilitated the removal of buffer. The dialysed supernatant sample was then mixed with the equilibrated beads, incubated at 4 °C for 4 h, with very gentle rocking. The protein-bound beads was collected and resuspended in 50 μL 1 x sample buffer. No washing of the beads was performed.

2.9.8.2 Purification of His6-tagged proteins with Ni-NTA agarose (Qiagen)

Purification of the His6-tagged protein from E. coli (Section 2.9.7.5) under native conditions was performed according to the manufacturer’s instructions (Qiagen). Briefly, equilibrated 50 % Ni-NTA slurry (Qiagen) was mixed with 4 mL cell lysate in a 10 mL tube and incubated at 4 °C for 1 h (with gentle shaking). The mixture was centrifuged (3000 rpm, 10 min, Labofuge 400R Heraeus Instrument), the supernatant collected and the Ni-NTA slurry was resuspended and washed a few times with 4 mL wash buffer (5 min incubation at RT with gentle rotation each wash) (50 mM NaH2PO4, 300 mM NaCl, 20 mM imidazole, pH 8.0). The His6-tagged protein was eluted 4 times with 0.5 mL elution buffer (5 min incubation at RT with gentle rotation each elution) (50 mM NaH2PO4, 300 mM NaCl, 250 mM imidazole, pH 8.0). Eluted samples were assessed by SDS-PAGE and Coomassie Blue staining (Section 2.9.4).

2.9.8.3 Purification of His6-tagged protein with IMAC resin (Bio-Rad) Bacterial pellets (from 1 L culture) prepared as described in Section 2.9.7.4 were resuspended in 25 mL binding buffer [20 mM NaH2PO4, 500 mM NaCl, 20 mM Imidazole, pH 7.4], passed through a cell disruptor (Constant Cell Disruption System) operated at 30, 000 psi to lyse the bacterial cells, and centrifuged to remove dead cell debris (13, 000 rpm, 30 min, 4 °C, Rotor HFA 22.50, Heraeus Sepatech). The recovered supernatant (~ 25 mL) was collected and supplemented with x2 cOmplete ULTRA tablets (EDTA-free) (Roche). 100 L Profinity IMAC Ni-Charged Resin (Bio-Rad) was equilibrated with binding buffer in a 1.5 mL reaction tube and incubated with the soluble fraction at RT for 1 h with gentle rotation. The beads were then washed 6 times with wash buffer [0.5 % (v/v) glycerol, 0.1 % (v/v) Triton X-100 in binding buffer]. The beads were incubated at RT for 5 min with gentle rotation for each wash. Proteins were eluted in 200 L elution buffer [0.5 % (v/v) glycerol, 500 mM Imidazole in binding buffer] at RT for 15 min with gentle rotation.

2.9.8.4 Purification of His-tagged proteins using the ÄKTAprime plus system (GE Healthcare) Bacterial pellets prepared as described in Section 2.9.7.3 and Section 2.9.7.4 were resuspended in 4 mL (for sonication), or 25 mL (if lysed by Constant system cell disruptor) of filtered binding buffer [20 mM NaH2PO4, 500 mM NaCl, 20 mM Imidazole, pH 7.4], and transferred to a 20 mL centrifuge tube prior to sonication. 100 L of 1 mg/mL of lysozyme was added, mixed and incubated on ice for 30 min. The cells were then lysed by sonication with ten 30-s pulses and centrifuged to remove dead cell debris (13, 000 rpm, 30 min, 4 °C, Rotor HFA 22.50, Heraeus Sepatech). Alternatively, 25 mL of bacterial suspension (without lysozyme) was lysed by a cell disruptor (Constant Cell Disruption System). The supernatant (soluble fraction) was collected and filtered through a 0.45 μm syringe filter. Prior to loading sample, a system wash of the purification column and machine was performed for 2 times with MQ water (to remove any remaining 20 % [v/v] ethanol) followed by binding buffer for 3 times. 1 mL His Trap FF columns (GE

Healthcare) were used. Approximately 5 mL or 25 mL of the filtered sample was injected into the ÄKTAprime plus machine and a preset program (Program name: Any HiTrap) was chosen for the purification process. Tube A and Tube B of the machine were immersed in binding buffer and elution buffer [20 mM NaH2PO4, 500 mM NaCl, 500 mM Imidazole, pH 7.4], respectively during the process. The eluent was collected. For the StrepTagII-

“GFP-N-WASP”-His10 proteins, the eluent was used in the StrepTagII protein purification directly (Section 2.9.8.5). The column was washed with MQ water (3 times) followed by 20 % (v/v) ethanol (2 times) at the end of each purification process.

2.9.8.5 Purification of StrepTagII protein

Samples from the His10-tagged protein purification (Section 2.9.8.4) were used directly in StrepTagII protein purification without dialysis. At least 600 μL of Strep•Tactin® SuperflowTM agarose (CV = 300 μL) (Novagen) was transferred to a 5 mL polypropylene column (Pierce) and equilibrated with 2 CVs Buffer W [100 mM Tris-Cl, 150 mM NaCl, 1 mM EDTA, pH 8.0]. Eluent from His-purification was incubated with the Strep•Tactin® agarose at RT, 1 h, with very gentle rocking. Then, the flow through sample was collected, and the column was washed 20 times with 1 CV Buffer W. The bound protein was eluted (6 times) from the agarose by adding 0.5 mL Buffer E [100 mM Tris-Cl, 150 mM NaCl, 1 mM EDTA, 2.5 mM desthiobiotin, pH 8.0]. The Strep•Tactin® SuperflowTM agarose (Novagen) was regenerated by washing the column with 5 CVs (3 times) Buffer R (100 mM Tris-Cl, 150 mM NaCl, 1 mM EDTA, 1mM HABA [hydroxyl-azophenyl-benzoic acid], pH 8.0) or until the agarose turned a red colour. The agarose was stored in 2 mL Buffer R at 4 °C.

The eluted fractions were pooled together and dialysed (Selbys type 453103 dialysis tube; MWCO 8000-10, 000 Da) against 3 L of dialysis buffer (100 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, pH 8.0) at 4 °C for 16 h, with constant stirring. The dialysis sample was then transferred to another 3 L fresh buffer and dialysed for another 6 h under the same conditions. The dialysed sample was recovered, mixed with an equal volume of glycerol and stored at -20 °C. The concentration of various purified proteins were 65

measured with the Pierce® BCA protein assay kit (Thermo Scientific) according to the manufacturer’s instructions. Graphs were plotted using Prism5.

2.9.9 Bacterial Cell Fractionation

Overnight cultures (16 h) were diluted 1:20 in 100 mL LB broth, grown at 37 C with aeration for 2-2 ½ h. The culture was centrifuged (8000 rpm, 15 min, 4 °C, Rotor HFA 14.290, Heraeus Sepatech) and the supernatant discarded. The pellet was resuspended in 2 mL 20 % (w/v) sucrose in 30 mM Tris-HCl, pH 8.0, and transferred to a centrifuge tube. To isolate the periplasmic proteins, 100 μL of 1 mg/mL lysozyme in 0.1 M EDTA, pH 7.3, was added into the suspension and chilled on ice for 30 min, followed by centrifugation (10, 000 rpm, 10 min, 4 °C, Rotor HFA 22.50, Heraeus Sepatech). The periplasmic fraction supernatant was collected. The bacterial pellet was exposed to freeze/ thaw cycle for 4 times to weaken the membranes of bacterial cells. The pellet was incubated on dry ice with 100 % (v/v) ethanol for 2 min, then thawed in 37 °C water bath for approximately 4 min. The pellet was then resuspended in 6 mL of 3 mM EDTA and lysed by sonication with ten 30-s pulses. Unbroken cells were removed by low speed centrifugation (5000 rpm, 10 min, 4 °C, Rotor HFA 22.50, Heraeus Sepatech). The supernatant was collected and centrifuged at high speed (35, 000 rpm, 1 h, 4 °C, Rotor Ti 80, Beckman Coulter OptimaTM L-100 XP Ultracentrifuge). The cytoplasmic supernatant was then collected and the whole cell membrane pellet was resuspended in 2 mL of 2 % (v/v) Triton X-100 in 0.25 M Tris-

HCl; 1 mM MgCl2, pH 7.5, followed by incubation at 37 °C for 30 min with aeration. The sample was centrifuged (35, 000 rpm, 1 h, 4 °C, Rotor Ti 80, Beckman Coulter OptimaTM L-100 XP Ultracentrifuge). The supernatant was collected and the pellet contained outer membrane fraction.

2.9.10 Indirect immunofluorescence of whole bacteria Overnight cultures (16 h) were diluted 1:20 in 10 mL LB broth, and grown for 2 h at 37 C. 1 mL of bacteria culture was aliquot into a 1.5 mL reaction tube and centrifuged (13, 000 rpm, 1 min, RT, Eppendorf Centrifuge 5415R). The pellet was resuspended in 100 μL 66

of 3.7 % (v/v) formalin in 0.85 % (w/v) saline and incubated at RT for 20 min. The formalin-fixed bacteria were then washed once in 1 x PBS and resuspended in 100 μL PBS.

A glass coverslip was placed into each well of a 24-well tray and coated with 10 % (v/v) poly-L-lysine (Sigma) in PBS at RT for 15 min. The poly-L-lysine was then aspirated and 3 μL of formalin-fixed bacteria in PBS was added onto each poly-L-lysine coated glass coverslip. The tray was tabbed a few times in order to spread out the bacterial suspension on coverslips. The tray was centrifuged at low speed to aid adherence of bacteria to the coverslips (2000 rpm, 7 min, RT, Heraeus Labofuge 400R Centrifuge). Each well was washed three times with PBS to remove any unbound bacteria. The bacteria were then stained with 50 μL of the desired primary antibody (Table 2.1) diluted 1:100 in 10 % (v/v) FCS in PBS (1 h, RT), followed by three washes in PBS. 50 L of the secondary antibody (Table 2.1) diluted 1:100 in 10 % (v/v) FCS in PBS was added into each well and incubated at 37 °C for 30 min. The secondary antibody was removed and washed three times with PBS. The coverslips were mounted onto glass microscopy slides, and examined by IF microscopy, as described in Section 2.15.

2.9.11 β-galactosidase assay The β-galactosidase assay was performed using the Miller protocol (Miller, 1972) with some modifications. 18 h bacterial cultures were diluted 1:20 into 10 mL LB and grown to mid-exponential phase with aeration at 37°C. The OD600 of bacterial culture was measured, 1 mL sample was taken, centrifuged (13, 000 rpm, 1 min, RT, Eppendorf 5417R), the supernatant discarded and the pellet was resuspended in Z buffer [60 mM Na2HPO4, 40 mM NaH2PO4, 10 mM KCl, 1 mM MgSO4, 50 mM -ME; pH 7.0]. Cells were permeabilised by adding 20 μL 0.1 % (w/v) SDS and 40 μL chloroform and mixed vigorously for 10 sec. 120 μL samples were dispensed into a 96 well microtitre tray in triplicates and 24 μL 7 mg/mL ortho-Nitrophenyl-β-galactoside (ONPG; Calbiochem) was added into each well. Samples were incubated at 37°C for 3 h and readings (OD420 and

OD550) were taken at 2 min intervals. Units of activity were calculated as previously described (Miller, 1972) by the following equation:

1000 x (OD420-1.75 x OD550)

time (min) x OD600 x volume (mL) where time is the number of minutes at which the reading was taken and volume refers to the volume of the culture resuspended in 1 ml of Z buffer for the assay. The optimum

OD420 reading is an absorbance from 0.6-0.9.

2.9.12 Pull down assay with purified protein

2.9.12.1 Pull down assay with whole cell bacteria Overnight cultures (16 h) were diluted 1:20 in LB and grown to mid-exponential phase. The equivalent of 5x108 bacteria was centrifuged (13, 000 rpm, 1 min, RT, Eppendorf 5417R), supernatant removed, the cells were washed once in 1 x TBS [50 mM Tris, 150 mM NaCl, pH 7.6] and mixed with 5 μg of purified protein, in a final volume of 100 μL 1 x TBS. The reaction was performed in the presence or absence of 20 μg/mL BSA, and incubated at either 37 °C, 25 °C or 4 °C for 2 h. Bacterial cells were centrifuged, the supernatant collected, the cells were washed twice with cold 1 x TBS and resuspended in 50 μL 1 x sample buffer.

2.9.12.2 Pull down assay with IcsAα::BIO bound Dynabeads Pull down assay with purified “GFP-N-WASP” proteins (Section 2.9.8.5) was performed using IcsA ::BIO bound Dynabeads from Section 2.9.8.1. The IcsA ::BIO bound Dynabeads were washed 5 times with 500 L Buffer P [20 mM Tris-HCl, pH 7.5, 100 mM

KCl, 1 mM MgCl2, 0.1 % (w/v) BSA] and resuspended in 100 L Buffer P. A concentration of 80 pmoles of purified protein (StrepTagII-GFP-CRIB-His10 or

StrepTagII-EGFP-His10) was mixed with Dynabeads and incubated at 4 °C for 1 h. The 68

supernatant was collected using a magnetic stand as described in Section 2.9.8.1 and the beads were washed 5 times with Buffer P. A negative control that incubated Dynabeads only with purified proteins only was also included.

2.10 Antisera techniques

2.10.1 Production of polyclonal anti-IcsB-IpgA antisera This procedure was performed by LAS staff and was approved by the University of Adelaide Animal Ethics Committee and NHMRC guidelines. Polyclonal anti-IcsB-IpgA antiserum was produced by injecting a rabbit subcutaneously 5 times over a period of 2 months with purified His6-IcsB-IpgA protein (protein band cut out of SDS-PAGE gel) (Section 2.9.8.2). In the first immunisation, purified protein from SDS-PAGE gel was mixed with complete Freund’s adjuvant (CFA) and injected into the rabbit subcutaneously up to 4 sites. Booster immunisations were given to the rabbit at Week 3, 6, 8, 10 and 12 after the first immunisation by mixing purified protein (from SDS-PAGE gel) with incomplete Freund’s adjuvant (IFA). At Week 5 and 10, a test blood was obtained and tested by Western immunoblotting to confirm the presence of anti-IcsB antibodies in antiserum (Section 2.9.6). After 14 weeks, the rabbit was bled. The collected blood was clotted by incubation at 37 °C and the supernatant was centrifuged twice in a 50 mL Falcon tube (2000 rpm, 15 min, #8179 swing-out rotor, Heraeus Labofuge 400 R centrifuge) and stored at -20 °C.

2.10.2 Purification of antisera by absorption with live bacteria A loop-full of bacterial strains (MYRM156 [S. flexneri ∆icsB::aphA-3]; RMA2159 [smooth S. flexneri VP negative] and/or RMA2161 [rough S. flexneri VP negative]) grown to confluent on agar plates were mixed with the rabbit anti-IcsB-IpgA antiserum and incubated at RT for 3-4 h. The bacteria were then removed by centrifugation (13, 000 rpm, 1 min, RT, Eppendorf Centrifuge 5415R). The absorption process was repeated as above at 4 °C. After ~ 1 week of repeated absorption, bacteria were removed by centrifugation (as

above) and the absorbed serum was filter sterilised by filtering through a 0.2 μm syringe filter (Minisart).

2.10.3 Affinity purification of antisera Affinity purification of antiserum was performed as described previously (Rybicki & von

Wechmar, 1982). Purified His6-tagged IcsB-IpgA protein was electrophoresed on an SDS- 15%-PAGE gel and transferred to a nitrocellulose membrane (Section 2.9.6). Protein transferred to the membrane was visualised by staining the membrane with 0.1 % (w/v) Ponceau S stain in 5 % (v/v) acetic acid and the protein band was cut using a scalpel blade. The membrane strip was then destained with RO water for 5 min and blocked with 10 mL PBS containing 5 % (w/v) skim milk and 0.1 % (v/v) Tween-20 for 1 h at RT. The membrane was then incubated with 5 mL of live bacteria-absorbed antiserum (Section 2.10.2) for 4 h at RT with shaking, washed 3 times in PBS-T (containing 0.1 % [v/v] Tween-20, 15 min each) and 1 time in PBS. The bound antibodies were eluted by mixing the membrane with 0.7 mL of 0.2 M glycine (pH 2.2) for 30 min at RT. The pH of the eluate was adjusted to pH 7.0 by the addition of 1 M K2HPO4 and the antiserum was dialysed against 3 L PBS for 16 h at 4 °C with constant stirring. The antiserum was then recovered and stored at -20 °C in 50 % (v/v) glycerol.

2.11 Lipopolysaccharide (LPS) techniques

2.11.1 Preparation of LPS samples LPS samples were prepared as previously described (Hitchcock & Brown, 1983). An overnight culture (16 h) was diluted 1:20 and grown at 37 °C with aeration for 3-4 h. The equivalent of 109 bacteria were centrifuged (13, 000 rpm, 1 min, 4 °C, Eppendorf Centrifuge 5415R) and resuspended in 50 μL of lysing buffer [2 % (w/v) SDS, 4 % (v/v) -mercaptoethanol (Sigma), 10 % (v/v) glycerol, 0.1 % (w/v) bromophenol blue (Sigma), 0.66 M Tris-HCl, pH 7.6]. The samples were heated at 100 °C for 10 min, allowed to cool

prior to the addition of 10 μL of 2.5 mg/mL Proteinase K (Invitrogen) in lysing buffer. Samples were incubated at 56 °C for 16 h.

2.11.2 Analysis of LPS by silver-stained SDS-PAGE LPS samples were incubated at 100 °C for 5 min prior to loading 8 μL on an SDS-15%- PAGE gel as previously described (Macpherson et al., 1991). Samples were electrophoresed at 12 mA for 16 h. Silver-staining was performed as previously described (Tsai & Frasch, 1982). Briefly, gels were fixed in fixing solution [5 % (v/v) glacial acetic acid, 40 % (v/v) ethanol] for 2.5 h with gentle agitation, then, oxidised with oxidising solution [5 % (v/v) glacial acetic acid, 40 % (v/v) ethanol, 0.7 % (w/v) periodic acid] for 5 min. Gels were washed 4 times in MQ water for 15 min each time, followed by staining in staining solution [2 mL NH3OH, 0.12g NaOH, 5 mL 20 % (w/v) AgNO3, made up to 150 mL with MQ] for 10 min. Gels were again washed 5 times in MQ water for 10 min each. The gels were then developed with developing solution [50 mg citric acid in 1 L MQ] pre- warmed to 42 °C, with 500 μL 37 % (v/v) formaldehyde solution added just prior to developing, and stopped by the addition of stopping solution [4 % (v/v) glacial acetic acid].

2.11.3 LPS depletion-regeneration assay Overnight cultures (16 h) were diluted 1:20 in 10 mL LB and grown to mid-exponential phase with aeration at 37 °C. The bacterial strains were further diluted 1:20 in 5 mL LB, supplemented with 3 μg/ml polymyxin B nonapeptide (PMBN; Sigma) and 10 μg/ml Tunicamycin (Sigma) in DMSO. Unless otherwise stated, bacterial cultures were treated for 3 h with aeration at 37 °C. After 3 h, the bacterial cultures were washed twice with fresh LB to remove any PMBN and Tunicamycin residues. Then, the bacterial cultures were diluted 1:20 for the third time in 5 mL LB with aeration at 37 °C for a further 3 h in the LPS regeneration step. Samples taken at each time point were then solubilised and analysed by Western immunoblotting and LPS silver staining.

2.12 DSP cross-linking and outer membrane protein oligomers extraction

Overnight cultures (16 h) were diluted 1:20 in LB (50 mL) and grown for 2 h at 37 °C with aeration. Bacterial cultures were centrifuged (4500 rpm, 10 min, 4 °C, 3K15 Sigma), the pellet was washed once in 25 mL of buffer (120 mM NaCl, 20 mM Na2PO4/NaH2PO4 buffer pH 7.2) and resuspended in 5 mL of the same buffer. Dithio- bis(succinimidylpropionate) (DSP; Pierce) from a 50 mM stock DMSO (Sigma) was added to each sample at a final concentration of 0.2 mM and samples were incubated for 30 min at 37 °C. Excess DSP was quenched with 20 mM Tris-HCl pH7.5 and samples were washed once with TN buffer (20 mM Tris-HCl pH 8.0, 10 mM NaCl) and resuspended in 25 mL of TN buffer, supplemented with 0.1 mg/mL DNase (Roche), 0.1 mg/mL RNAase (Roche), and 0.1 mM PMSF (added after cell disruption). Bacteria were lysed by passing through the cell disruptor (Constant Cell Disruption System) operated at 30, 000 psi. Unbroken cells were removed by low speed centrifugation (4500 rpm, 10 min, 4 °C, 3K15 Sigma). Lysates were then ultracentrifuged (35, 000 rpm, 1 h, 4 °C, Rotor Ti 80, Beckman Coulter OptimaTM L-100 XP Ultracentrifuge). The supernatant was discarded and the whole membrane pellet was resuspended in 200 μL TN buffer with 1 % (w/v) SDS. Whole membrane proteins were solubilised by incubating the pellet at RT for 30 min. Each sample was then centrifuged (13, 000 rpm, 1 min, RT, Eppendorf Centrifuge 5415R). The supernatant that contained the solubilised whole membrane proteins was collected and resuspended in an equal volume of 2 x sample buffer without β-mercaptoethanol. Duplicates of each sample were prepared in an equal volume of 2 x sample buffer with β- mercaptoethanol as a control. Samples were heated to 60 °C for 5 min prior to SDS-PAGE and Western immunoblotting.

2.13 Tissue Culture

2.13.1 Maintenance of cell lines Human cervical cancer HeLa cells (ATCC #CCL-2) and monkey kidney CV-1 cells (ATCC #CCL-70) were grown and maintained in Modified Eagle’s Media (MEM, Gibco) 72

containing 0.225 % (w/v) NaHCO3, 10 % (v/v) foetal calf serum (FCS), 100 U/mL penicillin/streptomycin in 0.85 % (w/v) saline, and supplemented with 2 mM L-glutamine. MDCK cells (epithelial cells from dog kidney ATCC #CCL-34) were grown and maintained in Dulbecco’s Modified Eagle’s Media (DMEM, Gibco) containing 0.37 %

(w/v) NaCO3, 5 % (v/v) FCS, 25 mM HEPES (pH 7.0) and supplemented with 2 mM L- glutamine. Wildtype mouse embryonic fibroblasts (May et al., 2010) were grown and maintained in DMEM containing 0.37 % (w/v) NaCO3, 10 % (v/v) FCS and supplemented with 2 mM L-glutamine. N-WASP-/- MEFs (Snapper et al., 2001) were grown and maintained in DMEM containing 12.5 % (v/v) FCS, 100 U/mL penicillin/streptomycin in 0.85 % (v/v) saline, 0.25 mM -mercaptoethanol, and supplemented with 2 mM L- glutamine. Cells were always grown and maintained at 37 °C in a humidified atmosphere with 5 % CO2.

2.13.2 Splitting cells and seeding trays For plaque assays using HeLa cells, cells grown to confluence in a 75 cm3 tissue culture medium flask (BD Falcon) were split at Day 0 (the day before conducting plaque assay) and seeded ~1x106 cells into 35 mm diameter 6-well Falcon trays (Becton Dickinson) to obtain a confluent monolayer cells the next day. Upon splitting cells, cells were washed with PBS for 4 min and incubated in 2 mL 0.1 % (w/v) trypsin containing 0.02 % (w/v) EDTA in PBS to dislodge cells from the flask surface. Then, the cells were resuspended in ~10 mL of tissue culture media and seeded 1.5 mL of cells into each well. Cells were topped with ~2 mL media for extra nutrients.

For plaque assay using MDCK cells, cells grown to confluence in a 75 cm3 tissue culture medium flask (BD Falcon) were split as above. Cells were resuspended in ~20 mL tissue culture media, diluted 1:8 and 1 mL of cells seeded into each well. 2 mL of tissue culture media was added for extra nutrients. Cells were grown for 4 days in the 6-well tray until a confluent monolayer of cells was obtained at Day 4.

For invasion assay, cells were split as described above. Cells were resuspended in 20 mL tissue culture media, diluted 1:2 and 0.5 mL of cells seeded into each well containing sterile round coverslip (15 mm diameter 24-well Falcon tray, Becton Dickinson) to obtain semi-confluent cells the next day. Cells were topped with 1 mL media for extra nutrients.

For transfection assay, again, cells were split as mentioned above. Cells were resuspended in 20 mL tissue culture media, diluted 2:3 and 1.5 mL of cells seeded into each well of a 6- well tissue culture tray. Cells were topped with 2 mL of tissue culture media for extra nutrients. Cells were approximately at 80 % confluent the next day for transfection.

2.13.3 Preparation of bacteria for infection of cells

Overnight cultures (16 h) were diluted 1:20 in 10 mL LB broth, and grown for 2 h at 37 C with aeration. For plaque assay (Section 2.13.4), the equivalent of 1x108 bacteria/mL were centrifuged (13, 000 rpm, 1 min, RT, Eppendorf Centrifuge 5415R), resuspended in 1 mL of serum/antibiotic-free DMEM, and diluted 1:1000 in DMEM prior to infection. For invasion assay (Section 2.13.5), the equivalent of 3x108 bacteria/mL were centrifuged as above and resuspended in 1 mL of D-PBS (Dulbecco’s PBS; PBS containing 0.1 % [w/v]

CaCl2 and 0.1 % [w/v] MgCl2).

2.13.4 Plaque assay

2.13.4.1 Plaque assay using HeLa cells or CV-1 cells Plaque assays were performed based on a modified method described by Oaks et al. (1985). A confluent monolayer of cells in 6-well tray (Section 2.13.2) was washed twice with D-PBS and once with serum/antibiotic-free DMEM, then infected with 0.25 mL of 1:1000 bacterial suspension prepared in Section 2.13.3. Trays were incubated at 37 °C, 5

% CO2 for 120 min with gentle rocking every 15 min to ensure even distribution of bacteria across the monolayer. The bacterial inoculum was then aspirated and 3 mL of the first overlay (DMEM, 5 % [v/v] FCS, 20 μg/mL gentamycin, 0.5 % [w/v] agarose [Seakem

ME; Cambrex]) was added to each well. The second overlay (DMEM, 5 % [v/v] FCS, 20 μg/mL gentamicin, 0.5 % [w/v] agarose, 0.01 % [w/v] Neutral Red [Sigma] in 1 % [v/v] glacial acetic acid) was added into each well at 24-48 h post-infection and digital photo images were taken 6-8 h later.

2.13.4.2 Plaque assay using MDCK cells Plaque assay (with MDCK cells) for S. flexneri ΔicsB mutant was performed based on a modified method described by Oaks et al. (1985) and Ogawa et al. (2003). MDCK polarised cells were seeded on a 6-well tray and cultured 4 days until confluent. Prior to infection, MDCK monolayers were treated with Hank’s balanced salt solution (HBSS, Gibco) supplemented with 100 μM ethylene glycol-bis (β-aminoethyl enther)-N,N,N’,N’- tetraacetic acid (EGTA) for 1 h at 37 °C, 5 % CO2. Then, bacteria were added to infect the monolayer cells and the following steps were performed as described above (Section 2.13.4.1).

2.13.5 Invasion assay Invasion assay with Shigella strains was performed as described by Morona et al. (2003). Briefly, cells were grown to semi-confluent on 13 mm glass coverslips as described in Section 2.13.2, washed twice with D-PBS, and once with antibiotic-free MEM containing 10 % (v/v) FCS prior to bacterial infection. 80 L of bacterial suspension (Section 2.13.3) was added into each well. Infected monolayers were then centrifuged (2000 rpm, 7 min, RT, Heraeus Labofuge 400R Centrifuge), to allow bacteria to attach to the monolayers, followed by incubation at 37 °C in a humidified 5 % CO2 incubator for 1 h. The infected cells were then washed 3 times with D-PBS and incubated with 0.5 mL MEM containing 10 % (v/v) FCS and 40 μg/mL gentamycin for 90 min (4 h when infected with S. flexneri ΔicsB). The monolayers were washed 3 times with D-PBS and fixed for 15 min in 3.7 %

(v/v) formalin, incubated with 50 mM NH4Cl in D-PBS for 10 min, followed by incubation with 0.1 % (v/v) Triton X-100 (Sigma) in PBS for 5 min. After blocking with 10 % (v/v) FCS in PBS for 15 min, the desired primary antibody (Table 2.1) was added and incubated

at 37 °C for 30 min. The appropriate secondary antibody (Table 2.1) and Alexa Fluor 488- conjugated phalloidin (for F-actin staining) were added and incubated at 37 °C for 1 h after washing 3 times with PBS. After the incubation, the monolayers were washed 3 times with PBS, then incubated with 10 μg/mL DAPI in MQ (for bacteria and HeLa cell nuclei staining) for 1 min at RT, followed by another 3 washes with PBS. The coverslips were mounted onto microscopy slides and examined by IF microscopy as described in Section 2.15.

2.13.6 Transfection

2.13.6.1 Small scale transfection N-WASP-/- MEF, HeLa and CV-1 cells were transfected in this thesis. A day prior to transfection, cells were seeded to a 6-well tray as described in Section 2.13.2 and grown to 80% confluence. Cells were washed in D-PBS and then 0.2 mL serum/antibiotic-free MEM (or DMEM for N-WASP-/- MEF cells) was added to each well prior to transfection. For each well, the DNA for transfection was prepared by diluting 4 g DNA (prepared in Section 2.3.3) in 40 L serum/antibiotic-free MEM (or DMEM), while the transfection reagent was prepared by diluting 10 L lipofectamine 2000 (Invitrogen) in 40 L serum/antibiotic-free MEM (or DMEM) and incubated for 5 min at RT. The DNA mixture was then added into the lipofectamine mixture and incubated at RT for an additional 20 min. The DNA/lipofectamine mixture was added to each well (100 L/well) and incubated for 1 h at 37 °C, 5 % CO2. 2 mL of MEM (or DMEM) supplemented with 10 % (v/v) FCS was added to each well, and the cells were incubated for 24-48 h at 37 °C, 5 % CO2. Tranfected cells were washed with PBS for 5 min, incubated with 300 L of trypsin to detach cells from the tray and seeded to 24-well trays in MEM or DMEM maintenance medium (Section 2.13.1) supplemented with serum and antibiotics. Infection of transfected cells was performed as described in Section 2.13.5.

2.13.6.2 Large scale transfection with lipofectamine 2000 HeLa, CV-1 and N-WASP-/- MEF cells were transfected in larger scale to prepare cell lysate extracts. 24 h prior to transfection, the cells were split as described in Section 2.13.2, resuspended in 20 mL MEM or (DMEM for N-WASP-/- MEF cells) supplemented with 10 % (v/v) FCS and antibiotics, diluted 2:3 in the same media. In each 10 cm tissue culture petri dish, 6 mL of cells was added and grown to 80 % confluence at 37 °C, 5 % CO2. Cells were washed in D-PBS and then 4 mL serum/antibiotic-free MEM (or DMEM for N- WASP-/- MEF cells) was added to each dish prior to transfection. For each dish, the DNA for transfection was prepared by diluting 12 g DNA (prepared in Section 2.3.3) in 120 L serum/antibiotic-free MEM (or DMEM), while the transfection reagent was prepared by diluting 30 L lipofectamine 2000 (Invitrogen) in 120 L serum/antibiotic-free MEM (or DMEM) and incubated for 5 min at RT. The DNA mixture was then added into the lipofectamine mixture and incubated at RT for an additional 20 min. The DNA/lipofectamine mixture was added to each petri dish (300 L/dish) and incubated for

1 h at 37 °C, 5 % CO2. 3 mL of MEM (or DMEM) supplemented with 10 % (v/v) FCS was added to each petri dish and the cells were incubated for 24-48 h at 37 °C, 5 % CO2.

2.13.6.3 Large scale transfection with PEI HeLa, CV-1 and N-WASP-/- MEF cells were transfected in larger scale to prepare cell lysate extracts. 24 h prior to transfection, the cells were split as described in Section 2.13.2, resuspended in 20 mL MEM or (DMEM for N-WASP-/- MEF cells) supplemented with 10 % (v/v) FCS and antibiotics, diluted 2:1 (cells:media) in the same media. In each 10 cm tissue culture petri dish, 3 mL of cells was added and grown to 80 % confluence at 37 °C, 5

% CO2. Cells were washed in D-PBS and then 4 mL serum/antibiotic-free MEM (or DMEM for N-WASP-/- MEF cells) was added to each dish prior to transfection. For each 10 cm dish, 48 L 1 mg/mL polyethylenimine (branched PEI from Sigma), 16 g DNA (prepared in Section 2.3.3) were mixed with 312 L serum/antibiotic-free media and incubated for 15 min at RT. The 400 L DNA/PEI mixture was then added into each dish and cells were incubated for 4 h at 37 °C, 5 % CO2. 4 mL media supplemented with 10 % 77

(v/v) FCS was then added to each petri dish and the cells were incubated for 24-48 h at 37

°C, 5 % CO2.

2.14 Pull Down Assays with cell extracts

2.14.1 Preparation of cell lysate extracts Cell lysates of transfected HeLa, CV-1 or N-WASP-/- MEF cells (Section 2.13.6.2) were extracted as previously described (Qualmann & Kelly, 2000) with some modifications. The monolayers were washed with PBS for 5 min, dislodged with 1 mL of trypsin, and resuspended in 4 mL of PBS. Cells from two 10 cm tissue culture petri dishes were pooled together, centrifuged (3500 rpm, 5 min, RT, Eppendorf 5415R) and the supernatant discarded. The pellet was resuspended in 500 L 0.1 % (v/v) Triton X-100 in lysis Buffer

A (10 mM Hepes pH 7.4, 150 mM NaCl, 1 mM EGTA, 0.1 mM MgCl2) supplemented with protease inhibitors (5 g/mL pepstatin, 10 g/mL aprotinin, 10 g/mL chymostatin, 1 mM PMSF). The cells were incubated for 30 min at 4 °C to allow cell lysis. The lysed cells were then ultracentrifuged (25, 000 rpm, 30 min, 4 °C, Beckman OptimaTM MAX-UP Ultracentrifuge). The supernatant was collected and supplemented with 1 mM ATP, 1 mM DTT and 150 mM sucrose prior to storage at -80 °C.

2.14.2 Preparation of bacteria for pull down assays Overnight (16 h) cultures were diluted 1:20 in LB and incubated with aeration for 2 h at 37 °C. The equivalent of 7.5x108 bacteria were centrifuged (13, 000 rpm, 1 min, RT, Eppendorf 5415R) and the supernatant was discarded. The pellet was washed once with ice-cold XB buffer (100 mM KCl, 1 mM MgCl2, 0.1 mM CaCl2, 10 mM Hepes pH 7.4, 50 mM sucrose), centrifuged as before, and resuspended in 80 L ice-cold XB buffer.

2.14.3 Pull down assays

Approximately 200 L cell extract (Section 2.14.1) was incubated with 80 L of bacteria in XB buffer (Section 2.14.2) for 30 min at 37 °C. The bacteria were centrifuged (13, 000 rpm, 1 min, RT, Eppendorf 5415R) and the supernatant collected. The pellet was washed twice in ice-cold low salt buffer (10 mM Hepes pH 7.4, 40 mM KCl, 5 mM ATP) and then resuspended in 50 L 1 x sample buffer and stored at -20 °C.

2.15 Microscopy

2.15.1 Mounting medium Mowiol 4-88 for mounting medium was prepared by mixing 0.4 g of Mowiol 4-88 (Calbiochem), 1 g of glycine and 1 mL MQ. This was incubated for 2 h at 56 °C, prior to addition of 2 mL of 0.2 M Tris-HCl pH 8.5 and heating at 50 °C for at least 10 min, or until dissolved. To remove any remaining solids, the mixture was centrifuged at 5000 xg for 15 min, and the supernatant collected and stored at 4 °C. A fresh stock of p- phenylenediamine (PPD; Sigma) was prepared each time at 25 mg/mL in ethanol. The stock was vortexed and centrifuged (13, 000 rpm, 1 min, RT, Eppendorf 5417R) to remove undissolved PPD. The PPD solution was added to Mowiol 4-88 at a ratio of 1:5 (PPD:Mowiol). This mounting medium was vortexed and centrifuged (13, 000 rpm, 1 min, RT, Eppendorf 5417R) to remove any bubbles. Coverslips were mounted (cell-side down) onto glass slides using 3-4 μL of mounting medium and sealing the edge of the coverslip with nail polish.

2.15.2 Microscopy Microscopy was performed using an Olympus IX-70 microscope with phase-contrast optics using a 100x oil immersion objective. Fluorescence and phase-contrast images were false colour merged using the Metamorph software program (Version 7.7.3.0, Molecular Devices).

Table 2.1 Antibodies

Dilution Primary Antibody Concentration Source/Reference Western Blot IF Rabbit polyclonal Anti-IcsA - 1:1000 1:100 (Van Den Bosch et al., 1997) Anti-IcsP - 1:1000 - (Tran, 2007) Anti-N-WASP - - 1:100 Morona Lab Anti-Skp - 1:6000 - Prof. Thomas Silhavy Anti-SurA - 1:10, 000 - Prof. Carol Gross Anti-MBP-DegP - 1:20, 000 - Prof. Michael Ehrmann

Mouse monoclonal Anti-His 1 mg/mL 1:5000 - Covance (LN #14894001) Anti-GFP 0.4 mg/mL 1:1000 - Roche (#11814460001) Anti-Atg5 0.5 mg/mL 1:500 1:100 Sigma (#WH0009474M1-100UG) Anti-StrepTagII 0.2 mg/mL 1:1000 - Novagen (#71590-3) Anti-Arp3 250 g/mL - 1:100 Transduction Laboratories (#612134)

Dilution Secondary Antibody Concentration Source/Reference Western Blot IF HRP conjugated goat anti-mouse 1 mg/mL 1/30, 000 - KPL HRP conjugated goat anti-rabbit 1 mg/mL 1/30, 000 - KPL Alexa Fluor 488 donkey anti-rabbit IgG 2 mg/mL - 1:100 Invitrogen Alexa Fluor 594 donkey anti-rabbit IgG 2 mg/mL - 1:100 Invitrogen Alexa Fluor 594 donkey anti-mouse IgG 2 mg/mL - 1:100 Invitrogen 80

Table 2.2 Oligonucleotides

Oligonucleotide Sequence (5’ 3’) Annealing site Nucleotide positions icsB/ ipgA specific primers (Genbank: AF386526) MY_23 ggggtcagtgctgataaag Forward primer for sequencing C 115295 - 115313 MY_24 ggccaaaaaggttatggctg Reverse primer for sequencing C 115229 - 115248 MY_25 cgccagatcttggaaccaa Forward primer for sequencing C 114631 - 114649 MY_26 gcttattgatctgtaataagtc Reverse primer for sequencing C 114596 - 114617 MY_27 gcgggaatgttacaaaagat Forward primer for sequencing C 115527 - 115546 MY_28 cgagctccatttttgaggaaattatcc SacI RE site. Forward primer used in icsB deletion C 117462 - 117482 MY_29 tcccccgggcgtcaatgaaattgcta SmaI RE site. Reverse primer used in icsB deletion C 116018 - 116034 MY_30 tcccccgggatcttggaaccaaactttac SmaI RE site. Forward primer used in icsB deletion C 114618 - 114644 MY_31 ctagtctagacctgtctttaactgctgcgtc XbaI RE site. Reverse primer used in icsB deletion C 112403 - 112423 MY_34 ggcaggagttaattgaaaac Forward primer for sequencing (upstream) C 116858 - 116877 MY_35 ccggtcgacaagaatattag Reverse primer for sequencing (upstream) C 116818 - 116837 MY_36 ggccatacacaatggagtt Forward primer for sequencing (downstream) C 113841 - 113859 MY_37 gcgagtcccataatgtagt Reverse primer for sequencing (downstream) C 113234 - 113252 MY_38 gccagcttcggttgaaag Forward primer for sequencing (downstream) C 113109 - 113126 MY_39 cgctagctaatgtattgagg Reverse primer for sequencing C 115808 - 115827 MY_41 cgcggtaccagatgatcctcaaaattagcaattt KpnI RE site. Forward primer used to amplify icsB C 116026 - 116048 MY_42 gcggagctctatattagaatgagagttattcaa SacI RE site. Reverse primer to amplify icsB C 114567 - 114590 MY_48 cgcggtaccctatatattagaatgagagttat KpnI RE site. Reverse primer to amplify 961bp upstream icsB C 114564 - 114586 MY_50 cgcgagctccccctcatcatccaccac SacI RE site. Forward primer to amplify 961 bp upstream icsB C 116992 - 117009 MY_55 cgcggtaccttagttcacttctgaagtgat KpnI RE site. Reverse primer to amplify ipgA C 114162 - 114182 (Table continued over page)

Table 2.2 Oligonucleotides (continued)

Oligonucleotide Sequence (5’ 3’) Annealing site Nucleotide positions aphA-3 specific sequencing primers (Genbank: AF330699) MY_32 ccctttataccggctgtc Reverse primer 139 – 156 MY_33 gcggacaagtggtatgac Forward primer 643 – 660 MY_43 atggctaaaatgagaatatcac Forward primer 1 – 22 MY_44 aaacaattcatccagtaaaatata Reverse primer 769 – 792 egfp specific primers (pEGFP-N1) (Genbank: U55762) MY_52 gcggagctccttgtacagctcgtccatg SacI RE site. Reverse primer to amplify egfp 1377 – 1395 MY_54 cgcggtacctgagcaagggcgaggag KpnI RE site. Forward primer to amplify egfp 683 – 699 EGFPN1 ccttgtacagctcgtcca Reverse primer to sequence egfp of pRMA2693 / 2694 /2695 1379 – 1395 EGFPN2 gggtcttgtagttgccgt Reverse primer to sequence egfp of pRMA2693 / 2694 /2695 989 – 1006

Primers for pCB6-GFP-N-WASP constructs MY_45F_GFP tcacatggtcctgctggagtt Forward primer that targets the gfp sequence of pCB6-GFP-N-WASP MY_46R_CB6 tggtgggcactggagtggcaa Reverse primer that targets pCB6. 1031 – 1051 MY_62 gcgggtacccagcatctcgtcttttttcaga KpnI RE site. Reverse primer to amplify egfp-WH1 of pRMA2693 KpnI RE site. Reverse primer to amplify egfp-CRIB and egfp-WH1- MY_63 gcgggtaccctgcttgccttcggagttca CRIB of pRMA2694 and pRMA2695, respectively MY_64 gcgggtacccgtcttcccactcatcatcat KpnI RE site. Reverse primer to amplify egfp-N-WASP of pRMA2846 (Table continued over page)

Table 2.2 Oligonucleotides (continued)

Oligonucleotide Sequence (5’ 3’) Annealing site Nucleotide positions icsA specific sequencing primers (Genbank: AF386526) MY_68 cctatgttgcagtgacaaat Forward primer 151664 - 151683 MY_69 ccttcacccaaattaagtga Reverse primer 151942 - 151961 icsA mutagenesis primers (Genbank: AF386526) aacacaaaatgtagcaggtaatgctatccacatcnnsnnsggaaacaattcattaatactccatgaagg Degenerate primer to mutate aa 150597 - 150670 330NNS ttctg 330-331 caactattgaaggtgatttatgtgctggtgattgtacannsnnstcactatcaggtaacaaattcactgttt Degenerate primer to mutate aa 150746 - 150821 381NNS cagg 381-382 331TGG_F agcaggtaatgctatccacatcacttggggaaacaattcattaatactc Forward primer to mutate G331W 150609 - 150657 331TGG_R gagtattaatgaattgtttccccaagtgatgtggatagcattacctgc Reverse primer to mutate G331W 150610 - 150657 382CGT_F ttatgtgctggtgattgtacaactcgttcactatcaggtaacaaattcac Forward primer to mutate V382R 150763 - 150813 382CGT_R gtgaatttgttacctgatagtgaacgagttgtacaatcaccagcacataa Reverse primer to mutate V382R 150763 - 150813 Degenerate primer to mutate aa 151762 - 151821 716NNS cagaaaggccgtattgttgctggtagtnnsnnstatcgcctgaaacagggcactgtatct 716-717 716TTT_F cgtattgttgctggtagttttgactatcgcctgaaac Forward primer to mutate Y716F 151771 - 151807 716TTT_R gtttcaggcgatagtcaaaactaccagcaacaatacg Reverse primer to mutate Y716F 151771 - 151807 716GGT_F agaaaggccgtattgttgctggtagtggtgactatcgcctga Forward primer to mutate Y716G 151763 - 151804 716GGT_R tcaggcgatagtcaccactaccagcaacaatacggcctttct Reverse primer to mutate Y716G 151763 - 151804 717GGC_F attgttgctggtagttatggctatcgcctgaaacagg Forward primer to mutate D717G 151774 - 151810 717GGC_R cctgtttcaggcgatagccataactaccagcaacaat Reverse primer to mutate D717G 151774 - 151810 (Table continued over page)

Table 2.2 Oligonucleotides (continued)

Oligonucleotide Sequence (5’ 3’) Annealing site Nucleotide positions degP (Genbank: AF386526 ) 279941 cgccccgggtcatcatttgcacgaagc Forward primer 180112 279942 acatgcatgccaccaccatttcggttag Reverse primer 183094 pCAGGS (pStinger) (BCCM/LMBP Plasmid collection (Ghent University, Belgium) (Collection number: LMBP 2453) pCAGGS_F gggttcggcttctggcg Forward primer 4673-4689 pCAGGS_R ggggcttcatgatgtccc Reverse primer 119-136 pCAGGS_R2 ccgagtgagagacacaaaa Reverse primer 201-218 pEGFP-N1 or pEGFP–C1 (Clontech) rEGFP-N cgtcgccgtccagctcgaccag Reverse primer 598 – 679 Genbank: U55762 EGFP-C catggtcctgctggagttcgtg Forward primer 1266 – 1287 Genbank: U55763 pTriEx6 (Invitrogen) TriExUP ggttattgtgctgtctcatca Forward primer 1880 – 1900 TriExDOWN tcgatctcagtggtatttgtg Reverse primer 2344 – 2364

Table 2.3 Bacterial strains

Strain Relevant characteristics Reference or source E. coli K-12 DH5 F-(80dlacZ M15) (lacZYA-argF) U169 hsdR17(r-m+) Gibco-BRL recA1 endA1 relA1 deoR DH5 F-, rec A1, end A1, hod R17 (rk-, mk+), sup E44, lambda - Laboratory collection , thi 1, gyrA, rel A1 XL-10 Gold TcR Δ(mcrA)183 Δ(mcrCB-hsdSMR-mrr)173 endA1 Stratagene supE44 thi-1 recA1 gyrA96 relA1 lac Hte [F´ proAB lacIqZΔM15 Tn10 (TcR) Amy CmR BL21(DE3) F– ompT hsdS B(rB–, mB–) gal dcm (DE3) Laboratory collection S-17 Conjugative strain Laboratory collection RMA2242 UT5600 [pIcsA] Laboratory collection RMA2802 S-17-1 pir [pCVD442 + degP::Cm] (Purins et al., 2008) RMA2986 UT5600 [[pMG55] [pBRR1MCS::birA] [pBAD33-icsP] Laboratory collection RMA4301 UT5600 E. coli K-12 ompT Laboratory collection - - - R Rosetta2(DE3) F ompT hsdSB(rB mB ) gal dcm (DE3) pRARE2 (Cm ) Novagen MC4100 F-araD139 A(argF-lac)U169 rpsL150 deoCI relAl thiA (Zalucki & Jennings, ptsF25 flbB5301 2007) JGS190 MC4100 ara+ ∆skp zae::Tn10 (Sklar et al., 2007b) MG1655 K-12 (MG1655) rph-1 (Mutalik et al., 2009) CAG41291 MG1655 surA::KmR Carol Gross

S. flexneri 2457T S. flexneri 2a wild type Laboratory collection RMA2041 2457T ∆icsA::TcR (Van Den Bosch & Morona, 2003) RMA2090 RMA2041 [pIcsA] (Van Den Bosch & Morona, 2003) RMA2043 RMA2041 ∆rmlD::KmR (Van Den Bosch & Morona, 2003) RMA2107 RMA2043 [pIcsA] (Van Den Bosch & Morona, 2003) RMA2159 Virulence plasmid-cured 2457T Laboratory collection RMA2161 RMA2159 rfbD::KmR Laboratory collection KMRM105 RMA2041 [pIcsAi369] (May & Morona, 2008) KMRM107 RMA2041 [pIcsAi326] (May & Morona, 2008)

KMRM109 RMA2041 [pIcsAi633] (May & Morona, 2008) KMRM114 RMA2041 [pIcsAi643] (May & Morona, 2008) KMRM134 RMA2041 [pIcsAi677] (May & Morona, 2008) KMRM141 RMA2041 [pIcsAi386] (May & Morona, 2008) KMRM147 RMA2041 [pIcsAi716] (May & Morona, 2008)

Table 2.4 Bacterial strains created in this study

Strain Relevant Characteristics

Chapter 3 R R R MYRM275 RMA2043 [pIcsAi643]; Tc Km Ap R R R MYRM276 RMA2043 [pIcsAi677]; Tc Km Ap R R R MYRM277 RMA2043 [pIcsAi716]; Tc Km Ap R R R MYRM289 RMA2043 [pIcsAi633]; Tc Km Ap MYRM293 RMA2041 [pBR322]; TcR ApR MYRM294 RMA2043 [pBR322]; TcR KmR ApR MYRM296 RMA2159 [pBAD33::icsP]; CmR MYRM297 RMA2161 [pBAD33::icsP]; KmR CmR MYRM298 MYRM296 [pIcsA]; CmR ApR MYRM299 MYRM297 [pIcsA]; KmR CmR ApR R R MYRM303 MYRM296 [pIcsAi633]; Cm Ap R R MYRM304 MYRM296 [pIcsAi643]; Cm Ap R R MYRM305 MYRM296 [pIcsAi677]; Cm Ap R R MYRM306 MYRM296 [pIcsAi716]; Cm Ap R R R MYRM310 MYRM297 [pIcsAi633]; Km Cm Ap R R R MYRM311 MYRM297 [pIcsAi643]; Km Cm Ap R R R MYRM312 MYRM297 [pIcsAi677]; Km Cm Ap R R R MYRM313 MYRM297 [pIcsAi716]; Km Cm Ap R R MYRM363 UT5600 [pIcsAi502]; Sp Ap R R MYRM364 UT5600 [pIcsAi595]; Sp Ap R R MYRM365 UT5600 [pIcsAi598]; Sp Ap R R MYRM366 UT5600 [pIcsAi633]; Sp Ap R R MYRM367 UT5600 [pIcsAi643]; Sp Ap R R MYRM368 UT5600 [pIcsAi677]; Sp Ap R R MYRM369 UT5600 [pIcsAi716]; Sp Ap MYRM370 UT5600 [pIcsA]; SpR ApR MYRM371 UT5600 [pBR322]; SpR ApR MYRM372 UT5600 [pMG55]; SpR ApR MYRM373 UT5600 [pJRD215 + pIcsA]; SpR KmR ApR MYRM374 UT5600 [pJRD215 + pBR322]; SpR KmR ApR R R R MYRM378 UT5600 [pJRD215 + pIcsAI633]; Sp Km Ap R R R MYRM379 UT5600 [pJRD215 + pIcsAI643]; Sp Km Ap R R R MYRM380 UT5600 [pJRD215 + pIcsAI677]; Sp Km Ap R R R MYRM381 UT5600 [pJRD215 + pIcsAI716]; Sp Km Ap MYRM578 UT5600 [pRMA154 + pIcsA]; SpR KmR ApR MYRM383 UT5600 [pRMA154 + pBR322]; SpR KmR ApR R R R MYRM387 UT5600 [pRMA154 + pIcsAI633]; Sp Km Ap R R R MYRM388 UT5600 [pRMA154 + pIcsAI643]; Sp Km Ap R R R MYRM389 UT5600 [pRMA154 + pIcsAI677]; Sp Km Ap R R R MYRM390 UT5600 [pRMA154 + pIcsAI716]; Sp Km Ap MYRM391 UT5600 [pJRD215 + pMG55]; SpR KmR ApR MYRM392 UT5600 [pRMA154 + pMG55]; SpR KmR ApR MYRM400 MYRM296 [pBR322]; CmR ApR MYRM401 MYRM297 [pBR322]; CmR ApR KmR MYRM522 RMA2041 degP::CmR; TcR MYRM675 MYRM522 [pIcsA]; TcR CmR ApR R R R MYRM524 MYRM522 [pIcsAi677]; Tc Cm Ap R R R MYRM525 MYRM522 [pIcsAi716]; Tc Cm Ap MYRM526 MYRM522 [pBR322]; TcR CmR ApR 86

Table 2.4 Bacterial strains created in this study (continued)

Strain Relevant Characteristics MYRM632 DH5α [PicsA-lacZ-Km] #1; ApR KmR MYRM633 DH5α [PicsA-lacZ-Km] #2; ApR KmR MYRM644 RMA2159 [pMYRM632]; ApR KmR MYRM645 RMA2161 [pMYRM632]; ApR KmR MYRM675 MYRM522 [pIcsA]; TcR CmR ApR MYRM676 XL-10 Gold [pMYRM632-TGA] #1; ApR KmR MYRM677 XL-10 Gold [pMYRM632-TGA] #2; ApR KmR MYRM678 XL-10 Gold [pMYRM632-TGA] #3; ApR KmR MYRM679 XL-10 Gold [pMYRM632-TGA] #4; ApR KmR MYRM680 RMA2041 [pMYRM676]; TcR ApR KmR MYRM681 RMA2043 [pMYRM676]; TcR ApR KmR MYRM682 RMA2159 [pMYRM676]; ApR KmR MYRM683 RMA2161 [pMYRM676]; ApR KmR MYRM718 DH5α [pSU23-PicsA-TGA-lacZ-Km] #1; CmR KmR MYRM719 DH5α [pSU23-PicsA-TGA-lacZ-Km] #2; CmR KmR MYRM734 RMA2090 [pMYRM718] #1; ApR KmR CmR MYRM721 RMA2107 [pMYRM718]; ApR KmR CmR MYRM722 KMRM147 [pMYRM718]; ApR KmR CmR MYRM723 MYRM277 [pMYRM718]; ApR KmR CmR MYRM724 RMA2107 [pACYC184]; TcR ApR KmR CmR MYRM725 MYRM289 [pACYC184]; TcR ApR KmR CmR MYRM726 MYRM275 [pACYC184]; TcR ApR KmR CmR MYRM727 MYRM276 [pACYC184]; TcR ApR KmR CmR MYRM728 MYRM277 [pACYC184]; TcR ApR KmR CmR MYRM729 RMA2107 [pRMA727]; TcR ApR KmR CmR MYRM730 MYRM289 [pRMA727]; TcR ApR KmR CmR MYRM731 MYRM275 [pRMA727]; TcR ApR KmR CmR MYRM732 MYRM276 [pRMA727]; TcR ApR KmR CmR MYRM733 MYRM277 [pRMA727]; TcR ApR KmR CmR MYRM735 RMA2090 [pMYRM718] #2; ApR KmR CmR

Chapter 4 MYRM293 RMA2041 [pBR322]; TcR ApR MYRM294 RMA2043 [pBR322]; TcR ApR KmR MYRM315 XL-10 Gold [pMG55 Y716L D717S]; ApR MYRM317 XL-10 Gold [pMG55 Y716S D717K]; ApR MYRM318 XL-10 Gold [pMG55 Y716C D717C]; ApR MYRM319 XL-10 Gold [pMG55 Y716V D717H]; ApR MYRM322 XL-10 Gold [pMG55 Y716G D717G]; ApR MYRM324 XL-10 Gold [pMG55 Y716E D717I]; ApR MYRM340 XL-10 Gold [pMG55 Y716K D717S]; ApR MYRM329 RMA2041 [pMYRM315]; TcR ApR MYRM331 RMA2041 [pMYRM317]; TcR ApR MYRM332 RMA2041 [pMYRM318]; TcR ApR MYRM333 RMA2041 [pMYRM319]; TcR ApR MYRM336 RMA2041 [pMYRM322]; TcR ApR MYRM338 RMA2041 [pMYRM324]; TcR ApR MYRM346 RMA2041 [pMYRM340]; TcR ApR MYRM352 RMA2041 [pMG55]; TcR ApR MYRM353 RMA2043 [pMG55]; TcR ApR KmR 87

Table 2.4 Bacterial strains created in this study (continued)

Strain Relevant Characteristics MYRM354 RMA2043 [pMYRM315]; TcR ApR KmR MYRM355 RMA2043 [pMYRM317]; TcR ApR KmR MYRM356 RMA2043 [pMYRM318]; TcR ApR KmR MYRM357 RMA2043 [pMYRM319]; TcR ApR KmR MYRM359 RMA2043 [pMYRM322]; TcR ApR KmR MYRM360 RMA2043 [pMYRM324]; TcR ApR KmR MYRM362 RMA2043 [pMYRM340]; TcR ApR KmR MYRM536 XL-10 Gold [pMG55 T330S G331G]; ApR MYRM537 XL-10 Gold [pMG55 T330G G331R]; ApR MYRM538 XL-10 Gold [pMG55 T330E G331K]; ApR MYRM539 XL-10 Gold [pMG55 T330P G331G]; ApR MYRM543 XL-10 Gold [pMG55 T330G G331P]; ApR MYRM556 XL-10 Gold [pMG55 T330K G331N; ApR MYRM544 XL-10 Gold [pMG55 T381Q V382R]; ApR MYRM545 XL-10 Gold [pMG55 T381R V382K]; ApR MYRM546 XL-10 Gold [pMG55 T381A V382Q]; ApR MYRM547 XL-10 Gold [pMG55 T381M V382L]; ApR MYRM548 XL-10 Gold [pMG55 T381K V382M]; ApR MYRM549 XL-10 Gold [pMG55 T381P V382R]; ApR MYRM562 RMA2041 [pMYRM536]; TcR ApR MYRM563 RMA2041 [pMYRM537]; TcR ApR MYRM564 RMA2041 [pMYRM538]; TcR ApR MYRM565 RMA2041 [pMYRM539]; TcR ApR MYRM567 RMA2041 [pMYRM543]; TcR ApR MYRM575 RMA2041 [pMYRM556]; TcR ApR MYRM568 RMA2041 [pMYRM544]; TcR ApR MYRM569 RMA2041 [pMYRM545]; TcR ApR MYRM570 RMA2041 [pMYRM546]; TcR ApR MYRM571 RMA2041 [pMYRM547]; TcR ApR MYRM572 RMA2041 [pMYRM548]; TcR ApR MYRM577 RMA2041 [pMYRM549]; TcR ApR MYRM588 XL-10 Gold [pMG55 G331W] #1; ApR MYRM589 XL-10 Gold [pMG55 G331W] #2; ApR MYRM590 XL-10 Gold [pMG55 V382R] #1; ApR MYRM591 XL-10 Gold [pMG55 V382R] #2; ApR MYRM592 XL-10 Gold [pMG55 Y716F] #1; ApR MYRM593 XL-10 Gold [pMG55 Y716F] #2; ApR MYRM595 XL-10 Gold [pMG55 Y716G]; ApR MYRM596 RMA2041 [pMYRM588] #1; TcR ApR MYRM597 RMA2041 [pMYRM588] #2; TcR ApR MYRM598 RMA2041 [pMYRM590] #1; TcR ApR MYRM599 RMA2041 [pMYRM590] #2; TcR ApR MYRM600 RMA2041 [pMYRM592] #1; TcR ApR MYTM601 RMA2041 [pMYRM592] #2; TcR ApR MYRM602 RMA2041 [pMYRM595] #1; TcR ApR MYRM603 RMA2041 [pMYRM595] #2; TcR ApR MYRM604 RMA2043 [pMYRM592] #1; TcR ApR KmR MYRM605 RMA2043 [pMYRM592] #2; TcR ApR KmR MYRM606 RMA2043 [pMYRM595] #1; TcR ApR KmR MYRM607 RMA2043 [pMYRM595] #2; TcR ApR KmR 88

Table 2.4 Bacterial strains created in this study (continued)

Strain Relevant Characteristics MYRM608 XL-10 Gold [pMG55 D717G] #1; ApR MYRM609 XL-10 Gold [pMG55 D717G] #2; ApR MYRM610 RMA2041 [pMYRM608] #1; TcR ApR MYRM611 RMA2041 [pMYRM609] #2; TcR ApR MYRM612 RMA2043 [pMYRM608] #1; TcR ApR KmR MYRM613 RMA2043 [pMYRM609] #2; TcR ApR KmR R MYRM637 DH5 [pSU23 + IcsAWT]; Cm MYRM638 DH5 [pSU23 + IcsA::BIO] #1; CmR MYRM639 DH5 [pSU23 + IcsA::BIO] #2; CmR R MYRM640 DH5 [pSU23 + IcsAi248] #1; Cm R MYRM641 DH5 [pSU23 + IcsAi248] #2; Cm MYRM642 DH5 [pSU23 + IcsA::BIO Y716G D717G] #1; CmR MYRM646 RMA2041 [pMYRM637]; TcR CmR MYRM647 RMA2041 [pMYRM638]; TcR CmR MYRM648 RMA2041 [pMYRM640]; TcR CmR MYRM649 RMA2041 [pMYRM642]; TcR CmR MYRM650 RMA2043 [pMYRM637]; TcR CmR KmR MYRM651 RMA2043 [pMYRM638]; TcR CmR KmR MYRM652 RMA2043 [pMYRM640]; TcR CmR KmR MYRM653 RMA2043 [pMYRM642]; TcR CmR KmR MYRM685 RMA2041 [pSU23]; TcR CmR MYRM655 RMA2043 [pSU23]; TcR CmR KmR MYRM656 MYRM648 [pMYRM322]; TcR CmR ApR MYRM657 MYRM648 [pMYRM590]; TcR CmR ApR MYRM658 MYRM648 [pKMRM19]; TcR CmR ApR MYRM659 MYRM648 [pMYRM590]; TcR CmR ApR MYRM660 MYRM293 [pMYRM637]; TcR CmR ApR MYRM661 MYRM293 [pMYRM638]; TcR CmR ApR MYRM662 MYRM293 [pMYRM640]; TcR CmR ApR MYRM663 MYRM293 [pMYRM642]; TcR CmR ApR MYRM669 MYRM646 [pKMRM19]; TcR CmR ApR MYRM670 MYRM646 [pMYRM322]; TcR CmR ApR MYRM671 MYRM646 [pMYRM590]; TcR CmR ApR MYRM672 MYRM647 [pKMRM19]; TcR CmR ApR MYRM673 MYRM647 [pMYRM322]; TcR CmR ApR MYRM674 MYRM647 [pMYRM590]; TcR CmR ApR R R R MYRM686 MYRM685 [pIcsAWT]; Tc Cm Ap MYRM687 MYRM685 [pIcsA::BIO]; TcR CmR ApR MYRM688 MYRM685 [pKMRM19]; TcR CmR ApR MYRM689 MYRM685 [pMYRM322]; TcR CmR ApR MYRM690 MYRM685 [pMYRM590]; TcR CmR ApR MYRM691 MYRM651 [pKMRM19]; TcR CmR ApR KmR MYRM692 MYRM651 [pMYRM322]; TcR CmR ApR KmR MYRM693 MYRM651 [pMYRM590]; TcR CmR ApR KmR MYRM694 MYRM652 [pMYRM322]; TcR CmR ApR KmR MYRM695 MYRM652 [pMYRM590]; TcR CmR ApR KmR MYRM696 MYRM653 [pKMRM19]; TcR CmR ApR KmR MYRM697 MYRM653 [pMYRM590]; TcR CmR ApR KmR MYRM699 MYRM294 [pMYRM637]; TcR CmR ApR KmR

Table 2.4 Bacterial strains created in this study (continued)

Strain Relevant Characteristics MYRM700 MYRM294 [pMYRM638]; TcR CmR ApR KmR MYRM701 MYRM294 [pMYRM640]; TcR CmR ApR KmR MYRM702 MYRM294 [pMYRM642]; TcR CmR ApR KmR R R R MYRM703 MYRM655 [pIcsAWT]; Tc Cm Ap MYRM704 MYRM655 [pIcsA::BIO]; TcR CmR ApR KmR MYRM705 MYRM655 [pKMRM19]; TcR CmR ApR KmR MYRM706 MYRM655 [pMYRM322]; TcR CmR ApR KmR MYRM707 MYRM655 [pMYRM590]; TcR CmR ApR KmR MYRM708 MYRM698 [pKMRM19]; TcR CmR ApR KmR MYRM709 MYRM698 [pMYRM322]; TcR CmR ApR KmR MYRM710 MYRM698 [pMYRM590]; TcR CmR ApR KmR

Chapter 5 MYRM185 DH5α [pGEMT-E + EGFP] #1; ApR MYRM186 DH5α [pGEMT-E + EGFP] #2; ApR MYRM187 DH5α [pTriEx6 + EGFP] #1; ApR MYRM188 DH5α [pTriEx6 + EGFP] #2; ApR MYRM189 BL21(DE3) [pTriEx6 + EGFP]; ApR MYRM229 DH5α [pGEMT-E + GFP-WH1] #1; ApR MYRM230 DH5α [pGEMT-E + GFP-WH1] #2; ApR MYRM233 DH5α [pGEMT-E + GFP-WH1-CRIB] #1; ApR MYRM234 DH5α [pGEMT-E + GFP-WH1-CRIB] #2; ApR MYRM235 DH5α [pGEMT-E + GFP-N-WASP] #1; ApR MYRM236 DH5α [pGEMT-E + GFP-N-WASP] #2; ApR MYRM239 DH5α [pTriEx6 + GFP-WH1] #1; ApR MYRM240 DH5α [pTriEx6 + GFP-WH1] #2; ApR MYRM242 DH5α [pTriEx6 + GFP-WH1-CRIB] #1; ApR MYRM243 DH5α [pTriEx6 + GFP-WH1-CRIB] #2; ApR MYRM248 Rosetta2(DE3) [pREP4]; KmR MYRM249 Rosetta2(DE3) [placIq]; TcR MYRM250 MYRM249 [pMYRM239]; TcR ApR MYRM251 MYRM249 [pMYRM242]; TcR ApR MYRM256 DH5α [pTriEx6 + GFP-N-WASP] #1; ApR MYRM257 DH5α [pTriEx6 + GFP-N-WASP] #2; ApR MYRM258 MYRM249 [pMYRM256]; TcR ApR MYRM267 MYRM249 [pTriEx6]; TcR ApR MYRM270 MYRM249 [pMYRM187]; TcR ApR MYRM279 DH5α [pGEMT-E + GFP-CRIB]; ApR MYRM290 DH5α [pTriEx6 + GFP-CRIB] #1; ApR MYRM291 DH5α [pTriEx6 + GFP-CRIB] #2; ApR MYRM295 MYRM249 [pMYRM290]; TcR ApR R MYRM462 DH5α [pGEMT-E + IcsAαi87] #1; Ap R MYRM463 DH5α [pGEMT-E + IcsAαi87] #2; Ap R MYRM472 DH5α [pBAD/MycHisA + IcsAαi87] #1; Ap R MYRM473 DH5α [pBAD/MycHisA + IcsAαi87] #2; Ap MYRM474 Top 10 [pBAD/MycHisA]; ApR MYRM475 Top 10 [pMYRM472]; ApR MYRM480 BL21(DE3) + pRMA4040 [pKJE7]; CmR MYRM481 BL21(DE3) + pRMA4041 [pGro7]; CmR MYRM482 BL21(DE3) + pRMA4042 [pG-KJE8]; CmR 90

Table 2.4 Bacterial strains created in this study (continued)

Strain Relevant Characteristics MYRM483 BL21(DE3) + pRMA4043 [pTf16]; CmR MYRM484 BL21(DE3) + pRMA4044 [pG-Tf2]; CmR MYRM485 BL21(DE3) [pMYRM472]; ApR MYRM486 MYRM480 [pMYRM472]; ApR CmR MYRM487 MYRM481 [pMYRM472]; ApR CmR MYRM488 MYRM482 [pMYRM472]; ApR CmR MYRM489 MYRM483 [pMYRM472]; ApR CmR MYRM490 MYRM484 [pMYRM472]; ApR CmR

Chapter 6 MYRM80 DH5α [pGEMT-E + SmaI-XbaI] #1; ApR MYRM81 DH5α [pGEMT-E + SmaI-XbaI] #2; ApR MYRM98 DH5α [pGEMT-E + SacI-SmaI] #1; ApR MYRM99 DH5α [pUC18 + SacI-SmaI]/[pUC18SS] #1; ApR MYRM100 DH5α [pUC18 + SacI-SmaI]/[pUC18SS] #2; ApR MYRM101 DH5α [pUC18SX] #1; ApR MYRM102 DH5α [pUC18SX] #2; ApR MYRM103 DH5α [pGEMT-E + icsB_ST] #1; ApR MYRM104 DH5α [pGEMT-E + icsB_ST] #1; ApR MYRM108 DH5α [pET52b(+) + icsB_ST]; ApR MYRM109 BL21(DE3) [pET52b(+) + icsB_ST] #1; ApR MYRM110 BL21(DE3) [pET52b(+) + icsB_ST] #2; ApR MYRM111 BL21(DE3) [pET52b(+)] / [pRMA2824]; ApR MYRM112 DH5α [pUC18SX::aphA-3] #1; ApR KmR MYRM113 DH5α [pUC18SX::aphA-3] #2; ApR KmR MYRM137 BL21(DE3) [pTB101-His6-IcsB-IpgA] / [pRMA2861] #1;TpR ApR MYRM138 BL21(DE3) [pTB101-His6-IcsB-IpgA] / [pRMA2861] #2;TpR ApR MYRM148 DH5α [pGEMT-E + 0.9 kb-icsB] #1; ApR MYRM149 DH5α [pGEMT-E + 0.9 kb-icsB] #2; ApR MYRM150 DH5α [pWSK29 + 0.9 kb-icsB] #1; ApR MYRM151 DH5α [pWSK29 + 0.9 kb-icsB] #2; ApR MYRM152 2457T [pKD46]; ApR MYRM156 2457T ΔicsB::aphA-3 #1; KmR MYRM157 2457T ΔicsB::aphA-3 #2; KmR MYRM160 MYRM156 [pMYRM150] #1; ApR KmR MYRM161 MYRM156 [pMYRM150] #2; ApR KmR MYRM162 MYRM156 [pWSK29]; ApR KmR MYRM170 RMA2041 [pKD46]; TcR ApR MYRM181 DH5α [pWSK29 + 0.9 kb-icsB-ipgA] #1; ApR MYRM182 DH5α [pWSK29 + 0.9 kb-icsB-ipgA] #2; ApR MYRM183 MYRM156 [pMYRM181] #1; ApR KmR MYRM184 MYRM156 [pMYRM181] #2; ApR KmR MYRM193 2457T ΔicsA ΔicsB::aphA-3 #1; KmR TcR MYRM194 2457T ΔicsA ΔicsB::aphA-3 #2; KmR TcR MYRM195 2457T ΔicsA ΔicsB::aphA-3 #3; KmR TcR

Table 2.4 Bacterial strains created in this study (continued)

Strain Relevant Characteristics MYRM217 MYRM193 [pKMRM5]; TcR ApR KmR MYRM218 MYRM193 [pKMRM7]; TcR ApR KmR MYRM219 MYRM193 [pKMRM8]; TcR ApR KmR MYRM220 MYRM193 [pKMRM13]; TcR ApR KmR MYRM221 MYRM193 [pKMRM15]; TcR ApR KmR MYRM222 MYRM193 [pKMRM25]; TcR ApR KmR MYRM223 MYRM193 [pKMRM41]; TcR ApR KmR MYRM224 MYRM193 [pKMRM43]; TcR ApR KmR R MYRM228 2457T [pRMA2861] / [pTB101-His6-IcsB-IpgA]; Ap

Table 2.5 Plasmids used in this study

Plasmid Relevant characteristics Reference or source pACYC184 Low copy number; P15A ori; TcR, CmR NEB pBAD33 Arabinose-inducible pBAD promoter vector; CmR (Guzman et al., 1995) pBAD33::icsP icsP gene cloned into pBAD33; CmR Laboratory collection pBAD/MycHis A Arabinose-inducible pBAD promoter, pBR322 derived; Invitrogen ApR pBR322 Medium copy no.; ColE1 ori; ApR, TcR (Bolivar et al., 1977) pGEMT-Easy Cloning vector; ApR Promega pIcsA icsA gene cloned into pBR322; ApR (Van Den Bosch & Morona, 2003) pJRD215 Broad-host-range cosmid cloning vector; KmR, SmR; mob, (Davison et al., 1987) plasmid mobilisation functions pKOK6.1 Derivative of pKOK6 with inverse direction of the (Kokotek & Lotz, 1989; lacZ/Kan cassette in pKOK6 and has additional stop Murray et al., 2003) codons inserted into upstream of lacZ via the BamHI site; CmR, KmR R pKD46 Red recombinase helper plasmid; Ap ; orits (Datsenko & Wanner, 2000) pKMRM5 pIcsAi386 (May & Morona, 2008) pKMRM7 pIcsAi369 (May & Morona, 2008) pKMRM9 pIcsAi633 (May & Morona, 2008) pKMRM14 pIcsAi643 (May & Morona, 2008) pKMRM34 pIcsAi677 (May & Morona, 2008) pKMRM41 pIcsAi326 (May & Morona, 2008) pKMRM47 pIcsAi716 (May & Morona, 2008) pRMA727 rmlD (rfbD) gene cloned into pACYC184; CmR (Van Den Bosch et al., 1997) R R pRMA154 pJRD215ClaI-Kpn1-pPM2213Cla1-Kpn1 Km , Sm ; encodes (Morona et al., 1994) galF, rfb locus, rfc and gnd, Oag biosynthesis genes from S. flexneri pRMA2693 pCB6-GFP-WH1; ApR Prof. Michael Way pRMA2694 pCB6-GFP-CRIB; ApR Prof. Michael Way pRMA2695 pCB6-GFP-WH1-CRIB; ApR Prof. Michael Way pRMA2731 pGFP-Atg5 (Mizushima et al., 1998) pRMA2803 pUC18K::aphA-3; KmR, ApR (Menard et al., 1993) pRMA2846 pCB6-GFP-N-WASP; ApR Prof. Michael Way R pRMA2861 pTB101-His6-IcsB-IpgA; Tp (Ogawa et al., 2003) pRMA4040 pKJE7; CmR Takara pRMA4041 pGro7; CmR Takara pRMA4042 pG-KJE8; CmR Takara pRMA4043 pTf16; CmR Takara pRMA4044 pG-Tf2 Takara pSU23 Medium copy no.; P15A ori; CmR (Bartolome et al., 1991) pET52b(+) T7 promoter; ApR Novagen pTriEx6 CMV, T7 promoters; ApR Novagen pMG55 pBR322 encoding IcsA::BIO; ApR (May et al., 2012) pUC18 LacZ ; ApR NEB pWSK29 Low copy cloning vector; ApR (Wang & Kushner, 1991)

Chapter Three

Absence of O-antigen suppresses Shigella flexneri IcsA autochaperone region mutations

Chapter 3: Absence of O-antigen suppresses Shigella flexneri IcsA autochaperone region mutations

3.1 Introduction

IcsA is a Type Va AT that is responsible for initiation of S. flexneri ABM by interacting with the host actin regulator, N-WASP (Bernardini et al., 1989; Goldberg, 2001; Henderson et al., 2004; Lett et al., 1989). Biogenesis of ATs or OMPs has been extensively studied in E. coli (Ieva et al., 2011; Peterson et al., 2010; Ruiz-Perez et al., 2010; Soprova et al., 2010; Walton et al., 2009) and the involvement of new accessory proteins such as the periplasmic chaperones and the BAM complex in the translocation system has also been demonstrated (Ieva & Bernstein, 2009; Jain & Goldberg, 2007; Purdy et al., 2007; Sauri et al., 2009; Sklar et al., 2007b; Wagner et al., 2009). However, the detailed mechanisms of IcsA biogenesis have not been fully elucidated.

May and Morona (2008) identified a novel autochaperone (AC) region (aa 634-753) at the C-terminal end of IcsA functional passenger domain, which forms part of the self- associating AT (SAAT) domain and the new N-WASP interacting region (aa 508-730) (Klemm et al., 2006; May & Morona, 2008; Meng et al., 2011). Linker insertion mutagenesis (IcsAi) of the IcsA AC region affected protein production severely in the S- LPS background, and the resultant S. flexneri mutants were defective in N-WASP recruitment and ABM (May & Morona, 2008). In the same study, May and Morona (2008) also showed that LPS Oag can affect the function of certain IcsAi (mutation outside the AC region) and IcsA deletion mutants in a R-LPS S. flexneri strain. Therefore, the previously identified AC IcsAi mutants (IcsAi633, IcsAi643, IcsAi677 and IcsAi716) (May & Morona, 2008) were re-examined in this chapter (in the R-LPS background) to investigate the role of AC region in IcsA biogenesis and N-WASP recruitment.

3.2 Text of manuscript

Absence of O-antigen suppresses Shigella flexneri IcsA autochaperone region mutations

Min Yan Teh, Elizabeth Ngoc Hoa Tran and Renato Morona

Discipline of Microbiology and Immunology, School of Molecular and Biomedical Science, University of Adelaide, Adelaide, South Australia, Australia 5005.

Published - Microbiology (2012) 158 (11):2835-2850

STATEMENT OF AUTHORSHIP

Title of Paper Absence of O-antigen suppresses Shigella flexneri IcsA autochaperone region mutations Publication Status

Publication Details Teh, M.Y., Tran, E.N.H., Morona, R. (2012). Absence of O- antigen suppresses Shigella flexneri IcsA autochaperone region mutations. Microbiology, 158 (11):2835-2850.

Author Contributions By signing the Statement of Authorship, each author certifies that their stated contribution to the publication is accurate and that permission is granted for the publication to be included in the candidate’s thesis.

Name of Principal Min Yan Teh Author (Candidate) Contribution to the Paper Performed all the experiments (except those performed by Dr. Elizabeth Tran), performed analysis on all samples, interpreted data, and wrote manuscript. Signature Date

Name of Co-Author Elizabeth Ngoc Hoa Tran Contribution to the Paper Performed the anti-IcsP antibodies preparation (Section 3.2.3.5), construction of pQE60-icsP (Section 3.2.3.5) and pBAD33::icsP (Section 3.2.3.4), TCA precipitation assay (Section 3.2.3.8), -galactosidase assay (Section 3.2.3.16), and assisted in editing the paper. Signature Date

Name of Co-Author Renato Morona Contribution to the Paper Supervised development of work, helped in data interpretation, manuscript evaluation and acted as corresponding author.

Signature Date

Teh, M.Y., Tran, E.N.H. and Morona, R. (2012) Absence of O antigen suppresses Shigella flexneri IcsA autochaperone region mutations. Microbiology, v. 158 (11), pp. 2835-2850, November 2012

NOTE: This publication is included in the print copy of the thesis held in the University of Adelaide Library.

It is also available online to authorised users at:

http://dx.doi.org/10.1099/mic.0.062471-0

The following sections of Chapter 3 provide additional information for the work performed but was not included in the manuscript (Section 3.2).

3.3 IcsAi mutants production in S-LPS and R-LPS S. flexneri

In addition of detecting IcsAi production with Western immunoblotting as shown in the manuscript (Section 3.2.4.1), IF microscopy was also performed on both S-LPS and R-LPS

S. flexneri strains expressing IcsAWT, IcsAi633, IcsAi643, IcsAi677, or IcsAi716 mutant proteins with anti-IcsA antibody (Fig. 3.9 and Fig. 3.10), as described in Section 2.9.10. Consistent results were obtained whereby all AC IcsAi proteins have very low production levels in the S-LPS background (Fig. 3.9) but with WT comparable production levels in the R-LPS background (Fig. 3.10). Polar and lateral localisation of IcsAi mutants were retained in the R-LPS background.

3.4 N-WASP recruitment ability of IcsAi mutants

The ability of S. flexneri expressing IcsAi mutants to recruit N-WASP and form F-actin comet tails was examined by infecting HeLa cells with both S-LPS and R-LPS S. flexneri strains expressing IcsAWT, IcsAi633, IcsAi643, IcsAi677, or IcsAi716 mutant proteins (Fig. 3.11 and Fig. 3.12), as described in Section 2.13.5. As previously reported by May and Morona

(2008), S-LPS S. flexneri expressing very low levels of AC IcsAi mutants did not recruit N-WASP or form F-actin comet tail (Fig. 3.11). In contrast, R-LPS S. flexneri expressing either IcsAi633, IcsAi643, or IcsAi677 were capable of recruiting N-WASP and forming F- actin comet tails (Fig. 3.12 B-D), except IcsAi716 (Fig. 3.12E). The data suggest that the N- WASP binding site could be located at aa 716-717.

3.5 LPS depletion-regeneration assay

To independently verify the effect of Oag repeat units on AC IcsAi production, a novel assay was performed using tunicamycin in conjunction with PMBN. It was hypothesised that the inhibition of Oag production (S-LPS strain becomes R-LPS) would restore IcsAi716

136 production. The following sections describe the development of this assay.

3.5.1 Optimisation of tunicamycin concentration The optimal concentration of tunicamycin was first determined by treating an S-LPS S. flexneri strain expressing either IcsAWT (RMA2090) or IcsAi716 (KMRM147) with 3 μg/mL or 10 μg/mL tunicamycin (in DMSO), in conjunction with 3 μg/mL PMBN for 3 h, as described in Section 2.11.3, to deplete the LPS Oag production. PMBN was used at 3 μg/mL based on the previously reported literature (Vaara, 1992). As a control, DMSO was added instead of tunicamycin. Samples from the assay were subjected to SDS-PAGE gels followed by silver nitrate staining (Section 2.11.2) and Western immunoblotting with anti- IcsA (Section 2.9.6).

The results showed that 3 μg/mL tunicamycin + 3 μg/mL PMBN had no effect on the biogenesis of LPS Oag (Fig. 3.13A, lanes 2 and 7) and the IcsAi716 production remained extremely low (Fig. 3.13B, lane 7). In contrast, Oag biosynthesis was inhibited by approximately 90% when the strains were treated with 10 μg/mL tunicamycin + 3 μg/mL

PMBN (Fig. 3.13A, lanes 3 and 8). As expected, a distinct IcsAi716 protein band was observed after tunicamycin/PMBN treatment (Fig. 3.13B, lane 8). IcsAWT protein production remained high regardless of the tunicamycin/PMBN treatment (Fig. 3.13B, lanes 1-3). The biosynthesis of Oag was unaffected by the DMSO/PMBN treatment (Fig. 3.13A, lanes 4-5 and 9-10). Taken together, 10 μg/mL tunicamycin + 3 μg/mL PMBN is the optimal combination to inhibit Oag biosynthesis for this assay.

3.5.2 The importance of PMBN PMBN is known to be a potent OM permeabilising agent and not bactericidal (Vaara, 1992). Hence, it was of interest to determine whether PMBN is required for tunicamycin to penetrate across the OM of S. flexneri. An LPS depletion assay was performed on RMA2090 and KMRM147 using 10 μg/mL tunicamycin, in the presence or absence of 3 μg/mL PMBN.

137

Figure 3.9 Detection of surface IcsAi proteins expressed by S-LPS S. flexneri. Mid-exponential phase cultures of S. flexneri ΔicsA (S-LPS) strains expressing either

IcsAWT, IcsAi633, IcsAi643, IcsAi677 or IcsAi716, were formalin fixed and labelled with rabbit polyclonal anti-IcsA antibody and Alexa 488-conjugated goat anti-rabbit secondary antibody, as described in Section 2.9.10. Inserts show enlarged views for greater clarity. White arrow indicates the bacterium shown in insert. IF images were observed at 100x magnification. Scale bar = 10 μm. The images are as follows:

A. RMA2090 ΔicsA [IcsAWT]

B. KMRM109 ΔicsA [IcsAi633]

C. KMRM114 ΔicsA [IcsAi643]

D. KMRM134 ΔicsA [IcsAi677]

E. KMRM147 ΔicsA [IcsAi716]

138

139

Figure 3.10 Detection of surface IcsAi proteins expressed by R-LPS S. flexneri. Mid-exponential phase cultures of S. flexneri ΔicsA ΔrmlD (R-LPS) strains expressing either IcsAWT, IcsAi633, IcsAi643, IcsAi677 or IcsAi716, were formalin fixed and labelled with rabbit polyclonal anti-IcsA antibody and Alexa 488-conjugated goat anti-rabbit secondary antibody, as described in Section 2.9.10. Inserts show enlarged views for greater clarity. White arrow indicates the bacterium shown in insert. IF images were observed at 100x magnification. Scale bar = 10 μm. The images are as follows:

A. RMA2107 ΔicsA ΔrmlD [IcsAWT]

B. MYRM289 ΔicsA ΔrmlD [IcsAi633]

C. MYRM275 ΔicsA ΔrmlD [IcsAi643]

D. MYRM276 ΔicsA ΔrmlD [IcsAi677]

E. MYRM277 ΔicsA ΔrmlD [IcsAi716]

140

141

Figure 3.11 Detection of N-WASP recruitment by S-LPS S. flexneri expressing IcsAi proteins. HeLa cells were infected with mid-exponential phase cultures of S. flexneri ΔicsA expressing the IcsA mutants and formalin fixed. HeLa cells and bacteria nuclei were labelled with DAPI (blue), F-actin was labelled with Alexa Fluor 488-phalloidin (green), and N-WASP was labelled with anti-N-WASP and Alexa Fluor 594-conjugated donkey anti-rabbit antibody (red), as detailed in Section 2.13.5. IF images were observed at 100x magnification. Arrows indicate N-WASP recruitment and F-actin comet tail formation. Inserts show enlarged views of the indicated region. Strains were assessed in two independent experiments. Scale bar = 10 μm. The images are as follows:

A. RMA2090 ΔicsA [IcsAWT]

B. KMRM109 ΔicsA [IcsAi633]

C. KMRM114 ΔicsA [IcsAi643]

D. KMRM134 ΔicsA [IcsAi677]

E. KMRM147 ΔicsA [IcsAi716]

142

143

Figure 3.12 Detection of N-WASP recruitment and F-actin comet tail formation by R-

LPS S. flexneri expressing IcsAi proteins. HeLa cells were infected with mid-exponential phase cultures of S. flexneri ΔicsA ΔrmlD expressing the IcsAi mutants and formalin fixed. HeLa cells and bacteria nuclei were labelled with DAPI (blue), F-actin was labelled with Alexa Fluor 488-phalloidin (green), and N-WASP was labelled with anti-N-WASP and Alexa Fluor 594-conjugated donkey anti-rabbit antibody (red), as detailed in Section 2.13.5. IF images were observed at 100x magnification. Arrows indicate N-WASP recruitment and F-actin comet tail formation. Inserts show enlarged views of the indicated region. Strains were assessed in two independent experiments. Scale bar = 10 μm. The images are as follows:

A. RMA2107 ΔicsA ΔrmlD [IcsAWT]

B. MYRM289 ΔicsA ΔrmlD [IcsAi633]

C. MYRM275 ΔicsA ΔrmlD [IcsAi643]

D. MYRM276 ΔicsA ΔrmlD [IcsAi677]

E. MYRM277 ΔicsA ΔrmlD [IcsAi716]

144

145

Figure 3.13 Treatment of S-LPS S. flexneri with polymyxin B nonapeptide (PMBN) and different concentrations of tunicamycin.

S-LPS S. flexneri expressing IcsAWT (RMA2090) or IcsAi716 (KMRM147) were grown to mid-exponential phase, diluted 1:20 for the second time, supplemented with either 3 μg/mL tunicamycin or 10 μg/mL tunicamycin in conjunction with 3 μg/mL PMBN for 3 h, as detailed in Section 2.11.3. As a control, DMSO was added instead of tunicamycin. (A) LPS samples were prepared, as detailed in Section 2.11.1 and electrophoresed on an SDS- 15%-PAGE gel, prior to silver staining (Section 2.11.2). Samples represent approximately 2x108 bacteria. (B) Samples from the LPS-depletion assay were solubilised and electrophoresed on an SDS-12%-PAGE prior to Western immunoblotting with anti-IcsA antibody (Section 2.9.4 and Section 2.9.6). Samples in each lane represent 5x107 bacteria. The 120 kDa band corresponds to the full length IcsA; the 85 kDa band corresponds to the cleaved form (IcsA’). The samples in each lane are as follows:

Lane 1: RMA2090 Untreated Lane 2: RMA2090 3 μg/mL tunicamycin + PMBN treated Lane 3: RMA2090 10 μg/mL tunicamycin + PMBN treated Lane 4: RMA2090 DMSO control (for 3 μg/mL tunicamycin) + PMBN treated Lane 5: RMA2090 DMSO control (for 10 μg/mL tunicamycin) + PMBN treated Lane 6: KMRM147 Untreated Lane 7: KMRM147 3 μg/mL tunicamycin + PMBN treated Lane 8: KMRM147 10 μg/mL tunicamycin + PMBN treated Lane 9: KMRM147 DMSO control (for 3 μg/mL tunicamycin) + PMBN treated Lane 10: KMRM147 DMSO control (for 10 μg/mL tunicamycin) + PMBN treated

146

147

SDS-PAGE followed by either silver staining of LPS or Western immunoblotting with anti-IcsA were subsequently performed.

The data showed that in the absence of PMBN, LPS with Oag was only slightly inhibited by tunicamycin (~20% reduction) (Fig. 3.14A, lanes 4 and 9), in comparison with the 90% reduction seen in lanes 2 and 7, which had cells treated with both PMBN and tunicamycin. However, IcsAi716 protein production was slightly restored when treated with tunicamycin alone (Fig. 3.14B, lane 9), consistent with the ~20% reduction in LPS Oag biosynthesis. As expected, IcsAWT production remained unaffected throughout the assay and the reduction in S-LPS of untreated RMA2090 was most likely due to underloading of this bacterial sample (Fig. 3.14A, lane 1). LPS Oag production by RMA2090 and KMRM147 treated with PMBN/DMSO or DMSO was unaffected (Fig. 3.14A, lanes 3, 5,

8 and 10) and the IcsAi716 production was also unaffected (Fig. 3.14B, lanes 8 and 10), indicating that the depletion of LPS Oag was an effect of tunicamycin treatment. Collectively, PMBN is required to facilitate the penetration of tunicamycin across the S. flexneri OM.

3.6 Construction of PicsA-TGA-lacZ transcriptional reporter plasmid

In order to determine whether the difference in IcsAi production between S-LPS and R- LPS S. flexneri was due to the downregulation of gene transcription in the S-LPS background or vice versa, an IcsA promoter transcriptional reporter plasmid was made. To create a transcriptional reporter plasmid with the icsA promoter, an lacZ-Km fragment was derived from pKOK6.1 by digesting the plasmid with PstI, and pIcsA (pBR322 background) was digested with NsiI to remove a large fragment of the icsA gene. The pIcsA vector backbone which contained the icsA promoter was gel extracted and ligated with the lacZ-Km fragment via the compatible ends (Fig. 3.15). The ligated product was transformed into DH5α and grown on LB agar supplemented with Ap, Km and X-gal. A blue colony that was resistant to Ap and Km was selected and named MYRM632. pMYRM632 [PicsA-lacZ-Km] was sequenced with primer MY_7 to confirm the cloning of the lacZ-Km into pIcsA vector. Partial sequence of pMYRM632 which covers the icsA and

148

lacZ genes is illustrated in Fig. 3.16. The sequencing result showed that both icsA and lacZ are in-frame, producing an IcsA-LacZ fusion protein. However, the IcsA-LacZ fusion protein was lethal to S. flexneri strain carrying the virulence plasmid (data not shown). Thus, a stop codon (TGA) was introduced by mutating a glycine in between the icsA and lacZ genes of pMYRM632 via site-directed mutagenesis, as described in Section 2.8.4. The resulting PicsA-TGA-lacZ-Km plasmid was named pMYRM676. The mutation was confirmed with DNA sequencing.

In addition, the PicsA-TGA-lacZ-Km reporter construct was cloned into another vector background (Fig. 3.15). The PicsA-TGA-lacZ-Km fragment from pMYRM676 was extracted by digesting the plasmid with PstI and SalI and cloned into the likewise digested, SAP-treated pSU23 plasmid that confers chloramphenical resistance. The resulting plasmid was named pMYRM718. RMA2090, RMA2107, KMRM147 and MYRM277 were subsequently transformed with pMYRM718, yielding MYRM734, MYRM721,

MYRM722 and MYRM723, respectively. The production of IcsAWT and IcsAi716 was examined by Western immunoblotting with anti-IcsA. The results indicated that the presence of pMYRM718 did not affect IcsAWT or IcsAi716 production as the expected results were obtained (Fig. 3.17).

3.7 icsA promoter activity in S-LPS and R-LPS S. flexneri strains pMYRM676 (Section 3.6) was transformed into S. flexneri ΔicsA (RMA2041), S. flexneri ΔicsA ΔrmlD (RMA2043), virulence plasmid-cured S-LPS S. flexneri (RMA2159) and virulence plasmid-cured S. flexneri ΔrmlD R-LPS (RMA2161), generating MYRM680, MYRM681, MYRM682 and MYRM683, respectively. β-galactosidase assays were performed as described in Section 2.9.11 and the β-galactosidase activity level was measured as previously described (Miller, 1972). The data showed that in the virulence plasmid positive background, the icsA promoter activity was slightly higher in the S-LPS strain (MYRM680) than the R-LPS strain (MYRM681) (*P<0.05), while there was no significant difference between the S-LPS (MYRM682) and R-LPS (MYRM683) virulence

149

Figure 3.14 Treatment of S-LPS S. flexneri strains with 10 μg/mL tunicamycin with or without PMBN.

An S-LPS S. flexneri strain expressing IcsAWT (RMA2090) or IcsAi716 (KMRM147) was grown to mid-exponential phase, diluted 1:20 for the second time, supplemented with 10 μg/mL tunicamycin in conjunction with or without 3 μg/mL PMBN for 3 h, as detailed in Section 2.11.3. As a control, DMSO was added instead of tunicamycin. (A) LPS samples were prepared, as detailed in Section 2.11.1 and electrophoresed on an SDS-15%-PAGE gel, prior to silver staining (Section 2.11.2). Samples represent approximately 2x108 bacteria. (B) Samples from the LPS-depletion assay were electrophoresed on an SDS- 12%-PAGE prior to Western immunoblotting with anti-IcsA antibody (Section 2.9.4 and Section 2.9.6). Samples in each lane represent 5x107 bacteria. The 120 kDa band corresponds to the full length IcsA; the 85 kDa band corresponds to the cleaved form (IcsA’). The samples in each lane are as follows:

Lane 1: RMA2090 Untreated Lane 2: RMA2090 10 μg/mL tunicamycin + 3 μg/mL PMBN treated Lane 3: RMA2090 DMSO + 3 μg/mL PMBN treated Lane 4: RMA2090 10 μg/mL tunicamycin treated Lane 5: RMA2090 DMSO treated Lane 6: KMRM147 Untreated Lane 7: KMRM147 10 μg/mL tunicamycin + 3 μg/mL PMBN treated Lane 8: KMRM147 DMSO + 3 μg/mL PMBN treated Lane 9: KMRM147 10 μg/mL tunicamycin treated Lane 10: KMRM147 DMSO treated

150

151

Figure 3.15 Construction of the PicsA-TGA-lacZ-Km transcriptional reporter plasmid in pSU23 vector. pIcsA was digested with NsiI and the vector backbone was gel extracted. pKOK6.1 was digested with PstI and the lacZ-Km fragment was gel extracted prior to ligation with the NsiI digested pIcsA vector backbone via the NsiI/PstI compatible ends. The ligated product was transformed into DH5 and grown on selection agar plate supplemented with Ap, Km and X-gal. Blue colony that was Ap, Km-resistant was selected and named MYRM632. The plasmid [PicsA-lacZ-Km] was sequenced (Section 2.6.3.2). A stop codon (TGA) was introduced between the icsA and lacZ sequence of pMYRM632 using site-directed mutagenesis, as detailed in Section 2.8.4, to prevent the production of IcsA-LacZ fusion protein. The plasmid product was named pMYRM676 (ApR, KmR). The mutation was confirmed by DNA sequencing. Then, both pMYRM676 and pSU23 were digested with PstI and SalI. The PstI-PicsA-TGA-lacZ-Km-SalI fragment was gel extracted from the digested pMYRM676 and ligated with the digested, purified and SAP-treated pSU23 vector. The resulting plasmid was called pMYRM718 (CmR, KmR). Plasmids are not drawn to scale.

152

153

1 ATGAATCAAATTCACAAATTTTTTTGTAATATGACCCAATGTTCACAGGGGGGGGCCGGA 1 M N Q I H K F F C N M T Q C S Q G G A G

61 GAATTACCTACGGTAAAGGAAAAAACATGCAAATTGTCTTTTTCTCCTTTTGTTGTTGGT 21 E L P T V K E K T C K L S F S P F V V G

121 GCATCCCTGTTGCTCGGGGGGCCAATAGCTTTTGCTACTCCTCTTTCGGGTACTCAAGAA 41 A S L L L G G P I A F A T P L S G T Q E

181 CTTCATTTTTCAGAGGACAATTATGAAAAATTATTAACACCTGTTGATGGACTTTCTCCC 61 L H F S E D N Y E K L L T P V D G L S P

241 TTGGGAGCTGGTGAAGATGGAATGGATGCGTGGTATATAACTTCTTCCAACCCCTCTCAT 81 L G A G E D G M D A W Y I T S S N P S H

301 GCAGGGGGGGCTAGAGAGGAAACAGCTATGACCATGATTACGCCAAGCTTTCCGGGGAAT 101 A G G A R E E T A M T M I T P S F P G N

361 TCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAAT 121 S L A V V L Q R R D W E N P G V T Q L N

421 CGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGAT 141 R L A A H P P F A S W R N S E E A R T D

481 CGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCTTTGCCTGGTTTCCGG 161 R P S Q Q L R S L N G E W R F A W F P

Figure 3.16 Partial DNA and protein sequence of icsA-lacZ of pMYRM632. Ligation of the lacZ-Km fragment with pIcsA vector backbone was confirmed by determining the sequence at the point of fusion in pMYRM632. Primer MY_7 was used for DNA sequencing, and the DNA sequence was compiled and presented herein. Sequence for icsA (Genbank: AF386526) and lacZ (Genbank: AJ308295) is in orange and blue, respectively. Linker sequence between icsA and lacZ is in black. The amino acid that was mutagenised into a stop codon (TGA) is highlighted in yellow.

154

Figure 3.17 Detection of IcsA production in S-LPS and R-LPS S. flexneri carrying PicsA-TGA-lacZ-Km transcriptional reporter plasmid (pMYRM718). Whole cell lysates were prepared from mid-exponential phase cultures of the indicated S. flexneri strains, as detailed in Section 2.9.1. Samples were electrophoresed on an SDS- 12%-PAGE gel prior to Western immunoblotting with anti-IcsA antibody (Section 2.9.4 and Section 2.9.6). The 120 kDa band corresponds to the full length IcsA; the 85 kDa band corresponds to the cleaved form (IcsA’). S = S-LPS; R = R-LPS. Samples in each lane represent 5x107 bacteria. The samples in each lane are as follows:

Lane 1: MYRM734 (RMA2090 [pMYRM718]) S-LPS Lane 2: MYRM721 (RMA2107 [pMYRM718]) R-LPS Lane 3: MYRM722 (KMRM147 [pMYRM718]) S-LPS Lane 4: MYRM723 (MYRM277 [pMYRM718]) R-LPS

155

Figure 3.18 β-galactosidase assay

S-LPS or R-LPS of virulence plasmid positive (MYRM680 and MYRM681) and virulence plasmid-cured (MYRM682 and MYRM683) S. flexneri strains carrying PicsA-TGA-lacZ (pMYRM676) were grown to mid-exponential phase at 37°C and the β-galactosidase activity was measured, as described in Section 2.9.11. Data represent the means of three independent experiments. Error bars represent standard error of the mean (*P value < 0.05). VP+ = Virulence plasmid positive strains; VP- = Virulence plasmid-cured strains.

156

plasmid-cured strains (Fig. 3.18). The data suggest that the very low IcsAi protein production in the S-LPS background was unlikely due to an effect of transcriptional level, but may be due to a post-transcriptional effect. This is consistent with the data presented in

Section 3.2.4.5 where IcsAWT and IcsAi716 proteins were present in the strain used.

3.8 Construction of an S. flexneri degP::Cm ΔicsA mutant

An S. flexneri ∆icsA degP mutant was constructed by conjugating RMA2802 (S-17-1 pir [pCVD442+degP::Cm]) with RMA2041 (S. flexneri ∆icsA) as described in Section 2.8.1 and named MYRM522.

A degP::Cm mutant was confirmed by Western immunoblotting using anti-MBP-DegP antibody and temperature sensitivity phenotype. As shown in the manuscript supplementary data (Section 3.2.7, Fig. S3.2C), MYRM522 did not produce DegP protein. In addition, MYRM522 was sensitive to high temperature (42 °C) as very small colonies were grown on LB agar, while the strain grew normally at 30 °C. These data confirmed that MYRM522 is an degP::Cm mutant.

3.9 IcsA expression in an S. flexneri degP::Cm ∆icsA mutant

To investigate the effect of DegP protease on IcsAi mutants in the S-LPS background,

MYRM522 (S. flexneri degP::Cm ∆icsA) was complemented with pIcsAWT, pIcsAi677 or pIcsAi716, giving strains MYRM675, MYRM524 and MYRM525, respectively. IcsA production was examined by Western immunoblotting (Section 2.9.6) and IF microscopy (Section 2.9.10) with anti-IcsA antibody. The Western blot analysis data with whole cell lysates showed that the production of IcsAWT remained unaffected, while IcsAi677 and

IcsAi716 was restored in the S-LPS S. flexneri degP::Cm background but to a different degrees in production level (Fig. 3.19), indicating DegP protease activity is affecting IcsAi production in the S-LPS background. In contrast, surface IcsAWT expression in the S. flexneri degP::Cm ∆icsA strain was significantly reduced (Fig. 3.20B), as previously reported (Purdy et al., 2002; Purdy et al., 2007). Purdy et al. claimed that the surface IcsA 157

Figure 3.19 Detection of IcsAWT and IcsAi production in S. flexneri degP::Cm ΔicsA. Whole cell lysates were prepared from mid-exponential phase cultures of the indicated S. flexneri (S-LPS) strains grown at 30 °C or 37 °C, as described in Section 2.9.1. Samples were electrophoresed on an SDS-12%-PAGE gel prior to Western immunoblotting with anti-IcsA antibody (Section 2.9.4 and Section 2.9.6). The 120 kDa band corresponds to the full length IcsA; the 85 kDa band corresponds to the cleaved form (IcsA’). Samples in each lane represent 5x107 bacteria. The samples in each lane are as follows:

Lane 1: RMA2090 ΔicsA [IcsAWT] grown at 30 °C

Lane 2: RMA2090 ΔicsA [IcsAWT] grown at 37 °C

Lnae 3: MYRM675 degP::Cm ΔicsA [IcsAWT] grown at 30 °C

Lane 4: MYRM675 degP::Cm ΔicsA [IcsAWT] grown at 37 °C

Lane 5: MYRM524 degP::Cm ΔicsA [IcsAi677] grown at 30 °C

Lane 6: MYRM524 degP::Cm ΔicsA [IcsAi677] grown at 37 °C

Lane 7: MYRM525 degP::Cm ΔicsA [IcsAi716] grown at 30 °C

Lane 8: MYRM525 degP::Cm ΔicsA [IcsAi716] grown at 37 °C

Lane 9: MYRM526 degP::Cm ΔicsA [pBR322] grown at 30 °C

Lane 10: MYRM526 degP::Cm ΔicsA [pBR322] grown at 37 °C

158

159

Figure 3.20 Detection of surface IcsAi proteins expression by S. flexneri degP::Cm ∆icsA. Mid-exponential phase (grown at 30 °C) S. flexneri degP::Cm ΔicsA (S-LPS) strains expressing either IcsAWT, IcsAi677 or IcsAi716, were formalin fixed and labelled with rabbit polyclonal anti-IcsA antibody and Alexa 488-conjugated goat anti-rabbit secondary antibody, as described in Section 2.9.10. Inserts show enlarged views for greater clarity. White arrow indicates the bacterium shown in insert. IF images were observed at 100x magnification. Scale bar = 10 μm. The images are as follows:

A. RMA2090 ΔicsA [IcsAWT]

B. MYRM675 degP::Cm ΔicsA [IcsAWT]

C. MYRM524 degP::Cm ΔicsA [IcsAi677]

D. MYRM525 degP::Cm ΔicsA [IcsAi716]

160

161

expression in an S. flexneri degP mutant was reduced by ~ 40%, as detected in IF and HRP immunodetection assay (Purdy et al., 2007). Surface IcsAi677 and IcsAi716 expression on S. flexneri degP::Cm ∆icsA was not detectable (MYRM524 and MYRM525) (Fig. 3.20C and

D). Furthermore, MYRM675 (S. flexneri degP::Cm ∆icsA expressing IcsAWT) was unable to form plaques (data not shown), consistent with the previously reported 2457T degP mutant phenotype (Purdy et al., 2007). Thus, it was not possible to assess the function of the IcsAi protein by examining the intercellular spreading ability of MYRM524 (S. flexneri degP::Cm ∆icsA expressing IcsAi677) and MYRM525 (S. flexneri degP::Cm ∆icsA expressing IcsAi716).

3.10 DSP chemical cross-linking

The translocation domain of Neisseria meningitidis IgA1 protease, which is an AT has been suggested to form an OM oligomer (Veiga et al., 2002), while our laboratory has recently shown that the S. flexneri IcsA protein is able to self-associate and form a complex in the OM (May et al., 2012). The 5 aa linker insertion could cause a general disruption to local protein folding. Hence, DSP chemical cross linking was performed on selected IcsAi mutants to examine the proper folding of IcsAi proteins, as a protein with conformation varied from the WT protein may be unable to oligomerise.

An S. flexneri icsA rmlD strain complemented to express IcsAWT, IcsAi643, IcsAi677, or IcsAi716 was included in the DSP cross-linking assay as described in Section 2.12.

Cross-linking of strains expressing IcsAWT or various IcsAi produced high molecular weight proteins (IcsA*, >460 kDa) (Fig. 3.21, lanes 1, 3, 5 and 7) and cleavage of the cross-linker by β-ME abolished the high molecular weight products (Fig. 3.21, lanes 2, 4, 6 and 8). The very large IcsA complexes (IcsA**) indicate the accumulation of cross-linked proteins. The successful cross-linking of IcsAi mutants implies that IcsAi643, IcsAi677, and

IcsAi716 have either the WT conformation or do not have major changes in protein conformation, which is consistent with the results obtained from the trypsin accessibility assay, and ability to recruit N-WASP (except for IcsAi716) (Section 3.2.4.9 and Section 3.2.4.8).

162

Figure 3.21 DSP chemical cross-linking of IcsAi mutants.

Mid-exponential phase cultures of the indicated R-LPS S. flexneri strains were treated with 0.2 mM DSP. Outer membrane proteins were solubilised from isolated whole membranes and resuspended in sample buffer with or without β-mercaptoethanol (β-ME) and heated to 60°C, as described in Section 2.12. Cross-linked samples were separated on an SDS-7.5%- PAGE and subjected to Western immunoblotting with anti-IcsA antibody (Section 2.9.4 and Section 2.9.6). Sizes were estimated from the electrophoretic mobility of HighMark (Invitrogen) protein standard. IcsA* indicates HWM complexes containing IcsA. IcsA** indicates insoluble material accumulating at bottom of stacking gel. The samples in each lane are as follows:

Lane 1: RMA2107 [IcsAWT], β-ME –

Lane 2: RMA2107 [IcsAWT], β-ME +

Lane 3: MYRM276 [IcsAi677], β-ME –

Lane 4: MYRM276 [IcsAi677], β-ME +

Lane 5: MYRM275 [IcsAi643], β-ME –

Lane 6: MYRM275 [IcsAi643], β-ME +

Lane 7: MYRM277 [IcsAi716], β-ME –

Lane 8: MYRM277 [IcsAi716], β-ME +

163

Summary

In this chapter, the previously identified IcsAi mutants (IcsAi633, IcsAi643, IcsAi677 and

IcsAi716) with 5 aa linker insertion within the AC region, were expressed in an S. flexneri

ΔicsA ΔrmlD R-LPS strain and it was found that the IcsAi production was significantly restored. rmlD complementation which restored the S-LPS production reverted the expression of IcsAi to very low, further supporting that the presence of Oag affects IcsAi production. The LPS depletion-regeneration assay provided independent results to support the observation that Oag affects AC IcsAi production. In addition, the effect of Oag on - IcsAi production was not limited to S. flexneri as ompT E. coli K-12 UT5600 produced the same phenotype in both S-LPS and R-LPS backgrounds. Mechanisms that affect IcsAi production in the S-LPS background were investigated.

IcsP, the OM protease which specifically cleaves IcsA and releases the IcsA functional domain into the culture supernatant was shown to be not responsible for the very low IcsAi expression in the S-LPS background.

In addition, the icsA promoter activity in both S-LPS and R-LPS backgrounds was not downregulated or upregulated, in the absence or presence of IcsAWT/IcsAi716. This suggests that the extremely low IcsAi production in the S-LSP background was due to a post- transcriptional effect.

DegP proteolysis activity was shown to be affecting IcsAi production in the S-LPS background as the IcsAi677 and IcsAi716 production was restored in an S. flexneri degP::Cm ΔicsA mutant.

Furthermore, IcsAi633, IcsAi643, IcsAi677 mutants were functional and able to recruit N-

WASP and form F-actin comet tails in the R-LPS background, except for IcsAi716. Limited proteolysis assay and DSP chemical cross-linking both suggested that none of the IcsAi mutants had major changes in protein conformation and hence, the inability of recruiting

N-WASP by IcsAi716 suggests that aa 716-717 are an N-WASP binding/interaction site.

164

Chapter Four

Identification of Shigella flexneri IcsA residues affecting interaction with N-WASP

Chapter 4: Identification of Shigella flexneri IcsA residues affecting interaction with N-WASP, and evidence for IcsA-IcsA co-operative interaction

4.1 Introduction

The polarly distributed IcsA protein is responsible in interacting with the host actin regulatory protein, N-WASP which in turn activates the Arp2/3 complex, and initiates de novo actin polymerisation (Egile et al., 1999; Goldberg, 2001; Suzuki et al., 1998). The IcsA fragment (aa 103-433) which contains the GRRs (aa 117-307) was shown to be sufficient for N-WASP binding in vitro (Suzuki et al., 1998; Suzuki et al., 2002). However, it was later reported that a larger region of IcsA (aa 53-508) is required to induce actin polymerisation (Suzuki et al., 1996; Suzuki & Sasakawa, 2001). A recent study performed by May and Morona (2008) reported that the IcsA N-WASP interacting region (IR) can be divided into three regions: N-WASP IR I (aa 185-312) that contains the GRRs; N-WASP IR II (aa 330-382) that overlaps with the S. flexneri IcsB and host autophagic protein, Atg5 binding region (aa 320-433); and N-WASP IR III (aa 508-730) that contains the AC region (aa 634-735). The AC is important for IcsA biogenesis (Chapter 3).

The identification of N-WASP IR II and III was revealed by linker insertion mutagenesis (May & Morona, 2008). However, the insertion of 5 amino acids may induce local protein conformational change, complicating the identification of important residues involved in N-WASP interaction/binding. Therefore, site-directed mutagenesis was undertaken to mutate specific residue of IcsA within N-WASP IR II and III, and the mutants were characterised. The data is presented in this chapter.

165

4.2 Text of manuscript

Identification of Shigella flexneri IcsA residues affecting interaction with N-WASP, and evidence for IcsA-IcsA co-operative interaction

Min Yan Teh and Renato Morona

Discipline of Microbiology and Immunology, School of Molecular and Biomedical Science, University of Adelaide, South Australia, Australia 5005.

Published – PloS One 8(2): e55152. doi:10.1371/journal.pone.0055152

166

STATEMENT OF AUTHORSHIP

Title of Paper Identification of Shigella flexneri IcsA residues affecting interaction with N-WASP, and evidence for IcsA-IcsA co- operative interaction. Publication Status

Publication Details Teh, M.Y. and Morona, R. (2012). Identification of Shigella flexneri IcsA residues affecting interaction with N-WASP, and evidence for IcsA-IcsA co-operative interaction. Plos One (Accepted for publication)

Name of Principal Min Yan Teh Author (Candidate) Contribution to the Paper Performed all the experiments, analysed and interpreted data, wrote the manuscript and acted as corresponding author

Signature Date

Name of Co-Author Renato Morona Contribution to the Paper Supervised development of work, helped in data interpretation and manuscript evaluation.

Signature Date

167

4.2.1 Abstract The Shigella flexneri IcsA (VirG) protein is a polarly distributed outer membrane protein that is a fundamental virulence factor which interacts with neural Wiskott-Aldrich syndrome protein (N-WASP). The activated N-WASP then activates the Arp2/3 complex which initiates de novo actin nucleation and polymerisation to form F-actin comet tails and allows bacterial cell-to-cell spreading. In a previous study, IcsA was found to have three N-WASP interacting regions (IRs): IR I (aa 185-312), IR II (aa 330-382) and IR III (aa 508-730). The aim of this study was to more clearly define N-WASP interacting regions II and III by site-directed mutagenesis of specific amino acids. Mutant IcsA proteins were expressed in both smooth lipopolysaccharide (S-LPS) and rough LPS (R-LPS) S. flexneri strains and characterised for IcsA production level, N-WASP recruitment and F-actin comet tail formation. We have successfully identified new amino acids involved in N- WASP recruitment within different N-WASP interacting regions, and report for the first time using co-expression of mutant IcsA proteins, that N-WASP activation involves interactions with different regions on different IcsA molecules as shown by Arp3 recruitment. In addition, our findings suggest that the autochaperone (AC) mutant protein production was not rescued by another AC region provided in trans, differing to that reported for two other autotransporters, PrtS and BrkA autotransporters.

168

4.2.2 Introduction Shigella flexneri is a human pathogen that causes bacillary dysentery by infecting and colonising the colonic epithelium (Philpott et al., 2000a). IcsA (VirG), one of the key virulence factors of S. flexneri, is polarly distributed at the outer membrane (OM). IcsA is required for inter- and intracellular spreading of S. flexneri within the host intestinal epithelium (Bernardini et al., 1989; Lett et al., 1989; Makino et al., 1986; Sansonetti et al., 1991; Suzuki & Sasakawa, 2001). Inside the host cytoplasm, Shigella multiplies and interacts with the host actin regulatory protein neural Wiskott-Aldrich syndrome protein (N-WASP), which in turn activates the Arp2/3 complex that initiates actin polymerisation by recruiting the globular actin monomers to form the filamentous actin (F-actin) comet tails (Cossart, 2000; Goldberg, 2001; Pantaloni et al., 2001). The formation of F-actin comet tails allows bacterial actin-based motility (ABM) (Bernardini et al., 1989; Cossart, 2000; Goldberg, 2001).

IcsA is a member of the autotransporter (AT) family (Type Va secretion system), the largest family of secreted proteins in Gram-negative bacteria (Henderson et al., 2004; Pallen et al., 2003). Like other family members, IcsA consists of three major domains: an extended N-terminal signal sequence (amino acids [aa] 1-52), a functional passenger - domain (aa 53-758), and a C-terminal translocation β-domain (aa 759-1102) that mediates the translocation of the passenger domain across the OM via the BAM (beta-barrel assembly machine) complex (Brandon et al., 2003; Henderson et al., 2004; Jain & Goldberg, 2007; Peterson et al., 2010; Suzuki et al., 1995). The β-barrel domain is anchored in the OM, while the functional IcsA passenger domain is exposed on the bacterial surface and is responsible for N-WASP recruitment and ABM (Goldberg, 2001; Suzuki & Sasakawa, 2001).

In spite of the diversity in sequence, function and length, the passenger domains of most ATs possess a β-helical structure (Wells et al., 2010). IcsA was recently classified to a subgroup of self associating ATs (SAATs) that mediate bacterial aggregation and biofilm 169

formation (Klemm et al., 2006; Meng et al., 2011). The ability of IcsA to self-associate has recently been shown via reciprocal co-precipitation of differentially epitope-tagged IcsA proteins (May et al., 2012). A putative autochaperone (AC) region at the C-terminal of IcsA passenger domain (aa 634-735), which forms part of the SAAT domain, is required for IcsA biogenesis (May & Morona, 2008; Meng et al., 2011). To date, only the crystal structure of the IcsA AC region (aa 591-758) is available, and it possesses two coils of a right-handed parallel β-helix (Kuhnel & Diezmann, 2011).

N-WASP is a key regulator of the actin cytoskeleton and functions as a link between signalling pathways and de novo actin polymerisation, leading to host cell motility and morphological changes (Goldberg, 2001; Miki & Takenawa, 2003; Snapper et al., 2001;

Suzuki et al., 1998; Yarar et al., 1999). IcsA103-433 which contains glycine-rich repeats (GRRs; aa 117-307) is sufficient for N-WASP binding in vitro (Suzuki et al., 1998; Suzuki et al., 2002), and in vitro assays showed that IcsA53-508 is adequate to induce actin polymerisation (Goldberg, 2001). Five amino acids (5 aa) linker-insertion mutations (IcsAi) (May & Morona, 2008) confirmed the involvement of aa 185-312 (N-WASP interacting region [IR] I), and a second region (aa 330-382 [N-WASP IR II]) in N-WASP recruitment. N-WASP IR II overlapped with the S. flexneri IcsB and host autophagy protein, Atg5, binding region (aa 320-433) (Ogawa et al., 2005). In addition, a new IcsA region (aa 508- 730 [N-WASP IR III]) that contains the IcsA AC region was also suggested to be important for N-WASP recruitment and F-actin comet tail formation (May & Morona, 2008). However, specific N-WASP binding/interaction site or residues within IcsA have not yet been reported.

From the 5 aa linker-insertion mutagenesis study, IcsAi mutants (IcsAi633, IcsAi643,

IcsAi677, and IcsAi716) with mutational alterations within the AC region have markedly reduced protein production in an S. flexneri strain with native LPS O-antigen (LPS Oag) (smooth LPS, S-LPS) and hence, were unable to form plaques, recruit N-WASP or form F- actin comet tail (May & Morona, 2008). When the same IcsAi mutants were expressed in an S. flexneri strain without LPS Oag (rough LPS, R-LPS), IcsAi mutant production was 170

restored to a level comparable to wild-type (WT) IcsA (Teh et al., 2012) (reported in

Chapter 3). With the restoration of IcsAi production in an S. flexneri R-LPS strain, we have identified that IcsAi633, IcsAi643, IcsAi677, but not IcsAi716, were able to recruit N- WASP and form F-actin comet tails (Teh et al., 2012) (reported in Chapter 3).

In this study, we investigated the ability of IcsA mutants with point mutations within N-WASP IR II and III to recruit N-WASP and form F-actin comet tails in both S-LPS and R-LPS S. flexneri backgrounds. Using this approach, we have identified specific residues affecting N-WASP binding/interaction. In addition, we have also co-expressed IcsA mutant proteins with mutations at two N-WASP interaction regions, and showed for the first time that all three N-WASP interacting regions are essential for N-WASP and Arp3 recruitment, supporting a role for oligomeric IcsA in this interaction.

171

4.2.3 Materials and Methods:

4.2.3.1 Ethics Statement The anti-IcsA antiserum was produced under the National Health and Medical Research Council (NHMRC) Australian Code of Practice for the Care and Use of Animals for Scientific Purposes and was approved by the University of Adelaide Animal Ethics Committee.

4.2.3.2 Bacterial strains and plasmids Strains and plasmids used in this study are listed in Table 4.1.

4.2.3.3 Growth media and growth conditions All strains used in this study were routinely grown in Luria Bertani (LB) medium. S. flexneri strains were grown from a Congo Red positive colony as previously described (Morona et al., 2003). Bacterial cultures were cultured for 18 h, diluted 1:20 and grown to mid-exponential phase (2 h) with aeration at 37°C. Where appropriate, antibiotics were used at the following concentrations: ampicillin (Ap, 100 μg mL-1), chloramphenicol (Cm, 25 μg mL-1), kanamycin (Km, 50 μg mL-1), or tetracycline (Tet, 10 μg mL-1).

4.2.3.4 DNA methods

E. coli K-12 DH5 was used for all cloning. DNA manipulation, PCR, transformation and electroporation into S. flexneri were performed as previously described (Baker et al., 1999; Morona et al., 1995).

4.2.3.5 Antibodies and antisera Affinity purified rabbit polyclonal antibody to IcsA was produced as previously described (Van Den Bosch et al., 1997). The antiserum was produced under the National Health and

172

Table 4.1 Bacterial strains and plasmids Reference Strain or plasmid Relevant characteristics a or source E. coli K-12 DH5 Cloning host Gibco-BRL XL-10 Gold TcR Δ(mcrA)183 Δ(mcrCB-hsdSMR-mrr)173 endA1 supE44 thi-1 Stratagene recA1 gyrA96 relA1 lac Hte [F´ proAB lacIqZΔM15 Tn10 (TcR) Amy CmR S. flexneri 2457T S. flexneri 2a wild type Laboratory collection RMA2041 2457T ∆icsA::TcR (Van Den Bosch & Morona, 2003) RMA2043 RMA2041 ∆rmlD::KmR (Van Den Bosch & Morona, 2003) MYRM329 RMA2041 [pMYRM315] This study MYRM331 RMA2041 [pMYRM317] This study MYRM332 RMA2041 [pMYRM318] This study MYRM333 RMA2041 [pMYRM319] This study MYRM336 RMA2041 [pMYRM322] This study MYRM338 RMA2041 [pMYRM324] This study MYRM346 RMA2041 [pMYRM340] This study MYRM352 RMA2041 [pMG55] This study MYRM353 RMA2043 [pMG55] This study MYRM354 RMA2043 [pMYRM315] This study MYRM355 RMA2043 [pMYRM317] This study MYRM356 RMA2043 [pMYRM318] This study MYRM357 RMA2043 [pMYRM319] This study MYRM359 RMA2043 [pMYRM322] This study MYRM360 RMA2043 [pMYRM324] This study MYRM362 RMA2043 [pMYRM340] This study MYRM562 RMA2041 [pMYRM536] This study MYRM563 RMA2041 [pMYRM537] This study MYRM564 RMA2041 [pMYRM538] This study MYRM565 RMA2041 [pMYRM539] This study MYRM567 RMA2041 [pMYRM543] This study MYRM575 RMA2041 [pMYRM556] This study MYRM568 RMA2041 [pMYRM544] This study MYRM569 RMA2041 [pMYRM545] This study MYRM570 RMA2041 [pMYRM546] This study MYRM571 RMA2041 [pMYRM547] This study MYRM572 RMA2041 [pMYRM548] This study MYRM577 RMA2041 [pMYRM549] This study MYRM596 RMA2041 [pMYRM588] This study MYRM598 RMA2041 [pMYRM590] This study MYRM600 RMA2041 [pMYRM592] This study MYRM602 RMA2041 [pMYRM595] This study MYRM604 RMA2043 [pMYRM592] This study MYRM606 RMA2043 [pMYRM595] This study 173

MYRM610 RMA2041 [pMYRM608] This study MYRM612 RMA2043 [pMYRM608] This study MYRM646 RMA2041 [pSU23-IcsA] This study MYRM647 RMA2041 [pSU23-IcsA::BIO] This study MYRM648 RMA2041 [pSU23-IcsAi248] This study MYRM649 RMA2041 [pSU23-IcsA::BIO Y716G D717G] This study MYRM650 RMA2043 [pSU23-IcsA] This study MYRM651 RMA2043 [pSU23-IcsA::BIO] This study MYRM652 RMA2043 [pSU23-IcsAi248] This study MYRM653 RMA2043 [pSU23-IcsA::BIO Y716G D717G] This study MYRM685 RMA2041 [pSU23] This study MYRM655 RMA2043 [pSU23] This study MYRM656 RMA2041 [pSU23-IcsAi248] + [pIcsA::BIO Y716G D717G] This study MYRM657 RMA2041 [pSU23-IcsAi248] + [pIcsA::BIO V382R] This study MYRM658 RMA2041 [pSU23-IcsA::BIO Y716G D717G] + [pIcsAi248] This study MYRM659 RMA2041 [pSU23-IcsA::BIO Y716G D717G] + [pIcsA::BIO This study V382R] MYRM660 RMA2041 [pSU23-IcsA] + [pBR322] This study MYRM661 RMA2041 [pSU23-IcsA::BIO] + [pBR322] This study MYRM662 RMA2041 [pSU23-IcsAi248] + [pBR322] This study MYRM663 RMA2041 [pSU23-IcsA::BIO Y716G D717G] + [pBR322] This study MYRM669 RMA2041 [pSU23-IcsA] + [pIcsAi248] This study MYRM670 RMA2041 [pSU23-IcsA] + [pIcsA::BIO Y716G D717G] This study MYRM671 RMA2041 [pSU23-IcsA] + [pIcsA::BIO V382R] This study MYRM672 RMA2041 [pSU23-IcsA::BIO] + [pIcsAi248] This study MYRM673 RMA2041 [pSU23-IcsA::BIO] + [pIcsA::BIO Y716G D717G] This study MYRM674 RMA2041 [pSU23-IcsA::BIO] +[pIcsA::BIO V382R] This study MYRM686 RMA2041 [pSU23] + [pIcsA] This study MYRM687 RMA2041 [pSU23] + [pIcsA::BIO] This study MYRM688 RMA2041 [pSU23] + [pIcsAi248] This study MYRM689 RMA2041 [pSU23] + [pIcsA::BIO Y716G D717G] This study MYRM690 RMA2041 [pSU23] +[pIcsA::BIO V382R] This study MYRM691 RMA2043 [pSU23-IcsA::BIO] + [pIcsAi248] This study MYRM692 RMA2043 [pSU23-IcsA::BIO] + [pIcsA::BIO Y716G D717G] This study MYRM693 RMA2043 [pSU23-IcsA::BIO] +[pIcsA::BIO V382R] This study MYRM694 RMA2043 [pSU23-IcsAi248] + [pIcsA::BIO Y716G D717G] This study MYRM695 RMA2043 [pSU23-IcsAi248] + [pIcsA::BIO V382R] This study MYRM696 RMA2043 [pSU23-IcsA::BIO Y716G D717G] + [pIcsAi248] This study MYRM697 RMA2043 [pSU23-IcsA::BIO Y716G D717G] + [pIcsA::BIO This study V382R] MYRM699 RMA2043 [pBR322] + [pSU23-IcsA] This study MYRM700 RMA2043 [pBR322] + [pSU23-IcsA::BIO] This study MYRM701 RMA2043 [pBR322] + [pSU23-IcsAi248] This study MYRM702 RMA2043 [pBR322] + [pSU23-IcsA::BIO Y716G D717G] This study MYRM703 RMA2043 [pSU23] + [pIcsA] This study MYRM704 RMA2043 [pSU23] + [pIcsA::BIO] This study MYRM705 RMA2043 [pSU23] + [pIcsAi248] This study MYRM706 RMA2043 [pSU23] + [pIcsA::BIO Y716G D717G] This study MYRM707 RMA2043 [pSU23] +[pIcsA::BIO V382R] This study MYRM708 RMA2043 [pSU23-IcsA] + [pIcsAi248] This study MYRM709 RMA2043 [pSU23-IcsA] + [pIcsA::BIO Y716G D717G] This study MYRM710 RMA2043 [pSU23-IcsA] +[pIcsA::BIO V382R] This study Plasmids pBR322 medium copy no.; ColE1 ori ; ApR, TcR (Bolivar et 174

al., 1977) pSU23 medium copy no.; P15A ori; CmR (Bartolome et al., 1991) pMG55 pBR322 encoding IcsA::BIO; ApR (May et al., 2012) pIcsA pBR322 encoding IcsA; ApR (Van Den Bosch & Morona, 2003) R pIcsAi248 pIcsA with 5 amino acids insertion at aa248; Ap (May & Morona, 2008) pSU23-IcsA pSU23 encoding IcsA; CmR This study pSU23-IcsA::BIO pSU23 encoding IcsA::BIO; CmR This study R pSU23-IcsAi248 pSU23 encoding IcsAi248; Cm This study pSU23-IcsA::BIO pSU23 encoding IcsA::BIO Y716G D717G; CmR This study Y716G D717G pMYRM315 pMG55 Y716L D717S; ApR This study pMYRM317 pMG55 Y716S D717K; ApR This study pMYRM318 pMG55 Y716C D717C; ApR This study pMYRM319 pMG55 Y716V D717H; ApR This study pMYRM322 pMG55 Y716G D717G; ApR This study pMYRM324 pMG55 Y716E D717I; ApR This study pMYRM340 pMG55 Y716K D717S; ApR This study pMYRM536 pMG55 T330S G331G; ApR This study pMYRM537 pMG55 T330G G331R; ApR This study pMYRM538 pMG55 T330E G331K; ApR This study pMYRM539 pMG55 T330P G331G; ApR This study pMYRM543 pMG55 T330G G331P; ApR This study pMYRM556 pMG55 T330K G331N; ApR This study pMYRM544 pMG55 T381Q V382R; ApR This study pMYRM545 pMG55 T381R V382K; ApR This study pMYRM546 pMG55 T381A V382Q; ApR This study pMYRM547 pMG55 T381M V382L; ApR This study pMYRM548 pMG55 T381K V382M; ApR This study pMYRM549 pMG55 T381P V382R; ApR This study pMYRM588 pMG55 G331W; ApR This study pMYRM590 pMG55 V382R; ApR This study pMYRM592 pMG55 Y716F; ApR This study pMYRM595 pMG55 Y716G; ApR This study pMYRM608 pMG55 D717G; ApR This study a TcR, Tetracycline resistant; KmR, Kanamycin resistant; ApR, Ampicillin resistant; CmR, Chloramphenicol resistant.

175

Medical Research Council (NHMRC) Australian Code of Practice for the Care and Use of Animals for Scientific Purposes and was approved by the University of Adelaide Animal Ethics Committee. The anti-IcsA antibody was used at 1:100 in immunofluorescence (IF) assay or 1:1000 in Western immunoblotting (WB). The rabbit polyclonal anti-N-WASP (May & Morona, 2008) and monoclonal anti-Arp3 (BD Biosciences) antibodies were both used at 1:100 in IF.

4.2.3.6 Preparation of whole cell lysate The equivalent of 5x108 bacteria were centrifuged (2,200 xg, 1 min) and resuspended in 100 μl of 1x sample buffer (Lugtenberg et al., 1975). Samples were heated to 100°C for 5 min prior to electrophoresis.

4.2.3.7 Western transfer and detection Western immunoblotting was performed as described previously (May & Morona, 2008) with some modifications. Briefly, proteins were separated on sodium dodecyl sulfate-7.5% or 12%-polyacrylamide gel electrophoresis (SDS-PAGE) gels and transferred to a nitrocellulose membrane. The membrane was blocked with 5% (w/v) skim milk in TTBS (Tris-buffered saline, 0.005% (v/v) Tween-20) for 20 min and incubated with anti-IcsA antibody in TTBS containing 2.5% (w/v) skim milk for 18 h. After three washes in TTBS, the membrane was incubated with horseradish peroxidise-conjugated goat anti-rabbit secondary antibody (Biomediq DPC) for 2 h, followed by three washes in TTBS, then three times in TBS. The membrane was incubated with CPS3 chemiluminescence substrate (Sigma) for 5 min, followed by exposure of the membrane to either X-ray film (Agfa) or imaged with a Kodak Image Station 4000MM Pro (Carestream Molecular Imaging), to visualise the reactive bands. The film was developed using a Curix 60 automatic X-ray film processor (Agfa).

176

4.2.3.8 Site-directed mutagenesis Single and multi site-directed mutagenesis were performed according to the QuikChange® Lightning Site-directed or QuikChange® Lightning Multi Site-directed protocol (Stratagene), respectively. Specific primers with the desired substitutions were designed for single site-directed mutagenesis (Table S4.1) and degenerate primers were designed for multi site-directed mutagenesis (Table S4.1). pMG55 (pIcsA::BIO) was used as the DNA template for the construction of the mutants. IcsA::BIO protein possesses a BIO epitope (GLNDIFEAQKIEWH; a substrate for metabolic biotinylation by the BirA biotin-protein ligase (Cull & Schatz, 2000)) introduced at aa 87 which does not affect the IcsA production levels, polar localisation and function (May et al., 2012). Briefly, the resultant PCR products were treated with DpnI and transformed into XL 10-Gold ultracompetent cells (Stratagene). Mutations were confirmed by DNA sequencing.

4.2.3.9 Construction of pSU23-IcsA plasmids pSU23-IcsAWT, pSU23-IcsA::BIO, pSU23-IcsAi248 and pSU23-IcsA::BIO Y716G D717G were constructed by sub-cloning the PstI-SalI fragment of pIcsAWT, pIcsA::BIO, pIcsAi248 and pIcsA::BIO Y716G D717G (pMYRM322), encoding different IcsA proteins, respectively, into likewise digested pSU23.

4.2.3.10 Plaque assays Plaque assays were performed as described previously (May & Morona, 2008) using the method of Oaks et al. (Oaks et al., 1985). Briefly, HeLa cells (Human, cervical, epithelial cells ATCC #CCL-70) were grown to confluence overnight in minimal essential medium (MEM)-10% (v/v) foetal calf serum (FCS), washed twice with Dulbecco’s PBS (D-PBS) and once in Dulbecco’s modified Eagle medium (DMEM) prior to infection. 1x108 bacteria mL-1 mid-exponential phase bacteria were diluted to 1:1000 in DMEM, and 0.25 mL was added to each well. Trays were incubated in a CO2 (5%) incubator, and the trays were gently rocked every 15 min. At 120 min post-infection, the inoculum was carefully aspirated and 3 mL of the first overlay (DMEM, 5% (v/v) FCS, 20 μg mL-1 gentamycin, 177

0.5% (w/v) agarose [Seakem ME]) was added to each well. The second overlay (DMEM, 5% (v/v) FCS, 20 μg mL-1 gentamycin, 0.5% (w/v) agarose, 0.1% (w/v) Neutral Red solution [Gibco BRL]) was added at either 24 or 48 h post-infection and plaque formation observed 6-8 h later.

4.2.3.11 Indirect immunofluorescence of whole bacteria Indirect IF labelling of bacteria was performed as described previously (May & Morona, 2008). Briefly, mid-exponential phase bacteria were fixed in formalin (3.7% (v/v) paraformaldehyde in 0.85% (w/v) saline) and centrifuged onto poly-L-lysine-coated coverslips. Bacteria were incubated with anti-IcsA antibody, washed with PBS and labelled with Alexa 488-conjugated donkey anti-rabbit secondary antibody (Molecular Probes) (1:100). Microscopy was performed as previously described (May & Morona, 2008), using an Olympus IX-70 microscope with phase-contrast optics using a 100x oil immersion objective. Fluorescence and phase-contrast images were false colour merged using the Metamorph software program (Version 7.7.3.0, Molecular Devices).

4.2.3.12 Infection of tissue culture monolayers with S. flexneri and IF labelling Infection of HeLa cell monolayers and IF staining were performed as described previously (May & Morona, 2008). HeLa monolayers were inoculated with mid-exponential phase bacteria and incubated for 1 h at 37°C, CO2 (5%). The infected monolayers were washed three times with D-PBS and incubated with MEM containing gentamycin for a further 1.5 h. Infected cells were then washed and fixed for 15 min in 3.7% (v/v) formalin, incubated with 50 mM NH4Cl in D-PBS for 10 min, and permeabilised with 0.1% (v/v) Triton X-100 for 5 min. The infected cells were blocked with 10% (v/v) FCS in PBS and incubated with the desired primary antibody at 37°C for 30 min. After washing in PBS, coverslips were incubated with Alexa Fluor 594-conjugated donkey anti-rabbit, Alexa Fluor 488- conjugated donkey anti-rabbit or Alexa Fluor 594-conjugated donkey anti-mouse secondary antibodies (Molecular Probes) (1:100), where appropriate. F-actin was visualised by staining with Alexa Fluor 488-conjugated phalloidin (2 U mL-1), and 4’,6’-

178

diamidino-2-phenylindole (DAPI) (10 μg mL-1) was used to counterstain bacteria and cellular nuclei.

179

4.2.4 Results:

4.2.4.1 N-WASP interacting region II May & Morona (May & Morona, 2008) previously identified a region in IcsA (aa 330-382) that was involved in N-WASP recruitment, based on linker-insertion mutagenesis. Protein production of IcsAi mutants with insertion mutations within this region was unaffected but the mutants were defective in ABM when expressed in S. flexneri icsA S-LPS (May & Morona, 2008). This region was classified as N-WASP IR II. Since the 5 aa linker insertion may disrupt local protein structure conformation (IcsAi330 and IcsAi381), it was of interest to determine if altering specific residues would reproduce the same phenotype, thus, enabling the identification of specific amino acids involved in N-WASP recruitment within this region. Multi site-directed mutagenesis was performed on pIcsA::BIO (pMG55) to randomly substitute both amino acids, 330-331 and 381-382, respectively, by using degenerate primers listed in Table S4.1. Mutants were isolated, DNA sequenced, and listed in Tables 4.2 and 4.3. IcsA::BIO T330*G331* and IcsA::BIO T381*V382* mutant production in S. flexneri icsA was assessed by Western immunoblotting with anti-IcsA antibody (data not shown). All of these IcsA mutant proteins were produced by S. flexneri at WT levels (Table 4.2 and 4.3).

The ability of S. flexneri icsA expressing IcsA::BIO T330*G331* or IcsA::BIO T381*V382* mutants to recruit N-WASP and form F-actin comet tail was investigated by IF microscopy using anti-N-WASP antibody and Alexa Fluor 488-phalloidin, respectively (data not shown). The results are summarised in Tables 4.2 and 4.3. T330 and G331 are both polar amino acids, and IcsA::BIO T330*G331* mutants that have at least one non- polar amino acid (proline) substitution at either position (e.g. encoded by pMYRM539 and pMYRM543) did not recruit N-WASP (Table 4.2). Notably, mutants encoded by pMYRM536 [IcsA::BIO T330S G331G] and pMYRM539 [IcsA::BIO T330P G331G] both possess single mutations at residue 330 (in bold) but only mutant T330S G331G (both polar amino acids) was capable of recruiting N-WASP. However, it cannot be ruled out that the proline substitution at position 330 or 331 is causing a localised conformation 180

Table 4.2 Summary of S. flexneri strains expressing IcsA::BIO T330*G331* and IcsA::BIO G331W

Codon Amino IcsA N-WASP Plaque Plasmid Polarity a F-actin tails d #330-331 acids production b recruitment c formation e pIcsA::BIO ACT GGT Thr Gly P, P +++ +++ +++ +++ pMYRM536 AGC GGG Ser Gly P, P +++ +++ +++ +++ pMYRM537 GGG AGG Gly Arg P, Basic +++ +/- +/- - pMYRM538 GAG AAG Glu Lys Acidic, Basic +++ ++ ++ ++ pMYRM539 CCG GGC Pro Gly NP, P +++ - - - pMYRM543 GGG CCG Gly Pro P, NP +++ - - - pMYRM556 AAG AAC Lys Asn Basic, P +++ ++ ++ ++ pMYRM588 (pIcsA::BIO ACT TGG Thr Trp P, NP +++ ++ ++ ++ G331W) a P, polar; NP, non-polar. b The “+++” symbol indicates relative band intensities of Western immunoblots of whole cell lysates. c, d “+++”, WT N-WASP recruitment/F-actin comet tail or capping formation; “++”, 20%-80% reduction in N-WASP recruitment/F-actin comet tail or capping formation; “+/-”, 90% reduction in N-WASP recruitment/F-actin comet tail or capping formation; “-”, N-WASP/F-actin tail not detected. e “+++”, WT plaques; “++”, small plaques; “-”, no plaques.

181

Table 4.3 Summary of S. flexneri strains expressing IcsA::BIO T381*V382* and IcsA::BIO V382R

Codon #381- Amino IcsA N-WASP Plaque Plasmid Polarity a F-actin tails d 382 acids production b recruitment c formation e pIcsA::BIO ACT GTT Thr Val P, NP +++ +++ +++ +++ pMYRM544 CAG CGG Gln Arg P, Basic +++ - - - pMYRM545 CGG AAG Arg Lys Basic, Basic +++ - - - pMYRM546 GCG CAG Ala Gln NP, P +++ - - - pMYRM547 ATG TTG Met Leu NP, NP +++ +++ +++ +++ pMYRM548 AAG ATG Lys Met Basic, NP +++ ++ ++ ++ pMYRM549 CCC CGC Pro Arg NP, Basic +++ - - - pMYRM590 ACT CGT Thr Arg P, Basic +++ - - - (pIcsA::BIO V382R) a P, polar; NP, non-polar. b The “+++” symbol indicates relative band intensities of Western immunoblots of whole cell lysates. c, d “+++”, WT N-WASP recruitment/F-actin comet tail formation; “++”, 20%-80% reduction in N-WASP recruitment/F-actin comet tail or capping formation; “-”, N- WASP/F-actin comet tail not detected. e “+++”, WT plaques; “++”, small plaques; “-”, no plaques.

182

change thereby affecting IcsA function. Furthermore, mutants with charged amino acids (encoded by pMYRM537, pMYRM538 and pMYRM556) recruited less N-WASP and formed less F-actin capping/tails (Table 4.2), suggesting that polar residues are required for efficient N-WASP recruitment.

In contrast, T381 and V382 are polar and non-polar amino acids, respectively. Based on the IF microscopy results (Table 4.3), IcsA::BIO T381*V382* mutants with residue 382 substituted with either charged or polar amino acids (e.g. encoded by pMYRM544, pMYRM545, pMYRM546 and pMYRM549) were unable to recruit N-WASP, whilst mutants that had V382 substituted with another non-polar amino acid (e.g. encoded by pMYRM547 and pMYRM548) recruited N-WASP, regardless of the amino acid polarity at residue 381. The data suggest that a non-polar amino acid is required at residue 382 in order for IcsA to be capable of recruiting N-WASP.

IcsA::BIO T330*G331* mutants that recruited N-WASP were selected to examine their ability to perform intercellular spreading by plaque assay (Fig. S4.1). As expected, T330*G331* that recruited N-WASP formed plaques but with different plaque sizes, depending on the amino acids substitution. Similar results were obtained for IcsA::BIO T381*V382* mutants wherein mutants that had non-polar amino acids substituted at residue 382, and also recruited N-WASP, formed plaques. In all cases, there was a consistent correlation between N-WASP recruitment, F-actin comet tail/capping formation and plaque formation. Taken together, the data suggest that both residues 330-331 of IcsA need to be polar while residue 382 needs to be non-polar in order for IcsA to be able to recruit N-WASP.

183

Figure 4.1 Expression of IcsA::BIO G331W and IcsA::BIO V382R and effect on N- WASP recruitment and intercellular spreading. A) Whole cell lysates from mid-exponential phase cultures of the indicated S. flexneri strains were subjected to Western immunoblotting with anti-IcsA antibody. S= S-LPS; R = R-LPS. IcsA- = IcsA deletion control. The 120 kDa band corresponds to the full length IcsA and the 85 kDa band corresponds to the cleaved form (IcsA’). B) HeLa cells were infected with mid-exponential phase S. flexneri ΔicsA expressing the IcsA mutants and formalin fixed. HeLa cells and bacteria nuclei were labelled with DAPI (blue), F-actin was labelled with Alexa Fluor 488-phalloidin (green), and N-WASP was labelled with anti-N- WASP antibody and Alexa Fluor 594-conjugated donkey anti-rabbit antibody (red) as detailed in Materials and Methods. IF images were observed at 100x magnification. Arrows indicate N-WASP recruitment and F-actin comet tail formation. Insert shows an enlargement of the indicated region. Strains were assessed in two independent experiments. Scale bar = 10 μm. C) Plaque assay by S. flexneri ΔicsA strains expressing IcsA::BIO, IcsA::BIO G331W or IcsA::BIO V382R. Confluent HeLa cell monolayers were infected with mid-exponential phase S. flexneri strains for 2 h, and plaques were observed 48 h post-infection as detailed in Materials and Methods. 30 plaques were measured from each experiment. Data are represented as mean ± SEM of three independent experiments. ***, P<0.001 (determined by Student’s unpaired one-tailed t test).

184

185

4.2.4.2 Effect of the G331W mutation on N-WASP recruitment and intercellular spreading We hypothesised that residues 330-331 require the polar-polar combination to recruit N- WASP. Thus, site-directed mutagenesis was performed on pIcsA::BIO using primer pairs listed in Table S1 to mutate G331 to tryptophan (W), which is a non-polar, aromatic amino acid. IcsA::BIO G331W (encoded by pMYRM588) was expressed in S. flexneri ΔicsA, and protein production was examined by Western immunoblotting (Fig. 4.1A, lane 2) and IF microscopy (Fig. S4.2). IcsA::BIO G331W was expressed on the bacterial surface and was produced at a WT comparable levels. As seen by IF microscopy, IcsA::BIO G331W mutant was capable of recruiting N-WASP and formed F-actin comet tails but seemed less frequent than the functionally equivalent IcsA::BIO (Fig. 4.1B(b)). Its ability to promote intercellular spreading was also tested by plaque assay. Plaques formed by IcsA::BIO G331W were half the size (***P<0.001) of those formed by S. flexneri expressing IcsA::BIO (Fig. 4.1C). Collectively, the data suggest that the G331W mutation affected intercellular spreading of S. flexneri, presumably by affecting N-WASP recruitment efficiency. In addition, the data also indicate that a polar-polar combination for residues 330-331 is not essential for N-WASP recruitment.

4.2.4.3 Effect of the V382R mutation on N-WASP recruitment and intercellular spreading We hypothesised that it is essential for IcsA residue 382 to be a non-polar amino acid for N-WASP recruitment. Site-directed mutagenesis was performed on pIcsA::BIO to mutate V382 to arginine (R) that is positively charged. IcsA::BIO V382R (encoded by pMYRM590) mutant production by S. flexneri ΔicsA was assessed by Western immunoblotting (Fig. 4.1A, lane 3) and IF microscopy (Fig. S4.2). IcsA::BIO V382R was expressed on the bacterial surface and produced at a WT comparable levels. Its ability to recruit N-WASP and form F-actin comet tails within HeLa cells was examined. IF microscopy showed that the V382R mutant was defective in N-WASP recruitment and F- actin comet tail formation (Fig. 4.1B(c)). Consequently, S. flexneri expressing the

186

IcsA::BIO V382R mutant was unable to form plaques (Fig. 4.1C). These data suggest that a non-polar amino acid (aa 382) is a prerequisite for N-WASP recruitment and residue 382 is likely to be an N-WASP binding/interaction site.

4.2.4.4 N-WASP interacting region III

We have previously characterised several IcsAi mutants which had 5 aa insertion mutations within the IcsA AC region for their ability to recruit N-WASP, and identified that IcsAi716 was defective in N-WASP recruitment (Teh et al., 2012) (results presented in Chapter

3). These IcsAi mutants had extremely low protein production in the S-LPS background but WT comparable expression levels in the R-LPS background (Teh et al., 2012) (results presented in Chapter 3). The IcsAi716 mutant has a 5 aa insertion mutation after residue

716 which affects the Aro-X-Aro (aromatic residue-any-aromatic residue) motif, Y716-

D717-Y718. This motif is commonly found in the β-domain of ATs and is thought to be a preferential binding site of SurA (Bitto & McKay, 2003; Xu et al., 2007). Hence, it was of interest to determine if altering residues 716 and 717 would reproduce the effect of the insertion mutation that may have an effect on local protein conformation, in terms of IcsA biogenesis and N-WASP recruitment ability. The recently identified IcsA AC crystal structure (Fig. S4.3) shows that the predicted locations for residues 716-717 appeared to be surface exposed, while residue 718 is predicted to be buried. Hence, multi site-directed mutagenesis was performed on pIcsA::BIO to substitute both Y716 and D717 with random amino acids at these positions. Seven pIcsA::BIO Y716*D717* mutants were isolated, DNA sequenced, and are listed in Table 4.4. The production of IcsA::BIO Y716*D717* mutants in both S. flexneri icsA S-LPS and S. flexneri icsA rmlD R-LPS strains was determined by Western immunoblotting. The IcsA::BIO Y716*D717* mutant production was markedly reduced in the S-LPS strain, regardless of the amino acids substitutions (Fig.

4.2A). As expected, similar to the IcsAi mutants (Teh et al., 2012) (results presented in Chapter 3), IcsA::BIO Y716*D717* mutant production in the R-LPS strain was restored to a level that was comparable to IcsA::BIO (Fig. 4.2A).

187

Table 4.4 Analysis of S. flexneri strains expressing IcsA::BIO Y716* and/or D717* in S-LPS and R-LPS backgrounds Codon Amino N-WASP Plaque Plasmid Polarity a IcsA production b F-actin tails d #716-717 acids recruitment c Formation e S-LPS R-LPS S-LPS R-LPS S-LPS R-LPS pIcsA::BIO TAT GAC Tyr Asp NP, Acidic +++ +++ +++ +++ +++ +++ +++ pMYRM315 TTG AGC Leu Ser NP, P + +++ - - - - - pMYRM317 AGC AAG Ser Lys P, Basic + +++ - - - - - pMYRM318 TGC TGC Cys Cys NP, NP + +++ - - - - - pMYRM319 GTG CAC Val His NP, Basic + +++ - - - - - pMYRM322 GGG GGC Gly Gly P, P + +++ - - - - - pMYRM324 GAG ATC Glu Ile Acidic, NP + +++ - - - - - pMYRM340 AAG ATC Lys Ser Basic, P + +++ - - - - - pMYRM592 TTT GAC Phe Asp NP, Acidic +++ +++ +++ +++ +++ +++ +++ (pIcsA::BIO Y716F) pMYRM595 GGT GAC Gly Asp P, Acidic ++ ++ ++ +++ ++ +++ ++ (pIcsA::BIO Y716G) pMYRM608 TAT GGC Tyr Gly NP, P + ++ - +/- - +/- - (pIcsA::BIO D717G) a P, polar; NP, non-polar. b The “+++”, “++” and “+” symbols indicate relative band intensities of Western immunoblots of whole cell lysates. c, d “+++”, WT N-WASP recruitment/F-actin comet tail or capping formation; “++”, 20%-80% reduction in N-WASP recruitment/F-actin comet tail or capping formation; “+/-”, 90% reduction in N-WASP recruitment/F-actin comet tail or capping formation; “-”, N-WASP/F-actin tail not detected. e “+++”, WT plaques; “++”, small plaques; “-”, no plaques.

188

Figure 4.2 Expression of IcsA::BIO with mutations at Y716 D717 by S-LPS and R- LPS S. flexneri. Whole cell lysates from mid-exponential phase S. flexneri ΔicsA (S-LPS) and S. flexneri ΔicsA ΔrmlD (R-LPS) expressing A) IcsA::BIO or various IcsA::BIO Y716* D717* mutants; B) IcsA::BIO, IcsA::BIO Y716F or IcsA::BIO Y716G; C) IcsA::BIO or IcsA::BIO D717G; were prepared and analysed by Western immunoblotting using anti- IcsA antibody. S. flexneri carrying an empty vector was used as a negative control (IcsA-). Strain names are shown above each lane. The 120 kDa band corresponds to the full length IcsA; the 85 kDa band corresponds to the cleaved form (IcsA’). S = S-LPS; R = R-LPS.

189

We then investigated the effect of individual residues (Y716 and D717) by performing site-directed mutagenesis on pIcsA::BIO to mutate Y716 to phenylalanine (F) or glycine (G), and D717 to glycine (G) using primer pairs shown in Table S4.1. Plasmid constructs pIcsA::BIO Y716F (pMYRM592), pIcsA::BIO Y716G (pMYRM595) and pIcsA::BIO D717G (pMYRM608) were transformed into both S. flexneri icsA S-LPS and S. flexneri icsA rmlD R-LPS strains and protein production was examined by Western immunoblotting (Fig. 4.2B) and IF microscopy (Fig. S4.4). The Y716F mutation did not affect IcsA production (Fig. 4.2B, lanes 2 and 6) but the Y716G mutation (Fig. 4.2B, lanes 3 and 7) resulted in reduced IcsA production, in both S-LPS and R-LPS backgrounds. Similar to other IcsA mutants with mutations within the AC region (Teh et al., 2012) (results presented in Chapter 3), the D717G mutation greatly reduced IcsA production in S. flexneri icsA S-LPS (Fig. 4.2C, lane 2) but the production was restored in S. flexneri icsA rmlD R-LPS, albeit slightly lower than IcsA::BIO (Fig. 4.2C, lane 5). Hence, whereas aa 717 is essential for IcsA biogenesis, the aromatic aa 716 is also important but less dependent on LPS structure.

4.2.4.5 Effect of Y716 and D717 mutagenesis on N-WASP recruitment and F- actin comet tail formation

We have previously shown that IcsAi716 was defective in N-WASP recruitment and proposed that residues 716-717 could be an N-WASP binding/interaction site (Teh et al., 2012) (results presented in Chapter 3). To clarify this hypothesis, the IcsA::BIO Y716*D717* mutants, IcsA::BIO Y716F, IcsA::BIO Y716G and IcsA::BIO D717G mutants were assessed for their ability to recruit N-WASP and form F-actin comet tail by IF microscopy (in both S-LPS and R-LPS backgrounds). The results are summarised in Table 4.4. For the IcsA::BIO Y716*D717* mutants, regardless of the amino acids substitutions, none of the mutants recruited N-WASP in HeLa cells (in both S-LPS and R- LPS backgrounds), despite the higher protein expression levels in the R-LPS background (Fig. 4.2A), which suggest that residues 716-717 are an N-WASP binding/interaction site.

190

Investigation of individual residues, Y716 and D717, on N-WASP recruitment showed that S. flexneri icsA S-LPS strain expressing IcsA::BIO Y716F recruited N-WASP and formed F-actin comet tails (Fig. 4.3A(c)), while the S. flexneri icsA S-LPS strain expressing IcsA::BIO Y716G recruited N-WASP (slightly less than IcsA::BIO) but had only F-actin capping formation and F-actin comet tails were not observed (Fig. 4.3A(e)). However, both Y716F and Y716G mutants expressed by the S. flexneri icsA rmlD R- LPS strains recruited N-WASP and formed F-actin comet tails (Fig. 4.3A(d,f)), suggesting that the aromatic property of residue 716 is not essential for N-WASP binding/interaction. As expected, S. flexneri icsA S-LPS expressing IcsA::BIO D717G did not recruit any N- WASP or form F-actin comet tail, likely due to the very low protein level (Fig. 4.3A(g)). In contrast, despite the higher level of protein production in the R-LPS background, N- WASP staining was barely detectable and F-actin capping was detected on a minor population of S. flexneri icsA rmlD expressing IcsA::BIO D717G (~15%) (Fig. 4.3A(h)). Collectively, the data suggest that residue D717 has a greater impact on N-WASP recruitment in comparison to Y716.

4.2.4.6 Effect of the Y716F, Y716G or D717G mutation on IcsA function in intercellular spreading

The ability of S. flexneri icsA S-LPS expressing IcsA::BIO Y716F, IcsA::BIO Y716G and IcsA::BIO D717G to perform ABM was investigated by assaying plaque formation. While S. flexneri icsA [IcsA::BIO Y716F] formed plaques comparable to the WT control (IcsA::BIO), S. flexneri icsA [IcsA::BIO Y716G] formed plaques that were 50% smaller (***P<0.001) (Fig. 4.3B). These results are consistent with the IF microscopy data whereby S. flexneri icsA expressing IcsA::BIO Y716G only formed F-actin capping, and hence were affected in ABM efficiency. As expected, S. flexneri icsA [IcsA::BIO D717G] that does not recruit N-WASP due to very low protein expression, did not form plaques (Fig. 4.3B).

191

Figure 4.3 Effect of mutagenesis of IcsA::BIO Y716 and IcsA::BIO D717 on N-WASP recruitment and intercellular spreading. A) HeLa cells were infected with mid-exponential phase S. flexneri ΔicsA (S-LPS) or S. flexneri ΔicsA ΔrmlD (R-LPS) having an empty vector or expressing IcsA::BIO, IcsA::BIO Y716F, IcsA::BIO Y716G or IcsA::BIO D717G, and then formalin fixed. HeLa cells and bacteria nuclei were labelled with DAPI (blue), F-actin was labelled with Alexa Fluor 488-phalloidin (green), and N-WASP was labelled with anti-N-WASP antibody and Alexa Fluor 594-conjugated donkey anti-rabbit antibody (red) as detailed in Materials and Methods. IF images were observed at 100x magnification. Arrows indicate N-WASP recruitment and F-actin comet tail formation. Enlargements of relevant region shown for clarity. Strains were assessed in two independent experiments. Scale bar = 10 μm. B) Plaque assay of S. flexneri ΔicsA strains expressing IcsA::BIO, IcsA::BIO Y716F, IcsA::BIO Y716G or IcsA::BIO D717G. Confluent HeLa cell monolayers were infected with mid-exponential phase S. flexneri strains for 2 h, and plaques were observed 48 h post-infection as detailed in Materials and Methods. 30 plaques were measured from each experiment. Data are represented as mean ± SEM of three independent experiments. ***, P<0.001 (determined by Student’s unpaired one-tailed t test).

192

193

4.2.4.7 Co-expression of mutated IcsA proteins in S. flexneri Our results and those reported by May & Morona (May & Morona, 2008) showed that N- WASP recruitment was partly affected or completely abolished when IcsA protein with mutation within any of the N-WASP IRs (I, II or III) was expressed by S. flexneri (summary in Table S4.2). We have also recently found that IcsA is able to self-associate (May et al., 2012). Therefore, we hypothesised that all three N-WASP interacting regions are required for N-WASP binding/activation and co-expression of two IcsA proteins with mutations at different N-WASP interacting regions would be able to complement the N- WASP binding ability and ultimately, restore N-WASP recruitment and activation. To co- express two mutated IcsA proteins, relevant icsA genes were cloned into vector pSU23 which has a similar copy number (intermediate) to pBR322. IcsA mutants with mutation at each N-WASP IR and defective in N-WASP recruitment when expressed individually in S. flexneri were chosen for co-expression/complementation analysis. pSU23 constructs that encode for IcsAWT, IcsA::BIO, IcsAi248 (N-WASP IR I) and IcsA::BIO Y716G D717G (N- WASP IR III) were constructed as detailed in the Materials and Methods. As expected, all IcsA proteins were expressed at WT levels that were comparable to those expressed by the pBR322 constructs in both S-LPS and R-LPS backgrounds (Fig. S4.5A), except IcsA::BIO Y716G D717G (N-WASP IR III) that had extremely low protein production in the S-LPS background (Fig. S4.5A, lane 7), which was similar to that observed for the pBR322 based clone (Fig. 4.2A). Similar results were obtained for IF microscopy where surface IcsA expression was detected at WT levels, except for IcsA::BIO Y716G D717G in the S-LPS background, as expected (Fig. S4.5B).

To co-express IcsA proteins, various pBR322-IcsA constructs that encode for IcsAWT,

IcsA::BIO, IcsAi248 (N-WASP IR I), IcsA::BIO V382R (N-WASP IR II) or IcsA::BIO Y716G D717G (N-WASP IR III) were subsequently electroporated into different S. flexneri strains (S-LPS and R-LPS) carrying the pSU23-IcsA constructs as shown in Tables 4.5A and 4.5B. S. flexneri S-LPS strains that co-expressed IcsA proteins were assayed for N-WASP recruitment following infection of HeLa cells by IF microscopy, and the results are summarised in Table 4.5A. S. flexneri S-LPS strains that expressed either 194

IcsAWT or the functionally equivalent IcsA::BIO were able to recruit N-WASP, regardless of the co-expressed IcsA protein. However, co-expression of two mutated IcsA proteins (N-WASP IR I+II, II+III or I+III) did not result in N-WASP recruitment. As expected, S. flexneri strains that co-expressed a mutated IcsA protein with an empty vector did not recruit N-WASP. As the production of IcsA::BIO Y716G D717G was extremely low in the S-LPS background but restored to a WT comparable levels in the R-LPS background, various IcsA proteins were also co-expressed in R-LPS S. flexneri. Their ability to recruit N-WASP was examined and summarised in Table 4.5B. The same outcomes were obtained for the R-LPS S. flexneri strains which have the same IcsA co-expression combination in the S-LPS background, with the remarkable exception of the co-expressed combination IcsA::BIO V382R and IcsA::BIO Y716G D717G (N-WASP IR II and III, respectively) that was able to recruit N-WASP (Table 4.5B).

4.2.4.8 N-WASP activation by the co-expressed IcsA::BIO V382R and IcsA::BIO Y716G D717G To investigate if the N-WASP recruited by S. flexneri R-LPS co-expressing IcsA::BIO V382R and IcsA::BIO Y716G D717G (IR II + III) (MYRM697) was activated, Arp2/3 complex recruitment and F-actin comet tail formation were examined by IF microscopy with anti-Arp3 monoclonal antibody and Alexa Fluor 488-phalloidin staining, respectively. Arp3 recruitment was significantly detected at one pole of the bacterium which co- localised with N-WASP (Fig. 4.4A(b)) and F-actin comet tail/capping was observed (Fig. 4.4B(b)). The data indicate that the complementation of N-WASP interacting regions II and III allowed S. flexneri MYRM697 to activate N-WASP, recruit Arp2/3 complex and form F-actin comet tails. However, MYRM697 displayed reduced N-WASP recruitment frequency and F-actin comet tail/capping formation compared to MYRM704 (expressing the functionally equivalent IcsA::BIO). We have quantitated the recruitment of N-WASP, Arp3 and F-actin comet tail/capping formation by scoring 20 infected HeLa cells (~ 250- 350 bacteria) when both N-WASP/Arp3 and N-WASP/F-actin tail/capping were observed respectively, in two independent experiments. MYRM697 which co-expressed IcsA::BIO V382R and IcsA::BIO Y716G D717G had an approximately 40-45% reduction in N- 195

WASP (P***<0.001) and Arp3 recruitment (0.001

196

Table 4.5A N-WASP recruitment by S. flexneri S-LPS strains co-expressing various IcsA proteins

N-WASP IR I N-WASP IR II N-WASP IR III

IcsA::BIO IcsA::BIO Protein IcsA a IcsA::BIO a IcsA a pBR322 vector a WT i248 V382R a Y716G D717G a b IcsAWT nt nt IcsA::BIO b nt nt b N-WASP IR I IcsAi248 nt nt nt IcsA::BIO N-WASP IR III nt nt nt Y716G D717G b pSU23 vector b nt a IcsA proteins expressed by pBR322 intermediate copy plasmid. b IcsA proteins expressed by pSU23 intermediate copy plasmid. “” = N-WASP recruited. “” = No N-WASP recruited. nt = not tested.

197

Table 4.5B N-WASP recruitment by S. flexneri R-LPS strains co-expressing various IcsA proteins

N-WASP IR I N-WASP IR II N-WASP IR III

198

4.2.5 Discussion: IcsA (VirG) is one of the key virulence proteins of S. flexneri, and is able to initiate F-actin comet tail formation through activation of the host N-WASP, leading to bacterial ABM and spreading within the host colonic epithelium. Although N-WASP is known to interact with IcsA and several IcsA regions have been reported to be involved in N-WASP recruitment (May & Morona, 2008), specific N-WASP interacting residues have yet to be identified. The aim of this study was to determine the N-WASP binding/interaction site(s) on IcsA (N-WASP interacting regions II and III) based on previously identified linker insertion mutations (May & Morona, 2008). However, 5 aa linker insertion mutations may have caused local disruption to the IcsA secondary structure, complicating the identification of important amino acids residues involved in N-WASP interaction. Hence, site-directed mutagenesis of specific residues at these sites was undertaken in this study.

Specific amino acids within the N-WASP IR II were randomly mutated (aa 330-331 and aa 381-382, respectively). Screening of the resultant IcsA mutants suggested that for efficient N-WASP recruitment, a polar-polar combination is required for residues 330-331, while a non-polar amino acid is required for residue 382 (Tables 4.2 and 4.3). Hence, site- directed mutagenesis was subsequently performed on pIcsA::BIO to mutate residues G331 and V382 into non-polar tryptophan (W) and polar arginine (R), respectively. S. flexneri ΔicsA expressing IcsA::BIO G331W was capable of recruiting N-WASP and forming F- actin comet tail/capping but not as frequently as the positive control strain (IcsA::BIO). As a result, a reduction in plaque size (~50%) was observed for IcsA::BIO G331W. In comparison, a single amino acid change at position 330 into a proline which is a non-polar amino acid (pMYRM539, T330P), abolished N-WASP recruitment. Notably, pMYRM543 (T330G G331P) which possesses proline at position 331 was also defective in N-WASP recruitment. Although both pMYRM543 (IcsA::BIO T330G G331P) and IcsA::BIO G331W mutants have the polar and non-polar amino acids combination, a contradictory effect on function was obtained. Taken together, the results obtained suggest that the proline substitution at either position disrupts local secondary structure of IcsA and

199

Figure 4.4 N-WASP interacting region complementation assay. A, B) IF microscopy to detect N-WASP, Arp3 recruitment and F-actin comet tail formation by intracellular S. flexneri strains. HeLa cells were infected with mid- exponential phase S. flexneri ΔicsA ΔrmlD (R-LPS) strains expressing either IcsA::BIO only or co-expressing IcsA::BIO V382R (N-WASP IR II) and IcsA::BIO Y716G D717G (N-WASP IR III), and formalin fixed. HeLa cells and bacteria nuclei were labelled with DAPI (blue), and N-WASP was labelled with anti-N-WASP antibody and either A) Alex Fluor 488-conjugated donkey anti-rabbit antibody (green) or B) Alex Fluor 594-conjugated donkey anti-rabbit antibody (red). A) Arp3 was labelled with anti-Arp3 monoclonal antibody and an Alex Fluor 594-conjugated donkey anti-mouse antibody (red). B) F-actin was labelled with Alexa Fluor-488-phalloidin (green). IF images were observed at 100x magnification. Arrows indicate N-WASP, Arp3 recruitment and F-actin tail formation. Enlargements of relevant region shown for clarity. Strains were assessed in two independent experiments. Scale bar = 10 μm. C) Quantification of N-WASP/Arp3 recruitment, and D) N-WASP/F-actin tail or capping formation, by intracellular S. flexneri ΔicsA ΔrmlD strains expressing IcsA::BIO only or co-expressing IcsA::BIO V382R (N- WASP IR II) and IcsA::BIO Y716G D717G (N-WASP IR III). Bacteria that either recruited both N-WASP and Arp3 (C), or recruited N-WASP and formed F-actin comet tail/capping (D), were scored from infected HeLa cells (n = 20 HeLa cells; ~250-350 bacteria). Data are represented as percentage of N-WASP/Arp3 recruitment ± SEM of two independent experiments (C); and, as percentage of N-WASP recruitment/F-actin tail or capping formation ± SEM of two independent experiments (D). **, 0.001

200

201

prevents N-WASP binding. Nevertheless, the results suggest that N-WASP interaction at this site does not rely on amino acid polarity, and the polar-polar combination is not essential. Indeed, the data suggest that the presence of specific amino acid residues at positions 330-331 is required for efficient N-WASP interaction and recruitment.

Consistent with the IcsA::BIO T381*V382* mutants that also have residue 382 substituted with polar arginine (R) [pMYRM544 and pMYRM549] (Table 4.3), S. flexneri expressing the IcsA::BIO V382R mutant was incapable of recruiting N-WASP and forming plaques. In contrast, mutants T381M V382L [pMYRM547] and T381K V382M [pMYRM548] (Table 4.3), which possess a non-polar amino acid at residue 382 (in bold), were able to recruit N-WASP and form plaques when expressed in S. flexneri, regardless of the amino acid substitution at residue 381. The data suggest that a non-polar residue is essential at position 382 and plays an important role in N-WASP recruitment. Collectively, site-directed mutagenesis within the N-WASP IR II revealed new N-WASP binding/interaction sites, and we have assigned them as N-WASP IR 2a (aa 330-331) and N-WASP IR 2b (aa 382), respectively.

We have previously shown that IcsAi716 which had a 5 aa insertion mutation within the AC region (N-WASP IR III) was defective in N-WASP recruitment (Teh et al., 2012) (results presented in Chapter 3). The predicted location for residues Y716-D717 (forming part of the Aro-X-Aro motif) is at the beginning of the first anti-parallel β-strand that appears to be exposed to the external medium (Fig. S4.3), suggesting that this motif could be involved in protein binding. Hence, IcsA::BIO Y716*D717*, IcsA::BIO Y716F, IcsA::BIO Y716G and IcsA::BIO D717G mutants were created, expressed in both S. flexneri S-LPS and R-LPS backgrounds, and investigated for N-WASP recruitment. The IcsA::BIO Y716*D717* mutant protein production was markedly reduced in the S-LPS background but restored to a WT comparable levels in the R-LPS background (Fig. 4.2A), which is consistent with the IcsAi716 mutant phenotype (Teh et al., 2012) (results presented in Chapter 3). In spite of the WT comparable levels of IcsA::BIO

202

Y716*D717* mutant expression on the R-LPS bacterial surface, N-WASP recruitment was not observed (Table 4.4). The data suggested that this Aro-X-Aro motif is an N-WASP binding/interaction site, in this region of the protein.

Our results showed that IcsA::BIO Y716F (conserved mutation) and IcsA::BIO Y716G (non-conserved mutation) were functional in both S-LPS and R-LPS backgrounds, except that only F-actin capping was observed for Y716G in the S-LPS background. This may be due to the lower levels of IcsA::BIO Y716G expression in the S-LPS background which affected the N-WASP recruitment efficiency and/or activation, hence, resulting in F-actin capping formation only. Consistent with these results, S. flexneri S-LPS expressing IcsA::BIO Y716F formed plaques that were comparable with WT while IcsA::BIO Y716G formed smaller plaques (Fig. 4.3B), reflecting the slightly reduced N-WASP recruitment efficiency and F-actin capping formation by IcsA::BIO Y716G. Together, the data suggest that the aromatic property of residue 716 is not essential for N-WASP recruitment.

IcsA::BIO D717G did not recruit N-WASP in the S-LPS background (Fig. 4.3A(g)), which was due to the extremely low IcsA production (Fig. 4.2C). Consequently, plaques were not observed. In contrast, the restoration of IcsA::BIO D717G expression in the R- LPS strain (Fig. 4.2C) did not lead to WT comparable N-WASP recruitment efficiency (Fig. 4.3A(h); Table 4.4), implying that D717 is involved in N-WASP binding/interaction. Collectively, the data obtained suggest that D717 plays a more important role than Y716 in N-WASP recruitment. Nevertheless, both residues Y716-D717 are important for N-WASP recruitment as mutation of both residues (IcsA::BIO Y716*D717* mutants) abolished N- WASP recruitment completely (Table 4.4).

In terms of IcsA biogenesis, we showed that the 716 aromatic residue is important for IcsA production but this was largely independent of LPS structure because the non- conservative mutation resulted in reduced IcsA::BIO Y716G protein production in both S- LPS and R-LPS backgrounds (Fig. 4.2B). This implies that the aromatic property of 203

residue 716 is important for protein folding/stability. In contrast, D717 is a critical residue within the AC region for IcsA biogenesis but in a LPS structure dependent manner, as the IcsA::BIO D717G mutant had markedly reduced IcsA mutant production in the S-LPS background but was mostly restored in the R-LPS background (Fig. 4.2C, lanes 2 and 5).

These results are consistent with our findings regarding the IcsAi AC mutant production (Teh et al., 2012) (results presented in Chapter 3).

Previous investigations on IcsA regions involved in N-WASP recruitment have been studied on individual N-WASP interacting regions (based on deletion and linker insertion mutations) (May & Morona, 2008; Suzuki et al., 1998; Suzuki et al., 2002) and the identification of multiple N-WASP interacting regions on IcsA led us to investigate the mode of action of IcsA in recruiting and activating N-WASP. IcsA is part of the SAATs and has recently been shown to self-associate and oligomerise at the OM (May et al., 2012; Meng et al., 2011). On the other hand, allosterically activated N-WASP is able to dimerise/oligomerise and recruit the Arp2/3 complex (Padrick et al., 2008; Padrick & Rosen, 2010). May et al. (May et al., 2012) also suggested that self-association of IcsA may play a role in N-WASP clustering, as S. flexneri S-LPS co-expressing IcsAWT and

IcsAi563 or IcsAi677 displayed reduced efficiency in ABM. We hypothesised that IcsA functions as a complex on the bacterial surface and different regions of IcsA (N-WASP IR I, II and III) are involved in interacting with N-WASP. To investigate our hypothesis, we co-expressed two IcsA mutant proteins in both S-LPS and R-LPS backgrounds in different combinations, to complement one mutated N-WASP IR with another copy of IcsA that had mutation at another N-WASP IR (Tables 4.5A and 4.5B). Similar IcsA mutant production was obtained when the IcsA mutants were individually expressed by either pBR322 or pSU23 in S-LPS and R-LPS S. flexneri. Hence, the expression levels of co-expressed IcsA proteins (either with functional IcsA or IcsA mutant) were expected to be similar as the compatible intermediate copy plasmids (pBR322 and pSU23) were used. In addition, May et al. (May et al., 2012) showed that the co-expression of functional IcsA with IcsAi mutant did not affect the polar distribution and the amount of functional protein at the bacterial surface. 204

Our findings showed that none of the IcsA mutants when co-expressed recruited N-

WASP in the S-LPS background, except when co-expressed with IcsAWT or the functionally equivalent IcsA::BIO (Table 4.5A). Interestingly, when IcsA with mutations within N-WASP IR II and III (IcsA::BIO V382R and IcsA::BIO Y716G D717G) were co- expressed in the R-LPS background, N-WASP was activated, resulting in Arp2/3 complex recruitment and formation of F-actin comet tail/capping, albeit at a frequency less than the control (~ 40-45% reduction) (Fig. 4.4). Co-expression of these IcsA mutant proteins in the S-LPS background did not show N-WASP recruitment which was likely due to the very low IcsA::BIO Y716G D717G production. IcsA::BIO V382R alone was not able to recruit N-WASP. Interestingly, this suggests that the AC region possessed by IcsA::BIO V382R does not seem to rescue the related expression defect of IcsA::BIO Y716G D717G. This is in contrast with the ability of the co-expressed AC region to rescue an AC region mutant in other systems (e.g. PrtS and BrkA ATs) (Ohnishi et al., 1994; Oliver et al., 2003b).

Studies on other autotransporter AC regions (e.g. PrtS and BrkA) were performed on E. coli which is an R-LPS strain, and the additional AC region was provided in trans and located at the OM (Ohnishi et al., 1994; Oliver et al., 2003b). Our system is different from those previously reported whereby two full length mutated IcsA proteins were co- expressed in both S-LPS and R-LPS S. flexneri, and the AC IcsA mutant (e.g. IcsA::BIO Y716G D717G) production was severely affected in the S-LPS background. We have previously proposed that AC IcsA mutant could be degraded in the periplasm prior to translocation across the OM (Teh et al., 2012) (results presented in Chapter 3). Hence, the failure to complement N-WASP recruitment by co-expressing IcsA::BIO V382R and IcsA::BIO Y716G D717G in the S-LPS background, could be due to the absence of IcsA::BIO Y716G D717G at the OM, as a result of degradation in the periplasm, supporting our previous hypothesis. Alternatively, LPS O-antigen could be masking the function of co-expressed IcsA::BIO V382R and IcsA::BIO Y716G D717G. However, it is unclear if IcsA::BIO Y716G D717G was co-expressed at high levels on the S-LPS S. flexneri surface. IcsA proteins with different tags could be co-expressed in S-LPS S. flexneri in future to determine the IcsA::BIO Y716G D717G expression level. In addition, 205

we have previously shown that the expression of individual AC IcsA mutants in both R- LPS S. flexneri and R-LPS E. coli was restored to WT comparable levels, which does not require complementation of an additional AC region to restore IcsA biogenesis (Teh et al., 2012) (results presented in Chapter 3). Therefore, it is unclear whether the AC region provided by IcsA::BIO V382R (at the OM) is able to restore IcsA biogenesis/folding of an AC IcsA mutant, as reported in PrtS and BrkA (Ohnishi et al., 1994; Oliver et al., 2003b).

The N-WASP interacting region complementation data (Table 4.5B, Fig. 4.4) suggest that IcsA functions as a complex (at least as a dimer), with all three N-WASP interacting regions required for efficient N-WASP recruitment. Furthermore, N-WASP IR II and III on different IcsA molecules interact co-operatively with N-WASP to promote its activation. However, we do not rule out that N-WASP binds to all three N-WASP IRs of one IcsAWT molecule. The function of N-WASP IR I (contains the GRRs) cannot be complemented by another copy of IcsA with mutation at another N-WASP IR (Fig. 4.5).

However, S. flexneri co-expressing both IcsAi248 (N-WASP IR I) and IcsAWT (or the functionally equivalent IcsA::BIO) was capable of recruiting N-WASP, suggesting that despite mutation in N-WASP IR I, the presence of another copy of functional IcsA that provides sufficient functional N-WASP IR regions is able to complement the defect, and a negative dominance effect was not detected.

Taken together, we have identified new amino acids within N-WASP IR II and III that are involved in N-WASP recruitment. In particular, the conserved Aro-X-Aro motif (aa 716-718, N-WASP IR III) that is located within the AC region could be a potential drug target site, by utilising the recently crystallised IcsA AC region structure. Furthermore, our N-WASP IR complementation data strongly suggest that IcsA functions as a multimer. We have shown for the first time that all three N-WASP IRs are involved in N-WASP recruitment and activation. Our findings have shed light on N-WASP activation by S. flexneri IcsA protein where the nature of their interactions is poorly understood. However, it is still unclear which region of N-WASP (WHI domain, CRIB domain or both) (Moreau

206

et al., 2000; Suzuki et al., 2002) is involved in binding to the IcsA protein and whether N- WASP binds to three different sites of IcsA as a single molecule or as a complex. It is also unclear whether the binding of N-WASP to multiple sites of IcsA is a pre-requisite or if it merely enhances the allosteric activation of N-WASP and/or N-WASP oligomerisation which in turn activates the Arp2/3 complex. These issues warrant further investigations that would reveal the mystery of the complex interaction between the S. flexneri virulence IcsA protein and the host actin cytoskeleton regulatory N-WASP protein.

207

Figure 4.5 Schematic locations of the three N-WASP interacting regions with mutations in IcsA proteins.

A) Three major domains of IcsA. The N-WASP interacting regions (IR) are in dotted boxes and marked as I, II and III. B) Three different combinations of IcsA mutants were co-expressed and the corresponding phenotypes in R-LPS S. flexneri are shown. (i) N- WASP IR I and II; (ii) N-WASP IR I and III; (iii) N-WASP IR II and III. “-” = N-WASP, Arp3 or F-actin comet tails not detected; “+” = N-WASP, Arp3 or F-actin comet tail/capping detected. The “” symbol indicates the presence of mutation within the N- WASP interacting region. 208

4.2.6 Supporting Information

Identification of Shigella flexneri IcsA residues affecting interaction with N-WASP, and evidence for IcsA-IcsA co-operative interaction

Min Yan Teh and Renato Morona

PloS One 8(2): e55152. doi:10.1371/journal.pone.0055152

209

Table S4.1 Oligonucleotides used in this study.

Primer Oligonucleotide sequence (5’ – 3’) a Target Nucleotide positions b 330NNS aacacaaaatgtagcaggtaatgctatccacatcnnsnnsggaaacaattcattaatactccatgaaggttctg IcsA::BIO T330*G331* 150597 381NNS caactattgaaggtgatttatgtgctggtgattgtacannsnnstcactatcaggtaacaaattcactgtttcagg IcsA::BIO T381*V382* 150746 716NNS cagaaaggccgtattgttgctggtagtnnsnnstatcgcctgaaacagggcactgtatct IcsA::BIO Y716*D717* 151762 331TGG_F agcaggtaatgctatccacatcacttggggaaacaattcattaatactc IcsA::BIO G331W 150609 331TGG_R gagtattaatgaattgtttccccaagtgatgtggatagcattacctgc IcsA::BIO G331W 150610 382CGT_F ttatgtgctggtgattgtacaactcgttcactatcaggtaacaaattcac IcsA::BIO V382R 150763 382CGT_R gtgaatttgttacctgatagtgaacgagttgtacaatcaccagcacataa IcsA::BIO V382R 150763 716TTT_F cgtattgttgctggtagttttgactatcgcctgaaac IcsA::BIO Y716F 151771 716TTT_R gtttcaggcgatagtcaaaactaccagcaacaatacg IcsA::BIO Y716F 151771 716GGT_F agaaaggccgtattgttgctggtagtggtgactatcgcctga IcsA::BIO Y716G 151763 716GGT_R tcaggcgatagtcaccactaccagcaacaatacggcctttct IcsA::BIO Y716G 151763 717GGC_F attgttgctggtagttatggctatcgcctgaaacagg IcsA::BIO D717G 151774 717GGC_R cctgtttcaggcgatagccataactaccagcaacaat IcsA::BIO D717G 151774 a Underlined and bolded sequences indicate the nucleotides that undergo site-directed mutagenesis b Nucleotide positions based on the sequence of the S. flexneri 2a strain 301 virulence plasmid pCP301 – GenBank accession # AF386526 * = random amino acid change

210

Table S4.2 IcsA production and N-WASP recruitment by S. flexneri S-LPS and R-LPS strains expressing various IcsA proteins.

IcsA S-LPS R-LPS IcsA production N-WASP recruitment IcsA production N-WASP recruitment

IcsAWT +++ ܂ +++ ܂ IcsA::BIO +++ ܂ +++ ܂

IcsAi248 +++ ܄ +++ ܄ IcsA::BIO V382R +++ ܄ +++ ܄ IcsA::BIO Y716G D717G + ܄ +++ ܄

The “+++”, “+” symbols indicate relative band intensities of Western immunoblots of whole cell lysates. “܂” = N-WASP recruited “܄” = No N-WASP recruited

211

Figure S4.1 Plaque formation by S. flexneri ΔicsA expressing IcsA::BIO T330*G331* and IcsA::BIO T381*V382* mutants. Confluent HeLa cell monolayers were infected with mid-exponential phase S. flexneri strains for 2 h, and plaques were observed 48 h post-infection as detailed in Materials and Methods. 30 plaques were measured from each experiment. Data are represented as mean ± SEM of three independent experiments. **, 0.001

212

Figure S4.2 Detection of surface IcsA::BIO, IcsA::BIO G331W or IcsA::BIO V382R proteins expressed by S-LPS S. flexneri. Mid-exponential phase S. flexneri ΔicsA strains expressing either IcsA::BIO, IcsA::BIO G331W, IcsA::BIO V382R or an empty vector alone, were formalin fixed and labelled with rabbit polyclonal anti-IcsA antibody and Alexa 488-conjugated goat anti-rabbit secondary antibody. Inserts show enlarged views for greater clarity. IF images were observed at 100x magnification. Scale bar = 10 μm.

213

Figure S4.3 Locations of Y716, D717 and Y718 residues mapped on the crystal structure of the IcsA AC region. Protein Data Bank accession no. 3ML3. Residue Y716 is illustrated in pink, residue D717 is yellow and residue Y718 is blue. Side chains of each residue, as well as the amino (N) and carboxyl (C) termini are shown.

214

Figure S4.4 Detection of surface IcsA::BIO Y716 or D717 proteins expressed by S-LPS and R-LPS S. flexneri. Mid-exponential phase S. flexneri ΔicsA (S-LPS) or S. flexneri ΔicsA ΔrmlD (R-LPS) strains expressing either IcsA::BIO, IcsA::BIO Y716F, IcsA::BIO Y716G, IcsA::BIO D717G or an empty vector, were formalin fixed and labelled with anti-IcsA antibody and Alexa 488- conjugated goat anti-rabbit secondary antibody. Inserts show enlarged views for greater clarity. IF images were observed at 100x magnification. Scale bar = 10 μm.

215

Figure S4.5 Detection of IcsA proteins encoded by pSU23-based plasmids in S-LPS and R-LPS S. flexneri. A) Whole cell lysates from mid-exponential phase S. flexneri ΔicsA (S-LPS) or S. flexneri

ΔicsA ΔrmlD (R-LPS) expressing IcsAWT, IcsAi248, IcsA::BIO IcsA::BIO Y716G D717G or an empty vector were prepared and analysed by Western immunoblotting using anti-IcsA antibody. Strain names are shown above each lane. The 120 kDa band corresponds to the full length IcsA; the 85 kDa band corresponds to the cleaved form (IcsA’). S = S-LPS; R = R- LPS. B) Mid-exponential phase S. flexneri ΔicsA (S-LPS) or S. flexneri ΔicsA ΔrmlD (R-LPS) strains expressing either IcsA, IcsA::BIO, IcsAi248, IcsA::BIO Y716G D717G or an empty vector, were formalin fixed and labelled with rabbit polyclonal anti-IcsA antibody and Alexa 488-conjugated goat anti-rabbit secondary antibody. Inserts show enlarged views for greater clarity. IF images were observed at 100x magnification. Scale bar = 10 μm.

216

217

The following sections of Chapter 4 provide additional information for the work performed but was not included in the manuscript (Section 4.2).

4.3 Multi site-directed mutagenesis of IcsA N-WASP IR II

To determine new N-WASP binding sites, residues 330-331 and residues 381-382 of N- WASP IR II were randomly mutagenised using pIcsA::BIO via multi site-directed mutagenesis, as described in Section 2.8.3. The mutated plasmids were sequenced and electroporated into S. flexneri ΔicsA (RMA2041). The production of various IcsA::BIO T330*G331* and IcsA::BIO T381*V382* mutants was examined by Western immunoblotting with anti-IcsA antibody, as described in Section 2.9.6. As expected, the production of the altered IcsA mutants was similar to that of IcsA::BIO (Fig. 4.6).

4.4 N-WASP recruitment by S. flexneri ΔicsA expressing IcsA::BIO T330*G331* proteins

The ability for various IcsA::BIO T330*G331* mutant proteins to recruit N-WASP was determined by infecting monolayers of HeLa cells with mid-exponential phase S. flexneri ΔicsA strains expressing the mutated IcsA proteins, as described in Section 2.13.5. MYRM352 (S. flexneri ΔicsA expressing IcsA::BIO) was used as a positive control (Fig. 4.7A). MYRM562 (IcsA::BIO T330S G331G), MYRM563 (IcsA::BIO T330G G331R), MYRM564 (IcsA::BIO T330E G331K) and MYRM575 (IcsA::BIO T330K G331N) mutant strains were capable of recruiting N-WASP and formed F-actin comet tails (Fig. 4.7B, C, D and G). In contrast, MYRM565 (IcsA::BIO T330P G331G) and MYRM567 (IcsA::BIO T330G G331P) were unable to recruit N-WASP (Fig. 4.7E and F). The interpretation of these results were detailed in the manuscript (Section 4.2), hence, will not be further discussed here.

218

4.5 N-WASP recruitment by S. flexneri ΔicsA expressing IcsA::BIO T381*V382* proteins

The ability for various IcsA::BIO T381*V382* mutant proteins to recruit N-WASP was determined by infecting monolayers of HeLa cells with mid-exponential phase S. flexneri ΔicsA strains expressing the mutated IcsA proteins, as described in Section 2.13.5. Out of 6 mutant strains, only MYRM571 (IcsA::BIO T381M V382L) and MYRM572 (IcsA::BIO T381K V382M) were capable of recruiting N-WASP and forming F-actin comet tails (Fig. 4.8E and F). Again, the interpretation of these results were documented in the manuscript (Section 4.2), hence, will not be further discussed here.

4.6 N-WASP recruitment by S. flexneri ΔicsA ΔrmlD expressing IcsA::BIO Y716*D717*

IcsA::BIO Y716*D717* mutants generated from multi site-directed mutagenesis were electroporated into both S. flexneri ΔicsA (RMA2041) and S. flexneri ΔicsA ΔrmlD (RMA2043) as described in the manuscript (Section 4.2). Monolayers of HeLa cells were infected with various S. flexneri strains expressing IcsA::BIO Y716*D717* mutants, however, none of the mutant strains recruited detectable levels of N-WASP and F-actin comet tails were not observed (Fig. 4.9B-H). That S-LPS S. flexneri strain expressing IcsA::BIO Y716*D717* did not recruit N-WASP is likely due to the extremely low protein production in the S-LPS background. As a negative result was obtained, data for these strains are not shown. On the other hand, N-WASP recruitment was also not detected on R-LPS S. flexneri strains that restored IcsA::BIO Y716*D717* production (Fig. 4.9), suggesting that residues 716-717 are involved in N-WASP binding/interaction.

219

Figure 4.6 Detection of IcsA::BIO T330*G331* and IcsA::BIO T381*V382* proteins expressed by S-LPS S. flexneri. Whole cell lysates were prepared from mid-exponential phase cultures of S. flexneri ΔicsA (RMA2041) carrying plasmids encoding various IcsA::BIO mutant proteins, as described in Section 2.9.1. Samples were electrophoresed on an SDS-12%-PAGE gel prior to Western immunoblotting with anti-IcsA antibody (Section 2.9.4 and Section 2.9.6). The 120 kDa band corresponds to the full length IcsA; the 85 kDa band corresponds to the cleaved form (IcsA’). Samples in each lane represent 5x107 bacteria. The samples in each lane are as follows:

Lane 1: MYRM352 [IcsA::BIO] Lane 2: MYRM562 [IcsA::BIO T330S G331G] Lane 3: MYRM563 [IcsA::BIO T330G G331R] Lane 4: MYRM564 [IcsA::BIO T330E G331K] Lane 5: MYRM565 [IcsA::BIO T330P G331G] Lane 6: MYRM567 [IcsA::BIO T330G G331P] Lane 7: MYRM575 [IcsA::BIO T330K G331N] Lane 8: MYRM568 [IcsA::BIO T381Q V382R] Lane 9: MYRM569 [IcsA::BIO T381R V382K] Lane 10: MYRM570 [IcsA::BIO T381A V382Q] Lane 11: MYRM571 [IcsA::BIO T381M V382L] Lane 12: MYRM572 [IcsA::BIO T381K V382M] Lane 13: MYRM577 [IcsA::BIO T381P V382R] Lane 14: MYRM293 [pBR322] control

220

221

Figure 4.7 Detection of N-WASP recruitment and F-actin comet tail by S. flexneri strains expressing IcsA::BIO T330*G331* mutants. HeLa cells were infected with mid-exponential phase S. flexneri ΔicsA (RMA2041) carrying plasmids encoding various IcsA::BIO T330*G331* mutants and formalin fixed. HeLa cells and bacteria nuclei were labelled with DAPI (blue), F-actin was labelled with Alexa Fluor 488-phalloidin (green), and N-WASP was labelled with anti-N-WASP and Alexa Fluor 594- conjugated donkey anti-rabbit antibody (red), as detailed in Section 2.13.5. IF images were observed at 100x magnification. Arrows indicate N-WASP recruitment and F-actin comet tail formation. Inserts show enlarged views of the indicated region. Strains were assessed in two independent experiments. Scale bar = 10 μm. The images are as follows:

A. MYRM352 [IcsA::BIO] B. MYRM562 [IcsA::BIO T330S G331G] C. MYRM563 [IcsA::BIO T330G G331R] D. MYRM564 [IcsA::BIO T330E G331K] E. MYRM565 [IcsA::BIO T330P G331G] F. MYRM567 [IcsA::BIO T330G G331P] G. MYRM575 [IcsA::BIO T330K G331N]

222

223

Figure 4.8 Detection of N-WASP recruitment and F-actin comet tail by S. flexneri strains expressing IcsA::BIO T381*V382* mutants. HeLa cells were infected with mid-exponential phase S. flexneri ΔicsA (RMA2041) carrying plasmids encoding various IcsA::BIO T381*V382* mutants and formalin fixed. HeLa cells and bacteria nuclei were labelled with DAPI (blue), F-actin was labelled with Alexa Fluor 488-phalloidin (green), and N-WASP was labelled with anti-N-WASP and Alexa Fluor 594- conjugated donkey anti-rabbit antibody (red), as detailed in Section 2.13.5. IF images were observed at 100x magnification. Arrows indicate N-WASP recruitment and F-actin comet tail formation. Inserts show enlarged views of the indicated region. Strains were assessed in two independent experiments. Scale bar = 10 μm. The images are as follows:

A. MYRM352 [IcsA::BIO] B. MYRM568 [IcsA::BIO T381Q V382R] C. MYRM569 [IcsA::BIO T381R V382K] D. MYRM570 [IcsA::BIO T381A V382Q] E. MYRM571 [IcsA::BIO T381M V382L] F. MYRM572 [IcsA::BIO T381K V382M] G. MYRM577 [IcsA::BIO T381P V382R]

224

225

Figure 4.9 Detection of N-WASP recruitment and F-actin comet tail by R-LPS S. flexneri strains expressing IcsA::BIO Y716*D717* mutants. HeLa cells were infected with mid-exponential phase S. flexneri ΔicsA ΔrmlD (RMA2043) carrying plasmids encoding various IcsA::BIO Y716*D717* mutants and formalin fixed. HeLa cells and bacteria nuclei were labelled with DAPI (blue), F-actin was labelled with Alexa Fluor 488-phalloidin (green), and N-WASP was labelled with anti-N-WASP and Alexa Fluor 594-conjugated donkey anti-rabbit antibody (red), as detailed in Section 2.13.5. IF images were observed at 100x magnification. Arrows indicate N-WASP recruitment and F- actin comet tail formation. Inserts show enlarged views of the indicated region. Strains were assessed in two independent experiments. Scale bar = 10 μm. The images are as follows:

A. MYRM353 [IcsA::BIO] B. MYRM354 [IcsA::BIO Y716L D717S] C. MYRM355 [IcsA::BIO Y716S D717K] D. MYRM356 [IcsA::BIO Y716C D717C] E. MYRM357 [IcsA::BIO Y716V D717H] F. MYRM359 [IcsA::BIO Y716G D717G] G. MYRM360 [IcsA::BIO Y716E D717I] H. MYRM362 [IcsA::BIO Y716K D717S]

226

227

4.7 Trypsin sensitivity of IcsA::BIO Y716F, IcsA::BIO Y716G and IcsA::BIO D717G

As described in the manuscript (Section 4.2), IcsA::BIO Y716F, IcsA::BIO Y716G and IcsA::BIO D717G mutants were created to examine the effect of these individual residues on IcsA biogenesis and N-WASP recruitment. It was of interest to determine if these mutants retained the WT protein conformation. Hence, limited proteolysis assay was performed on R- LPS S. flexneri MYRM353 (IcsA::BIO), MYRM604 (IcsA::BIO Y716F), MYRM606 (IcsA::BIO Y716G) and MYRM612 (IcsA::BIO D717G) as described in Section 2.9.3, followed by Western immunoblotting with anti-IcsA antibody.

IcsA::BIO Y716F had a WT proteolysis profile (Fig. 4.10A, lanes 5-8), comparable to IcsA::BIO (Fig. 4.10A, lanes 1-4). IcsA::BIO Y716G seemed to be slightly more sensitive to trypsin as the full length IcsA band disappeared after 15 min digestion but with a WT proteolysis profile overall (Fig. 4.10A, lanes 9-12). On the other hand, IcsA::BIO D717G which had lower production level than IcsA::BIO Y716F and IcsA::BIO Y716G, seemed to be digested faster by trypsin but with a WT proteolysis comparable profile (Fig. 4.10B, lanes 5-8). The disappearance of some of the IcsA bands maybe due to the lower IcsA level of mutant protein being more rapidly degraded by trypsin. Both IcsA::BIO Y716G and IcsA::BIO D717G seemed to be more sensitive to trypsin but this is complicated by lower level of expression of IcsA::BIO D717G. Taken together, single amino acid changes of these residue positions do not dramatically change the conformation of these proteins. Hence the inability to recruit N-WASP maybe due to a direct effect on N-WASP binding/interaction at this location.

4.8 Construction of pSU23-IcsA plasmids

To allow co-expression of IcsA proteins, an alternative vector was required to encode the icsA genes and pSU23 that confers chloramphenicol resistance was chosen. The relevant icsA genes from pIcsAWT, pIcsA::BIO, pIcsAi248, and pIcsA::BIO Y716G D717G were extracted by digesting those plasmids with PstI and SalI (Fig. 4.11). pSU23 was likewise digested, followed by SAP treatment (Section 2.5.2) to prevent re-ligation. The relevant PstI-icsA-SalI 228

fragments were subsequently ligated with the SAP-treated pSU23. The ligated products were transformed into DH5 and yielded: pSU23-IcsAWT [pMYRM637], pSU23-IcsA::BIO

[pMYRM638], pSU23-IcsAi248 [pMYRM640], and pSU23-IcsA::BIO Y716G D717G [pMYRM642]. The constructs were confirmed by restriction enzyme digestion.

4.9 Expression of IcsA proteins encoded by pSU23 derivatives

The pSU23 derivatives constructs from Section 4.8 were transformed into S. flexneri ΔicsA

(RMA2041) and S. flexneri ΔicsA ΔrmlD (RMA2043), yielded: MYRM646 (S-LPS IcsAWT),

MYRM647 (S-LPS IcsA::BIO), MYRM648 (S-LPS IcsAi248), MYRM649 (S-LPS IcsA::BIO

Y716G D717G), MYRM650 (R-LPS IcsAWT), MYRM651 (R-LPS IcsA::BIO), MYRM652

(R-LPS IcsAi248), and MYRM653 (R-LPS IcsA::BIO Y716G D717G). The production of various IcsA proteins by these strains was examined by Western immunoblotting using anti- IcsA antibody, as described in Section 2.9.6 (Fig. 4.12). The results obtained were as expected where IcsA::BIO Y716G D717G had a very low level of protein production in the S-LPS background (Fig. 4.12, lane 7) but a near WT level of protein production in the R-LPS background (Fig. 4.12, lane 8). IcsAWT, IcsAi248 and IcsA::BIO had similar protein levels in both S-LPS and R-LPS backgrounds (Fig. 4.12, lanes 1-6). The results confirmed that the pSU23-based plasmids produced IcsA proteins at levels that were comparable to the pBR32- based constructs.

4.10 N-WASP recruitment by co-expressed IcsA proteins

S-LPS and R-LPS S. flexneri strains that were co-expressing IcsA proteins (encoded by pBR322 and pSU23) in different combinations (Section 4.2) were examined for their ability to recruit N-WASP. The mid-exponential S. flexneri strains were used to infect monolayers of HeLa cells, as described in Section 2.13.5. The results are shown in Fig. 4.13a and 4.13b for S-LPS S. flexneri strains and Fig. 4.14a and 4.14b for R-LPS S. flexneri strains, respectively.

As described previously in Section 4.2, none of the S-LPS S. flexneri strains co-expressing IcsA mutants recruited N-WASP or formed F-actin comet tails, except when co-expressed 229

with either IcsAWT (Fig. 4.13a, Panel E, I and J; Fig. 4.13b, Panel K and O) or IcsA::BIO (Fig. 4.13a, Panel F; Fig. 4.13b, Panel L, M, N and P). On the other hand, R-LPS S. flexneri strains co-expressing IcsA mutants also had the same outcome (Fig. 4.14a and Fig. 4.14b) as the S-LPS S. flexneri strains having the same IcsA co-expression combination, with the exception of MYRM697 [IcsA::BIO V382R + IcsA::BIO Y716G D717G] which was able to recruit N-WASP and form F-actin comet tails (Fig. 4.14a, Panel G). The results show that complementation of N-WASP IR II and III is able to restore N-WASP recruitment ability and IcsA functions as a complex. The detailed interpretation of this result was presented in the manuscript (Section 4.2), hence will not be further discussed here.

4.11 Summary

Specific residues within N-WASP IR II (aa 330-382) were mutated in this chapter and the effect of these mutations on IcsA production, N-WASP recruitment, F-actin comet tail formation and intercellular spreading was investigated.

IcsA production of multi site-directed mutagenesised IcsA::BIO T330*G331* and IcsA::BIO T381*V382* mutants was not affected but the N-WASP recruitment and intercellular spreading ability of certain mutants were affected (defective or reduced function), depending on the amino acids substitution.

Furthermore, IcsA production of the site-directed mutagenised IcsA::BIO G331W and IcsA::BIO V382R mutants was also unaffected. However, IcsA::BIO G331W displayed reduced N-WASP recruitment and intercellular spreading ability, suggesting that this is an N- WASP binding/interaction site but dependent on the presence of specific amino acids. In contrast, IcsA::BIO V382R mutant was defective in N-WASP recruitment, F-actin comet tail formation and intercellular spreading, suggesting that this is another N-WASP binding/interaction site and a non-polar amino acid is required at this position for efficient N- WASP recruitment.

The Aro-X-Aro motif (Y716-D717-Y718) within the IcsA AC region (aa 634-735) which is part of the N-WASP IR III (aa 508-730), was examined in this chapter via multi and site- directed mutagenesis of residues Y716 and D717. IcsA::BIO Y716*D717* mutant production 230

was significantly reduced in the S-LPS background but restored to a WT comparable levels in the R-LPS background, consistent with the AC IcsAi mutants described in Chapter 3. Various IcsA::BIO Y716*D717* mutants were defective in N-WASP recruitment and F-actin comet tail formation in both S-LPS and R-LPS backgrounds, indicating this is an N-WASP binding/interaction site, which supports the data from Chapter 3 (IcsAi716).

The aromatic Y716 residue is not essential for N-WASP recruitment but is important for IcsA biogenesis. In contrast, residue D717 has greater impact than Y716 in N-WASP recruitment and its effect on IcsA biogenesis is dependent on LPS Oag. Taken together, both Y716-D717 are important for N-WASP binding/interaction and IcsA biogenesis.

This chapter also describes co-expression of IcsA with mutations within different N- WASP interacting regions. It was shown for the first time that IcsA functions as a complex and that multi N-WASP interacting regions are required for N-WASP activation. The N- WASP complementation assay suggests that the N-WASP IR I which contains GRRs, is the most important region because co-expression of IcsA with mutation within this region with another mutated IcsA protein was unable to restore N-WASP recruitment ability. Overall, the results suggest that N-WASP interacts with an IcsA complex where the N-WASP interacting site is not restricted to GRRs as reported in the literatures (Suzuki et al., 1998; Suzuki et al., 2002).

231

Figure 4.10 Trypsin accessibility of IcsAi mutants. Mid-exponential phase cultures of the indicated S. flexneri ΔicsA ΔrmlD (RMA2043) strains carrying plasmids encoding various IcsAWT or IcsAi mutants were treated with 0.1 μg/mL trypsin at 25°C, as described in Section 2.9.3. Aliquots were taken at 0 min, 5 min, 15 min and 20 min and supplemented with 1 mM PMSF to inhibit further proteolysis. Whole cell lysates were prepared as described in Section 2.9.1, electrophoresed on an SDS-12%-PAGE gel and subjected to Western immunoblotting with anti-IcsA antibody (Section 2.9.4 and Section 2.9.6). The 120 kDa band corresponds to the full length IcsA; the 85 kDa band corresponds to the cleaved form (IcsA’). Samples in each lane represent 1x109 bacteria. The samples in each lane are as follows: Panel A. Lane 1: MYRM353 [IcsA::BIO] 0 min Lane 2: MYRM353 [IcsA::BIO] 5 min Lane 3: MYRM353 [IcsA::BIO] 15 min Lane 4: MYRM353 [IcsA::BIO] 20 min Lane 5: MYRM604 [IcsA::BIO Y716F] 0 min Lane 6: MYRM604 [IcsA::BIO Y716F] 5 min Lane 7: MYRM604 [IcsA::BIO Y716F] 15 min Lane 8: MYRM604 [IcsA::BIO Y716F] 20 min Lane 9: MYRM606 [IcsA::BIO Y716G] 0 min Lane 10: MYRM606 [IcsA::BIO Y716G] 5 min Lane 11: MYRM606 [IcsA::BIO Y716G] 15 min Lane 12: MYRM606 [IcsA::BIO Y716G] 20 min Panel B. Lane 1: MYRM353 [IcsA::BIO] 0 min Lane 2: MYRM353 [IcsA::BIO] 5 min Lane 3: MYRM353 [IcsA::BIO] 15 min Lane 4: MYRM353 [IcsA::BIO] 20 min Lane 5: MYRM612 [IcsA::BIO D717G] 0 min Lane 6: MYRM612 [IcsA::BIO D717G] 5 min Lane 7: MYRM612 [IcsA::BIO D717G] 15 min Lane 8: MYRM612 [IcsA::BIO D717G] 20 min 232

233

Figure 4.11 Construction of various pSU23-IcsA plasmids. pIcsAWT, pIcsA::BIO, pIcsAi248 and pIcsA::BIO Y716G D717G were digested with PstI and SalI, the icsA fragments were gel extracted (Section 2.3.3.1) and subsequently ligated with the likewise digested and SAP-treated pSU23 vector. The ligated plasmids were transformed into DH5α and grown on LB agar supplemented with Cm. Cm-resistant colonies were selected and named MYRM637 [pSU23-IcsAWT], MYRM638 [pSU23-IcsA::BIO], MYRM640

[pSU23-IcsAi248], and MYRM642 [pSU23-IcsA::BIO Y716G D717G]. The resultant plasmids were confirmed by restriction enzyme digestion and transformed into S. flexneri ΔicsA (RMA2041) and S. flexneri ΔicsA ΔrmlD (RMA2043). IcsA protein expression was subsequently examined by Western immunoblotting (Section 4.9). Plasmids are not drawn to scale.

234

Figure 4.12 Western immunoblotting of S. flexneri S-LPS and R-LPS expressing IcsA proteins encoded by pSU23 derivatives. Whole cell lysates were prepared from mid-exponential phase cultures of the indicated S. flexneri ΔicsA S-LPS (RMA2041) and S. flexneri ΔicsA ΔrmlD R-LPS (RMA2043) strains carrying plasmids encoding various IcsA proteins encoded by pSU23 derivatives, as described in Section 2.9.1. Samples were electrophoresed on an SDS-12%-PAGE gel prior to Western immunoblotting with anti-IcsA antibody. The 120 kDa band corresponds to the full length IcsA; the 85 kDa band corresponds to the cleaved form (IcsA’). Samples in each lane represent 5x107 bacteria. The samples in each lane are as follows:

Lane 1: MYRM646, ΔicsA [IcsAWT]

Lane 2: MYRM650, ΔicsA ΔrmlD [IcsAWT]

Lane 3: MYRM648, ΔicsA [IcsAi248]

Lane 4: MYRM652, ΔicsA ΔrmlD [IcsAi248] Lane 5: MYRM647, ΔicsA [IcsA::BIO] Lane 6: MYRM651, ΔicsA ΔrmlD [IcsA::BIO] Lane 7: MYRM649, ΔicsA [IcsA::BIO Y716G D717G] Lane 8: MYRM653, ΔicsA ΔrmlD [IcsA::BIO Y716G D717G] Lane 9: MYRM685, ΔicsA [pSU23] control Lane 10: MYRM655, ΔicsA ΔrmlD [pSU23] control

235

Figure 4.13a Detection of N-WASP recruitment and F-actin comet tail formation by S. flexneri S-LPS co-expressing IcsA proteins. HeLa cells were infected with mid-exponential phase S. flexneri ΔicsA S-LPS (RMA2041) carrying plasmids encoding various IcsA proteins and formalin fixed. HeLa cells and bacteria nuclei were labelled with DAPI (blue), F-actin was labelled with Alexa Fluor 488-phalloidin (green), and N-WASP was labelled with anti-N-WASP and Alexa Fluor 594-conjugated donkey anti-rabbit antibody (red), as detailed in Section 2.13.5. IF images were observed at 100x magnification. Arrows indicate N-WASP recruitment and F-actin comet tail formation. Inserts show enlarged views of the indicated region. Strains were assessed in two independent experiments. Scale bar = 10 μm. The images are as follows:

A. MYRM656, S. flexneri [pSU23-IcsAi248 + pIcsA::BIO Y716G D717G]

B. MYRM657, S. flexneri [pSU23-IcsAi248 + pIcsA::BIO V382R]

C. MYRM658, S. flexneri [pSU23-IcsA::BIO Y716G D717G + pIcsAi248] D. MYRM659, S. flexneri [pSU23-IcsA::BIO Y716G D717G + pIcsA::BIO V382R]

E. MYRM660, S. flexneri [pSU23-IcsAWT + pBR322] F. MYRM661, S. flexneri [pSU23-IcsA::BIO + pBR322]

G. MYRM662, S. flexneri [pSU23-IcsAi248 + pBR322] H. MYRM663, S. flexneri [pSU23-IcsA::BIO Y716G D717G + pBR322]

I. MYRM669, S. flexneri [pSU23-IcsAWT + pIcsAi248]

J. MYRM670, S. flexneri [pSU23-IcsAWT + pIcsA::BIO Y716G D717G]

236

237

Figure 4.13b Detection of N-WASP recruitment and F-actin comet tail formation by S. flexneri S-LPS co-expressing IcsA proteins. HeLa cells were infected with mid-exponential phase S. flexneri ΔicsA S-LPS (RMA2041) carrying plasmids encoding various IcsA proteins and formalin fixed. HeLa cells and bacteria nuclei were labelled with DAPI (blue), F-actin was labelled with Alexa Fluor 488-phalloidin (green), and N-WASP was labelled with anti-N-WASP and Alexa Fluor 594-conjugated donkey anti-rabbit antibody (red), as detailed in Section 2.13.5. IF images were observed at 100x magnification. Arrows indicate N-WASP recruitment and F-actin comet tail formation. Inserts show enlarged views of the indicated region. Strains were assessed in two independent experiments. Scale bar = 10 μm. The images are as follows:

K. MYRM671, S. flexneri [pSU23-IcsAWT + IcsA::BIO V382R]

L. MYRM672, S. flexneri [pSU23-IcsA::BIO + IcsAi248] M. MYRM673, S. flexneri [pSU23-IcsA::BIO + pIcsA::BIO Y716G D717G] N. MYRM674, S. flexneri [pSU23-IcsA::BIO + pIcsA::BIO V382R]

O. MYRM686, S. flexneri [pIcsAWT + pSU23] P. MYRM687, S. flexneri [pIcsA::BIO + pSU23]

Q. MYRM688, S. flexneri [pIcsAi248 + pSU23] R. MYRM689, S. flexneri [pIcsA::BIO Y716G D717G + pSU23] S. MYRM690, S. flexneri [pIcsA::BIO V382R + pSU23]

238

239

Figure 4.14a Detection of N-WASP recruitment and F-actin comet tail formation by S. flexneri R-LPS co-expressing IcsA proteins. HeLa cells were infected with mid-exponential phase S. flexneri ΔicsA ΔrmlD R-LPS (RMA2043) carrying plasmids encoding various IcsA proteins and formalin fixed. HeLa cells and bacteria nuclei were labelled with DAPI (blue), F-actin was labelled with Alexa Fluor 488-phalloidin (green), and N-WASP was labelled with anti-N-WASP and Alexa Fluor 594- conjugated donkey anti-rabbit antibody (red), as detailed in Section 2.13.5. IF images were observed at 100x magnification. Arrows indicate N-WASP recruitment and F-actin comet tail formation. Inserts show enlarged views of the indicated region. Strains were assessed in two independent experiments. Scale bar = 10 μm. The images are as follows:

A. MYRM691, S. flexneri [pSU23-IcsA::BIO + pIcsAi248] B. MYRM692, S. flexneri [pSU23-IcsA::BIO + pIcsA::BIO Y716G D717G] C. MYRM693, S. flexneri [pSU23-IcsA::BIO + pIcsA::BIO V382R]

D. MYRM694, S. flexneri [pSU23-IcsAi248+ pIcsA::BIO Y716G D717G]

E. MYRM695, S. flexneri [pSU23-IcsAi248+ pIcsA::BIO V382R]

F. MYRM696, S. flexneri [pSU23-IcsA::BIO Y716G D717G + pIcsAi248] G. MYRM697, S. flexneri [pSU23-IcsA::BIO Y716G D717G + pIcsA::BIO V382R]

H. MYRM699, S. flexneri [pSU23-IcsAWT + pBR322] I. MYRM700, S. flexneri [pSU23-IcsA::BIO + pBR322]

J. MYRM701, S. flexneri [pSU23-IcsAi248 + pBR322]

240

241

Figure 4.14b Detection of N-WASP recruitment and F-actin comet tail formation by S. flexneri R-LPS co-expressing IcsA proteins. HeLa cells were infected with mid-exponential phase S. flexneri ΔicsA ΔrmlD R-LPS (RMA2043) carrying plasmids encoding various IcsA proteins and formalin fixed. HeLa cells and bacteria nuclei were labelled with DAPI (blue), F-actin was labelled with Alexa Fluor 488-phalloidin (green), and N-WASP was labelled with anti-N-WASP and Alexa Fluor 594- conjugated donkey anti-rabbit antibody (red), as detailed in Section 2.13.5. IF images were observed at 100x magnification. Arrows indicate N-WASP recruitment and F-actin comet tail formation. Inserts show enlarged views of the indicated region. Strains were assessed in two independent experiments. Scale bar = 10 μm. The images are as follows:

K. MYRM702, S. flexneri [pSU23-IcsA::BIO Y716G D717G + pBR322]

L. MYRM703, S. flexneri [pIcsAWT + pSU23] M. MYRM704, S. flexneri [pIcsA::BIO + pSU23]

N. MYRM705, S. flexneri [pIcsAi248 + pSU23] O. MYRM706, S. flexneri [pIcsA::BIO Y716G D717G + pSU23] P. MYRM707, S. flexneri [pIcsA::BIO V382R + pSU23]

Q. MYRM708, S. flexneri [pSU23-IcsAWT + pIcsAi248]

R. MYRM709, S. flexneri [pSU23-IcsAWT + IcsA::BIO Y716G D717G]

S. MYRM710, S. flexneri [pSU23-IcsAWT + IcsA::BIO V382R]

242

243

244

Chapter Five

Expression and purification of N-WASP domains and IcsA protein

Chapter 5: Expression and purification of N-WASP domains and IcsA protein

5.1 Introduction

As outlined in Section 1.6.4, the poorly understood interaction between IcsA and N-WASP requires further investigation. Several N-WASP domains (WH1 and CRIB domains) have been shown to be involved in interacting with IcsA via pull down assays and IF microscopy (Lommel et al., 2001; Moreau et al., 2000; Suzuki et al., 2002). Moreau et al. (2000) reported that the GFP-CRIB protein was recruited to the Shigella surface and formed F-actin tail in HeLa cells. Similarly, Lommel et al. (2001) showed that both GFP-B-GBD and GFP-WH1 were recruited to the Shigella surface in N-WASP-defective fibroblasts without inducing actin tails. Suzuki et al. (2002) showed that the N-WASP fragments that contained the WH1 domain interacted with GST-VirG 3 (aa 53-506) in pull down assays. The authors also reported that the GBD domain did not interact with GST-VirG 3 (Suzuki et al., 2002). As different results were obtained from various assays, it is still unknown how these domains interact with IcsA. The binding order of N-WASP domains to IcsA, and the region of IcsA they interact with, are still unclear.

Chapter 4 investigated N-WASP/IcsA interaction via in situ detection of N-WASP recruitment by intracellular S. flexneri expressing mutated IcsA. However, it was unable to determine which N-WASP domain was involved in IcsA binding/interaction. In vitro protein binding assay is an alternative approach to investigate the relationship between N-WASP and IcsA. This approach may allow the confirmation of the N-WASP domain(s) responsible for IcsA binding, as well as the binding affinity, and the region in IcsA that they bind. Purified proteins (N-WASP and its sub-domains, and IcsA) are required to develop the protein binding assays. Hence, this chapter covers the production and purification of various N-WASP sub- domains fused to GFP and also the IcsA passenger α-domain, as well as providing some preliminary data for the protein binding assays. However, these experiments could not be repeated due to PhD time limitations.

245

5.2 Purification of N-WASP and sub-domains GFP fusions pTriEx6 (Novagen) is a vector that allows proteins to be expressed with a StrepTagII tag

(Strep) and a His10 tag (His) sequence at their N- and C- termini, respectively. The following sections describe the cloning of various sequences of GFP-N-WASP and GFP-N-WASP sub- domains (which will be referred as “GFP-N-WASP”, unless otherwise stated) (Section 5.2.1), and EGFP (Section 5.2.2), into pTriEx6 for protein overexpression, and purification.

5.2.1 Construction of various pTriEx6-“GFP-N-WASP” domain plasmids Due to the unavailability of the sequence of the source plasmids made by the Michael Way laboratory (Lincoln’s Inn Fields Laboratories, London, UK), the insert regions in plasmids [pCB6-GFP-WH1], [pCB6-GFP-CRIB], [pCB6-GFP-WH1-CRIB] and [pCB6-GFP-N- WASP] (Table 2.5) were sequenced with primers MY_45F_GFP and MY_46R_CB6 (Table 2.2), as detailed in Section 2.6.3. The GFP sequence (derived from pEGFP_N1; Clontech) is located at the N-terminal end of rat N-WASP and rat N-WASP sub-domains (Frischknecht et al., 1999; Harlander et al., 2003; Lommel et al., 2001; Moreau et al., 2000). The nucleotide sequence of GFP-WH1, GFP-CRIB, GFP-WH1-CRIB and GFP-N-WASP is illustrated in Fig. 5.1, 5.2, 5.3 and 5.4, respectively. These plasmids were then used as the DNA template for PCR amplification.

Various “GFP-N-WASP” domain fragments were PCR amplified using primer sets MY_54/MY_62 (for GFP-WH1), MY_54/MY_63 (for GFP-CRIB and GFP-WH1-CRIB) and MY_54/MY_64 (for GFP-N-WASP), that contained KpnI restriction sites. The resultant PCR products were cloned into pGEMT-Easy, yielding pMYRM230 [pGEMT-E + GFP-WH1], pMYRM279 [pGEMT-E + GFP-CRIB], pMYRM233 [pGEMT-E + GFP-WH1-CRIB], and pMYRM235 [pGEMT-E + GFP-N-WASP]. The relevant “GFP-N-WASP” fusions were then excised by digestion with KpnI, and sub-cloned into the likewise digested, SAP-treated pTriEx6 vector (Fig. 5.5). The resultant plasmids were named pMYRM239 [pTriEx6-GFP- WH1], pMYRM290 [pTriEx6-GFP-CRIB], pMYRM242 [pTriEx6-GFP-WH1-CRIB] and pMYRM244 [pTriEx6-GFP-N-WASP]. All constructs were confirmed by DNA sequencing

246

1 ACGTATTAGT CATCGCTATT ACCATGGTGA TGCGGTTTTG GCAGTACACC AATGGGCGTG 61 GATAGCGGTT TGACTCACGG GGATTTCCAA GTCTCCACCC CATTGACGTC AATGGGAGTT 121 TGTTTTGGCA CCAAAATCAA CGGGACTTTC CAAAATGTCG TAATAACCCC GCCCCGTTGA 181 CGCAAATGGG CGGTAGGCGT GTACGGTGGG AGGTCTATAT AAGCAGAGCT CGTTTAGTGA 241 ACCGTCAGAA TTAATTCAGA TCTGGTACCA CCATGAGCAA GGGCGAGGAG CTGTTCACCG 301 GGGTGGTGCC CATCCTGGTC GAGCTGGACG GCGACGTAAA CGGCCACAAG TTCAGCGTGT 361 CCGGCGAGGG CGAGGGCGAT GCCACCTACG GCAAGCTGAC CCTGAAGTTC ATCTGCACCA 421 CCGGCAAGCT GCCCGTGCCC TGGCCCACCC TCGTGACCAC CCTGACCTAC GGCGTGCAGT 481 GCTTCAGCCG CTACCCCGAC CACATGAAGC AGCACGACTT CTTCAAGTCC GCCATGCCCG 541 AAGGCTACGT CCAGGAGCGC ACCATCTTCT TCAAGGGCGA CGGCAACTAC AAGACCCGCG 601 CCGAGGTGAA GTTCGAGGGC GACACCCTGG TGAACCGCAT CGAGCTGAAG GGCATCGACT 661 TCAAGGAGGA CGGCAACATC CTGGGGCACA AGCTGGAGTA CAACTACAAC AGCCACAACG 721 TCTATATCAT GGCCGACAAG CAGAAGAACG GCATCAAGGT GAACTTCAAG ATCCGCCACA 781 ACATCGAGGA CGGCAGCGTG CAGCTCGCCG ACCACTACCA GCAGAACACC CCCATCGGCG 841 ACGGCCCCGT GCTGCTGCCC GACAACCACT ACCTGAGCAC CCAGTCCGCC CTGAGCAAAG 901 ACCCCAACGA GAAGCGCGAT CACATGGTCC TGCTGGAGTT CGTGACCGCC GCCGGGATCA 961 CTCTCGGCAT GGACGAGCTG TACAAGGGCG GCCGCGGCCC CGGGATGAGC TCGGGCCAGC 1021 AGCCCCCGCG GAGGGTCACC AACGTGGGCT CCCTGCTGCT CACCCCGCAA GAAAACGAGT 1081 CTCTTTTCTC CTTCCTCGGC AAGAAATGTG TGACTATGTC TTCAGCAGTG GTGCAGTTAT 1141 ATGCAGCTGA TCGGAACTGT ATGTGGTCAA AGAAGTGCAG TGGTGTTGCT TGTCTTGTTA 1201 AGGACAATCC TCAGAGATCT TATTTTTTAA GAATATTTGA CATTAAGGAT GGGAAATTAC 1261 TGTGGGAACA AGAGCTATAC AATAACTTTG TATATAATAG TCCTAGAGGA TATTTTCATA 1321 CCTTTGCTGG AGATACTTGT CAAGTAGCTC TTAATTTTGC CAATGAAGAA GAAGCAAAAA 1381 AGTTCCGAAA AGCAGTTACA GACCTGTTGG GTCGACGACA AAGGAAATCT GAAAAAAGAC 1441 GAGATGCTTG ATGAGAATTC CTGCAGCCCG GGGGATCCAC TAGTTCTAGA GGATCCCGGG 1501 TGGCATCCCT GTGACCCCTC CCCAGTGCCT CTCCTGGGCC CTGGAAGTTG CCACTCCAGT 1561 GCCCACCAGC CTTGTCCTAA TAAAATTAAG TTGCATCATT TTGTCTGACT AGGTGTCCTT 1621 CTATAATATT ATGGGGTGGA GGGGGGTGGT ATATGAGAGC AGGGGGCAAG TTTGGGAAGA 1681 CAACCTGTAG GGCCTGCGGG GTCTATTGGG AACCAAGCTG GAGTGCAGTG GCACAATCTT 1741 GGCTCACTGC AATCTCCGCC TCCTGGGTTC AAGCGATTCT CCTGCCTCAG CCTCCCGAGT 1801 TGTTGGGATT CCAGGCATGC ATGACCAGGC TCAGCTAATT TTTGTTTTTT TGGTAGAGAC 1861 GGGGTTTCAC CATATTGGCC AGGCTGGTCT CCAACTCCTA ATCTCAGTGA TCTACCCACC 1921 TTGGCTCCCA AATTGCTGGG ATTACAGGCG TGACCACTGC TCCCTTCCCT GTCCTTCTGA 1981 TTTAAAATAA CTATACCAGC AGAGACGTCA GACACAGCAT A

Figure 5.1 Nucleotide sequence of GFP-WH1 in pRMA2693 [pCB6-GFP-WH1]. Nucleotide sequence of GFP-WHI encoded by pCB6-GFP-WH1 was determined by performing DNA sequencing with primers MY_35F_GFP and MY_46R_CB6, as described in Section 2.6.3. The nucleotide sequence of the pCB6 vector, GFP, part of N-WASP and WH1 domain is shown in blue, green, orange, and magenta, respectively. Nucleotide sequences in black are linkers between two different sequences. Genbank accession number for rat N- WASP and GFP is D88461 and U55762, respectively.

247

1 CCATGTTGAC ATTGATTATT GACTAGTTAT TAATAGTAAT CAATTACGGG GTCATTAGTT 61 CATAGCCCAT ATATGGAGTT CCGCGTTACA TAACTTACGG TAAATGGCCC GCCTGGCTGA 121 CCGCCCAACG ACCCCCGCCC ATTGACGTCA ATAATGACGT ATGTTCCCAT AGTAACGCCA 181 ATAGGGACTT TCCATTGACG TCAATGGGTG GAGTATTTAC GGTAAACTGC CCACTTGGCA 241 GTACATCAAG TGTATCATAT GCCAAGTCCG CCCCCTATTG ACGTCAATGA CGGTAAATGG 301 CCCGCCTGGC ATTATGCCCA GTACATGACC TTACGGGACT TTCCTACTTG GCAGTACATC 361 TACGTATTAG TCATCGCTAT TACCATGGTG ATGCGGTTTT GGCAGTACAC CAATGGGCGT 421 GGATAGCGGT TTGACTCACG GGGATTTCCA AGTCTCCACC CCATTGACGT CAATGGGAGT 481 TTGTTTTGGC ACCAAAATCA ACGGGACTTT CCAAAATGTC GTAATAACCC CGCCCCGTTG 541 ACGCAAATGG GCGGTAGGCG TGTACGGTGG GAGGTCTATA TAAGCAGAGC TCGTTTAGTG 601 AACCGTCAGA ATTAATTCAG ATCTGGTACC ACCATGAGCA AGGGCGAGGA GCTGTTCACC 661 GGGGTGGTGC CCATCCTGGT CGAGCTGGAC GGCGACGTAA ACGGCCACAA GTTCAGCGTG 721 TCCGGCGAGG GCGAGGGCGA TGCCACCTAC GGCAAGCTGA CCCTGAAGTT CATCTGCACC 781 ACCGGCAAGC TGCCCGTGCC CTGGCCCACC CTCGTGACCA CCCTGACCTA CGGCGTGCAG 841 TGCTTCAGCC GCTACCCCGA CCACATGAAG CAGCACGACT TCTTCAAGTC CGCCATGCCC 901 GAAGGCTACG TCCAGGAGCG CACCATCTTC TTCAAGGGCG ACGGCAACTA CAAGACCCGC 961 GCCGAGGTGA AGTTCGAGGG CGACACCCTG GTGAACCGCA TCGAGCTGAA GGGCATCGAC 1021 TTCAAGGAGG ACGGCAACAT CCTGGGGCAC AAGCTGGAGT ACAACTACAA CAGCCACAAC 1081 GTCTATATCA TGGCCGACAA GCAGAAGAAC GGCATCAAGG TGAACTTCAA GATCCGCCAC 1141 AACATCGAGG ACGGCAGCGT GCAGCTCGCC GACCACTACC AGCAGAACAC CCCCATCGGC 1201 GACGGCCCCG TGCTGCTGCC CGACAACCAC TACCTGAGCA CCCAGTCCGC CCTGAGCAAA 1261 GACCCCAACG AGAAGCGCGA TCACATGGTC CTGCTGGAGT TCGTGACCGC CGCCGGGATC 1321 ACTCTCGGCA TGGACGAGCT GTACAAGGGC GGCCGCGGCC CCGGGGCTCC AAATGGTCCC 1381 AATCTACCCA TGGCTACAGT TGACATAAAA AATCCAGAAA TCACAACAAA CAGGTTTTAT 1441 AGTTCACAAG TCAACAACAT CTCCCACACC AAAGAAAAGA AGAAAGGAAA AGCTAAAAAG 1501 AAGAGATTAA CCAAGGCAGA TATTGGAACA CCAAGTAATT TCCAGCACAT TGGACATGTT 1561 GGTTGGGATC CAAATACAGG TTTTGATCTA AATAATTTGG ATCCAGAATT GAAGAATCTT 1621 TTTGATATGT GTGGGATCTC TGAGGCCCAG CTTAAAGACA GAGAAACATC AAAAGTTATT 1681 TATGACTTTA TTGAAAAAAC AGGAGGTGTA GAAGCTGTTA AAAATGAACT CCGAAGGCAA 1741 GCATGATGAG AATTCCTGCA GCCCGGGGGA TCCACTAGTT CTAGAGGATC CCGGGTGGCA 1801 TCCCTGTGAC CCCTCCCCAG TGCCTCTCCT GGCCCTGGAA GTTGCCACTC CAGTGCCCAC 1861 CAGCCTTGTC CTAATAAAAT TAAGTTGCAT CATTTTGTCT GACTAGGTGT CCTTCTATAA 1921 TATTATGGGG TGGAGGGGGG TGGTATGGAG CAAGGGGCAA GTTGGGAAGA CAACCTGTAG 1981 GGCCTGCGGG GTCTATTGGG AACCAAGCTG GAGTGCAGTG GCACAATCTT GGCTCACTGC 2041 AATCTCCGCC TCCTGGGTTC AAGCGATTCT CCTGCCTCAG CCTCCCGAGT TGTTGGGATT 2101 CCAGGCATGC ATGACCAGGC TCAGCTAATT TTTGTTTTTT TGGTAGAGAC GGGGTTTCAC 2161 CATATTGGCC AGGCTGGTCT CCAACTCCTA ATCTCAGGTG ATCTACCCAC CTTGGCCTCC 2221 CAAATTGCTG GGATTACAGG CGTGAACCAC TGCTCCCTTC CCTGTCCTTC TGATTTTAAA

Figure 5.2 Nucleotide sequence of GFP-CRIB in pCB6-GFP-CRIB. Nucleotide sequence of GFP-CRIB encoded by pCB6-GFP-CRIB was determined by performing DNA sequencing with primers MY_35F_GFP and MY_46R_CB6, as described in Section 2.6.3. The nucleotide sequence of the pCB6 vector, GFP, part of N-WASP and CRIB domain is shown in blue, green, orange, and cyan, respectively. Nucleotide sequences in black are linkers between two different sequences. Genbank accession number for rat N-WASP and GFP is D88461 and U55762, respectively.

248

1 ATTGGCTCAT GTCCAATATG ACCGCCATGT TGACATTGAT TATTGACTAG TTATTAATAG 61 TAATCAATTA CGGGGTCATT AGTTCATAGC CCATATATGG AGTTCCGCGT TACATAACTT 121 ACGGTAAATG GCCCGCCTGG CTGACCGCCC AACGACCCCC GCCCATTGAC GTCAATAATG 181 ACGTATGTTC CCATAGTAAC GCCAATAGGG ACTTTCCATT GACGTCAATG GGTGGAGTAT 241 TTACGGTAAA CTGCCCACTT GGCAGTACAT CAAGTGTATC ATATGCCAAG TCCGCCCCCT 301 ATTGACGTCA ATGACGGTAA ATGGCCCGCC TGGCATTATG CCCAGTACAT GACCTTACGG 361 GACTTTCCTA CTTGGCAGTA CATCTACGTA TTAGTCATCG CTATTACCAT GGTGATGCGG 421 TTTTGGCAGT ACACCAATGG GCGTGGATAG CGGTTTGACT CACGGGGATT TCCAAGTCTC 481 CACCCCATTG ACGTCAATGG GAGTTTGTTT TGGCACCAAA ATCAACGGGA CTTTCCAAAA 541 TGTCGTAATA ACCCCGCCCC GTTGACGCAA ATGGGCGGTA GGCGTGTACG GTGGGAGGTC 601 TATATAAGCA GAGCTCGTTT AGTGAACCGT CAGAATTAAT TCAGATCTGG TACCACCATG 661 AGCAAGGGCG AGGAGCTGTT CACCGGGGTG GTGCCCATCC TGGTCGAGCT GGACGGCGAC 721 GTAAACGGCC ACAAGTTCAG CGTGTCCGGC GAGGGCGAGG GCGATGCCAC CTACGGCAAG 781 CTGACCCTGA AGTTCATCTG CACCACCGGC AAGCTGCCCG TGCCCTGGCC CACCCTCGTG 841 ACCACCCTGA CCTACGGCGT GCAGTGCTTC AGCCGCTACC CCGACCACAT GAAGCAGCAC 901 GACTTCTTCA AGTCCGCCAT GCCCGAAGGC TACGTCCAGG AGCGCACCAT CTTCTTCAAG 961 GGCGACGGCA ACTACAAGAC CCGCGCCGAG GTGAAGTTCG AGGGCGACAC CCTGGTGAAC 1021 CGCATCGAGC TGAAGGGCAT CGACTTCAAG GAGGACGGCA ACATCCTGGG GCACAAGCTG 1081 GAGTACAACT ACAACAGCCA CAACGTCTAT ATCATGGCCG ACAAGCAGAA GAACGGCATC 1141 AAGGTGAACT TCAAGATCCG CCACAACATC GAGGACGGCA GCGTGCAGCT CGCCGACCAC 1201 TACCAGCAGA ACACCCCCAT CGGCGACGGC CCCGTGCTGC TGCCCGACAA CCACTACCTG 1261 AGCACCCAGT CCGCCCTGAG CAAAGACCCC AACGAGAAGC GCGATCACAT GGTCCTGCTG 1321 GAGTTCGTGA CCGCCGCCGG GATCACTCTC GGCATGGACG AGCTGTACAA GGGCGGCCGC 1381 GGCCCCGGGA TGAGCTCGGG CCAGCAGCCC CCGCGGAGGG TCACCAACGT GGGCTCCCTG 1441 CTGCTCACCC CGCAAGAAAA CGAGTCTCTT TTCTCCTTCC TCGGCAAGAA ATGTGTGACT 1501 ATGTCTTCAG CAGTGGTGCA GTTATATGCA GCTGATCGGA ACTGTATGTG GTCAAAGAAG 1561 TGCAGTGGTG TTGCTTGTCT TGTTAAGGAC AATCCTCAGA GATCTTATTT TTTAAGAATA 1621 TTTGACATTA AGGATGGGAA ATTACTGTGG GAACAAGAGC TATACAATAA CTTTGTATAT 1681 AATAGTCCTA GAGGATATTT TCATACCTTT GCTGGAGATA CTTGTCAAGT AGCTCTTAAT 1741 TTTGCCAATG AAGAAGAAGC AAAAAAGTTC CGAAAAGCAG TTACAGACCT GTTGGGTCGA 1801 CGACAAAGGA AATCTGAAAA AAGACGAGAT GCTCCAAATG GTCCCAATCT ACCCATGGCT 1861 ACAGTTGACA TAAAAAATCC AGAAATCACA ACAAACAGGT TTTATAGTTC ACAAGTCAAC 1921 AACATCTCCC ACACCAAAGA AAAGAAGAAA GGAAAAGCTA AAAAGAAGAG ATTAACCAAG 1981 GCAGATATTG GAACACCAAG TAATTTCCAG CACATTGGAC ATGTTGGTTG GGATCCAAAT 2041 ACAGGTTTTG ATCTAAATAA TTTGGATCCA GAATTGAAGA ATCTTTTTGA TATGTGTGGG 2101 ATCTCTGAGG CCCAGCTTAA AGACAGAGAA ACATCAAAAG TTATTTATGA CTTTATTGAA 2161 AAAACAGGAG GTGTAGAAGC TGTTAAAAAT GAACTCCGAA GGCAAGCATG ATGAGAATTC 2221 CTGCAGCCCG GGGGATCCAC TAGTTCTAGA GGATCCCGGG TGGCATCCCT GTGACCCCTC 2281 CCAGTGCTCT C

Figure 5.3 Nucleotide sequence of GFP-WH1-CRIB in pCB6-GFP-WH1-CRIB. Nucleotide sequence of GFP-WH1-CRIB encoded by pCB6-GFP-WH1-CRIB was determined by performing DNA sequencing with primers MY_35F_GFP and MY_46R_CB6, as described in Section 2.6.3. The nucleotide sequence of the pCB6 vector, GFP, part of N- WASP, WH1 and CRIB domain is shown in blue, green, orange, magenta and cyan, respectively. Nucleotide sequences in black are linkers between two different sequences. Genbank accession number for rat N-WASP and GFP is D88461 and U55762, respectively.

249

1 ATGAGCAAGG GCGAGGAGCT GTTCACCGGG GTGGTGCCCA TCCTGGTCGA GCTGGACGGC 61 GACGTAAACG GCCACAAGTT CAGCGTGTCC GGCGAGGGCG AGGGCGATGC CACCTACGGC 121 AAGCTGACCC TGAAGTTCAT CTGCACCACC GGCAAGCTGC CCGTGCCCTG GCCCACCCTC 181 GTGACCACCC TGACCTACGG CGTGCAGTGC TTCAGCCGCT ACCCCGACCA CATGAAGCAG 241 CACGACTTCT TCAAGTCCGC CATGCCCGAA GGCTACGTCC AGGAGCGCAC CATCTTCTTC 301 AAGGGCGACG GCAACTACAA GACCCGCGCC GAGGTGAAGT TCGAGGGCGA CACCCTGGTG 361 AACCGCATCG AGCTGAAGGG CATCGACTTC AAGGAGGACG GCAACATCCT GGGGCACAAG 421 CTGGAGTACA ACTACAACAG CCACAACGTC TATATCATGG CCGACAAGCA GAAGAACGGC 481 ATCAAGGTGA ACTTCAAGAT CCGCCACAAC ATCGAGGACG GCAGCGTGCA GCTCGCCGAC 541 CACTACCAGC AGAACACCCC CATCGGCGAC GGCCCCGTGC TGCTGCCCGA CAACCACTAC 601 CTGAGCACCC AGTCCGCCCT GAGCAAAGAC CCCAACGAGA AGCGCGATCA CATGGTCCTG 661 CTGGAGTTCG TGACCGCCGC CGGGATCACT CTCGGCATGG ACGAGCTGTA CAAGGGCGGC 721 CGCGGCCCCG GGATGAGCTC GGGCCAGCAG CCCCCGCGGA GGGTCACCAA CGTGGGCTCC 781 CTGCTGCTCA CCCCGCAAGA AAACGAGTCT CTTTTCTCCT TCCTCGGCAA GAAATGTGTG 841 ACTATGTCTT CAGCAGTGGT GCAGTTATAT GCAGCTGATC GGAACTGTAT GTGGTCAAAG 901 AAGTGCAGTG GTGTTGCTTG TCTTGTTAAG GACAATCCTC AGAGATCTTA TTTTTTAAGA 961 ATATTTGACA TTAAGGATGG GAAATTACTG TGGGAACAAG AGCTATACAA TAACTTTGTA 1021 TATAATAGTC CTAGAGGATA TTTTCATACC TTTGCTGGAG ATACTTGTCA AGTAGCTCTT 1081 AATTTTGCCA ATGAAGAAGA AGCAAAAAAG TTCCGAAAAG CAGTTACAGA CCTGTTGGGT 1141 CGACGACAAA GGAAATCTGA AAAAAGACGA GATGCTCCAA ATGGTCCCAA TCTACCCATG 1201 GCTACAGTTG ACATAAAAAA TCCAGAAATC ACAACAAACA GGTTTTATAG TTCACAAGTC 1261 AACAACATCT CCCACACCAA AGAAAAGAAG AAAGGAAAAG CTAAAAAGAA GAGATTAACC 1321 AAGGCAGATA TTGGAACACC AAGTAATTTC CAGCACATTG GACATGTTGG TTGGGATCCA 1381 AATACAGGTT TTGATCTAAA TAATTTGGAT CCAGAATTGA AGAATCTTTT TGATATGTGT 1441 GGGATCTCTG AGGCCCAGCT TAAAGACAGA GAAACATCAA AAGTTATTTA TGACTTTATT 1501 GAAAAAACAG GAGGTGTAGA AGCTGTTAAA AATGAACTCC GAAGGCAAGC ACCACCACCT 1561 CCTCCACCCT CAAGAGGAGG ACCTCCCCCT CCTCCTCCCC CTCCTCACAG CTCAGGCCCT 1621 CCTCCCCCTC CTGCCCGTGG AAGGGGGGCT CCTCCCCCGC CACCATCAAG AGCTCCTACT 1681 GCTGCACCTC CACCTCCACC TCCTTCTAGG CCTGGTGTTG TCGTTCCTCC ACCTCCTCCA 1741 AACAGGATGT ACCCTCCTCC ACCACCAGCC CTGCCTTCCT CAGCACCTTC AGGCCCACCA 1801 CCACCTCCGC CTCTGTCTAT GGCAGGGTCC ACAGCACCAC CACCTCCTCC ACCACCTCCC 1861 CCTCCACCAG GGCCACCACC TCCCCCTGGC CTGCCTTCTG ATGGTGACCA TCAAGTTCCA 1921 GCTTCTTCAG GAAACAAAGC AGCTCTTTTG GATCAAATTA GAGAGGGTGC TCAGCTAAAA 1981 AAAGTGGAGC AGAATAGTCG GCCCGTGTCC TGCTCAGGAA GGGATGCACT TCTAGACCAG 2041 ATACGACAGG GCATTCAGTT GAAATCCGTG TCTGATGGCC AAGAGTCCAC ACCACCAACC 2101 CCCGCGCCCA CTTCAGGAAT TGTGGGTGCG CTGATGGAAG TGATGCAGAA AAGGAGCAAA 2161 GCCATTCATT CCTCAGATGA AGATGAAGAT GATGATGATG AAGAGGATTT TCAGGATGAT 2221 GATGAGTGGG AAGACTGATG AGAATTCCTG CAGCCCGGGG GATCCACTAG TTCTAGAGGA 2281 TCCCGGGTGG CATCCCTG

Figure 5.4 Nucleotide sequence of GFP-N-WASP in pCB6-GFP-N-WASP. Nucleotide sequence of GFP-N-WASP encoded by pCB6-GFP-N-WASP was determined by performing DNA sequencing with primers MY_35F_GFP and MY_46R_CB6, as described in Section 2.6.3. The nucleotide sequence of the pCB6 vector, GFP, N-WASP is shown in blue, green, and orange, respectively. Nucleotide sequences in black are linkers between two different sequences. Genbank accession number for rat N-WASP and GFP is D88461 and U55762, respectively.

250

and restriction enzyme digestion. Plasmids pMYRM239, pMYRM290, pMYRM242 and pMYRM244 were then transformed into MYRM249 (Rosetta2(DE3) [placIq] expression strain) to give MYRM250 (MYRM249 [pTriEx6-GFP-WH1]), MYRM 295 (MYRM249 [pTriEx6-GFP-CRIB]), MYRM251 (MYRM249 [pTriEx6-GFP-WH1-CRIB]), and MYRM258 (MYRM249 [pTriEx6-GFP-N-WASP]).

5.2.2 Construction of pTriEx6-EGFP plasmid A pTriEx6-EGFP plasmid was constructed to overexpress the Strep-EGFP-His protein (Fig. 5.6) as a control for protein binding assay (Section 2.9.12) involving purified “GFP-N- WASP” fusion proteins. The egfp gene from pCB6-GFP-WH1 (pRMA2693) was initially PCR amplified using primer pairs MY_54 (KpnI) and MY_52 (SacI) and ligated into pGEMT-Easy to give pMYRM185. The egfp fragment was then excised by KpnI and SacI digestion, and ligated into the likewise digested pTriEx6, yielding pMYRM187 [pTriEx6- EGFP]. The pMYRM187 construct was confirmed by DNA sequencing and restriction enzyme digestion, prior to transformation into MYRM249 (Rosetta2(DE3) [placIq] expression strain) to give MYRM270.

5.2.3 IPTG induction of Strep-“GFP-N-WASP”-His proteins and Strep-EGFP-His The Strep-“GFP-N-WASP”-His fusion proteins were expressed from MYRM250 (Strep- GFP-WH1-His), MYRM251 (Strep-GFP-WH1-CRIB-His), MYRM295 (Strep-GFP-CRIB- His), and MYRM258 (Strep-GFP-N-WASP-His), respectively, while the expression of Strep- EGFP-His was expressed from MYMR270. Induction of these proteins was optimised and performed as described in Section 2.9.7.3. Cultures were induced with 1 mM IPTG at different temperatures (RT or 37 °C). Proteins degradation was observed at 37 °C induction (data not shown) but the amount of degraded protein was significantly reduced when cultures were induced at RT. Hence, MYRM250, MYRM251, MYRM258, MYRM295 and MYRM270 were grown to mid-exponential phase at 37 °C and IPTG induction was carried out at RT for 1 h. The expression of various Strep-“GFP-N-WASP”-His fusion proteins and

251

Figure 5.5 Construction of various pTriEx6-“GFP-N-WASP” domain plasmids. pTriEx6-GFP-WH1 (pMYRM239), pTriEx6-GFP-CRIB (pMYRM290), pTriEx6-GFP-WH1- CRIB (pMYRM242), and pTriEx6-GFP-N-WASP (pMYRM244) plasmids were constructed by PCR amplifying the relevant “GFP-N-WASP” domain fragments from pCB6-GFP-WH1, pCB6-GFP-CRIB, pCB6-GFP-WH1-CRIB and pCB6-GFP-N-WASP, respectively, as described in Section 2.6.2. Primer pairs that contained the KpnI restriction sites: MY_54/MY_62 (for GFP-WH1), MY_54/MY_63 (for GFP-CRIB and GFP-WH1-CRIB) and MY_54/MY_64 (for GFP-N-WASP) were used. PCR products were ligated into pGEMT- Easy, digested with KpnI, gel extracted and subsequently cloned into the likewise digested, SAP-treated pTriEx6 vector. The resulting constructs were confirmed by restriction enzyme digestion and DNA sequencing. Plasmids are not drawn to scale.

252

253

Figure 5.6 Construction of pTriEx6-EGFP plasmid. The egfp gene from pCB6-GFP-WH1 (pRMA2693) was PCR amplified using primer pairs MY_54 (KpnI) and MY_52 (SacI) and ligated into pGEMT-Easy, resulting in pMYRM185. pMYRM185 was subsequently digested with KpnI and SacI, gel extracted and cloned into the likewise digested pTriEx6 vector, yielding pMYRM187 [pTriEx6-EGFP]. The construct was confirmed by restriction enzyme digestion and DNA sequencing. Plasmids are not drawn to scale. Strep-EGFP-His protein was then examined by IF microscopy. The GFP-fused proteins were successfully expressed by all strains after 1 mM IPTG induction at RT (Fig. 5.7).

254

The expression of various proteins was also examined by Western immunoblotting with anti-His antibody, as described in Section 2.9.6. The sizes of the Strep-GFP-WH1-His (~ 46 kDa) (Fig. 5.8A), Strep-GFP-WH1-CRIB (~ 70 kDa) (Fig. 5.8B), Strep-GFP-N-WASP-His (~ 90 kDa) (Fig. 5.8C), Strep-GFP-CRIB-His (~ 45 kDa) (Fig. 5.8D) and Strep-EGFP-His (~ 30 kDa) (Fig. 5.8E) proteins were as expected after IPTG induction. However, some leaky expression from the vectors was observed for strains MYRM250, MYRM251, MYRM295 and MYRM270 without induction (Fig. 5.8A, 5.8B, 5.8D and 5.8E, lane 1).

5.2.4 Cell fractionation In order to determine the solubility of the expressed proteins, cell fractionation was performed on strains MYRM250, MYRM251, MYRM258, MYRM295 and MYRM270, as described in Section 2.9.9, followed by Western immunoblotting with anti-His antibody (Section 2.9.6). Strep-GFP-WH1-His (Fig. 5.9A), Strep-GFP-N-WASP-His (Fig. 5.9C), Strep-GFP-CRIB-His (Fig. 5.9D) and Strep-EGFP-His (Fig. 5.9E) proteins were detected in the cytoplasm, IM and OM fractions. In contrast, Strep-GFP-WH1-CRIB-His protein could only be detected in the cytoplasm and OM (Fig. 5.9B). Since every overexpressed protein was present in the soluble cytoplasm fraction, this fraction was used for further protein purification as described in Section 2.9.8.4.

5.2.5 Sequential purification of Strep-“GFP-N-WASP”-His proteins and Strep- EGFP-His Various Strep-“GFP-N-WASP”-His proteins and Strep-EGFP-His protein (from 0.25 L culture) were initially purified via their C-terminal His tag, as described in Section 2.9.8.4 using the ÄKTAprime plus purification system (GE Healthcare). The eluted samples from the

His10 tag purification were pooled together, and subsequently incubated with Buffer W equilibrated StrepTactin® SuperflowTM agarose (Novagen) at RT for 1 h with gentle rocking,

255

Figure 5.7 IF microscopy of E. coli Rosetta2(DE3) expressing various StrepTagII-“GFP-

N-WASP”-His10 proteins. E. coli Rosetta2(DE3) (MYRM249) expressing either Strep-GFP-WH1-His (MYRM250), Strep-GFP-WH1-CRIB-His (MYRM251), Strep-GFP-N-WASP-His (MYRM258), Strep- GFP-CRIB-His (MYRM295), or Strep-EGFP-His (MYRM270) were grown to mid- exponential phase at 37 °C, induced with 1 mM IPTG at RT for 1 h as described in Section 2.9.7.3, and heat fixed onto microscopy slides. Scale bar = 10 μm. The images are as follows:

A. MYRM250 Rosetta2(DE3) [pTriEx6-GFP-WH1] B. MYRM251 Rosetta2(DE3) [pTriEx6-GFP-WH1-CRIB] C. MYRM258 Rosetta2(DE3) [pTriEx6-GFP-N-WASP] D. MYRM295 Rosetta2(DE3) [pTriEx6-GFP-CRIB] E. MYRM270 Rosetta2(DE3) [pTriEx6-EGFP]

256

257

Figure 5.8 Expression of various StrepTagII-“GFP-N-WASP”-His10 fusion proteins detected by Western immunoblotting. MYRM249 (Rosetta2(DE3)) strains carrying [pTriEx6-GFP-WH1] (MYRM250), [pTriEx6- GFP-WH1-CRIB] (MYRM251), [pTriEx6-GFP-N-WASP] (MYRM258), [pTriEx6-GFP- CRIB] (MYRM295) or [pTriEx6-EGFP] (MYRM270), were grown to mid-exponential phase at 37 °C and induced with 1 mM IPTG at RT for 1 h, as described in Section 2.9.7.3. Whole cell samples were prepared and electrophoresed on an SDS-15%-PAGE gel prior to Western immunoblotting with anti-His (Section 2.9.4 and Section 2.9.6). Samples in each lane represent 5x107 bacteria. The lane order is as follows:

A. Lane 1: MYRM250 pre-induction Lane 2: MYRM250 induced with 1 mM IPTG

B. Lane 1: MYRM251 pre-induction Lane 2: MYRM251 induced with 1 mM IPTG

C. Lane 1: MYRM258 pre-induction Lane 2: MYRM258 induced with I mM IPTG

D. Lane 1: MYRM295 pre-induction Lane 2: MYRM295 induced with 1 mM IPTG

E. Lane 1: MYRM270 pre-induction Lane 2: MYRM270 induced with 1 mM IPTG

258

259

Figure 5.9 Induction and fractionation of various StrepTagII-“GFP-N-WASP”-His10 fusion proteins. MYRM249 (Rosetta2(DE3)) strains carrying [pTriEx6-GFP-WH1] (MYRM250), [pTriEx6- GFP-WH1-CRIB] (MYRM251), [pTriEx6-GFP-N-WASP] (MYRM258), [pTriEx6-GFP- CRIB] (MYRM295) or [pTriEx6-EGFP] (MYRM270), were grown to mid-exponential phase at 37 °C and induced with 1 mM IPTG at RT for 1 h, as described in Section 2.9.7.3. Cell fractionation was performed as described in Section 2.9.9 and samples were prepared and electrophoresed on an SDS-15%-PAGE gel prior to Western immunoblotting with anti-His (Section 2.9.4 and Section 2.9.6). The lane order is as follows: A. 7 Lane 1: MYRM250 whole cell pre-induction (5x10 bacteria) (T0) Lane 2: 10 μL 1 mM IPTG induced, cytoplasmic fraction (Cyto) Lane 3: 10 μL 1 mM IPTG induced, inner membrane fraction (IM) Lane 4: 10 μL 1 mM IPTG induced, outer membrane fraction (OM)

B. 7 Lane 1: MYRM251 whole cell pre-induction (5x10 bacteria) (T0) Lane 2: 10 μL 1 mM IPTG induced, cytoplasmic fraction (Cyto) Lane 3: 10 μL 1 mM IPTG induced, inner membrane fraction (IM) Lane 4: 10 μL 1 mM IPTG induced, outer membrane fraction (OM)

C. 7 Lane 1: MYRM258 whole cell pre-induction (5x10 bacteria) (T0) Lane 2: 10 μL 1 mM IPTG induced, cytoplasmic fraction (Cyto) Lane 3: 10 μL 1 mM IPTG induced, inner membrane fraction (IM) Lane 4: 10 μL 1 mM IPTG induced, outer membrane fraction (OM)

D. 7 Lane 1: MYRM295 whole cell pre-induction (5x10 bacteria) (T0) Lane 2: 10 μL 1 mM IPTG induced, cytoplasmic fraction (Cyto) Lane 3: 10 μL 1 mM IPTG induced, inner membrane fraction (IM) Lane 4: 10 μL 1 mM IPTG induced, outer membrane fraction (OM)

E. 7 Lane 1: MYRM270 whole cell pre-induction (5x10 bacteria) (T0) Lane 2: 10 μL 1 mM IPTG induced, cytoplasmic fraction (Cyto) Lane 3: 10 μL 1 mM IPTG induced, inner membrane fraction (IM) Lane 4: 10 μL 1 mM IPTG induced, outer membrane fraction (OM)

260

261

as described in Section 2.9.8.5. No dialysis was required for the eluted samples from the His purification prior to the Strep purification.

Strep-GFP-WH1-His (Fig. 5.10A), Strep-GFP-WH1-CRIB-His (Fig. 5.10B), Strep-GFP- N-WASP-His (Fig. 5.10C), Strep-GFP-CRIB-His (Fig. 5.10D) and Strep-EGFP-His (Fig. 5.10E) proteins with the expected size were successfully purified from sequential His- and Strep- purifications, as determined by Coomassie Blue staining and Western immunoblotting with anti-His antibody. The purified proteins were then dialysed against 1x TE buffer as detailed in Section 2.9.8.5, prior to storage at -20 °C in 50 % (v/v) glycerol. Protein concentration of the purified proteins was determined with the BCA protein assay kit (Thermo Scientific). The determined concentration of the purified proteins was (yield of 0.25 L culture): GFP-WH1 (40 μg/mL), GFP-CRIB (30 μg/mL), GFP-WH1-CRIB (25 μg/mL), GFP-N-WASP (40 μg/mL) and EGFP (100 μg/mL).

5.2.6 Optimisation of pull down assay with whole cell bacteria The purified “GFP-N-WASP” proteins from Section 5.2.5 were used in pull down assays to investigate the binding ability of these proteins to IcsA. Whole cell bacteria were used in the assays, as described in Section 2.9.12.1.

UT5600 (E. coli K-12) and RMA2242 (UT5600 expressing IcsA) were incubated with 5 μg/mL EGFP, GFP-N-WASP, GFP-WH1 or GFP-WH1-CRIB at either 37 °C, 25 °C or 4 °C. At 37 °C and 25 °C, non-specific binding of GFP-N-WASP and GFP-WH1 to UT5600 was observed (Fig. 5.11A and B, lanes 3 and 5). The GFP-WH1-CRIB protein was hardly detectable and likely due to degradation of the protein during storage. On the other hand, both GFP-N-WASP and GFP-WH1 were also pulled down by RMA2242 following incubation at 37 °C and 25 °C (Fig. 5.11A and B, lanes 11 and 13). However, due to the non-specific binding of these proteins to UT5600 under the same conditions, the binding of GFP-N-WASP and GFP-WH1 protein to RMA2242 was found to be inconclusive.

The EGFP protein did not bind non-specifically to either UT5600 or RMA2242 at any temperature (Fig. 5.11, lanes 1 and 9). Following incubation at 4 °C, none of the purified proteins were pulled down by UT5600 (Fig. 5.11C). In contrast, a low amount of GFP-N- 262

WASP and GFP-WH1 was pulled down by RMA2242 (Fig. 5.11C, lanes 11 and 13). As non- specific binding of purified proteins to whole cell bacteria was detected following incubation at 37 °C and 25 °C, the pull down assay was repeated with the addition of BSA.

S. flexneri 2457T, RMA2041 (2457T ΔicsA), E. coli UT5600 and RMA2242 were incubated with 5 μg/mL GFP-WH1 purified protein in the presence of 20 μg/mL BSA at 37 °C, 25 °C or 4 °C, as described in Section 2.9.12.1. 2457T and RMA2041 (both S-LPS) were included to examine if the presence of LPS O-antigens would affect the binding of purified “GFP-N-WASP” proteins. Both UT5600 and RMA2242 are R-LPS strains. BSA was added as a blocking reagent to prevent non-specific binding. Non-specific binding of GFP-WH1 to RMA2041 and UT5600 was detected following incubation at 37 °C (Fig. 5.12A, lanes 3 and 5), suggesting that this temperature is not ideal for pull down assays. Following incubation at 25 °C, a significant amount of GFP-WH1 was pulled down by 2457T (Fig. 5.12B, lane 1) but not by RMA2242 which also expressed the IcsA protein (Fig. 5.12B, lane 7). GFP-WH1 did not bind non-specifically to RMA2041 following incubation at 25 °C but a low amount of GFP-WH1 was pulled down by UT5600 (Fig. 5.12B, lane 5), which may be due to poor technique. Again, in spite of the presence of BSA, non-specific binding of GFP-WH1 was detected for both negative controls, RMA2041 and UT5600 following incubation at 4 °C (Fig. 5.12C). The pull down assay results obtained suggest that 25 °C is the most reliable temperature for this assay. Hence, the assay was repeated at 25 °C.

2457T, RMA2090 (2457T ΔicsA/icsA) and RMA2041 were incubated with 5 μg/mL GFP- WH1 or EGFP purified protein at 25 °C in the presence of BSA, as described in Section 2.9.12.1. As expected, both 2457T and RMA2090 pulled down GFP-WH1 protein (Fig. 5.13A, lanes 1 and 3). However, GFP-WH1 was also detected for RMA2041 (Fig. 5.13A, lane 5). As GFP-WH1 did not bind non-specifically to RMA2041 in the previous assay (Fig. 5.12B, lane 3) under the same conditions, this is likely due to inadequate washing of the bacterial cells after the incubation. The stronger GFP-WH1 bands in lanes 3 and 4 (Fig. 5.13A) indicate that a higher amount of GFP-WH1 was added into the assay with RMA2090, resulting in the uneven loading of protein. On the other hand, EGFP did not bind non- specifically to 2457T and RMA2041 except for RMA2090, which may be due to inadequate

263

Figure 5.10a Purification of various StrepTagII-“GFP-N-WASP”-His10 proteins.

MYRM249 (Rosetta2(DE3)) strains carrying [pTriEx6-GFP-WH1] (MYRM250), [pTriEx6- GFP-WH1-CRIB] (MYRM251), [pTriEx6-GFP-N-WASP] (MYRM258), [pTriEx6-GFP- CRIB] (MYRM295) or [pTriEx6-EGFP] (MYRM270), were grown to mid-exponential phase at 37 °C and induced with 1 mM IPTG at RT for 4 h, as described in Section 2.9.7.3. Cells were lysed by sonication, centrifuged, and the cytoplasmic supernatant collected (Section 2.9.7.3). The cytoplasmic samples were filtered through a 0.45 μm syringe filter membrane and loaded into the ÄKTAprime Plus system (GE Healthcare) to purify proteins via the His10- tag purification, as detailed in Section 2.9.8.4. The eluted samples were then pooled, and incubated with equilibrated StrepTactin SuperflowTM agarose (Novagen) to purify the full- length Strep-GFP-N-WASP-His domain proteins, as detailed in Section 2.9.8.5.

His10/StrepTagII purified proteins for each protein purification were loaded onto an SDS- 15%-PAGE prior to Coomassie Blue staining (upper panel) (Section 2.9.5) and Western immunoblotting with anti-His (lower panel) (Section 2.9.6). 10 μL samples were loaded into each lane. The lane order is as follows:

A. Lane 1: Strep-GFP-WH1-His protein from His purification step Lane 2: Flow through in StrepTagII purification (FT) Lanes 3 -7: Strep-GFP-WH1-His elution fraction from StrepTagII purification (E1-E5)

B. Lane 1: Strep-GFP-WH1-CRIB-His protein from His purification step Lane 2: Flow through in StrepTagII purification (FT) Lanes 3-4: Strep-GFP-WH1-CRIB-His elution fraction from StrepTagII purification (E1-E2)

264

265

Figure 5.10b Purification of various StrepTagII-“GFP-N-WASP”-His10 proteins. MYRM249 (Rosetta2(DE3)) strains carrying [pTriEx6-GFP-WH1] (MYRM250), [pTriEx6- GFP-WH1-CRIB] (MYRM251), [pTriEx6-GFP-N-WASP] (MYRM258), [pTriEx6-GFP- CRIB] (MYRM295) or [pTriEx6-EGFP] (MYRM270), were grown to mid-exponential phase at 37 °C and induced with 1 mM IPTG at RT for 4 h, as described in Section 2.9.7.3. Cells were lysed by sonication, centrifuged, and the cytoplasmic supernatant collected (Section 2.9.7.3). The cytoplasmic samples were filtered through a 0.45 μm syringe filter membrane and loaded into the ÄKTAprime Plus system (GE Healthcare) to purify proteins via the His10- tag purification, as detailed in Section 2.9.8.4. The eluted samples were then pooled, and incubated with equilibrated StrepTactin SuperflowTM agarose (Novagen) to purify the full- length Strep-GFP-N-WASP-His domain proteins, as detailed in Section 2.9.8.5.

His10/StrepTagII purified proteins for each protein purification were loaded onto SDS-15%- PAGE prior to Coomassie Blue staining (upper panel) (Section 2.9.5) and Western immunoblotting with anti-His (lower panel) (Section 2.9.6). 10 μL samples were loaded into each lane. The lane order is as follows:

C. Lane 1: Strep-GFP-N-WASP-His protein from His purification Lane 2: Flow through in StrepTagII purification (FT) Lanes 3 -7: Strep-GFP-N-WASP-His elution fraction from StrepTagII purification (E1-E5)

D. Lane 1: Strep-GFP-CRIB-His elution fraction from StrepTagII purification

E. Lanes 1-2: Strep-EGFP-His elution fraction from StrepTagII purification

266

267

Figure 5.11 Pull down assay with E. coli UT5600 and RMA2242 strains.

UT5600 (E. coli K-12) and RMA2242 (UT5600 expressing IcsA) were grown to mid- exponential phase at 37 °C. The equivalent of 5x108 bacteria were prepared, incubated with 5 μg/mL Strep-EGFP-His, Strep-GFP-N-WASP-His, Strep-GFP-WH1-His or Strep-GFP-WH1- CRIB-His purified protein (final volume 100 L in TBS) at either 37 °C, 25 °C or 4 °C, as described in Section 2.9.12.1. Bacterial cells were centrifuged, the supernatant discarded and the pellets were washed twice in cold TBS. Samples were prepared as described in Section 2.9.1 and electrophoresed on an SDS-15%-PAGE prior to Western immunoblotting with anti- His (Section 2.9.4 and Section 2.9.6). Samples in each lane are the same in all three panels (A, B, and C). Panel A = Incubation at 37 °C; Panel B = Incubation at 25 °C; Panel C = Incubation at 4 °C. Left panel = UT5600; Right panel = RMA2242. P = Whole cell bacteria; S = Supernatant. Samples in lanes 1, 3, 5, 7, 9, 11, 13 and 15 represent 5x107 bacteria. The lane order is as follows:

Left Panel = UT5600 Lane 1: Pellet of UT5600 after incubated with Strep-EGFP-His Lane 2: 10 μL Supernatant after incubated with Strep-EGFP-His Lane 3: Pellet of UT5600 after incubated with Strep-GFP-N-WASP-His Lane 4: 10 μL Supernatant after incubated with Strep-GFP-N-WASP-His Lane 5: Pellet of UT5600 after incubated with Strep-GFP-WH1-His Lane 6: 10 μL Supernatant after incubated with Strep-GFP-WH1-His Lane 7: Pellet of UT5600 after incubated with Strep-GFP-WH1-CRIB-His Lane 8: 10 μL Supernatant after incubated with Strep-GFP-WH1-CRIB-His

Right Panel = RMA2242 Lane 9: Pellet of RMA2242 after incubated with Strep-EGFP-His Lane 10: 10 μL Supernatant after incubated with Strep-EGFP-His Lane 11: Pellet of RMA2242 after incubated with Strep-GFP-N-WASP-His Lane 12: 10 μL Supernatant after incubated with Strep-GFP-N-WASP-His Lane 13: Pellet of RMA2242 after incubated with Strep-GFP-WH1-His Lane 14: 10 μL Supernatant after incubated with Strep-GFP-WH1-His Lane 15: Pellet of RMA2242 after incubated with Strep-GFP-WH1-CRIB-His Lane 16: 10 μL Supernatant after incubated with Strep-GFP-WH1-CRIB-His

268

269

Figure 5.12 Pull down assay with S. flexneri and E. coli strains. 2457T, RMA2041 (2457T∆icsA), UT5600 and RMA2242 (UT5600 expressing IcsA) were grown to mid-exponential phase at 37 °C. The equivalent of 5x108 bacteria were prepared, incubated with 5 μg/mL purified Strep-GFP-WH1-His protein and 20 g/mL BSA (final volume 100 L in TBS) at either 37 °C, 25 °C or 4 °C, as described in Section 2.9.12.1. Bacterial cells were centrifuged, the supernatant discarded and the pellets were washed twice in cold TBS. Samples were prepared as described in Section 2.9.1 and electrophoresed on an SDS-15%-PAGE prior to Western immunoblotting with anti-His (Section 2.9.4 and Section 2.9.6). Samples in each lane are the same in all three panels (A, B, and C). Panel A = Incubation at 37 °C; Panel B = Incubation at 25 °C; Panel C = Incubation at 4 °C. P = Bacteria; S = Supernatant. Samples in lanes 1, 3, 5 and 7 represent 5x107 bacteria. The lane order is as follows:

Lane 1: Pellet of 2457T after incubated with Strep-GFP-WH1-His and BSA Lane 2: 10 μL Supernatant after incubated with Strep-GFP-WH1-His and BSA Lane 3: Pellet of RMA2041 after incubated with Strep-GFP-WH1-His and BSA Lane 4: 10 μL Supernatant after incubated with Strep-GFP-WH1-His and BSA Lane 5: Pellet of UT5600 after incubated with Strep-GFP-WH1-His and BSA Lane 6: 10 μL Supernatant after incubated with Strep-GFP-WH1-His and BSA Lane 7: Pellet of RMA2242 after incubated with Strep-GFP-WH1-His and BSA Lane 8: 10 μL Supernatant after incubated with Strep-GFP-WH1-His and BSA

270

271

washing of the latter bacterial cells (Fig. 5.13B). Taken together, the purified “GFP-N- WASP” proteins seemed to bind non-specifically to bacterial surfaces, in comparison to EGFP which did not bind under the conditions used.

5.3 IcsA protein purification

Purification of the full length native IcsA protein is extremely difficult. It is a relatively large protein (120 kDa) embedded in the OM, and is easily degraded. Various truncated IcsA proteins have previously been used to investigate the interaction with N-WASP in protein binding assays (Suzuki et al., 1998). However, with the newly identified multi N-WASP interacting regions (May & Morona, 2008) (Chapter 4), the truncated IcsA proteins are no longer ideal for N-WASP protein binding assays. Hence, different approaches were undertaken to purify the IcsA passenger α-domain instead of the full length IcsA for use in N- WASP binding studies.

5.3.1 Purification of IcsAα::BIO from the culture supernatant using Dynabeads Purification of native full length IcsA from the OM has previously been proven to be problematic due to difficulties with solubilisation, protein instability and degradation (Morona laboratory, unpublished observation). As the 85 kDa IcsAα fragment is cleaved from the surface by IcsP, this cleavage property was utilised to purify the IcsAα fragment from the culture supernatant. RMA2986 (UT5600 carrying [pIcsA::BIO] [pBRR1MCS::birA] [pBAD33-icsP]) which expresses IcsA::BIO with a BIO tag sequence that can be biotinylated by BirA was grown to mid-exponential phase at 37 °C (May et al., 2012). IcsP expression was induced by 0.2 % (w/v) arabinose to cleave the surface IcsA::BIO effector domain and release it into the culture supernatant, as described in Section 2.9.7.2. The culture supernatant was then dialysed against Buffer W to remove free biotin prior to purification with Dynabeads MyOne Streptavidin T1 (Invitrogen), as described in Section 2.9.8.1.

272

Figure 5.13 Pull down assay with S. flexneri strain at 25 °C. 2457T, RMA2090 (2457T ∆icsA expressing IcsA) and RMA2041 (2457T ∆icsA) were grown to mid-exponential phase at 37 °C. The equivalent of 5x108 bacteria were prepared, incubated with 5 μg/mL purified Strep-GFP-WH1-His or Strep-EGFP-His protein and 20 g/mL BSA (final volume 100 L in TBS) at either 25 °C as described in Section 2.9.12.1. Bacterial cells were centrifuged, the supernatant discarded and the pellets were washed twice in cold TBS. Samples were prepared as described in Section 2.9.1 and electrophoresed on an SDS-15%- PAGE prior to Western immunoblotting with anti-His (Section 2.9.4 and Section 2.9.6). P = Bacteria; S = Supernatant. (A,B) Samples in lanes 1, 3 and 5 represent 5x107 bacteria. The lane order is as follows:

A. Lane 1: Pellet of 2457T after incubated with Strep-GFP-WH1-His and BSA Lane 2: 10 μL Supernatant after incubated with Strep-GFP-WH1-His and BSA Lane 3: Pellet of RMA2090 after incubated with Strep-GFP-WH1-His and BSA Lane 4: 10 μL Supernatant after incubated with Strep-GFP-WH1-His and BSA Lane 5: Pellet of RMA2041 after incubated with Strep-GFP-WH1-His and BSA Lane 6: 10 μL Supernatant after incubated with Strep-GFP-WH1-His and BSA

B. Lane 1: Pellet of 2457T after incubated with Strep-EGFP-His and BSA Lane 2: 10 μL Supernatant after incubated with Strep-EGFP-His and BSA Lane 3: Pellet of RMA2090 after incubated with Strep-EGFP-His and BSA Lane 4: 10 μL Supernatant after incubated with Strep-EGFP-His and BSA Lane 5: Pellet of RMA2041 after incubated with Strep-EGFP-His and BSA Lane 6: 10 μL Supernatant after incubated with Strep-EGFP-His and BSA

273

The free IcsA::BIO fragment was successfully purified from the culture supernatant as an 85 kDa band corresponding to the cleaved form of IcsA::BIO was detected in Western immunoblotting (Fig. 5.14, lane 4). However, due to the irreversible binding of biotin to streptavidin of Dynabeads, IcsAα::BIO could not be eluted.

5.3.2 Pull Down Assay with IcsAα::BIO bound Dynabeads Dynabeads with the bound IcsAα::BIO protein from Section 5.3.1 were used in pull down assays to investigate the binding ability of IcsAα::BIO with the purified Strep-GFP-CRIB-His protein and the Strep-EGFP-His purified protein, which was used as the negative control (Section 5.2.5). A pull down assay was performed, as described in Section 2.9.12.2. Briefly, Dynabeads with bound IcsAα::BIO were prepared as described in Section 5.3.1, the supernatant collected and the beads were washed, followed by incubation with either 80 pmoles Strep-GFP-CRIB-His or Strep-EGFP-His. After incubation at 4 °C for 1 h, the supernatant was again collected and the beads washed. As a control for non-specific binding of GFP-CRIB or EGFP to Dynabeads, the pull down assay was also performed in the absence of IcsAα::BIO by incubating Dynabeads with the purified proteins only. SDS-PAGE and Western immunoblotting were performed with anti-IcsA and anti-His antibodies.

As expected, IcsAα::BIO (85 kDa) was successfully pulled down from the culture supernatant by Dynabeads (Fig. 5.15A, lanes 4 and 6) with some unbound IcsAα::BIO proteins remaining in the supernatant (Fig. 5.15A, lanes 3 and 5), as detected in Western immunoblotting with anti-IcsA antibody. Pull down assay samples were also examined by Western immunoblotting with anti-His antibody to detect pulled down EGFP or GFP-CRIB protein. Both EGFP and GFP-CRIB proteins were detected in the supernatant after incubation with the IcsAα::BIO bound Dynabeads (Fig. 5.15B, lanes 1 and 3). However, GFP-CRIB was not pulled down by IcsAα::BIO as a protein band was not detected (Fig. 5.15B, lane 4). Notably, the concentration of GFP-CRIB was significantly lower than EGFP despite 80 pmoles of proteins being added into each assay. This could be due to the degradation of GFP- CRIB protein over time during storage. Thus, even though the GFP-CRIB protein band was

274

Figure 5.14 Purification of IcsA ::BIO from the culture supernatant using Dynabeads MyOne Streptavidin T1. RMA2986 (UT5600 carrying [pIcsA::BIO] [pBRR1MCS::birA] [pBAD33-icsP]) was grown to mid-exponential phase at 37 °C in Terrific broth (100 mL) supplemented with 0.3 % (w/v) glucose. The culture was washed, resuspended in 2 mL pre-warmed Terrific broth and the IcsP expression was induced with 0.2 % (w/v) arabinose at 37°C for 1 h, as described in Section 2.9.7.2. The culture was then centrifuged and the supernatant was collected. The culture supernatant was dialysed against Buffer W prior to purification, as described in Section 2.9.8.1. The dialysed supernatant which contained IcsA ::BIO was incubated with 200 g Dynabeads MyOne Straptavidin T1 (Invitrogen) and purified, as described in Section 2.9.8.1. Samples were prepared by adding an equal amount of sample buffer and subjected to SDS-12%-PAGE and Western immunoblotting with anti-IcsA antibody (Section 2.9.4 and Section 2.9.6). The lane order is as follows:

Lane 1: RMA2986 whole cell sample (5x107 bacteria) after IcsP induction Lane 2: 10 μL culture supernatant before dialysis Lane 3: 10 μL culture supernatant after dialysis Lane 4: 10 μL Dynabeads incubated with supernatant (IcsA ::BIO)

275

not detected in the pulled down sample, it cannot be ruled out that GFP-CRIB bound to IcsAα::BIO but was not detectable due to the low protein concentration. Hence, a new batch of Strep-GFP-CRIB-His protein would need to be purified and the pull down assay repeated.

The Strep-EGFP-His protein did not bind non-specifically to Dynabeads (Fig. 5.15B, lane 6). However, a weak band corresponding to Strep-GFP-CRIB-His was detected when incubated with Dynabeads only (Fig. 5.15B, lane 8), which may be due to inadequate washing.

Collectively, this method seems feasible as the native IcsAα::BIO can be easily purified by Dynabeads. The pull down assay needs to be repeated with other GFP-N-WASP purified proteins or a new batch of GFP-CRIB to verify this assay. Due to time constraints, this could not be repeated.

5.3.3 Construction of pBAD/MycHis::IcsAα In addition to purification of IcsAα::BIO from the culture supernatant as described in Section 5.3.1, an attempt was also taken to express and purify an IcsA α-domain without the β- domain. It was hypothesised that by expressing only the signal sequence and IcsA α-domain, the IcsA protein will be localised in the periplasm and won’t be translocated to the OM. This may then facilitate the purification process, as the IcsAα protein will be soluble and can be purified in the native state.

To create a construct that encodes the IcsA signal sequence and α-domain, pMLRM1 [pBAD33::IcsAα] (Lum & Morona, 2012) was used as a DNA template to PCR amplify the icsA α-coding region with primers MY_78 (XhoI) and MY_80 (KpnI) (Fig. 5.16).The PCR product was ligated into pGEMT-Easy and yielded pMYRM462. The icsA α-domain was excised by digesting pMYRM462 with XhoI and KpnI and subsequently ligated into the likewise digested pBAD/MycHisA [pRMA2627] vector. The resulting plasmid was named pMYRM472 [pBAD/MycHis::icsAα]. The construct was confirmed by DNA sequencing and restriction enzyme digestion. Both [pBAD/MycHisA] and [pBAD/MycHis::icsAα] were transformed into Top10, yielding MYRM474 and MYRM475, respectively.

276

5.3.4 Induction and fractionation of IcsAα-MycHis protein The expression of IcsAα-MycHis protein was examined by growing MYRM474 (Top10 [pBAD/MycHisA]) and MYRM475 (Top10 [pBAD/MycHis::icsAα]) to mid-exponential phase (in LB, supplemented with 0.3 % [w/v] glucose) at 37 °C with aeration, followed by washing and resuspending in fresh LB. The cultures were then induced with 0.2 % (w/v) arabinose at 37 °C for 2 h with aeration, as described in Section 2.9.7.4. IcsAα-MycHis protein was successfully expressed by MYRM475 after arabinose induction, as a protein of the expected protein size of ~85 kDa was detected by Western immunoblotting with anti-IcsA (Fig. 5.17A, lanes 5-6). As expected, MYRM474 did not show any IcsA band (Fig. 5.17A, lanes 1-3). Different concentrations of arabinose (0.002 %, 0.02 % and 0.2 %) were also trialled to optimise IcsAα-MycHis protein expression. However, the same level of IcsAα- MycHis protein was expressed by MYRM475 independent of the arabinose concentration (Fig. 5.17B), indicating that the concentration (0.2 % [w/v]) used was optimal.

Cell fractionation of the induced MYRM475 was performed as described in Section 2.9.9. Surprisingly, most of the IcsAα-MycHis protein was located at the OM (Fig. 5.18A, lane 6), despite the expected periplasmic localisation of the IcsAα protein. Nevertheless, the IcsAα- MycHis protein was also detected in both periplasm and cytoplasm fractions (Fig. 5.18A, lanes 3-4). Thus, the soluble IcsAα-MycHis could be purified from the cytoplasm fraction. Fig. 5.18B shows the Coomassie Blue staining of arabinose-induced MYMR475 cell fractionations.

277

Figure 5.15 Pull down assay - IcsA ::BIO on Dynabeads with purified Strep-GFP- CRIB-His protein. RMA2986 was grown to mid-exponential phase and IcsP expression was induced with 0.2 % (w/v) arabinose, as described in Section 2.9.7.2. IcsA ::BIO from the culture supernatant was pulled down by Dynabeads (Invitrogen), as described in Section 2.9.8.1. The IcsA ::BIO bound Dynabeads was then washed with Buffer P (5 times) and resuspended in 100 L Buffer P. A concentration of 80 pmoles of purified Strep-EGFP-His or Strep-GFP-CRIB-His (Section 5.2.5) was added into the IcsA ::BIO bound Dynabeads mixture and incubated at 4 °C for 1 h (Section 2.9.12.2). The supernatant was then collected and the beads were washed with Buffer P (5 times). As a control, Dynabeads without IcsA ::BIO was incubated with the purified proteins. Samples were prepared as described in Section 2.9.1 and subjected to SDS- 12%-PAGE prior to Western immunoblotting (Section 2.9.4 and Section 2.9.6) with (A) anti- IcsA antibody; and (B) anti-His antibody. WC = Bacteria; S = Supernatant; B = Beads. The lane order is as follows:

A. Anti-IcsA Lane 1: RMA2986 whole cells sample (5x107 bacteria) after IcsP induction Lane 2: 10 μL Supernatant after dialysis (contain IcsA ::BIO) Lane 3: 10 μL Supernatant of Dynabeads + IcsA ::BIO and EGFP Lane 4: 10 μL Beads after pull down assay Lane 5: 10 μL Supernatant of Dynabeads + IcsA ::BIO and GFP-CRIB Lane 6: 10 μL Beads after pull down assay

B. Anti-His Lane 1: 10 μL Supernatant of Dynabeads + IcsA ::BIO and EGFP Lane 2: 10 μL Beads after pull down assay Lane 3: 10 μL Supernatant of Dynabeads + IcsA ::BIO and GFP-CRIB Lane 4: 10 μL Beads after pull down assay Lane 5: 10 μL Supernatant of Dynabeads and EGFP only Lane 6: 10 μL Beads after pull down assay Lane 7: 10 μL Supernatant of Dynabeads and GFP-CRIB only Lane 8: 10 μL Beads after pull down assay

278

279

Figure 5.16 Construction of pBAD/MycHisA::icsAα (pMYRM472).

Plasmid pBAD/MycHis::icsAα which encodes the signal sequence and the IcsA α-domain was constructed by PCR amplifying the icsA fragment from pMLRM1 [pBAD33::icsAα] without the β-domain using primers MY_78 and MY_80 (containing XhoI and KpnI, respectively), and ligating into pGEMT-Easy to yield pMYRM462. The icsA fragment was then excised by digesting pMYRM462 with XhoI/KpnI and ligated into the likewise digested pBAD/MycHisA [pRMA2627], resulting in pMYRM472 [pBAD/MycHis::icsAα]. The construct was confirmed by DNA sequencing and restriction enzyme digestion. Plasmids are not drawn to scale.

280

281

Figure 5.17A Detection of IcsAα-MycHis expression by Western immunoblotting.

MYRM474 (Top10 [pBAD/MycHisA]) and MYRM475 (Top10 [pBAD/MycHis::icsAα]) were grown to mid-exponential phase (supplemented with 0.3 % [w/v] glucose) at 37 °C, washed once with LB, resuspended in fresh LB, and IcsA-MycHis protein expression was induced with 0.2 % (w/v) arabinose at 37 °C for 2 h with aeration, as described in Section 2.9.7.4. Samples were prepared as described in Section 2.9.1 and electrophoresed on an SDS- 12%-PAGE gel prior to Western immunoblotting with anti-IcsA antibody (Section 2.9.4 and Section 2.9.6). Samples in each lane represent 5x107 bacteria. The lane order is as follows: Lane 1: MYRM474 pre-induction (0 h) Lane 2: MYRM474 induced with 0.2 % arabinose (1 h) Lane 3: MYRM474 induced with 0.2 % arabinose (2 h) Lane 4: MYRM475 pre-induction (0 h) Lane 5: MYRM475 induced with 0.2 % arabinose (1 h) Lane 6: MYRM475 induced with 0.2 % arabinose (2 h)

Figure 5.17B Induction of IcsAα-MycHis protein with different arabinose concentrations.

MYRM475 (Top10 [pBAD/MycHis::icsAα]) was grown to mid-exponential phase (supplemented with 0.3 % [w/v] glucose) at 37 °C, washed once with LB, resuspended in fresh LB, and IcsA-MycHis protein expression was induced with 0.002 % (w/v), 0.02 % (w/v) or 0.2 % (w/v) arabinose at 37 °C for 2 h with aeration, as described in Section 2.9.7.4. Samples were prepared as described in Section 2.9.1 and electrophoresed on an SDS-12%- PAGE gel prior to Western immunoblotting with anti-IcsA antibody (Section 2.9.4 and Section 2.9.6). Samples in each lane represent 5x107 bacteria. The lane order is as follows:

Lane 1: MYRM475 pre-induced (T0) Lane 2: MYRM475 induced with 0.002 % arabinose Lane 3: MYRM475 induced with 0.02 % arabinose Lane 4: MYRM475 induced with 0.2 % arabinose

282

283

Figure 5.18 Fractionation of IcsAα-MycHis.

MYRM475 (Top10 [pBAD/MycHis::icsAα]) was grown to mid-exponential phase (50 mL LB supplemented with 0.3 % [w/v] glucose) at 37 °C, washed once with LB, resuspended in fresh LB, and IcsA-MycHis protein expression was induced with 0.2 % (w/v) arabinose at 37 °C for 2 h with aeration, as described in Section 2.9.7.4. Cell fractionation was performed as described in Section 2.9.9 and samples were electrophoresed on SDS-12%-PAGE gels prior to (A) Western immunoblotting with anti-IcsA (Section 2.9.6); and (B) Coomassie Blue staining (Section 2.9.5). The lane order is as follows:

A. 7 Lane 1: MYRM475 pre-induction (5x10 bacteria) (T0) Lane 2: MYRM475 induced with 0.2 % arabinose (5x107 bacteria) (WC = Whole cell) Lane 3: 25 μL Periplasm fraction (Peri) Lane 4: 10 μL Cytoplasmic fraction (Cyto) Lane 5: 25 μL Inner membrane fraction (IM) Lane 6: 10 μL Outer membrane fraction (OM)

B. Lane 1: Low molecular weight standard marker 7 Lane 2: MYRM475 pre-induction (5x10 bacteria) (T0) Lane 3: MYRM475 induced with 0.2 % arabinose (5x107 bacteria) (WC = Whole cell) Lane 4: 25 μL Periplasm fraction (Peri) Lane 5: 10 μL Cytoplasmic fraction (Cyto) Lane 6: 25 μL Inner membrane fraction (IM) Lane 7: 10 μL Outer membrane fraction (OM)

284

285

5.3.5 Purification of IcsAα-MycHis The IcsAα-MycHis protein expressed from MYRM475 was purified using ÄKTAprime plus purification system via its His6 tag, as described in Section 2.9.8.4. Samples obtained from the

His6 purification were electrophoresed on an SDS-12%-PAGE gel prior to Coomassie Blue staining and Western immunoblotting. Coomassie Blue staining of the eluted samples showed that many other non-specific proteins were co-purified in high concentration (eg. marked by an asterisk*) (Fig. 5.19A, lanes 4-5). On the other hand, a protein band with the expected size (85 kDa) corresponding to the IcsAα-MycHis protein was observed in the eluted samples (Fig. 5.19B, lane 4-6), as detected with anti-His. The 85 kDa IcsA -MycHis protein band was not detected in the initial cytoplasmic fraction used for purification (Fig. 5.19B, lane 2). This may be due to its concentration being below the level detectable by anti-His used in this blot. The purified IcsAα-MycHis protein was also confrimed by Western immunoblotting with anti-IcsA antibody (Fig. 5.19C). Purification of IcsAα-MycHis was successful using ÄKTAprime purification system but contained high amounts of non-specific proteins. Hence, the purification conditions (eg. wash buffer) need to be optimised to reduce the co- purification of non-specific products in future. This problem has also been observed using other approaches to purify IcsAα-His6 (Morona Laboratory, unpublished data).

5.3.6 Co-expression of chaperones and IcsAα-MycHis Most of the IcsAα-MycHis protein was located in the insoluble OM fraction when expressed in E. coli (Fig. 5.18). Chaperones were therefore co-expressed with IcsAα-MycHis in an attempt to increase the production of soluble protein and increase the yield of purified protein. The E. coli expression strain BL21(DE3) was transformed with 5 different plasmids encoding different chaperones, resulting in MYRM480 [pKJE7], MYRM481 [pGro7], MYRM482 [pG- KJE8], MYRM483 [pTf16], and MYRM484 [pG-Tf2]. These strains were subsequently transformed with [pBAD/MycHis::icsAα] and yielded strains MYRM486 (BL21(DE3) [pKJE7] [pBAD/MycHis::icsAα]), MYRM487 (BL21(DE3) [pGro7] [pBAD/MycHis::icsAα]), MYRM488 (BL21(DE3) [pG-KJE8] [pBAD/MycHis::icsAα]), MYRM489 (BL21(DE3) [pTf16] [pBAD/MycHis::icsAα]) and MYRM490 (BL21(DE3) [pG-

286

Tf2] [pBAD/MycHis::icsAα]). BL21(DE3) was also transformed with [pBAD/MycHis::icsAα] only and named MYRM485.

Expression of chaperones encoded by [pKJE8] and [pG-Tf2] is controlled by the Pzt-1 promoter which is inducible by tetracycline. In contrast, [pKJE7], [pGro7] and [pG-KJE8] possess the araB promoter that is arabinose inducible. Since [pBAD/MycHis::icsAα] also has the araB promoter, chaperones expression of various strains were induced at the same time as IcsAα-MycHis. Briefly, MYRM485, MYRM486, MYRM487, MYRM488, MYRM489 and MYRM490 were grown to mid-exponential phase (in LB supplemented with 0.3 % [w/v] glucose) at 37 °C, washed, and resuspended in fresh LB, as described in Section 2.9.7.4. Protein expression of MYRM485, MYRM486, MYRM487 and MYRM489 was induced by 0.05 % (w/v) arabinose, while MYRM488 and MYRM490 were induced with 5 ng/mL tetracycline (as suggested by the manufacturer, Takara) and 0.05 % (w/v) arabinose, at 37 °C for 2 h.

Cell fractionation of various strains was performed as described in Section 2.9.9 and illustrated in Fig. 5.20. Co-expression of IcsAα-MycHis with dnaK-dnaJ-grpE (encoded by [pKJE-7]) in MYRM486 seemed to increase the soluble IcsAα-MycHis protein in the periplasm (Fig. 5.20B, lane 3), in comparison to MYRM485 (Fig. 5.20A). The same observation was obtained when IcsAα-MycHis was co-expressed with tig (encoded by [pTf- 16]), and groES-groEL-tig (encoded by [pG-Tf2]), in MYRM489 (Fig. 5.20E, lane 3) and MYRM490 (Fig. 5.20F, lane 2), respectively. On the other hand, IcsAα-MycHis had an increased expression in the cytoplasm when co-expressed with groES-groEL (encoded by [pGro7]) in MYRM487 (Fig. 5.20C, lane 4). In contrast, co-expression with dnaK-dnaJ-grpE and groES-groEL (encoded [pG-KJE8]) in MYRM488 did not improve IcsAα-MycHis protein solubility (Fig. 5.20D). Overall, four out of five of the IcsAα- MycHis/chaperone co- expression systems seemed to increase the level of soluble IcsAα-MycHis protein in BL21(DE3) but the protein remained mostly insoluble, under the conditions used. Ideally, cell fractionation of MYRM486, MYRM487, MYRM489 and MYRM490 should be repeated in future to confirm the observation, and attempt to purify the soluble IcsAα-MycHis protein from these strains. Due to time constraints, this could not be repeated.

287

Figure 5.19 Purification of IcsAα-MycHis.

MYRM475 (Top10 [pBAD/MycHis::icsAα]) was grown to mid-exponential phase (in 0.5 L LB supplemented with 0.3% [w/v] glucose) at 37 °C, washed once with LB, resuspended in fresh LB, and IcsA-MycHis protein expression was induced with 0.2% (w/v) arabinose at 37 °C for 2 h with aeration, as described in Section 2.9.7.4. Arabinose-induced MYRM475 was centrifuged, the pellet resuspended in Binding Buffer, passed through a cell disruptor to lyse the bacterial cells and the cytoplasmic fraction was prepared as described in Section 2.9.8.4. The cytoplasmic fraction that contained the IcsAα-MycHis protein was loaded into the ÄKTAprime plus purification system and purified using the His Trap FF column (GE Healthcare). Purified protein was then pooled together and dialysed, as described in Section 2.9.8.4. Samples from His purification were electrophoresed on an SDS-12%-PAGE gel prior to (A) Coomassie Blue staining (Section 2.9.5); and Western immunoblotting (Section 2.9.6) with (B) anti-His and (C) anti-IcsA, antibodies. * indicates purified non-specific protein. The lane order is as follows:

A. Lane 1: Low molecular weight standard marker (M) Lane 2: 10 μL Flow through from His purification (FT) Lane 3 – 9: 10 μL Eluted samples (E1 – E7) Lane 10: 10 μL Cytoplasmic fraction (Cyto)

B. Lane 1: MYRM475 induced with 0.2% arabinose (5x107 bacteria) (WC = whole cell) Lane 2: 10 μL Cytoplasmic fraction (Cyto) Lane 3: 10 μL Flow through (FT) Lane 4 – 9: 10 μL Eluted samples (E1 – E6)

C. Lane 1: MYRM475 induced with 0.2% arabinose (5x107 bacteria) (WC = whole cell) Lane 2: 10 μL Cytoplasmic fraction (Cyto) Lane 3: 10 μL Eluted sample (E2)

288

289

Figure 5.20 Co-induction of chaperones and IcsAα-MycHis expression, and cell fractionation.

MYRM485 (BL21(DE3) [pBAD/MycHis::icsAα]), MYRM486 (BL21(DE3) [pBAD/MycHis::icsAα] [pKJE7]), MYRM487 (BL21(DE3) [pBAD/MycHis::icsAα] [pGro7]), MYRM488 (BL21(DE3) [pBAD/MycHis::icsAα] [pG-KJE-8]), MYRM489 (BL21(DE3) [pBAD/MycHis::icsAα] [pTF16]) and MYRM490 (BL21(DE3) [pBAD/MycHis::icsAα] [pG-Tf2]) were grown to mid-exponential phase (in 0.05 L LB supplemented with 0.3 % [w/v] glucose) at 37 °C, washed once, and resuspended in fresh LB. The expression of chaperone and IcsAα in MYRM485, MYRM486, MYRM487 and MYRM489 was induced with 0.05 % (w/v) arabinose, while the expression of chaperone and IcsAα in MYRM488 and MYRM490 were induced with 5 ng/mL tetracycline and 0.05 % (w/v) arabinose, respectively, at 37 °C for 2 h, as described in Section 5.3.6. Cell fractionation of each culture was then performed as described in Section 2.9.9 and samples were electrophoresed on SDS-12%-PAGE gels prior to Western immunoblotting with anti-IcsA (Section 2.9.4 and Section 2.9.6). Panels: A. MYRM485 expressing IcsAα-MycHis only B. MYRM486 expressing IcsAα-MycHis and dnaK-dnaJ-grpE C. MYRM487 expressing IcsAα-MycHis and groES-groEL D. MYRM488 expressing IcsAα-MycHis and dnaK-dnaJ-grpE groES-groEL E. MYRM489 expressing IcsAα-MycHis and tig F. MYRM490 expressing IcsAα-MycHis and groES-groEL-tig

Lane orders in each panel are the same: 7 Lane 1: Pre-induction (5x10 bacteria) (T0) Lane 2: Arabinose induced whole cell bacteria (5x107 bacteria) (WC) Lane 3: 25 μL Periplasmic fraction (Peri) Lane 4: 10 μL Cytoplasmic fraction (Cyto) Lane 5: 25 μL Inner membrane fraction (IM) Lane 6: 10 μL Outer membrane fraction (OM)

290

291

5.3.7 IcsAα-MycHis expression in M63 minimal media and purification Another way to improve protein solubility is to grow the bacterial strain in minimal media at low temperature. MYRM485 (BL21(DE3) [pBAD/MycHis::icsAα]) was grown to mid- exponential phase in M63 minimal media, supplemented with 0.3 % (w/v) glucose at 25 °C with aeration (~ 4 h), as described in Section 2.9.7.4. The culture was then washed, resuspended in fresh M63 minimal media, supplemented with 0.2 % (w/v) arabinose and protein expression induced overnight at 25 °C. Cell fractionation was performed as described in Section 2.9.9. Again, the IcsAα-MycHis protein was mostly insoluble but the protein solubility seemed to improve slightly when expressed at low temperature in M63 minimal media (Fig. 5.21). The cytoplasmic fraction of MYRM485 (grown in 1 L of M63 minimal media) was used in protein purification.

The IcsAα-MycHis protein from cells grown above was purified using the Profinity IMAC Ni-charged resin (Bio-Rad), as described in Section 2.9.8.3. IMAC resin was used instead of the ÄKTAprime plus purification system to test whether purification with the resin would reduce the co-purification of non-specific proteins. Briefly, cytoplasmic fraction extracted from 1 L culture was incubated with the equilibrated IMAC resin at RT for 1 h with gentle rotation. The mixture was then centrifuged, the supernatant collected (flow through), and the resin washed 6 times with wash buffer (0.5 % [v/v] glycerol, 0.1 % [v/v] Triton X-100 in binding buffer pH 7.4). The IcsAα-MycHis protein was eventually eluted in 200 μL elution buffer (0.5 % [v/v] glycerol, 500 mM imidazole in binding buffer pH 7.4). In spite of the use of IMAC resin and wash buffer supplemented with 0.5 % [v/v] glycerol and 0.1 % [v/v] Triton X-100, high amounts of non-specific proteins were co-purified with the IcsAα-MycHis protein (Fig. 5.22A, lane 5). Nevertheless, IcsAα-MycHis protein was successfully purified using this method as shown in Western immunoblotting with anti-IcsA (Fig. 5.22B) and anti- His (Fig. 5.22C). The IcsAα-MycHis protein band in the cytoplasmic fraction

292

Figure 5.21 Induction and fractionation of IcsAα-MycHis in MYRM485 grown in M63 minimal media. MYRM485 (BL21(DE3) [pBAD/MycHis::icsAα]) was grown in 0.1 L M63 minimal media

(supplemented with 0.3 % [w/v] glucose) at 25 °C to OD600 ~0.6, washed, resuspended in fresh M63 minimal media and IcsAα-MycHis expression was induced with 0.2 % (w/v) arabinose at 25 °C for 16 h, as described in Section 2.9.7.4 Cell fractionation was performed as described in Section 2.9.9 and samples were electrophoresed on an SDS-12%-PAGE gel prior to Western immunoblotting with anti-His (Section 2.9.4 and Section 2.9.6). The lane order is as follows:

7 Lane 1: MYRM485 pre-induction (5x10 bacteria) (T0) Lane 2: MYRM485 induced with 0.2 % arabinose (5x107 bacteria) (WC) Lane 3: 20 μL Periplasmic fraction (Peri) Lane 4: 10 μL Cytoplasmic fraction (Cyto) Lane 5: 20 μL Inner membrane fraction (IM) Lane 6: 10 μL Outer membrane fraction (OM)

293

Figure 5.22 Purification of IcsAα-MycHis using IMAC. MYRM485 (BL21(DE3) [pBAD/MycHis::icsAα]) was grown in 1 L M63 minimal media

(supplemented with 0.3 % [w/v] glucose) at 25 °C to OD600 ~0.6, washed, resuspended in fresh M63 minimal media and IcsAα-MycHis expression was induced with 0.2 % (w/v) arabinose at 25 °C for 16 h, as described in Section 2.9.7.4. The culture was centrifuged, the pellet resuspended in binding buffer, lysed by passing through the cell disruptor, and the cytoplasmic fraction was obtained, as described in Section 2.9.8.3. The cytoplasmic sample was incubated with 50 μL (bed volume) equilibrated Profinity IMAC Ni-Charged Resin (Bio- Rad) at RT for 1 h with gentle rotation, as described in Section 2.9.8.3. The beads were then washed 6x with wash buffer (at RT for 5 min each wash with gentle rotation) and eluted in 200 μL elution buffer (at RT for 15 min with gentle rotation). Samples were solubilised in sample buffer and electrophoresed on an SDS-12%-PAGE gel prior to (A) Coomassie Blue staining (Section 2.9.5); and Western immunoblotting (Section 2.9.6) with (B) anti-IcsA and (C) anti-His, antibodies. The lane order is as follows:

Panel (A) Coomassie Blue staining Lane 1: Low molecular weight standard marker (M) Lane 2: MYRM485 induced with 0.2 % arabinose (5x107 bacteria) (WC) Lane 3: 10 μL Cytoplasmic fraction (Cyto) Lane 4: 10 μL Flow through (FT) Lane 5: 10 μL Eluted sample (E)

Western immunoblotting with: Panel (B) anti-IcsA; and Panel (C) anti-His 7 Lane 1: MYRM485 pre-induction (5x10 bacteria) (T0) Lane 2: MYRM485 induced with 0.2 % arabinose (5x107 bacteria) (WC) Lane 3: 10 μL Cytoplasmic fraction (Cyto) Lane 4: 10 μL Flow through (FT) Lane 5: 10 μL Eluted sample (E) Lane 6: 10 μL IMAC beads (Beads)

294

295

was not detected by anti-His (Fig. 5.22C, lane 3), which is likely due to the anti-His antibody being not as sensitive as the anti-IcsA when the protein level is low. Notably, the IcsAα- MycHis protein was not fully eluted from the IMAC resin (Fig. 5.22B and C, lane 6). Hence, the washing and elution conditions should be further optimised to reduce the co-purification of non-specific products and increase the yield of purified protein. Due to PhD time constraints, this could not be undertaken.

5.4 Summary

This chapter described the protein overexpression and purification of various “GFP-N- WASP” fusion proteins and IcsA α-domain protein, as well as pull down assays that examined the interaction between N-WASP and IcsA.

Various StrepTagII/His10-tagged “GFP-N-WASP” fusion proteins were successfully purified and used in protein binding assays. Pull down assays that involved whole cell bacteria (E. coli and S. flexneri) and purified “GFP-N-WASP” fusion proteins suggest that 25 °C is an optimal temperature for protein binding. However, non-specific binding of “GFP-N- WASP” fusion protein to the bacterial surface was also observed. To overcome this issue, the washing condition could be improved by increasing the concentration of NaCl in TBS, for example.

Different approaches were undertaken to purify the IcsAα protein. The most effective method was the purification of IcsAα::BIO protein from the culture supernatant using Dynabeads. However, the binding between biotin and streptavidin is irreversible and hence, it was not possible to elute the purified IcsAα::BIO protein using mild conditions. In addition, the protein binding assay that involved the pulled down IcsAα::BIO and purified “GFP-N- WASP” protein seemed feasible because non-specific binding was not observed for the purified EGFP protein. This assay should be repeated by using either other or newly purified “GFP-N-WASP” proteins.

Co-expression of IcsAα-MycHis with some chaperones seemed to increase the levels of protein solubility. On the other hand, induction of IcsAα-MycHis protein expression in M63 minimal media at low temperature also seemed to increase the protein solubility slightly. 296

Hence, IcsAα-MycHis solubility could be further improved by co-expressing IcsAα-MycHis and chaperones in M63 minimal media at low temperature.

Overall, IcsAα-MycHis protein expressed in E. coli was successfully overexpressed and partially purified after multiple attempts. Unfortunately, high amount of non-specific proteins were also present in the samples. This has also been observed in other attempts in our laboratory to purify IcsAα-His6 and other GST-IcsAα-His6 fusion protein (Morona laboratory, unpublished data). Hence, purification of IcsAα protein requires further optimisation (for both IMAC batch purification and purification with the ÄKTAprime plus purification system).

297

298

Chapter Six

S. flexneri 2457T icsB mutant construction and characterisation

Chapter 6: S. flexneri 2457T icsB mutant construction and characterisation

6.1 Introduction

The IcsB effector protein (52 kDa, 494 aa) of S. flexneri is encoded by the icsB gene which is located upstream of the ipa genes on the 220 kb virulence plasmid (Allaoui et al., 1992). IcsB is secreted via TTSS and the binding of IcsB to the polarly distributed IcsA protein improves the intracellular survival of Shigella by preventing interaction of the autophagic protein, Atg5, with IcsA. Autophagy is inhibited when IcsB is present as both IcsB and Atg5 share the same binding region on IcsA (aa 320-433) (Ogawa et al., 2003; Ogawa et al., 2005). Ogawa et al. (2005) demonstrated that IcsB is not required for invasion but plays an important role at the post-invasion stage because the YSH6000 S. flexneri 2a ∆icsB mutant formed smaller plaques in plaque assays when compared to wild-type YSH6000 or an ∆icsB/pTB-IcsB-IpgA complemented strain, indicating that the ∆icsB mutant was defective in performing intercellular spreading. Furthermore, Ogawa et al. (2005) showed that IcsB is chaperoned by IpgA, which is encoded by the immediate downstream ipgA gene. IcsB and IpgA are produced as a fusion protein (IcsB-IpgA) due to the presence of an amber stop codon at icsB. IpgA is suggested to stabilise IcsB, prevent IcsB degradation and facilitate IcsB secretion via the TTSS. In addition, the N-WASP IR II (aa 330-382) overlaps with the IcsB/Atg5 binding region (aa 320-433) (Chapter 4) (May & Morona, 2008). The aim of this chapter was to create an S. flexneri 2a icsB mutant and to investigate the relationship between IcsB, Atg5, N-WASP and IcsA.

6.2 Mutagenesis of S. flexneri icsB in 2457T

A non-polar S. flexneri 2457T ΔicsB mutant was constructed as described by Ogawa et al. (2003) and Datsenko and Wanner (2000) using λ-red phage mutagenesis (Section 2.8.2), to investigate the relationship between IcsB, Atg5 and N-WASP with IcsA. Briefly, two DNA fragments encompassing a region from nucleotide 1434 upstream of the 5’ end of icsB

299

Figure 6.1A Construction of the ∆icsB cassette. The 2457T ∆icsB mutant was constructed by -red mutagenesis. Firstly, two DNA fragments encompassing upstream and downstream regions of the icsB gene were PCR amplified using primers MY_28/MY_29 (with SacI and SmaI, respectively) and MY_30/MY_31 (with SmaI and XbaI, respectively), respectively. The amplified products were then ligated into pGEMT- Easy to give pGEMT-E::SacI-SmaI and pGEMT-E::SmaI-XbaI, respectively. The amplified genes were confirmed by DNA sequencing. pGEMT-E::SacI-SmaI was digested with SacI/SmaI and the 1.5 kb fragment was then sub-cloned into the likewise digested pUC18, resulting in pUC18SS. Then, both pGEMT-E::SmaI-XbaI and pUC18SS were digested with SmaI and XbaI and the 2.26 kb SmaI-XbaI fragment was sub-cloned into the digested pUC18SS, yielding pUC18SX.

300

301

Figure 6.1B Construction of the ∆icsB::aphA-3 cassette. pRMA2803 (pUC18K::aphA-3) was digested with SmaI and the aphA-3 cassette (encodes the kanamycin resistance, ~0.8 kb) was excised and cloned into the likewise digested pUC18SX, yielding pUC18SX::aphA-3 which encodes for the disrupted icsB gene.

302

303

Figure 6.1C Construction of the 2457T ∆icsB mutant by -red phage mutagenesis. The aphA-3 disrupted icsB gene was PCR amplified from pUC18SX::aphA-3 using primers MY_41 and MY_48. The resulting PCR product was concentrated and electroporated into arabinose induced 2457T carrying pKD46, as detailed in Section 2.8.2. The transformants were grown on selective agar at 37 °C to allow recombination to occur. The ∆icsB::aphA-3 mutants were screened by PCR and colonies that were Congo Red-positive, kanamycin- resistant and ampicillin-sensitive were chosen.

304

305

through to nucleotide 31 downstream of the 5’ end (~1.5 kb), and a region from nucleotide 1405 downstream of the 5’ end through to nucleotide 3645 (~2.26 kb), were amplified by PCR from S. flexneri 2457T DNA (Section 2.6.2) using primers MY_28 /MY_29 (containing SacI and SmaI restriction sites) and MY_30 /MY_31 (containing SmaI and XbaI restriction sites), respectively (Fig. 6.1A). The resultant PCR products were cloned into pGEMT-Easy to give pGEMT-E::SacI-SmaI [pMYRM98] and pGEMT-E::SmaI-XbaI [pMYRM80], respectively. pGEMT-E::SacI-SmaI was then digested with SacI and SmaI and the 1.5 kb DNA fragment was sub-cloned into the likewise digested pUC18, resulting in pUC18SS [pMYRM99]. Subsequently, both pGEMT-E::SmaI-XbaI and pUC18SS were digested with SmaI and XbaI restriction enzymes. The 2.26 kb SmaI-XbaI DNA fragment was cloned into the likewise digested pUC18SS, yielding pUC18SX [pMYRM102].

pRMA2803 (pUC18K::aphA-3) was digested with SmaI, and the resultant aphA-3 cassette (encoding a kanamycin resistant gene, ~0.8 kb) was subsequently cloned into the SmaI digested pUC18SX in the correct orientation, resulting in pUC18SX::aphA-3 [pMYRM112] (Fig. 6.1B) which contained the disrupted icsB gene. Then, λ-red phage mutagenesis was undertaken to create an ΔicsB mutant (Section 2.8.2). Briefly, the inactivated icsB::aphA-3 gene was PCR amplified from pMYRM112 using primers MY_41 and MY_48 (Fig. 6.1C). The resulting PCR product was purified and concentrated, as described in Section 2.8.2, and electroporated into electro-competent S. flexneri 2457T expressing λ-red recombinase (encoded by pKD46). The transformants were grown on selective agar plate at 37 °C and screened for icsB gene deletion by PCR using primers MY_26/MY_27 and MY_41/MY_42, which are primer sets that target the deleted icsB region and the 5’ and 3’ end of the icsB gene, respectively (Fig. 6.2A). An icsB mutant should not have a PCR product when primer set MY_26/MY_27 was used (Fig. 6.2B), but had a 0.9 kb band that corresponds the inserted aphA-3 cassette from PCR using primer set MY_41/MY_42 (Fig. 6.2C). Then, a colony which was Congo Red-positive, kanamycin-resistant, and ampicillin-sensitive (indicative of the loss of pKD46) was selected, and named MYRM156 (S. flexneri 2457T ΔicsB). Deletion of the icsB gene was confirmed with appropriate primers and DNA sequencing.

306

6.3 Construction of S. flexneri 2457T ΔicsA ΔicsB double mutant

As the IcsB/Atg5 binding region has been shown to be located between aa 320-433 of IcsA, it was of interest to determine the specific IcsB binding/interaction site. Hence, a S. flexneri 2457T ∆icsA ΔicsB mutant was created in this study by performing -red phage mutagenesis on RMA2041 (2457T ∆icsA), as described in Section 6.2. Briefly, the inactivated icsB::aphA- 3 gene was PCR amplified from pMYRM112 using primers MY_41 and MY_48. The resulting PCR product was concentrated and electroporated into electro-competent RMA2041 expressing the λ-red system (MYRM170). The transformants were grown on selective agar plate at 37 °C and screened for icsB gene deletion by PCR using primers MY_26/MY_27 and MY_41/MY_42, which are primer sets that target the deleted icsB region and the 5’ and 3’ end of the icsB gene, respectively. The PCR screening results are shown in Fig. 6.2, where the selected mutants had the icsB gene deleted (Fig. 6.2D) and replaced by the aphA-3 cassette (~0.9 kb) (Fig. 6.2E). A colony that was Congo Red-positive, kanamycin-resistant and ampicillin-sensitive (indicative of the loss of pKD46) was selected, and named MYRM193 (S. flexneri 2457T ∆icsA ΔicsB). Deletion of the icsB gene was confirmed with appropriate primers and DNA sequencing.

6.4 Cloning of icsB

For complementation studies and protein over-expression, the icsB gene was cloned into different vectors and is elaborated in the following sections.

6.4.1 Cloning of S. flexneri 2457T icsB into pWSK29 To create a plasmid suitable for complementing the icsB::aphA-3 mutation, a fragment that covers 0.9 kb upstream of icsB that contains the icsB promoter region was obtained by PCR using primers MY_50 and MY_48 (containing SacI and KpnI, respectively), and 2457T DNA as the template. The PCR product was cloned into pGEMT-Easy to obtain pMYRM148 and subsequently digested with SacI and KpnI. The 0.9 kb-icsB fragment was then ligated with the

307

Figure 6.2 icsB::aphA-3 mutant PCR analysis. PCR was performed on selected strains with primers MY_26 and MY_27 that target the deleted icsB region and MY_41 and MY_42 that target 5’ and 3’ ends of icsB (A; size not drawn to scale). The icsB gene fragment amplified by MY_26/MY_27 and MY_41/MY_42 are ~0.98 kb and ~1.5 kb, respectively. The size of aphA-3 amplified by MY_41/MY_42 is ~0.9 kb, as indicated. (B and C): PCR screening of putative 2457T ∆icsB mutants. (E and F): PCR screening of putative 2457T ∆icsA ∆icsB mutants. 2457T DNA (diluted 1/100) was used as a positive control and MQ water was used as a template for the negative control. The lane order is as follows:

B C Lane 1: SPP1 DNA Marker Lane 1: SPP1 DNA Marker Lane 2-6: ∆icsB Colony #1 - #5 Lane 2-6: ∆icsB Colony #1 - #5 Lane 7: 2457T genomic DNA control Lane 7: 2457T genomic DNA control Lane 8: MQ control Lane 8: MQ control

D E Lane 1: SPP1 DNA Marker Lane 1: SPP1 DNA Marker Lane 2-9: ∆icsA ∆icsB Colony #1 - #8 Lane 2-4: ∆icsA ∆icsB Colony #1 - #3 Lane 10: 2457T genomic DNA control Lane 5: 2457T genomic DNA control Lane 11: MQ control Lane 6: MQ control

308

309

likewise digested pWSK29 to obtain pWSK29+0.9kb-icsB [pMYRM150]. The resulting construct was confirmed by PCR screening, restriction enzyme digestion (SacI/KpnI) and DNA sequencing. pMYRM150 was then electroporated into MYRM156 to obtain the complemented S. flexneri strain (MYRM160). As a control, pWSK29 was also electroporated into MYRM156 and yielded MYRM162.

6.4.2 Cloning of S. flexneri 2457T icsB-ipgA into pWSK29 IpgA has been suggested to stabilise IcsB and prevent IcsB degradation, hence, a 0.9 kb-icsB- ipgA fragment was PCR amplified using primers MY_50 and MY_55 (containing SacI and KpnI, respectively), and 2457T DNA as the template. The resultant PCR product was digested with SacI and KpnI, purified as described in Section 2.3.3.2, and ligated into SacI/KpnI digested pWSK29 to obtain pWSK29+0.9kb-icsB-ipgA [pMYRM181]. The construct was confirmed by PCR screening, restriction enzyme digestion (SacI/KpnI) and DNA sequencing. pMYRM181 was then electroporated into MYRM156 to obtain the complemented S. flexneri strain (MYRM183).

6.5 Purification of His6-IcsB-IpgA protein and production of polyclonal anti-IcsB antiserum

To purify IcsB protein and raise anti-IcsB antiserum, a construct encoding the icsB gene in pET52b(+) [pRMA2824] was constructed and expressed in BL21(DE3). Briefly, The icsB gene was PCR amplified using primers MY_41 (KpnI) and MY_42 (SacI) and 2457T DNA as the template. The resulting PCR product was cloned into pGEMT-Easy and yielded pMYRM103. The icsB gene fragment was then excised by digesting pMYRM103 with KpnI and SacI, cloned into the likewise digested pET52b(+) and the resultant plasmid was named pMYRM108. The construct was confirmed by PCR screening, restriction enzyme digestion (KpnI/SacI) and DNA sequencing. pMYRM108 was subsequently electroporated into BL21(DE3) and named MYRM109. A control strain was constructed by electroporating pET52b(+) into BL21(DE3) and named MYRM111. StrepTagII-IcsB-His10 protein was

310

successfully expressed after 1 mM IPTG induction (data not shown). However, full length and degraded StrepTagII-IcsB-His10 proteins were detected after His10-purification (Section 2.9.8.4), and StrepTagII-purification (Section 2.9.8.5) was subsequently performed to purify the full length Strep8-IcsB-His10 protein. Unfortunately, the full length StrepTagII-IcsB-His10 protein purification was unsuccessful as the StrepTagII sequence of the protein was presumably buried and unable to bind to the Strep•Tactin agarose (data not shown).

Therefore, an expression construct, pTB101-His6-IcsB-IpgA (pRMA2861), donated by Prof. C. Sasakawa (University of Tokyo) was used in this study.

6.5.1 IPTG induced expression and purification of His6-IcsB-IpgA

BL21(DE3) carrying [pTB101-His6-IcsB-IpgA] (MYRM137) was induced with 1 mM IPTG to over-express His6-IcsB-IpgA, and protein expression was examined by Western immunoblotting with anti-His antibody. An ~70 kDa band that corresponds to His6-IcsB-IpgA was observed after IPTG induction (Fig. 6.3A). IPTG-induced MYRM137 was lysed using the French press, and His6-IcsB-IpgA was purified from the soluble fraction (Section 2.9.7.5). Batch purification was performed as described in Section 2.9.8.2.

Samples from His-purification were electrophoresed on an SDS-12%-PAGE gel prior to

Western immunoblotting with anti-His antibody and Coomassie Blue staining. The His6-IcsB- IpgA proteins were detected in the cytoplasmic fraction and eluents (Fig. 6.3B, lanes 1 and 6- 8). The purity of eluted samples was examined by Coomassie Blue staining. However, other non-specific proteins with distinct bands were observed in the eluents (Fig. 6.3C, lanes 7-9).

Several purification attempts were undertaken to improve the purity of His6-IcsB-IpgA protein but they were also unsuccessful. Hence, the “purified” His6-IcsB-IpgA protein was electrophoresed on an SDS-12%-PAGE gel, Coomassie Blue stained and the band corresponding to the His6-IcsB-IpgA was cut out of the SDS-PAGE gel, and was homogenised into an emulsion (Section 2.9.8.2). The homogenised sample was checked with

Western immunoblotting once more to confirm the right His6-IcsB-IpgA band was cut from the gel, prior to injection into a rabbit to raise an antiserum.

311

Figure 6.3 His6-IcsB-IpgA expression and purification.

(A) BL21(DE3) carrying [pTB101-His6-IcsB-IpgA] (MYRM137) was grown in LB at 37 °C to mid-exponential phase and protein expression was induced with 1 mM IPTG for 1, 2 and 3 h, as described in Section 2.9.7.5. Whole cell samples were prepared as described in Section 2.9.1 and electrophoresed on an SDS-15%-PAGE gel prior to Western immunoblotting with anti-His antibody (Section 2.9.4 and Section 2.9.6). The size of the ~ 70 kDa His6-IcsB-IpgA protein is indicated. Samples in each lane represent 5x107 bacteria. The lane order is as follows:

Lane 1: MYRM137 pre-induction Lane 2: MYRM137 induced for 1 h Lane 3: MYRM137 induced for 2 h Lane 4: MYRM137 induced for 3 h

(B and C) MYRM137 was grown in LB, induced with 1 mM IPTG and was lysed using the French press, and centrifuged (Section 2.9.8.2). The cytoplasmic fraction was incubated with

Ni-NTA for His-purification (Section 2.9.8.2). Purified His6-IcsB-IpgA proteins were eluted in 250 mM imidazole. Samples from the purification were solubilised with an equal volume of sample buffer and electrophoresed on an SDS-15%-PAGE gel prior to (B) Western immunoblotting with anti-His antibody (Section 2.9.6) and (C) Coomassie Blue staining

(Section 2.9.5). The size of the ~ 70 kDa His6-IcsB-IpgA protein is indicated. The lane order is as follows:

B C Lane 1: MYRM137 cytoplasmic fraction Lane 1: Low molecular weight protein (5x107 bacteria ) (Cyto) marker (M) Lane 2: BenchMark Prestained Marker Lane 2: MYRM137 pre-induction 7 (M) (5x10 bacteria ) (T0) Lane 3: MYRM137 induced (5x107 Lane 3: 10 L Flow through sample (FT) bacteria ) (T1) Lane 4: 10 L Flow through sample Lane 4: 10 L Washed sample #1 (W1) (FT) Lane 5: 10 L Washed sample #5 (W5) Lane 5: 10 L Washed sample #1 (W1) Lane 6-8 : 10 L Eluted sample #1 - #3 Lane 6: 10 L Washed sample #5 (W5) (E1-E3) Lane 7-9: 10 L Eluted sample #1-#3

(E1-E3) 312

313

6.5.2 Production of polyclonal anti-IcsB-IpgA antiserum Production of the polyclonal anti-IcsB-IpgA antiserum was performed as described in Section 2.10 and the resultant anti-IcsB-IpgA antibodies were assessed by Western immunoblotting and IF microscopy.

After purification of antiserum by absorption with live bacteria (Section 2.10.2), the anti- IcsB-IpgA antiserum was tested against MYRM137 and various S. flexneri strains (WT, ΔicsB, and ΔicsB/picsB-ipgA). However, Western immunoblotting results showed that the anti-IcsB-IpgA antiserum was reacting non-specifically with a protein that had a similar molecular weight to IcsB-IpgA, as a 70 kDa band was also observed in MYRM156 (ΔicsB) and MYRM183 (ΔicsA ΔicsB) (Fig. 6.4A, lanes 3 and 4). The anti-IcsB-IpgA antiserum was then tested against samples from the His-IcsB-IpgA purification (Section 2.9.8.2) and a band corresponding in size to that of the purified His6-IcsB-IpgA protein in eluted sample was observed (Fig. 6.4B, lane 9). In addition, the anti-IcsB-IpgA antiserum reacted with a 70 kDa band in the induced sample (Fig. 6.4B, lane 3) but not in the uninduced sample (Fig. 6.4B, lane 1). These data show that the antiserum had antibodies reacting with the 70 kDa His6- IcsB-IpgA protein.

The anti-IcsB-IpgA antibodies were affinity purified as described in Section 2.10.3 and tested in Western immunoblotting against whole cell samples, as well as purified His6-IcsB- IpgA protein. Unfortunately, the 70 kDa IcsB-IpgA bands observed in previous Western immunoblots disappeared after affinity purification of the antiserum and only a 35 kDa protein was detected (Fig. 6.5). In addition, IF was performed on formalin-fixed 2457T, MYRM156 and MYRM183 with live bacteria absorbed anti-IcsB-IpgA antiserum. However, surface IcsB staining was not detectable on any strain (Fig. 6.6A-C). IcsB staining was also assayed on intracellular bacteria (2457T, MYRM156 and MYRM183) within N-WASP -/- MEF cell line (Fig. 6.6D-F). N-WASP -/- MEF cell line was used to avoid N-WASP competing with IcsB and/or Atg5 in binding to IcsA due to the overlapping N-WASP interacting region with IcsB/Atg5 binding region. Again, IcsB could not be detected with the anti-IcsB-IpgA antiserum. Nevertheless, the amount of IcsB protein bound to surface IcsA may not be high enough for IF detection. Non-specific staining on N-WASP -/- MEF cells was observed with spotty background staining (Fig. 6.6D-F). Taken together, the data suggest that 314

the affinity purified anti-IcsB-IpgA antiserum harvested from the immunised rabbit did not contain antibody that targets IcsB-IpgA fusion protein but other non-specific proteins. Therefore, the attempt to raise polyclonal anti-IcsB antiserum in a rabbit was unsuccessful, preventing any effective use to characterise IcsB expression and binding. Further attempt to purify the anti-IcsB-IpgA antibodies was not undertaken due to PhD time constraints.

6.6 Characterisation of S. flexneri 2457T ΔicsB

Ogawa et al. (2005) reported that an YSH6000 ΔicsB mutant formed smaller plaques in plaque assays due to the binding of Atg5 to IcsA which leads to autophagy formation. Hence, the S. flexneri ΔicsB mutant (MYRM156) created in Section 6.2, together with the icsB (MYRM160) and icsB-ipgA (MYRM183) complemented strains, were characterised to determine whether the phenotype for the previously reported YSH6000 ΔicsB mutant could be reproduced in this study (Ogawa et al., 2003; Ogawa et al., 2005).

6.6.1 Intercellular spreading of S. flexneri 2457T ΔicsB To investigate the ability of the ΔicsB mutant to form plaques, S. flexneri 2457T, ΔicsB (MYRM156), ΔicsB/picsB (MYRM160), ΔicsB/pWSK29 (MYRM162) and ΔicsB/picsB-ipgA (MYRM183) complemented strains were used in MDCK cells plaque assay, as detailed in Section 2.13.4.2. MDCK cells were used because it is a polarised cell line that resembles the polarised colonic epithelium, allowing S. flexneri to invade from the basolateral surface and were used by Ogawa et al. (2005).

As shown in Fig. 6.7, MYRM156 formed smaller plaques than WT S. flexneri (2457T) (*P<0.05), suggesting an S. flexneri ΔicsB mutant had been created in Section 6.2. However, MYRM160 and MYRM183 also formed plaques that were similar in size to MYRM156, despite the strains being complemented with either icsB or icsB-ipgA (n=30 plaques. Data are from two independent experiments). The results indicate that the icsB or icsB-ipgA complementation in MYRM160 and MYRM183, respectively, did not restore the function

315

Figure 6.4 Western immunoblotting with absorbed anti-IcsB-IpgA antisera. (A) Whole cell lysates of S. flexneri (2457T, MYRM156 and MYRM183) strains were prepared from cultures grown to mid-exponential phase in LB (Section 2.9.1) and electrophoresed on an SDS-15%-PAGE gel prior to Western immunoblotting (Section 2.9.4 and Section 2.9.6) with live bacteria absorbed anti-IcsB-IpgA antiserum (from Section 2.10.2). MYRM137 and MYRM228 were grown to mid-exponential phase and induced with

1 mM IPTG at 37 °C for 1 h, as described in Section 2.9.7.5. The ~ 70 kDa His6-IcsB-IpgA protein band is indicated. Samples in each lane represent 5x107 bacteria. (B) Samples from the His6-IcsB-IpgA purification were electrophoresed on an SDS-15%-PAGE gel prior to Western immunoblotting with live bacteria absorbed anti-IcsB-IpgA antiserum. The samples in each lane are as follows:

Lane 1: MYRM137 (BL21/DE3 [pTB101-His6-IcsB-IpgA]) Lane 2: 2457T Lane 3: MYRM156 (2457T∆icsB) Lane 4: MYRM183 (2457T ∆icsB/picsB-ipgA)

Lane 5: MYRM228 (2457T [pTB101-His6-IcsB-IpgA])

B 7 Lane 1: MYRM137 pre-induction (5x10 bacteria) (T0) Lane 2: BenchMark Prestained Marker (M) 7 Lane 3: MYRM137 1 mM IPTG- induced (5x10 bacteria) (T1) Lane 4: 10 L Flow through sample (FT) Lane 5-7: 10 L Washed samples #1-#3 (W1-W3) Lane 8-11: 10 L Eluted samples #1-#4 (E1-E3)

316

317

Figure 6.5 Western immunoblotting with affinity purified anti-IcsB-IpgA antiserum. Whole cell lysates of S. flexneri strains as indicated were prepared from cultures grown to mid-exponential phase (Section 2.9.1) and electrophoresed on an SDS-15%-PAGE gel prior to Western immunoblotting (Section 2.9.4 and Section 2.9.6) with affinity purified anti-IcsB-

IpgA antiserum (from Section 2.10.3). The size of the ~ 70 kDa His6-IcsB-IpgA protein is indicated. Samples in each lane (except lane 3) represent 5x107 bacteria. The samples in each lane are as follows:

Lane 1: MYRM137 (BL21/DE3 [pTB101-His6-IcsB-IpgA]) pre-induction Lane 2: MYRM137 1 mM IPTG-induced

Lane 3: 10 μL Purified His6-IcsB-IpgA protein Lane 4: 2457T Lane 5: MYRM156 (2457T∆icsB) Lane 6: MYRM160 (2457T ∆icsB/pWSK29-icsB) Lane 7: MYRM162 (2457T ∆icsB/pWSK29) Lane 8: MYRM183 (2457T ∆icsB/pWSK29-icsB-ipgA)

Lane 9: MYRM228 (2457T [pTB-His6-IcsB-IpgA]) 1 mM IPTG-induced

318

319

Figure 6.6 IF microscopy of S. flexneri using live bacteria absorbed anti-IcsB-IpgA antiserum. (A, B and C): S. flexneri strains as indicated were grown to mid-exponential phase, formalin- fixed and labelled with rabbit anti-IcsB-IpgA antiserum and Alexa 594-conjugated goat anti- rabbit secondary antibody (Section 2.9.10). (D, E and F): N-WASP-/- MEF cells were infected with mid-exponential phase S. flexneri strains as indicated and formalin fixed. N- WASP-/- MEFs cells and bacteria nuclei were labelled with DAPI (blue), and IcsB was labelled with anti-IcsB-IpgA antiserum and Alex Fluor 594-conjugated donkey anti-rabbit antibody (red) (Section 2.13.5). IF images were observed at 100x magnification. Scale bar = 10 μm. The images are as follows:

A: 2457T B: MYRM156 (2457T ∆icsB) C: MYRM183 (2457T ∆icsB/pWSK29-icsB-ipgA)

D: N-WASP-/- cells infected with 2457T E: N-WASP-/- cells infected with MYRM156 (2457T ∆icsB) F: N-WASP-/- cells infected with MYRM183 (2457T ∆icsB/pWSK29-icsB-ipgA)

320

321

Figure 6.7 Plaque formation by S. flexneri 2457T, ∆icsB mutant and complemented strains on MDCK cells. Confluent MDCK cell monolayers were pre-treated with EGTA for 1 h prior to infection with S. flexneri 2457T, ∆icsB (MYRM156), ∆icsB/picsB (MYRM160), ∆icsB/pWSK29 (MYRM162), or ∆icsB/picsB-ipgA (MYRM183) for 2 h, overlaid with gentamycin-containing agarose and incubated at 37 °C with 5 % CO2, as described in Section 2.13.4.2. A second overlay containing Neutral Red was added 24 h later and incubated for a further 6 h prior to imaging. 30 plaques were measured from each experiment. Data are represented as mean ± SEM of two independent experiments. *, P<0.05 (determined by Student’s unpaired one- tailed t test).

322

of IcsB in preventing autophagy formation. This phenotype was not expected, as it has previously been reported that the icsB or icsB-ipgA complemented strains were capable of forming WT comparable plaques (Ogawa et al., 2003; Ogawa et al., 2005). This could be due to the very low IcsB expression levels by the low copy number vector pWSK29-based icsB clones. As a result, IcsA was available for Atg5 binding and triggered autophagy formation. Unfortunately, it was not possible to examine the IcsB levels in an S. flexneri ΔicsB mutant and in the icsB complemented strains by Western immunoblotting due to the unsuccessful anti-IcsB-IpgA antiserum production as described above. In addition, plaque assays were performed on non-polarised CV-1 cells using 2457T and MYRM156, where MYRM156 formed plaques that were indistinguishable from 2457T in size (data not shown). CV-1 cells were used as they are highly amenable to infection. Rathman et al. (2000) had previously reported that their non-polar S. flexneri M90T serotype 5 ΔicsB mutant also formed WT comparable plaques on polarised Caco-2 cells, indicating the effect of a ΔicsB mutation may be strain and cell line-dependent.

6.6.2 Effect of autophagy inhibitor on S. flexneri 2457T ΔicsB intercellular spreading To investigate if the smaller plaques formed by MYRM156 were due to autophagy, an autophagy inhibitor, bafilomycin A1 (Baf-A1) was included in MDCK plaque assay. Plaques form by MYRM156 should be comparable to those form by 2457T in the presence of Baf-A1 as autophagy will be inhibited. Baf-A1 was used at a concentration of 25 nM in a previous study (Ogawa et al., 2005). However, plaques were not observed for both 2457T and MYRM156 when 10 nM or 25 nM of Baf-A1 were included in the MDCK plaque assay (data not shown). Hence, 3 nM and 5 nM Baf-A1 were tested in MDCK plaque assay with 2457T and MYRM156. Plaques formed by these strains were measured and presented in Fig. 6.8. As expected, 2457T and MYRM156 treated with DMSO had a significant difference in plaque size (*P<0.05). However, Baf-A1 (3 nM or 5 nM) treated 2457T and MYRM156 did not have a statistical difference in plaque size, although both 2457T and MYRM156 (smaller plaques) showed a similar trend to the DMSO control. This is likely due to the larger error bars formed by MYRM156 when treated with Baf-A1. The preliminary data showed that treatment with 323

Figure 6.8 Plaque formation by S. flexneri 2457T and ∆icsB mutant on Bafilomycin A1- treated MDCK cells. Confluent MDCK cell monolayers were pre-treated with EGTA for 1 h prior to infection with S. flexneri 2457T and ∆icsB (MYRM156) for 2 h, overlaid with gentamycin-containing agarose supplemented with either 3 nM Bafilomycin A1 (Baf-A1), 5 nM Baf-A1 or DMSO, and incubated at 37 °C with 5 % CO2, as described in Section 2.13.4.2. A second overlay containing Neutral Red was added 24 h later and incubated for a further 6 h prior to imaging. 30 plaques were measured from each experiment. Data are represented as mean ± SEM of two independent experiments. *, P<0.05 (determined by Student’s unpaired one-tailed t test).

324

3 nM and 5 nM of Baf-A1 did not greatly increase the plaque size of MYRM156 when compared with the DMSO treated MYRM156 control (n=30 plaques. Data are from two independent experiments). Taken together, 3 nM and 5 nM of Baf-A1 did not seem to inhibit autophagy formation. As the concentrations used were unable to reproduce a similar phenotype reported by Ogawa et al. (2003) and Ogawa et al. (2005), higher concentration of Baf-A1 should be used to obtain the optimal concentration. Due to PhD time constraints, this could not be undertaken.

6.6.3 Interaction of Atg5 and IcsA in S. flexneri 2457T ΔicsB Ogawa et al. (2005) proposed that both IcsB and Atg5 bind to IcsA competitively, whereby IcsB has a higher binding affinity to IcsA. Thus, the ability of MYRM156 to interact with Atg5 was investigated by IF microscopy. It was hypothesised that chances for MYRM156 to interact with Atg5 will be higher than for the WT control strain.

The interaction between Atg5 and IcsA in the absence of IcsB was examined by IF microscopy. N-WASP-/- MEF cells were infected with 2457T, MYRM156 or MYRM183 followed by IF with anti-Atg5 monoclonal antibody. Atg5 recruitment was not detected on the bacterial surface of all three strains (Fig. 6.9A-C). However, the result was not as expected because Atg5 should have bound to IcsA of MYRM156 as IcsB was absent, while Atg5 will have to compete with IcsB for binding to IcsA of 2457T and MYRM183. This could be due to the very low amount of Atg5 interacting with surface IcsA which was not detectable by the anti-Atg5 used. In addition, detection of endogeneous Atg5 with the anti-Atg5 monoclonal antibody was relatively weak in Western immunoblotting (Fig. 6.9D). Endogenous Atg5 (~33 kDa) always forms a complex with Atg12, hence the 55 kDa protein band (Mizushima et al., 1998). This suggests that the anti-Atg5 antibody used was not ideal in detecting Atg5 in these assays.

In another experiment, N-WASP-/- MEF cells were transfected with pGFP-Atg5 and subsequently infected with 2457T, MYRM156 or MYRM183 to test for Atg5 recruitment. Yet again, GFP-Atg5 was not detected at the pole of intracellular bacteria within the pGFP-

325

Figure 6.9 Detection of Atg5 recruitment by S. flexneri 2457T, ∆icsB mutant and the complemented strain. (A, B, C) N-WASP-/- MEF cells were infected with mid-exponential phase S. flexneri strains (2457T, MYRM156 [∆icsB] and MYRM183 [∆icsB/picsB]) and were formalin fixed. N- WASP-/- MEF cells and bacteria nuclei were labelled with DAPI (blue), and Atg5 was labelled with anti-Atg5 monoclonal antibody (Sigma) and Alex Fluor 594-conjugated donkey anti-mouse antibody (red) (Section 2.13.5). (D) HeLa cells lysate was prepared by solubilising HeLa cells (confluent) harvested from a well of a 6-well tray with trypsin (as described in Section 2.13.2) in an equal volume of sample buffer and electrophoresed on an SDS-15%-PAGE prior to Western immunoblotting with anti-Atg5 monoclonal antibody (Section 2.9.4 and Section 2.9.6). (E, F, G) N-WASP-/- MEF cells were transfected with pGFP-Atg5 (Section 2.13.6.1) prior to infection with S. flexneri strains (2457T, MYRM156 and MYRM183) and were formalin fixed. N-WASP-/- MEF cells and bacteria nuclei were labelled with DAPI (blue) (Section 2.13.5). IF images were observed at 100x magnification. Scale bar = 10 μm. Arrows indicate the locations of intracellular bacteria.

326

327

Atg5 transfected N-WASP-/- MEF cells (Fig. 6.9E-G). Taken together, the data obtained indicate that the assays used in this study could not detect any interaction between Atg5 and IcsA.

6.7 Expression of IcsAi mutants in S. flexneri 2457T ΔicsA ΔicsB The IcsB/Atg5 binding region on IcsA has been suggested to fall within aa 320-433 by Ogawa et al. (2005) via pull down assay using various truncated VirG/IcsAα fragments. Therefore, it was of interest to determine the specific IcsB/Atg5 binding site within this region. Restoration in WT plaque size would be expected if the IcsB/Atg5 binding site is disrupted because Atg5 will not be able to interact with IcsA, hence unable to trigger autophagy formation. Therefore, various pIcsAi mutants (pIcsAi326, pIcsAi369, and pIcsAi386) previously identified by May and Morona (2008) which have 5 aa insertion mutations within the IcsB/Atg5 binding region, were transformed into S. flexneri 2457T ∆icsA ΔicsB

(MYRM193). The resultant strains were named MYRM223 (S. flexneri IcsAi326 ΔicsB),

MYRM218 (S. flexneri IcsAi369 ΔicsB), and MYRM217 (S. flexneri IcsAi386 ΔicsB).

MDCK plaque assays were performed using 2457T, MYRM156, MYRM223,

MYRM218, MYRM217, KMRM141 (∆icsA/IcsAi326), KMRM107 (∆icsA/IcsAi369) and

KMRM105 (∆icsA/IcsAi386). The plaque sizes were measured and presented in Fig. 6.10. All

S. flexneri ΔicsA and S. flexneri ∆icsA ΔicsB mutant strains expressing the IcsAi mutant proteins have the same trend as 2457T and the 2457T ΔicsB mutant, where the ΔicsA/IcsAi strains formed larger plaques than the ∆icsA ΔicsB/IcsAi strains (eg. KMRM141 vs MYRM223). The data suggested that in the absence of IcsB, Atg5 was able to interact with

IcsAWT and various IcsAi mutants (IcsAi326, IcsAi369, and IcsAi386) and triggered autophagy formation which resulted in smaller plaques (***P<0.001). The results suggest that the insertion mutations did not affect Atg5 binding in an icsB mutant and IcsB/Atg5 binding site is not located between aa 326-386.

328

Figure 6.10 MDCK cells plaque assay of S. flexneri 2457T, 2457T ∆icsA expressing IcsAi

and 2457T ∆icsB ∆icsA expressing IcsAi proteins. Confluent MDCK cell monolayers were pre-treated with EGTA for 1 h prior to infection with S. flexneri strains (indicated as below) for 2 h, overlaid with gentamycin-containing agarose and incubated at 37 °C with 5 % CO2, as described in Section 2.13.4.2. A second overlay containing Neutral Red was added 24 h later and incubated for a further 6 h prior to imaging. Data are represented as mean ± SEM of 30 plaques. ***, P<0.001 (determined by Student’s unpaired one-tailed t test).

WT = 2457T MYRM156 = 2457T ∆icsB

KMRM141 = 2457T ∆icsB expressing IcsAi326

KMRM107 = 2457T ∆icsB expressing IcsAi369

KMRM105 = 2457T ∆icsB expressing IcsAi386

MYRM223 = 2457T ∆icsB ∆icsA expressing IcsAi326

MYRM218 = 2457T ∆icsB ∆icsA expressing IcsAi369

MYRM217 = 2457T ∆icsB ∆icsA expressing IcsAi386

329

6.8 Summary

This chapter described the inactivation of the icsB gene in S. flexneri 2457T and 2457T ∆icsA. Mutagenesis of icsB was performed using λ-red mutagenesis and the resultant icsB mutant strains MYRM156 (S. flexneri ∆icsB) and MYRM193 (S. flexneri ∆icsA ∆icsB) were shown to have a disrupted icsB gene via PCR screening and plaque assay (applicable to MYRM156 only).

His6-IcsB-IpgA protein was purified in this study and anti-IcsB-IpgA antiserum was raised in rabbit. However, preparing of a specific antiserum was unsuccessful because the anti-IcsB- IpgA antibody raised was unable to detect IcsB following affinity purification.

The S. flexneri ∆icsB mutant was characterised by a few approaches to attempt to reproduce the phenotype previously reported (Ogawa et al., 2003; Ogawa et al., 2005). It was shown that the ∆icsB mutant (MYRM156) formed smaller plaques than 2457T, indicating that a non-polar ∆icsB mutant had been created. However, the concentration of the autophagy inhibitor (bafilomycin A1) used in this study was too low to inhibit autophagy formation, and hence it was not possible to characterise the icsB mutant with this approach. Therefore, further experiments are needed to optimise the concentration of the inhibition. Unfortunately, the ∆icsB mutant could not be characterised by Western immunoblotting due to the unsuccessful antiserum production.

One finding was that the difference in plaque size between 2457T and 2457T ∆icsB was not as great as the reported plaque size between YSH6000 S. flexneri and YSH6000 ∆icsB by Ogawa et al. (2003), indicating that 2457T may be different to YSH6000. Interaction between Atg5 and IcsA on the ∆icsB mutant could not be demonstrated, perhaps due to the sensitivity of the approaches taken.

Expression of IcsAi mutants with mutations within the IcsB/Atg5 binding region in S. flexneri ∆icsA ∆icsB suggested that the IcsAi proteins had no effect on plaque size due to the icsB::aphA-3 mutation. These mutant strains still formed plaques that were comparable with an icsB mutant expressing IcsAWT and smaller than 2457T.

Together, the data generated in this study were not conclusive and although much time was spent in performing and optimising different assays, no significant findings were 330

obtained. In addition, the data suggest that 2457T may be different of YSH6000 with respect to autophagy. Therefore, the investigation of the relationship between IcsB, Atg5, IcsA and N-WASP was discontinued due to PhD time constraints.

331

332

Chapter Seven

Discussion

Chapter 7: Discussion

7.1 Introduction

The IcsA (VirG) AT is a polarly distributed OMP that is critical for pathogenesis of S. flexneri. Inside the host cytoplasm, IcsA recruits and activates the host actin regulatory protein, N-WASP, which in turn recruits the Arp2/3 complex that initiates de novo actin polymerisation. The resultant F-actin comet tails allow cell-to-cell spread and ABM (Cossart, 2000; Goldberg, 2001; Pantaloni et al., 2001). The N-terminal passenger domain of IcsA (aa 53-758) is responsible for N-WASP interaction and three N-WASP interacting regions (IR I, II and III) have been reported (May & Morona, 2008). N-WASP IR I (aa 185-312) includes the well-known GRR region, N-WASP IR II (aa 320-433) that overlaps with the IcsB/Atg5 binding region, and the N-WASP IR III (aa 508-730), which contains the AC region. The AC region forms part of the SAAT domain that is able to self-associate (Klemm et al., 2006; Meng et al., 2011) and it has been suggested to be important for IcsA biogenesis via linker insertion mutagenesis (IcsAi) (May & Morona, 2008). The expression of AC IcsAi mutant proteins was significantly reduced in S-LPS S. flexneri and the strains were defective in N- WASP recruitment. May and Morona (2008) have previously shown that LPS affects the functionality of certain IcsAi mutant proteins. Hence, the importance of the IcsA AC region and its role in N-WASP recruitment were investigated in the R-LPS background. The effect of LPS Oag on AC IcsA mutant biogenesis was then studied. In addition, specific amino acids within N-WASP IR II and III were mutagenised and examined for IcsA production and N- WASP recruitment. Then, the mode of action of IcsA in N-WASP recruitment was investigated.

Other than investigation of N-WASP recruitment by intracellular S. flexneri expressing IcsA protein, in vitro studies were also attempted using purified proteins. Different “GFP-N- WASP” and sub-domain fusion proteins and IcsA passenger α-domain were overexpressed and purified for this purpose.

As the IcsB/Atg5 binding region overlapped with N-WASP IR II, it was of interest to investigate the relationship between N-WASP, IcsA, IcsB and Atg5. Hence, an S. flexneri

333

ΔicsB mutant was created and characterised in this study. In addition, an attempt was made to prepare an anti-IcsB-IpgA antiserum for use in these studies.

7.2 Production of AC IcsA mutants in S. flexneri ∆icsA ∆rmlD The translocation mechanism of various OMPs or ATs has been extensively studied in E. coli but the detailed mechanism of IcsA biogenesis has not yet been fully elucidated. The production of IcsAi mutants with insertion mutation within the AC region was markedly reduced in the S-LPS background but was restored to WT comparable levels in the R-LPS background (∆rmlD) (Chapter 3). This finding was supported by the rmlD complementation assay in S. flexneri, as well as in ompT - E. coli K-12 UT5600 complemented with Oag biosynthesis gene clusters. The data suggested that the presence of LPS Oag affects AC IcsAi protein biogenesis via an unknown mechanism independent of S. flexneri specific determinants, as UT5600 (S-LPS and R-LPS backgrounds) produced the same phenotype. The novel LPS depletion-regeneration assay independently confirmed the involvement of LPS

Oag on AC IcsAi biogenesis.

The same results were obtained for IcsA::BIO Y716*D717* and IcsA::BIO D717G amino acids substitution mutants (Chapter 4), where the protein expression was significantly reduced in the S-LPS background but restored to WT comparable levels when expressed in the R-LPS background. The results also suggested that the Aro716-X717-Aro718 motif within the AC region is important for IcsA biogenesis.

7.2.1 Investigation of the underlying mechanisms for AC IcsA mutant biogenesis Different approaches were undertaken to investigate the possible mechanisms that could affect AC IcsA mutant biogenesis in the presence of LPS Oag. It was hypothesised that the IcsA mutants were folded in a slightly different conformation which became sensitive to IcsP cleavage. However, the results showed that the extremely low IcsAi production in the S-LPS background was unlikely to be due to extensive IcsP cleavage. Nevertheless, the IcsAi

334

mutants seemed to be more sensitive to IcsP than IcsAWT, when expressed in R-LPS S. flexneri. TCA precipitation of IcsAi716 mutant (S-LPS) from the culture supernatant indicated that the very low IcsAi716 expression was not due to extensive cleavage by IcsP as IcsAi716 was not detected in TCA precipitates. However, the low expression of IcsAi716 was most likely due to other mechanisms involved in protein biogenesis or transport, as described below.

The transcription level of icsA was investigated in different combinations (with or without + - IcsAWT/IcsAi716; VP or VP strains) in both S-LPS and R-LPS backgrounds by utilising a PicsA-TGA-lacZ reporter plasmid. The findings showed that the icsA promoter activity was not downregulated in S-LPS relative to R-LPS S. flexneri, indicating the difference in IcsAi production between the S-LPS and R-LPS backgrounds was not due to a general effect on the transcription of AC IcsAi. These data suggested that a post-transcriptional effect such as proteolysis was involved in affecting AC IcsAi production in the S-LPS background.

Periplasmic chaperones (DegP, Skp and SurA) are required for proper IcsA presentation (Purdy et al., 2002; Purdy et al., 2007). DegP, which is also a protease, was reported to degrade misfolded and/or unproductive OMPs. Hence, the effect of periplasmic chaperones on AC IcsAi biogenesis was investigated by examining the expression levels of these chaperones in S-LPS and R-LPS S. flexneri strains (with or without IcsAWT/IcsAi716 expression). The results showed that the expression of DegP, Skp and SurA remained the same in both S-LPS and R-LPS backgrounds. However, this does not directly reflect the intrinsic level of chaperone activity. The production of IcsAi677 and IcsAi716 was partially restored by introducing an ΔdegP mutation into an S. flexneri ΔicsA S-LPS strain, suggesting that the IcsAi-periplasmic intermediate was sensitive to DegP degradation in the presence of Oag. As mentioned above, the expression level of DegP remained unchanged between S-LPS and R-LPS strains, despite in the presence of mutated IcsAi protein. Thus, it is possible that DegP could be less active as a protease in the R-LPS background or vice versa in the S-LPS background. However, there are no reports of DegP having LPS-dependent activity.

The degree of protein restoration for IcsAi677 and IcsAi716 in an ΔdegP mutant varied.

IcsAi716 mutant production was only restored by approximately 50 % and this could be due to the insertion mutation location. Residue 716 is part of the Aro-X-Aro motif which is a 335

potential SurA binding site (Bitto & McKay, 2003; Xu et al., 2007) and based on the IcsA AC crystal structure (Kuhnel & Diezmann, 2011), residue Y716 is predicted to be located at the beginning of the first anti-parallel strand that is exposed to the external medium. Therefore, it was speculated that the 5 aa insertion mutation might have altered this potential SurA binding site and affected the chaperone protection from SurA during the translocation of IcsA passenger domain across the OM. However, direct interaction between IcsA and SurA has not been reported, hence, this experiment would be crucial to verify this hypothesis.

7.2.2 Effect of specific residues within AC region on IcsA biogenesis The translocation β-domain of ATs is often rich in Aro-X-Aro motif and is believed to be a common feature of OM translocator. Interestingly, the Aro-X-Aro (Y716-D717-Y718) motif found within the IcsA AC region is highly conserved among other OMPs (Kuhnel & Diezmann, 2011). Furthermore, a conserved aromatic residue in the AC domain of Hbp, an AT, was claimed to be crucial for initiation of OM translocation (Soprova et al., 2010). Hence, the importance of the motif and its aromatic residue in IcsA biogenesis was investigated by mutating residues 716 and 717. The IcsA::BIO Y716*D717* mutants had the same phenotype as the AC IcsAi mutants whereby the protein production was significantly reduced in the S-LPS background but restored to WT levels in the R-LPS background (Chapter 4). The production of IcsA::BIO Y716F (conservative mutation) was not affected in both S-LPS and R-LPS backgrounds. In contrast, the IcsA::BIO Y716G (non-conservative mutation) mutant was produced in both S-LPS and R-LPS backgrounds but the production level was affected and slightly lower than the WT equivalent IcsA::BIO. The results suggested that the aromatic residue within the AC region is important for IcsA biogenesis. On the other hand, IcsA::BIO D717G also had a similar phenotype as the AC IcsAi mutants by having remarkably low protein production in the S-LPS background and restored expression level in the R-LPS background (albeit at a level slightly lower than the control IcsA::BIO).

Collectively, the investigation on the Aro-X-Aro motif within the IcsA AC region suggested that this motif and its aromatic residue are important for IcsA biogenesis, and dependent on the LPS structure.

336

7.2.3 A hypothetical model for IcsA biogenesis By reviewing the data obtained, a hypothetical model for IcsA biogenesis is proposed herein

(Fig. 7.1). It was speculated that an early interaction occurs between the Skp-IcsAi complex with transiting S-LPS or R-LPS molecules in the periplasm, via the putative LPS binding site on the outer surface of Skp. Under normal conditions, this possible transient interaction does not affect the Skp-IcsAWT. However, when the Skp-IcsAi mutant complex interacts with the

S-LPS molecule, the interaction may promote dissociation of IcsAi from Skp due to a weak interaction caused by the IcsAi AC mutations. The released and unprotected IcsAi mutant might then be rapidly aggregated and become degraded by DegP. Skp was initially suggested to bind only the β-domain (Walton et al., 2009) but has recently been proposed to bind both α- and β-domains of ATs, presumably by recognizing the amphipathic β strands that are present throughout the protein (Ieva et al., 2011). Hence, Skp could be binding to the IcsA

AC region and interacts weakly with the mutated IcsAi protein. On the other hand, binding of the R-LPS molecule to the Skp-IcsAi complex would not promote IcsAi dissociation, which could be a function of Oag polysaccharide chains. Oag polysaccharides are a substrate for bacteriophage tailspike protein (TSP) that have a right-handed parallel β-helix structure (Steinbacher et al., 1996) and is structurally similar to the predicted IcsA structure and that of other ATs. An alternative possibility is that a third unknown factor which is affected by Oag is involved in influencing IcsAi interaction with chaperones. SurA, which acts at later stage, then binds to the Aro-X-Aro motif and the -barrel domain of IcsA, facilitates IcsA translocation across the OM, together with the BAM complex. This hypothetical model warrants further investigation, as the interaction between Skp and LPS, SurA and IcsA, has not been reported in vivo, and no data suggesting Skp and SurA binding to AC region of IcsA have been shown.

7.3 N-WASP activation and recruitment by AC IcsA mutants

The restoration of AC IcsAi protein production in R-LPS S. flexneri allowed the investigation of N-WASP recruitment to the AC region (N-WASP IR III). It was found that IcsAi634,

IcsAi644, and IcsAi677 but not the IcsAi716 mutant were capable of recruiting N-WASP (Chapter

337

Figure 7.1 Hypothetical model for IcsA translocation. The wild-type IcsA protein enters the periplasm via the Sec machinery, and first encounters Skp to form a Skp-IcsA complex. DegP and SurA also bind to the protein-chaperone complex and deliver IcsA to SurA and the BAM complex, which mediates the insertion of the - domain of IcsA into the OM. SurA binds to the Aro-X-Aro motif and to the -barrel sequence (not shown). On the other hand, LPS molecule that is synthesised at the IM is translocated through the periplasm to the OM via the Lpt pathway (the trans-envelope complex model is shown). For IcsAi protein translocation, it was hypothesised that an early interaction occurs between the Skp-IcsAi complex with transiting S-LPS or R-LPS molecules in the periplasm via the putative LPS binding site on the outer surface of Skp. This transient interaction does not affect the Skp-IcsAWT complex under normal conditions. However, when the Skp-IcsAi complex interacts with S-LPS molecule, Skp might undergo conformational change and release IcsAi protein due to a weak interaction caused by the IcsAi AC mutation. The released IcsAi mutant might then be rapidly aggregated and become degraded by DegP or by a third unknown factor (Factor X) where its function is affected by LPS Oag.

338

3), suggesting that an N-WASP binding/interacting site is located at residues 716-717 (part of the Aro-X-Aro motif). The mutation was unlikely to have altered the IcsAi confirmation as DSP cross-linking and limited proteolysis assay indicated that the mutants possess WT conformation (Section 3.2 and Section 3.8).

The specific N-WASP binding site was further supported by IcsA::BIO Y716*D717* substitution mutants with non-conservative mutations (Chapter 4). None of the IcsA::BIO Y716*D717* mutants recruited N-WASP in the R-LPS background despite the high level of protein production, and hence the mutants did not form F-actin comet tails. IcsA::BIO Y716F and IcsA::BIO Y716G mutants recruited N-WASP and formed F-actin comet tails in both S- LPS and R-LPS backgrounds, suggesting that the aromatic property of residue 716 is not essential for N-WASP binding/interaction. In contrast, IcsA::BIO D717G was defective in N- WASP recruitment in the S-LPS background and had significant reduction in N-WASP recruitment efficiency in the R-LPS background. Taken together, the results showed that residue D717 is important and plays a greater role than residue Y716 in N-WASP binding/interaction. Nonetheless, both residues 716-717 within the AC region are critical for N-WASP recruitment as mutation of both residues abolished N-WASP recruitment completely.

7.4 Identification of residues involved in N-WASP binding in N- WASP IR II

N-WASP IR II (aa 330-382) has previously been reported by May and Morona (2008) based on linker insertion mutagenesis. The 5 aa insertion mutation may have disrupted the local protein structure conformation (IcsAi330 and IcsAi381), complicating the identification of important residues involved in N-WASP interaction. Hence, site-directed mutagenesis was performed on these sites. Mutagenesis of the amino acids confirmed that aa 330-331 and aa 382 are the N-WASP binding/interacting sites, where specific amino acids residues at position 330-331 are required for efficient N-WASP interaction and recruitment. On the other hand, a non-polar residue is essential at position 382 and plays an important role in N-WASP

339

recruitment (Chapter 4). These sites were assigned as N-WASP IR 2a (aa 330-331) and N- WASP IR 2b (aa 382), respectively.

7.5 Co-operative interaction of IcsA proteins in N-WASP activation

As multiple N-WASP interacting regions have been reported based on mutagenesis of each region, the mode of action of IcsA in recruiting and activating N-WASP was investigated (Chapter 4). It was hypothesised that IcsA functions as a complex on the bacterial surface and different regions of IcsA (N-WASP IR I, II and III) are involved in interacting with N-WASP. Co-expression of two IcsA proteins with mutations at different N-WASP IRs was performed in both S-LPS and R-LPS S. flexneri. One mutated N-WASP IR was used to complement another copy of IcsA that had mutation at another N-WASP IR. None of the IcsA mutants when co-expressed recruited N-WASP in the S-LPS background, except when co-expressed with IcsAWT or the functionally equivalent IcsA::BIO.

Interestingly, when IcsA mutants with mutation in N-WASP IR II and III (IcsA::BIO V382R and IcsA::BIO Y716G D717G) were co-expressed in the R-LPS background, N- WASP was activated, resulting in Arp2/3 complex recruitment and formation of F-actin comet tail/capping, albeit at a lower frequency than the control (~ 40-45% reduction). Co- expression of the same IcsA mutants in the S-LPS background did not show N-WASP recruitment, which was likely due to the very low IcsA::BIO Y716G D717G production level. IcsA::BIO V382R alone was unable to recruit N-WASP. The data also suggested that the AC region of IcsA::BIO V382R failed to rescue the related expression defect of IcsA::BIO Y716G D717G. This result contrasts with the ability of the co-expressed AC region to rescue an AC region mutant in other system (eg. PrtS and BrkA) (Ohnishi et al., 1994; Oliver et al., 2003b). However, the result may also be explained by the hypothetical model (Section 7.2.3) where AC IcsA mutant proteins are degraded in the periplasm prior to translocation across the OM.

Taken together, the N-WASP interacting region complementation assay strongly suggested that IcsA functions as a complex, with all three N-WASP IRs required for efficient N-WASP recruitment. However, the binding of N-WASP to all three N-WASP IRs of one 340

IcsA molecule is not ruled out. In addition, it is still unclear which domain of N-WASP (WH1 domain, CRIB domain or both) is involved in binding to the IcsA protein and whether N- WASP binds to three different sites of IcsA as a single molecule or as a complex. It is also unclear whether the binding of N-WASP to multiple sites of IcsA is a pre-requisite or if it merely enhances the allosteric activation of N-WASP and/or N-WASP oligomerisation which in turn activates the Arp2/3 complex. Hence, further investigations are required to reveal the complex interaction between IcsA and N-WASP.

7.6 Protein purification and protein binding assay

Purified proteins were required to investigate the relationship between IcsA and N-WASP via in vitro protein binding assay. Various StrepTagII-“GFP-N-WASP”-His10 (WH1, CRIB, WH1-CRIB and N-WASP) fusion proteins were successfully purified (Section 5.2.5) and used in pull down assay by incubating with whole cell bacteria (Section 5.2.6). In addition, various approaches were attempted to optimise the purification of IcsA α-domain from the culture supernatants and E. coli (Section 5.3). It was planned to purify IcsA mutant protein to investigate which IcsA region binds to which N-WASP sub-domain.

7.6.1 Whole cell bacteria and purified “GFP-N-WASP” proteins S. flexneri and E. coli that were or were not expressing IcsA were incubated with purified “GFP-N-WASP” fusion proteins at different temperatures (Section 5.2.6). 25 °C was the optimal temperature for the pull down assay that involved whole cell bacteria and purified “GFP-N-WASP” proteins (in the presence of BSA) because high level of non-specific binding was observed at 37 °C and 4 °C. In addition, the purified StrepTagII-EGFP-His10 protein did not bind non-specifically to whole cell bacteria. Taken together, the purified “GFP-N-WASP” fusion proteins seemed to bind non-specifically to the bacterial cell surface in comparison with EGFP alone. The non-specific binding of these “GFP-N-WASP” fusion proteins to the bacterial surface could be due to the exposed hydrophobic region of these proteins. Hence, the pull down assay condition needs to be further optimised by altering the NaCl concentration in

341

TBS or by performing the assay with a different buffer. Alternatively, various N-WASP domain proteins could be overexpressed and purified in the absence of GFP. However, it has been suggested that GFP is a good fusion partner to increase solubility of the overexpressed protein (Coutard et al., 2008; Drew et al., 2006). This work was a preliminary investigation and was not completed due to time limitation.

7.6.2 Purification of IcsAα::BIO protein from the culture supernatant Purification of the IcsAα::BIO protein from the culture supernatant by using Dynabeads which contains Streptavidin was the most effective method identified. This is because free IcsAα::BIO protein is released into the culture supernatant and correctly folded. The culture supernatant also likely to have fewer non-specific proteins that could be pulled down or co- purified. Hence, the IcsAα::BIO protein could be purified in the native form and is expected to be functional. However, the binding of biotin to streptavidin is strong and almost non- reversible, thus the purified IcsAα::BIO protein was bound to the beads and could not be eluted.

Pull down assays that involved IcsAα::BIO-bound Dynabeads and purified “GFP-N- WASP” proteins seem to be feasible because the EGFP protein did not bind non-specifically to Dynabeads (Section 5.3.2), and the purification of IcsAα::BIO from the culture supernatant was convenient. Due to the degradation of GFP-CRIB protein, pulled down GFP-CRIB protein could not be detected. Thus, the pull down assay should be optimised in future by using different purified “GFP-N-WASP” proteins and/or new preparation of the GFP-CRIB protein. Due to PhD time constraints, this was not investigated further.

7.6.3 Purification of IcsAα-MycHis protein from E. coli A plasmid that encoded only the signal sequence and IcsA α-domain was constructed, with the IcsAα protein expected to be soluble and expressed in the cytoplasm and/or periplasm. However, cell fractionation indicated that the IcsAα-MycHis protein was mostly expressed in the OM, despite some soluble proteins being detected in the cytoplasm and periplasm (Section

342

5.3.4). It was unknown why was the protein localised in the OM. However, it could be that IcsA formed inclusion bodies which lead to OM like behavior.

IcsAα-MycHis expression was induced in different E. coli strains and in different media (LB and M63 minimal media) at different temperatures (Section 5.3.4 and Section 5.3.7). The IcsAα-MycHis protein was still mostly localised in the OM but the solubility of IcsAα- MycHis seemed to be improved slightly in M63 minimal media. Co-expression of certain chaperones with IcsAα-MycHis also seemed to improve the protein solubility (Section 5.3.6). Therefore, IcsAα-MycHis could be co-expressed with chaperones (eg. dnaK-dnaJ-grpE, tig, groES-groEL-tig, or groES-groEL) in M63 minimal media in future to improve protein solubility.

IcsAα-MycHis was purified from the soluble cytoplasmic fraction using either ÄKTAprime plus purification system (Section 2.9.8.4) or Profinity IMAC Ni-charged resin (Section 2.9.8.3). However, the same results were obtained whereby the IcsAα-MycHis protein was co-purified with high levels of non-specific proteins. This has always been the main problem for IcsA purification (Morona Laboratory, unpublished data), which may be due to the nature of partially folded IcsA, it interacts with proteins non-specifically. In addition, multiple IcsA bands were also detected in the purified sample by Western immunoblotting (Chapter 5), implying that IcsA tends to bind/interact with proteins. The purity of IcsA proteins could potentially be improved by changing the buffers used.

Overall, purification of IcsAα::BIO from the culture supernatant with Streptavidin Dynabeads is the most effective way but the drawback of this method is that the IcsAα::BIO protein cannot be eluted off the Streptavidin Dynabeads. Thus, further attempts should be performed to purify IcsAα::BIO from the culture supernatant by using a system which is able to purify biotinylated protein and with reversible binding property, such as the monomeric avidin resin. However, the commercially available monomeric avidin resin have been proven unreliable (Morona Laboratory, unpublished data).

343

7.7 Construction and characterisation of 2457T icsB mutant, and IcsB-IpgA antiserum production

The IcsB effector protein has been shown to be involved in intracellular survival of Shigella where it competes with the autophagic protein, Atg5, in binding to IcsA at aa 320-433, thus, preventing degradation of Shigella by autophagy (Ogawa et al., 2005). The IcsB/Atg5 binding region overlaps with the recently identified N-WASP IR II (aa 330-382). A non-polar 2457T ΔicsB mutant (MYRM156) and a non-polar 2457T ΔicsA ΔicsB mutant (MYRM193) were created and characterised in Chapter 6. Furthermore, IcsB-IpgA fusion protein was obtained and an antiserum was raised in a rabbit.

7.7.1 Intercellular spreading of 2457T icsB mutant A previous study showed that YSH6000 ΔicsB serotype 2a mutant formed smaller plaques compared with the WT strain (Ogawa et al., 2003). Consistent to that, the 2457T ΔicsB serotype 2a mutant was also found to form smaller plaques than 2457T in MDCK cells when infected basolaterally. However, plaques formed by a 2457T ΔicsB mutant were not as small as those of YSH6000 ΔicsB as previously reported by Ogawa et al. (2003). The difference in plaque size formed by 2457T (~1 mm) and 2457T ΔicsB mutant (~0.8 mm) was not as great as seen in YSH6000 (>0.6 mm) and YSH6000 ΔicsB (<0.2 mm) (Ogawa et al., 2003). This may be due to the different strains of S. flexneri 2a being used where 2457T ΔicsB replicates and spreads faster than YSH6000 ΔicsB inside the cytosol. Furthermore, both icsB and icsB- ipgA complemented 2457T ΔicsB strains did not form WT comparable plaques but were similar in size to those of the 2457T ΔicsB. This could be due to the very low expression of IcsB expression by pWSK29 which may not be sufficient to restore function in 2457T ΔicsB. As a result, it is more likely that Atg5 would bind to IcsA and trigger autophagy formation.

Interestingly, microarray and RT-PCR analysis on intracellular S. flexneri 2a strain 301 within HeLa cells and human macrophage-like U937 cells showed that the expression of icsA and icsB was significantly downregulated during late stage of intracellular growth (Lucchini et al., 2005). Down-regulation of icsA expression in 2457T ΔicsB may have reduced autophagy formation because less IcsA protein is available for Atg5 to interact with. 344

However, the reduced IcsA expression in intracellular 2457T ΔicsB was still sufficient for actin polymerisation and ABM. Hence, this might explain why the difference in plaque size formed between 2457T ∆icsB and 2457T was not very much. Nevertheless, strain 2457T is less affected by autophagy, perhaps because 2457T might be like S. flexneri strain 301 and its intracellular IcsA level might be less than that of the strain in which this effect was originally reported (YSH6000).

Ogawa et al. (2005) have previously demonstrated that treatment of MDCK cells with autophagy inhibitor, bafilomycin A1, restored WT plaque formation by YSH6000 ΔicsB. Hence, bafilomycin A1-treated MDCK plaque assays were performed using 2457T and 2457T ΔicsB mutant. However, the result obtained was not conclusive as the concentration of Baf-A1 used was not optimal. 2457T ΔicsB was still forming smaller plaques than 2457T when treated with Baf-A1 (3 nM and 5 nM) and the plaques were not significantly different from those formed by 2457T ΔicsB with DMSO treatment control. Thus, this assay requires further optimisations. Due to time constraints, this could not be performed.

7.7.2 Interaction of Atg5 with IcsA It was hypothesised that Atg5 would bind to IcsA better in the absence of IcsB. Hence, another way to characterise the ΔicsB mutant was to directly detect Atg5 interaction with IcsA. However, Atg5 binding or recruitment could not be detected by IF microscopy with anti-Atg5 monoclonal antibody (Section 6.6.3). This could be due to the very low binding of Atg5 to IcsA and the anti-Atg5 antibody used was not sensitive enough to detect the protein, which is possible as the Atg5 bands shown in Western immunoblotting were relatively weak (Section 6.6.3). In addition, Atg5 recruitment was also not detected on 2457T and ΔicsB mutant inside infected N-WASP -/- MEF cells that were expressing GFP-Atg5. The results obtained showed that the existing systems in our laboratory were unable to detect for Atg5 recruitment. Furthermore, the level of IcsA produced by intracellular 2457T may be lower than the other strain, YSH6000 (Section 7.7.1). Hence, the relationship between IcsB, Atg5, IcsA and N-WASP could not be determined.

345

7.7.3 Investigation on IcsB/Atg5 binding region

IcsAi mutants with 5 aa insertion mutations within the IcsB/Atg5 binding region (aa 320-433) were selected and expressed in 2457T ΔicsA ΔicsB. The aim was to determine the specific IcsB/Atg5 binding site based on the previously defined binding region that overlaps with the N-WASP IR II (aa 330-382). It was hypothesised that disruption of the IcsB/Atg5 binding site would prevent Atg5 binding to IcsA and hence triggering autophagy formation. Then, the

2457T ΔicsA ΔicsB strain expressing IcsAi would form a similar plaque size as the 2457T

ΔicsA strain expressing IcsAi. However, the data demonstrated that IcsAi326, IcsAi369, and

IcsAi386 did not affect the binding of Atg5 to IcsA, as no significant effect on plaque size was detected for 2457T ΔicsA ΔicsB strain expressing these IcsAi proteins in comparison to 2457T

ΔicsA expressing IcsAi (Fig. 6.10). This result suggests that the IcsB/Atg5 binding site is not located between aa 326-386. However, IcsAi mutants with mutation within N-WASP IR II (aa 330-382) could not be tested in plaque assays, as these mutants were defective in recruiting N-WASP and ABM. Therefore, further investigation such as a valid IF microscopy to detect for Atg5 recruitment is required to confirm this finding. Collectively, the data obtained and the results of Ogawa et al. (2005), suggested that the IcsB/Atg5 binding region may be narrowed down to aa 387-433.

7.7.4 His6-IcsB-IpgA protein purification and antisera production

In order to raise antibody to IcsB protein, His6-IcsB-IpgA was purified as a fusion protein in Section 2.9.8.2. As other non-specific proteins were found in the purified samples, the band that corresponded to His6-IcsB-IpgA was cut from the polyacrylamide gel and was subsequently used to immunise a rabbit.

IcsB is a TTSS-secreted effector protein that binds to IcsA on the bacterial surface and IpgA is located in the cytoplasm. Hence, the harvested anti-IcsB-IpgA antiserum was absorbed with live bacteria such as icsB mutant and virulence plasmid-cured strains. The absorbed anti-IcsB-IpgA antiserum still detected non-specific proteins which have the same molecular weight as the IcsB-IpgA fusion protein. However, the non-induced MYRM137 (Fig. 6.4B, lane 1) did not have a 70 kDa band when the absorbed anti-IcsB-IpgA antiserum

346

was used in Western immunoblotting, indicating the antiserum contained IcsB-IpgA antibodies. Therefore, affinity purification of the antiserum was undertaken. Surprisingly, it was later found that the affinity purified antiserum lost the ability to detect IcsB-IpgA protein in Western immnublotting.

The crystal structure of IcsB is not available and little is known about IcsB. Since IcsB- IpgA is being produced as a fusion protein in Shigella (Ogawa et al., 2003), the secreted IcsB protein may have a different structure than when it was being chaperoned by IpgA in the cytoplasm. Notably, IcsB-IpgA fusion protein was used to raise antiserum. Hence, the protein folding of IcsB-IpgA may be different and epitopes used to raise antiserum were not the same as epitopes of IcsB protein. As a result, antiserum raised did not contain antibody that targets the IcsB protein.

Due to time constraints and the obstacles experienced throughout this project, significant findings were not found and it was decided not to continue this investigation as part of the PhD research.

7.8 Conclusion

The re-examination of the IcsAi mutants within the AC region in the R-LPS background showed that LPS Oag affects IcsAi biogenesis, suggesting possible interaction of LPS Oag with IcsA in the periplasm. This contributed to the otherwise poorly defined IcsA translocation mechanism. A novel LPS depletion-regeneration assay was also reported in this thesis.

New amino acid residues position involved in N-WASP binding/interaction were identified in N-WASP IR II and N-WASP IR III, where the Aro-X-Aro motif within the AC region was found to be important for both IcsA biogenesis and N-WASP binding/interaction. As the crystal structure of the IcsA AC region has been determined, the Aro-X-Aro motif could be a potential drug target site, to inhibit N-WASP binding. For the first time, N-WASP activation was shown to involve interactions with different regions on different IcsA molecules by co-expressing IcsA mutant proteins.

347

Purification of IcsAα protein from the culture supernatant using Streptavidin Dynabeads demonstrated that this is the most feasible method used, providing new direction for IcsA purification. IcsAα can be purified from the culture supernatant by using resin that allows reversible binding of biotin in the future. In addition, both co-expression of chaperones with IcsAα-MycHis and the use of M63 minimal media increased IcsAα-MycHis solubility, which also provided new direction for IcsA purification. Protein binding assays provided preliminary results for the investigation of IcsA/N-WASP.

348

References

Adler, B., Sasakawa, C., Tobe, T., Makino, S., Komatsu, K. & Yoshikawa, M. (1989). A dual transcriptional activation system for the 230 kb plasmid genes coding for virulence- associated antigens of Shigella flexneri. Mol Microbiol 3, 627-635.

Alexander, D. C. & Valvano, M. A. (1994). Role of the rfe gene in the biosynthesis of the Escherichia coli O7-specific lipopolysaccharide and other O-specific polysaccharides containing N-acetylglucosamine. J Bacteriol 176, 7079-7084.

Allaoui, A., Mounier, J., Prevost, M. C., Sansonetti, P. J. & Parsot, C. (1992). icsB: a Shigella flexneri virulence gene necessary for the lysis of protrusions during intercellular spread. Mol Microbiol 6, 1605-1616.

Ashida, H., Ogawa, M., Kim, M., Suzuki, S., Sanada, T., Punginelli, C., Mimuro, H. & Sasakawa, C. (2011). Shigella deploy multiple countermeasures against host innate immune responses. Curr Opin Microbiol 14, 16-23.

Baker, S. J., Gunn, J. S. & Morona, R. (1999). The Salmonella typhi melittin resistance gene pqaB affects intracellular growth in PMA-differentiated U937 cells, polymyxin B resistance and lipopolysaccharide. Microbiology 145 ( Pt 2), 367-378.

Bardhan, P., Faruque, A. S., Naheed, A. & Sack, D. A. (2010). Decrease in shigellosis- related deaths without Shigella spp.-specific interventions, Asia. Emerg Infect Dis 16, 1718- 1723.

Barnard, T. J., Dautin, N., Lukacik, P., Bernstein, H. D. & Buchanan, S. K. (2007). Autotransporter structure reveals intra-barrel cleavage followed by conformational changes. Nat Struct Mol Biol 14, 1214-1220.

Bartolome, B., Jubete, Y., Martinez, E. & de la Cruz, F. (1991). Construction and properties of a family of pACYC184-derived cloning vectors compatible with pBR322 and its derivatives. Gene 102, 75-78.

Bergounioux, J., Elisee, R., Prunier, A. L., Donnadieu, F., Sperandio, B., Sansonetti, P. & Arbibe, L. (2012). Calpain activation by the Shigella flexneri effector VirA regulates key steps in the formation and life of the bacterium's epithelial niche. Cell Host Microbe 11, 240- 252.

Bernardini, M. L., Mounier, J., d'Hauteville, H., Coquis-Rondon, M. & Sansonetti, P. J. (1989). Identification of icsA, a plasmid locus of Shigella flexneri that governs bacterial intra- and intercellular spread through interaction with F-actin. Proc Natl Acad Sci U S A 86, 3867- 3871.

349

Bernstein, H. D. (2007). Are bacterial 'autotransporters' really transporters? Trends Microbiol 15, 441-447.

Berthiaume, F., Rutherford, N. & Mourez, M. (2007). Mutations affecting the biogenesis of the AIDA-I autotransporter. Res Microbiol 158, 348-354.

Bitto, E. & McKay, D. B. (2003). The periplasmic molecular chaperone protein SurA binds a peptide motif that is characteristic of integral outer membrane proteins. J Biol Chem 278, 49316-49322.

Bolivar, F., Rodriguez, R. L., Betlach, M. C. & Boyer, H. W. (1977). Construction and characterization of new cloning vehicles. I. Ampicillin-resistant derivatives of the plasmid pMB9. Gene 2, 75-93.

Bowyer, A., Baardsnes, J., Ajamian, E., Zhang, L. & Cygler, M. (2011). Characterization of interactions between LPS transport proteins of the Lpt system. Biochem Biophys Res Commun 404, 1093-1098.

Bradley, P., Cowen, L., Menke, M., King, J. & Berger, B. (2001). BETAWRAP: successful prediction of parallel beta -helices from primary sequence reveals an association with many microbial pathogens. Proc Natl Acad Sci U S A 98, 14819-14824.

Brandish, P. E., Kimura, K. I., Inukai, M., Southgate, R., Lonsdale, J. T. & Bugg, T. D. (1996). Modes of action of tunicamycin, liposidomycin B, and mureidomycin A: inhibition of phospho-N-acetylmuramyl-pentapeptide translocase from Escherichia coli. Antimicrob Agents Chemother 40, 1640-1644.

Brandon, L. D. & Goldberg, M. B. (2001). Periplasmic transit and disulfide bond formation of the autotransported Shigella protein IcsA. J Bacteriol 183, 951-958.

Brandon, L. D., Goehring, N., Janakiraman, A., Yan, A. W., Wu, T., Beckwith, J. & Goldberg, M. B. (2003). IcsA, a polarly localized autotransporter with an atypical signal peptide, uses the Sec apparatus for secretion, although the Sec apparatus is circumferentially distributed. Mol Microbiol 50, 45-60.

Bulieris, P. V., Behrens, S., Holst, O. & Kleinschmidt, J. H. (2003). Folding and insertion of the outer membrane protein OmpA is assisted by the chaperone Skp and by lipopolysaccharide. J Biol Chem 278, 9092-9099.

Burton, E. A., Oliver, T. N. & Pendergast, A. M. (2005). Abl kinases regulate actin comet tail elongation via an N-WASP-dependent pathway. Mol Cell Biol 25, 8834-8843.

Carlier, M. F., Nioche, P., Broutin-L'Hermite, I. & other authors (2000). GRB2 links signaling to actin assembly by enhancing interaction of neural Wiskott-Aldrich syndrome protein (N-WASp) with actin-related protein (ARP2/3) complex. J Biol Chem 275, 21946- 21952. 350

Chakraborty, T., Ebel, F., Domann, E. & other authors (1995). A focal adhesion factor directly linking intracellularly motile Listeria monocytogenes and Listeria ivanovii to the actin-based cytoskeleton of mammalian cells. EMBO J 14, 1314-1321.

Charles, M., Perez, M., Kobil, J. H. & Goldberg, M. B. (2001). Polar targeting of Shigella virulence factor IcsA in Enterobacteriacae and Vibrio. Proc Natl Acad Sci U S A 98, 9871- 9876.

Chen, R. & Henning, U. (1996). A periplasmic protein (Skp) of Escherichia coli selectively binds a class of outer membrane proteins. Mol Microbiol 19, 1287-1294.

Chevalier, N., Moser, M., Koch, H. G., Schimz, K. L., Willery, E., Locht, C., Jacob- Dubuisson, F. & Muller, M. (2004). Membrane targeting of a bacterial virulence factor harbouring an extended signal peptide. J Mol Microbiol Biotechnol 8, 7-18.

Chng, S. S., Gronenberg, L. S. & Kahne, D. (2010a). Proteins required for lipopolysaccharide assembly in Escherichia coli form a transenvelope complex. Biochemistry 49, 4565-4567.

Chng, S. S., Ruiz, N., Chimalakonda, G., Silhavy, T. J. & Kahne, D. (2010b). Characterization of the two-protein complex in Escherichia coli responsible for lipopolysaccharide assembly at the outer membrane. Proc Natl Acad Sci U S A 107, 5363- 5368.

Cossart, P. (2000). Actin-based motility of pathogens: the Arp2/3 complex is a central player. Cell Microbiol 2, 195-205.

Coutard, B., Gagnaire, M., Guilhon, A. A., Berro, M., Canaan, S. & Bignon, C. (2008). Green fluorescent protein and factorial approach: an effective partnership for screening the soluble expression of recombinant proteins in Escherichia coli. Protein Expr Purif 61, 184- 190.

Cull, M. G. & Schatz, P. J. (2000). Biotinylation of proteins in vivo and in vitro using small peptide tags. Methods Enzymol 326, 430-440.

Cullinane, M., Gong, L., Li, X. & other authors (2008). Stimulation of autophagy suppresses the intracellular survival of Burkholderia pseudomallei in mammalian cell lines. Autophagy 4, 744-753. d'Hauteville, H. & Sansonetti, P. J. (1992). Phosphorylation of IcsA by cAMP-dependent protein kinase and its effect on intracellular spread of Shigella flexneri. Mol Microbiol 6, 833- 841.

351

d'Hauteville, H., Dufourcq Lagelouse, R., Nato, F. & Sansonetti, P. J. (1996). Lack of cleavage of IcsA in Shigella flexneri causes aberrant movement and allows demonstration of a cross-reactive eukaryotic protein. Infect Immun 64, 511-517.

D'Hauteville, H., Khan, S., Maskell, D. J. & other authors (2002). Two msbB genes encoding maximal acylation of lipid A are required for invasive Shigella flexneri to mediate inflammatory rupture and destruction of the intestinal epithelium. J Immunol 168, 5240-5251.

Danese, P. N., Snyder, W. B., Cosma, C. L., Davis, L. J. & Silhavy, T. J. (1995). The Cpx two-component signal transduction pathway of Escherichia coli regulates transcription of the gene specifying the stress-inducible periplasmic protease, DegP. Genes Dev 9, 387-398.

Danese, P. N. & Silhavy, T. J. (1997). The sigma(E) and the Cpx signal transduction systems control the synthesis of periplasmic protein-folding enzymes in Escherichia coli. Genes Dev 11, 1183-1193.

Datsenko, K. A. & Wanner, B. L. (2000). One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A 97, 6640-6645.

Davison, J., Heusterspreute, M., Chevalier, N., Ha-Thi, V. & Brunel, F. (1987). Vectors with restriction site banks. V. pJRD215, a wide-host-range cosmid vector with multiple cloning sites. Gene 51, 275-280.

Desvaux, M., Parham, N. J. & Henderson, I. R. (2004). The autotransporter secretion system. Res Microbiol 155, 53-60.

Desvaux, M., Cooper, L. M., Filenko, N. A., Scott-Tucker, A., Turner, S. M., Cole, J. A. & Henderson, I. R. (2006). The unusual extended signal peptide region of the type V secretion system is phylogenetically restricted. FEMS Microbiol Lett 264, 22-30.

Dorman, C. J. & Porter, M. E. (1998). The Shigella virulence gene regulatory cascade: a paradigm of bacterial gene control mechanisms. Mol Microbiol 29, 677-684.

Dorn, B. R., Dunn, W. A., Jr. & Progulske-Fox, A. (2002). Bacterial interactions with the autophagic pathway. Cell Microbiol 4, 1-10.

Drew, D., Lerch, M., Kunji, E., Slotboom, D. J. & de Gier, J. W. (2006). Optimization of membrane protein overexpression and purification using GFP fusions. Nat Methods 3, 303- 313.

Duguay, A. R. & Silhavy, T. J. (2004). Quality control in the bacterial periplasm. Biochim Biophys Acta 1694, 121-134.

DuPont, H. L., Levine, M. M., Hornick, R. B. & Formal, S. B. (1989). Inoculum size in shigellosis and implications for expected mode of transmission. J Infect Dis 159, 1126-1128.

352

Dutta, P. R., Sui, B. Q. & Nataro, J. P. (2003). Structure-function analysis of the enteroaggregative Escherichia coli plasmid-encoded toxin autotransporter using scanning linker mutagenesis. J Biol Chem 278, 39912-39920.

Egile, C., d'Hauteville, H., Parsot, C. & Sansonetti, P. J. (1997). SopA, the outer membrane protease responsible for polar localization of IcsA in Shigella flexneri. Mol Microbiol 23, 1063-1073.

Egile, C., Loisel, T. P., Laurent, V., Li, R., Pantaloni, D., Sansonetti, P. J. & Carlier, M. F. (1999). Activation of the CDC42 effector N-WASP by the Shigella flexneri IcsA protein promotes actin nucleation by Arp2/3 complex and bacterial actin-based motility. J Cell Biol 146, 1319-1332.

Emsley, P., Charles, I. G., Fairweather, N. F. & Isaacs, N. W. (1996). Structure of Bordetella pertussis virulence factor P.69 pertactin. Nature 381, 90-92.

Fasano, A., Noriega, F. R., Maneval, D. R., Jr., Chanasongcram, S., Russell, R., Guandalini, S. & Levine, M. M. (1995). Shigella enterotoxin 1: an enterotoxin of Shigella flexneri 2a active in rabbit small intestine in vivo and in vitro. J Clin Invest 95, 2853-2861.

Fernandez-Prada, C. M., Hoover, D. L., Tall, B. D. & Venkatesan, M. M. (1997). Human monocyte-derived macrophages infected with virulent Shigella flexneri in vitro undergo a rapid cytolytic event similar to oncosis but not apoptosis. Infect Immun 65, 1486-1496.

Frischknecht, F., Cudmore, S., Moreau, V., Reckmann, I., Rottger, S. & Way, M. (1999). Tyrosine phosphorylation is required for actin-based motility of vaccinia but not Listeria or Shigella. Curr Biol 9, 89-92.

Fukuda, I., Suzuki, T., Munakata, H., Hayashi, N., Katayama, E., Yoshikawa, M. & Sasakawa, C. (1995). Cleavage of Shigella surface protein VirG occurs at a specific site, but the secretion is not essential for intracellular spreading. J Bacteriol 177, 1719-1726.

Fukuoka, M., Miki, H. & Takenawa, T. (1997). Identification of N-WASP homologs in human and rat brain. Gene 196, 43-48.

Gangwer, K. A., Mushrush, D. J., Stauff, D. L., Spiller, B., McClain, M. S., Cover, T. L. & Lacy, D. B. (2007). Crystal structure of the Helicobacter pylori vacuolating toxin p55 domain. Proc Natl Acad Sci U S A 104, 16293-16298.

Germane, K. L., Ohi, R., Goldberg, M. B. & Spiller, B. W. (2008). Structural and functional studies indicate that Shigella VirA is not a protease and does not directly destabilize microtubules. Biochemistry 47, 10241-10243.

Geyer, R., Galanos, C., Westphal, O. & Golecki, J. R. (1979). A lipopolysaccharide- binding cell-surface protein from Salmonella minnesota. Isolation, partial characterization and occurrence in different Enterobacteriaceae. Eur J Biochem 98, 27-38. 353

Giangrossi, M., Prosseda, G., Tran, C. N., Brandi, A., Colonna, B. & Falconi, M. (2010). A novel antisense RNA regulates at transcriptional level the virulence gene icsA of Shigella flexneri. Nucleic Acids Res 38, 3362-3375.

Girardin, S. E., Tournebize, R., Mavris, M. & other authors (2001). CARD4/Nod1 mediates NF-kappaB and JNK activation by invasive Shigella flexneri. EMBO Rep 2, 736- 742.

Goldberg, M. B., Barzu, O., Parsot, C. & Sansonetti, P. J. (1993). Unipolar localization and ATPase activity of IcsA, a Shigella flexneri protein involved in intracellular movement. Infect Agents Dis 2, 210-211.

Goldberg, M. B. & Theriot, J. A. (1995). Shigella flexneri surface protein IcsA is sufficient to direct actin-based motility. Proc Natl Acad Sci U S A 92, 6572-6576.

Goldberg, M. B. (1997). Shigella actin-based motility in the absence of vinculin. Cell Motil Cytoskeleton 37, 44-53.

Goldberg, M. B. (2001). Actin-based motility of intracellular microbial pathogens. Microbiol Mol Biol Rev 65, 595-626, table of contents.

Goley, E. D. & Welch, M. D. (2006). The ARP2/3 complex: an actin nucleator comes of age. Nat Rev Mol Cell Biol 7, 713-726.

Gong, L., Cullinane, M., Treerat, P., Ramm, G., Prescott, M., Adler, B., Boyce, J. D. & Devenish, R. J. (2011). The Burkholderia pseudomallei Type III Secretion System and BopA Are Required for Evasion of LC3-Associated Phagocytosis. PLoS One 6, e17852.

Gorden, J. & Small, P. L. (1993). Acid resistance in enteric bacteria. Infect Immun 61, 364- 367.

Grabowicz, M. (2010). Biogenesis of Shigella flexneri IcsA protein. PhD dissertation, University of Adelaide, Australia.

Guzman, L. M., Belin, D., Carson, M. J. & Beckwith, J. (1995). Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. J Bacteriol 177, 4121-4130.

Harlander, R. S., Way, M., Ren, Q., Howe, D., Grieshaber, S. S. & Heinzen, R. A. (2003). Effects of ectopically expressed neuronal Wiskott-Aldrich syndrome protein domains on Rickettsia rickettsii actin-based motility. Infect Immun 71, 1551-1556.

Hauske, P., Meltzer, M., Ottmann, C., Krojer, T., Clausen, T., Ehrmann, M. & Kaiser, M. (2009). Selectivity profiling of DegP substrates and inhibitors. Bioorg Med Chem 17, 2920-2924. 354

Heindl, J. E., Saran, I., Yi, C. R., Lesser, C. F. & Goldberg, M. B. (2010). Requirement for formin-induced actin polymerization during spread of Shigella flexneri. Infect Immun 78, 193-203.

Henderson, I. R., Navarro-Garcia, F. & Nataro, J. P. (1998). The great escape: structure and function of the autotransporter proteins. Trends Microbiol 6, 370-378.

Henderson, I. R., Navarro-Garcia, F., Desvaux, M., Fernandez, R. C. & Ala'Aldeen, D. (2004). Type V protein secretion pathway: the autotransporter story. Microbiol Mol Biol Rev 68, 692-744.

Higgs, H. N. & Pollard, T. D. (2000). Activation by Cdc42 and PIP(2) of Wiskott-Aldrich syndrome protein (WASp) stimulates actin nucleation by Arp2/3 complex. J Cell Biol 150, 1311-1320.

Hitchcock, P. J. & Brown, T. M. (1983). Morphological heterogeneity among Salmonella lipopolysaccharide chemotypes in silver-stained polyacrylamide gels. J Bacteriol 154, 269- 277.

Ho, H. Y., Rohatgi, R., Lebensohn, A. M., Le, M., Li, J., Gygi, S. P. & Kirschner, M. W. (2004). Toca-1 mediates Cdc42-dependent actin nucleation by activating the N-WASP-WIP complex. Cell 118, 203-216.

Hong, M. & Payne, S. M. (1997). Effect of mutations in Shigella flexneri chromosomal and plasmid-encoded lipopolysaccharide genes on invasion and serum resistance. Mol Microbiol 24, 779-791.

Ieva, R., Skillman, K. M. & Bernstein, H. D. (2008). Incorporation of a polypeptide segment into the beta-domain pore during the assembly of a bacterial autotransporter. Mol Microbiol 67, 188-201.

Ieva, R. & Bernstein, H. D. (2009). Interaction of an autotransporter passenger domain with BamA during its translocation across the bacterial outer membrane. Proc Natl Acad Sci U S A 106, 19120-19125.

Ieva, R., Tian, P., Peterson, J. H. & Bernstein, H. D. (2011). Sequential and spatially restricted interactions of assembly factors with an autotransporter beta domain. Proc Natl Acad Sci U S A 108, E383-391.

Itzhaki, H., Naveh, L., Lindahl, M., Cook, M. & Adam, Z. (1998). Identification and characterization of DegP, a serine protease associated with the luminal side of the thylakoid membrane. J Biol Chem 273, 7094-7098.

Jacob-Dubuisson, F., Fernandez, R. & Coutte, L. (2004). Protein secretion through autotransporter and two-partner pathways. Biochim Biophys Acta 1694, 235-257. 355

Jain, S. & Goldberg, M. B. (2007). Requirement for YaeT in the outer membrane assembly of autotransporter proteins. J Bacteriol 189, 5393-5398.

Janakiraman, A., Fixen, K. R., Gray, A. N., Niki, H. & Goldberg, M. B. (2009). A genome-scale proteomic screen identifies a role for DnaK in chaperoning of polar autotransporters in Shigella. J Bacteriol 191, 6300-6311.

Jennison, A. V. & Verma, N. K. (2004). Shigella flexneri infection: pathogenesis and vaccine development. FEMS Microbiol Rev 28, 43-58.

Johnson, T. A., Qiu, J., Plaut, A. G. & Holyoak, T. (2009). Active-site gating regulates substrate selectivity in a chymotrypsin-like serine protease the structure of Haemophilus influenzae immunoglobulin A1 protease. J Mol Biol 389, 559-574.

Jose, J., Jahnig, F. & Meyer, T. F. (1995). Common structural features of IgA1 protease- like outer membrane protein autotransporters. Mol Microbiol 18, 378-380.

Jose, J., Kramer, J., Klauser, T., Pohlner, J. & Meyer, T. F. (1996). Absence of periplasmic DsbA oxidoreductase facilitates export of cysteine-containing passenger proteins to the Escherichia coli cell surface via the Iga beta autotransporter pathway. Gene 178, 107- 110.

Junker, M., Schuster, C. C., McDonnell, A. V., Sorg, K. A., Finn, M. C., Berger, B. & Clark, P. L. (2006). Pertactin beta-helix folding mechanism suggests common themes for the secretion and folding of autotransporter proteins. Proc Natl Acad Sci U S A 103, 4918-4923.

Kabeya, Y., Mizushima, N., Ueno, T., Yamamoto, A., Kirisako, T., Noda, T., Kominami, E., Ohsumi, Y. & Yoshimori, T. (2000). LC3, a mammalian homologue of yeast Apg8p, is localized in autophagosome membranes after processing. EMBO J 19, 5720-5728.

Kadurugamuwa, J. L., Rohde, M., Wehland, J. & Timmis, K. N. (1991). Intercellular spread of Shigella flexneri through a monolayer mediated by membranous protrusions and associated with reorganization of the cytoskeletal protein vinculin. Infect Immun 59, 3463- 3471.

Kayath, C. A., Hussey, S., El hajjami, N., Nagra, K., Philpott, D. & Allaoui, A. (2010). Escape of intracellular Shigella from autophagy requires binding to cholesterol through the type III effector, IcsB. Microbes Infect 12, 956-966.

Kelleher, J. F., Atkinson, S. J. & Pollard, T. D. (1995). Sequences, structural models, and cellular localization of the actin-related proteins Arp2 and Arp3 from Acanthamoeba. J Cell Biol 131, 385-397.

Khalid, S. & Sansom, M. S. (2006). Molecular dynamics simulations of a bacterial autotransporter: NalP from Neisseria meningitidis. Mol Membr Biol 23, 499-508. 356

Khan, S., Mian, H. S., Sandercock, L. E., Chirgadze, N. Y. & Pai, E. F. (2011). Crystal structure of the passenger domain of the Escherichia coli autotransporter EspP. J Mol Biol 413, 985-1000.

Kim, A. S., Kakalis, L. T., Abdul-Manan, N., Liu, G. A. & Rosen, M. K. (2000). Autoinhibition and activation mechanisms of the Wiskott-Aldrich syndrome protein. Nature 404, 151-158.

Kinsey, M. D., Formal, S. B., Dammin, G. J. & Giannella, R. A. (1976). Fluid and electrolyte transport in rhesus monkeys challenged intracecally with Shigella flexneri 2a. Infect Immun 14, 368-371.

Kirkegaard, K., Taylor, M. P. & Jackson, W. T. (2004). Cellular autophagy: surrender, avoidance and subversion by microorganisms. Nat Rev Microbiol 2, 301-314.

Kleinschmidt, J. H., Wiener, M. C. & Tamm, L. K. (1999). Outer membrane protein A of E. coli folds into detergent micelles, but not in the presence of monomeric detergent. Protein Sci 8, 2065-2071.

Klemm, P., Vejborg, R. M. & Sherlock, O. (2006). Self-associating autotransporters, SAATs: functional and structural similarities. Int J Med Microbiol 296, 187-195.

Klionsky, D. J. & Emr, S. D. (2000). Autophagy as a regulated pathway of cellular degradation. Science 290, 1717-1721.

Kocks, C., Marchand, J. B., Gouin, E., d'Hauteville, H., Sansonetti, P. J., Carlier, M. F. & Cossart, P. (1995). The unrelated surface proteins ActA of Listeria monocytogenes and IcsA of Shigella flexneri are sufficient to confer actin-based motility on Listeria innocua and Escherichia coli respectively. Mol Microbiol 18, 413-423.

Kokotek, W. & Lotz, W. (1989). Construction of a lacZ-kanamycin-resistance cassette, useful for site-directed mutagenesis and as a promoter probe. Gene 84, 467-471.

Kolmar, H., Waller, P. R. & Sauer, R. T. (1996). The DegP and DegQ periplasmic endoproteases of Escherichia coli: specificity for cleavage sites and substrate conformation. J Bacteriol 178, 5925-5929.

Korndorfer, I. P., Dommel, M. K. & Skerra, A. (2004). Structure of the periplasmic chaperone Skp suggests functional similarity with cytosolic chaperones despite differing architecture. Nat Struct Mol Biol 11, 1015-1020.

Kotloff, K. L., Noriega, F., Losonsky, G. A., Sztein, M. B., Wasserman, S. S., Nataro, J. P. & Levine, M. M. (1996). Safety, immunogenicity, and transmissibility in humans of CVD 1203, a live oral Shigella flexneri 2a vaccine candidate attenuated by deletions in aroA and virG. Infect Immun 64, 4542-4548. 357

Kotloff, K. L., Winickoff, J. P., Ivanoff, B., Clemens, J. D., Swerdlow, D. L., Sansonetti, P. J., Adak, G. K. & Levine, M. M. (1999). Global burden of Shigella infections: implications for vaccine development and implementation of control strategies. Bull World Health Organ 77, 651-666.

Kotloff, K. L., Taylor, D. N., Sztein, M. B. & other authors (2002). Phase I evaluation of delta virG Shigella sonnei live, attenuated, oral vaccine strain WRSS1 in healthy adults. Infect Immun 70, 2016-2021.

Krojer, T., Garrido-Franco, M., Huber, R., Ehrmann, M. & Clausen, T. (2002). Crystal structure of DegP (HtrA) reveals a new protease-chaperone machine. Nature 416, 455-459.

Krojer, T., Pangerl, K., Kurt, J., Sawa, J., Stingl, C., Mechtler, K., Huber, R., Ehrmann, M. & Clausen, T. (2008a). Interplay of PDZ and protease domain of DegP ensures efficient elimination of misfolded proteins. Proc Natl Acad Sci U S A 105, 7702-7707.

Krojer, T., Sawa, J., Schafer, E., Saibil, H. R., Ehrmann, M. & Clausen, T. (2008b). Structural basis for the regulated protease and chaperone function of DegP. Nature 453, 885- 890.

Kuhnel, K. & Diezmann, D. (2011). Crystal structure of the autochaperone region from the Shigella flexneri autotransporter IcsA. J Bacteriol 193, 2042-2045.

Lan, R. & Reeves, P. R. (2002). Escherichia coli in disguise: molecular origins of Shigella. Microbes Infect 4, 1125-1132.

Le-Barillec, K., Magalhaes, J. G., Corcuff, E., Thuizat, A., Sansonetti, P. J., Phalipon, A. & Di Santo, J. P. (2005). Roles for T and NK cells in the innate immune response to Shigella flexneri. J Immunol 175, 1735-1740.

Lett, M. C., Sasakawa, C., Okada, N., Sakai, T., Makino, S., Yamada, M., Komatsu, K. & Yoshikawa, M. (1989). virG, a plasmid-coded virulence gene of Shigella flexneri: identification of the virG protein and determination of the complete coding sequence. J Bacteriol 171, 353-359.

Leung, Y., Ally, S. & Goldberg, M. B. (2008). Bacterial actin assembly requires toca-1 to relieve N-wasp autoinhibition. Cell Host Microbe 3, 39-47.

Levine, B. & Klionsky, D. J. (2004). Development by self-digestion: molecular mechanisms and biological functions of autophagy. Dev Cell 6, 463-477.

Levine, B. (2005). Eating oneself and uninvited guests: autophagy-related pathways in cellular defense. Cell 120, 159-162.

358

Levine, M. M., Kotloff, K. L., Barry, E. M., Pasetti, M. F. & Sztein, M. B. (2007). Clinical trials of Shigella vaccines: two steps forward and one step back on a long, hard road. Nat Rev Microbiol 5, 540-553.

Leyton, D. L., Rossiter, A. E. & Henderson, I. R. (2012). From self sufficiency to dependence: mechanisms and factors important for autotransporter biogenesis. Nat Rev Microbiol 10, 213-225.

Lipinska, B., Fayet, O., Baird, L. & Georgopoulos, C. (1989). Identification, characterization, and mapping of the Escherichia coli htrA gene, whose product is essential for bacterial growth only at elevated temperatures. J Bacteriol 171, 1574-1584.

Lipinska, B., Zylicz, M. & Georgopoulos, C. (1990). The HtrA (DegP) protein, essential for Escherichia coli survival at high temperatures, is an endopeptidase. J Bacteriol 172, 1791- 1797.

Loisel, T. P., Boujemaa, R., Pantaloni, D. & Carlier, M. F. (1999). Reconstitution of actin- based motility of Listeria and Shigella using pure proteins. Nature 401, 613-616.

Lommel, S., Benesch, S., Rottner, K., Franz, T., Wehland, J. & Kuhn, R. (2001). Actin pedestal formation by enteropathogenic Escherichia coli and intracellular motility of Shigella flexneri are abolished in N-WASP-defective cells. EMBO Rep 2, 850-857.

Lucchini, S., Liu, H., Jin, Q., Hinton, J. C. & Yu, J. (2005). Transcriptional adaptation of Shigella flexneri during infection of macrophages and epithelial cells: insights into the strategies of a cytosolic bacterial pathogen. Infect Immun 73, 88-102.

Lugtenberg, B., Meijers, J., Peters, R., van der Hoek, P. & van Alphen, L. (1975). Electrophoretic resolution of the "major outer membrane protein" of Escherichia coli K12 into four bands. FEBS Lett 58, 254-258.

Lum, M. & Morona, R. (2012). IcsA autotransporter passenger promotes increased fusion protein expression on the cell surface. Microb Cell Fact 11, 20.

Ma, B., Reynolds, C. M. & Raetz, C. R. (2008). Periplasmic orientation of nascent lipid A in the inner membrane of an Escherichia coli LptA mutant. Proc Natl Acad Sci U S A 105, 13823-13828.

Ma, L., Cantley, L. C., Janmey, P. A. & Kirschner, M. W. (1998a). Corequirement of specific phosphoinositides and small GTP-binding protein Cdc42 in inducing actin assembly in Xenopus egg extracts. J Cell Biol 140, 1125-1136.

Ma, L., Rohatgi, R. & Kirschner, M. W. (1998b). The Arp2/3 complex mediates actin polymerization induced by the small GTP-binding protein Cdc42. Proc Natl Acad Sci U S A 95, 15362-15367.

359

Macpherson, D. F., Morona, R., Beger, D. W., Cheah, K. C. & Manning, P. A. (1991). Genetic analysis of the rfb region of Shigella flexneri encoding the Y serotype O-antigen specificity. Mol Microbiol 5, 1491-1499.

Makino, S., Sasakawa, C., Kamata, K., Kurata, T. & Yoshikawa, M. (1986). A genetic determinant required for continuous reinfection of adjacent cells on large plasmid in S. flexneri 2a. Cell 46, 551-555.

Mandic-Mulec, I., Weiss, J. & Zychlinsky, A. (1997). Shigella flexneri is trapped in polymorphonuclear leukocyte vacuoles and efficiently killed. Infect Immun 65, 110-115.

Martinez-Quiles, N., Rohatgi, R., Anton, I. M. & other authors (2001). WIP regulates N- WASP-mediated actin polymerization and filopodium formation. Nat Cell Biol 3, 484-491.

Maurer, J., Jose, J. & Meyer, T. F. (1997). Autodisplay: one-component system for efficient surface display and release of soluble recombinant proteins from Escherichia coli. J Bacteriol 179, 794-804.

May, K. L. (2007). Molecular characterisation of Shigella flexneri IcsA and the role of lipopolysaccharide O-antigen in actin-based motility. PhD dissertation, University of Adelaide, Australia.

May, K. L. & Morona, R. (2008). Mutagenesis of the Shigella flexneri autotransporter IcsA reveals novel functional regions involved in IcsA biogenesis and recruitment of host neural Wiscott-Aldrich syndrome protein. J Bacteriol 190, 4666-4676.

May, K. L., Paton, J. C. & Paton, A. W. (2010). Escherichia coli subtilase cytotoxin induces apoptosis regulated by host Bcl-2 family proteins Bax/Bak. Infect Immun 78, 4691- 4696.

May, K. L., Grabowicz, M., Polyak, S. W. & Morona, R. (2012). Self-association of the Shigella flexneri IcsA autotransporter protein. Microbiology 158, 1874-1883.

Mecsas, J., Rouviere, P. E., Erickson, J. W., Donohue, T. J. & Gross, C. A. (1993). The activity of sigma E, an Escherichia coli heat-inducible sigma-factor, is modulated by expression of outer membrane proteins. Genes Dev 7, 2618-2628.

Menard, R., Sansonetti, P. J. & Parsot, C. (1993). Nonpolar mutagenesis of the ipa genes defines IpaB, IpaC, and IpaD as effectors of Shigella flexneri entry into epithelial cells. J Bacteriol 175, 5899-5906.

Meng, G., Spahich, N., Kenjale, R., Waksman, G. & St Geme, J. W., 3rd (2011). Crystal structure of the Haemophilus influenzae Hap adhesin reveals an intercellular oligomerization mechanism for bacterial aggregation. EMBO J 30, 3864-3874.

360

Miki, H., Miura, K. & Takenawa, T. (1996). N-WASP, a novel actin-depolymerizing protein, regulates the cortical cytoskeletal rearrangement in a PIP2-dependent manner downstream of tyrosine kinases. EMBO J 15, 5326-5335.

Miki, H. & Takenawa, T. (2003). Regulation of actin dynamics by WASP family proteins. J Biochem 134, 309-313.

Miller, J. (1972). Experiments in molecular genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

Miller, S. I., Ernst, R. K. & Bader, M. W. (2005). LPS, TLR4 and infectious disease diversity. Nat Rev Microbiol 3, 36-46.

Mimuro, H., Suzuki, T., Suetsugu, S., Miki, H., Takenawa, T. & Sasakawa, C. (2000). Profilin is required for sustaining efficient intra- and intercellular spreading of Shigella flexneri. J Biol Chem 275, 28893-28901.

Mizushima, N., Sugita, H., Yoshimori, T. & Ohsumi, Y. (1998). A new protein conjugation system in human. The counterpart of the yeast Apg12p conjugation system essential for autophagy. J Biol Chem 273, 33889-33892.

Monack, D. M. & Theriot, J. A. (2001). Actin-based motility is sufficient for bacterial membrane protrusion formation and host cell uptake. Cell Microbiol 3, 633-647.

Moreau, V., Frischknecht, F., Reckmann, I., Vincentelli, R., Rabut, G., Stewart, D. & Way, M. (2000). A complex of N-WASP and WIP integrates signalling cascades that lead to actin polymerization. Nat Cell Biol 2, 441-448.

Morona, R., Mavris, M., Fallarino, A. & Manning, P. A. (1994). Characterization of the rfc region of Shigella flexneri. J Bacteriol 176, 733-747.

Morona, R., van den Bosch, L. & Manning, P. A. (1995). Molecular, genetic, and topological characterization of O-antigen chain length regulation in Shigella flexneri. J Bacteriol 177, 1059-1068.

Morona, R., Daniels, C. & Van Den Bosch, L. (2003). Genetic modulation of Shigella flexneri 2a lipopolysaccharide O antigen modal chain length reveals that it has been optimized for virulence. Microbiology 149, 925-939.

Morona, R. & Van Den Bosch, L. (2003). Lipopolysaccharide O antigen chains mask IcsA (VirG) in Shigella flexneri. FEMS Microbiol Lett 221, 173-180.

Mostowy, S., Bonazzi, M., Hamon, M. A. & other authors (2010). Entrapment of Intracytosolic Bacteria by Septin Cage-like Structures. Cell Host Microbe 8, 433-444.

361

Mostowy, S. & Cossart, P. (2011). Autophagy and the cytoskeleton: new links revealed by intracellular pathogens. Autophagy 7, 780-782.

Mounier, J., Laurent, V., Hall, A., Fort, P., Carlier, M. F., Sansonetti, P. J. & Egile, C. (1999). Rho family GTPases control entry of Shigella flexneri into epithelial cells but not intracellular motility. J Cell Sci 112 ( Pt 13), 2069-2080.

Muhlradt, P. F. & Golecki, J. R. (1975). Asymmetrical distribution and artifactual reorientation of lipopolysaccharide in the outer membrane bilayer of Salmonella typhimurium. Eur J Biochem 51, 343-352.

Muller, D., Benz, I., Tapadar, D., Buddenborg, C., Greune, L. & Schmidt, M. A. (2005). Arrangement of the translocator of the autotransporter adhesin involved in diffuse adherence on the bacterial surface. Infect Immun 73, 3851-3859.

Mullins, R. D., Heuser, J. A. & Pollard, T. D. (1998). The interaction of Arp2/3 complex with actin: nucleation, high affinity pointed end capping, and formation of branching networks of filaments. Proc Natl Acad Sci U S A 95, 6181-6186.

Murray, G. L., Attridge, S. R. & Morona, R. (2003). Regulation of Salmonella typhimurium lipopolysaccharide O antigen chain length is required for virulence; identification of FepE as a second Wzz. Mol Microbiol 47, 1395-1406.

Mutalik, V. K., Nonaka, G., Ades, S. E., Rhodius, V. A. & Gross, C. A. (2009). Promoter strength properties of the complete sigma E regulon of Escherichia coli and Salmonella enterica. J Bacteriol 191, 7279-7287.

Nakamoto, H. & Bardwell, J. C. (2004). Catalysis of disulfide bond formation and isomerization in the Escherichia coli periplasm. Biochim Biophys Acta 1694, 111-119.

Nakata, N., Tobe, T., Fukuda, I., Suzuki, T., Komatsu, K., Yoshikawa, M. & Sasakawa, C. (1993). The absence of a surface protease, OmpT, determines the intercellular spreading ability of Shigella: the relationship between the ompT and kcpA loci. Mol Microbiol 9, 459- 468.

Narita, S. & Tokuda, H. (2009). Biochemical characterization of an ABC transporter LptBFGC complex required for the outer membrane sorting of lipopolysaccharides. FEBS Lett 583, 2160-2164.

Nataro, J. P., Seriwatana, J., Fasano, A., Maneval, D. R., Guers, L. D., Noriega, F., Dubovsky, F., Levine, M. M. & Morris, J. G., Jr. (1995). Identification and cloning of a novel plasmid-encoded enterotoxin of enteroinvasive Escherichia coli and Shigella strains. Infect Immun 63, 4721-4728.

Nikaido, H. (2003). Molecular basis of bacterial outer membrane permeability revisited. Microbiol Mol Biol Rev 67, 593-656. 362

Niyogi, S. K. (2005). Shigellosis. J Microbiol 43, 133-143.

Oaks, E. V., Wingfield, M. E. & Formal, S. B. (1985). Plaque formation by virulent Shigella flexneri. Infect Immun 48, 124-129.

Ogawa, H., Nakamura, A. & Nakaya, R. (1968). Cinemicrographic study of tissue cell cultures infected with Shigella flexneri. Jpn J Med Sci Biol 21, 259-273.

Ogawa, M., Suzuki, T., Tatsuno, I., Abe, H. & Sasakawa, C. (2003). IcsB, secreted via the type III secretion system, is chaperoned by IpgA and required at the post-invasion stage of Shigella pathogenicity. Mol Microbiol 48, 913-931.

Ogawa, M., Yoshimori, T., Suzuki, T., Sagara, H., Mizushima, N. & Sasakawa, C. (2005). Escape of intracellular Shigella from autophagy. Science 307, 727-731.

Ohnishi, Y., Nishiyama, M., Horinouchi, S. & Beppu, T. (1994). Involvement of the COOH-terminal pro-sequence of Serratia marcescens serine protease in the folding of the mature enzyme. J Biol Chem 269, 32800-32806.

Okada, N., Sasakawa, C., Tobe, T., Yamada, M., Nagai, S., Talukder, K. A., Komatsu, K., Kanegasaki, S. & Yoshikawa, M. (1991). Virulence-associated chromosomal loci of Shigella flexneri identified by random Tn5 insertion mutagenesis. Mol Microbiol 5, 187-195.

Oliver, D. C., Huang, G. & Fernandez, R. C. (2003a). Identification of secretion determinants of the Bordetella pertussis BrkA autotransporter. J Bacteriol 185, 489-495.

Oliver, D. C., Huang, G., Nodel, E., Pleasance, S. & Fernandez, R. C. (2003b). A conserved region within the Bordetella pertussis autotransporter BrkA is necessary for folding of its passenger domain. Mol Microbiol 47, 1367-1383.

Oomen, C. J., van Ulsen, P., van Gelder, P., Feijen, M., Tommassen, J. & Gros, P. (2004). Structure of the translocator domain of a bacterial autotransporter. EMBO J 23, 1257- 1266.

Otto, B. R., Sijbrandi, R., Luirink, J., Oudega, B., Heddle, J. G., Mizutani, K., Park, S. Y. & Tame, J. R. (2005). Crystal structure of hemoglobin protease, a heme binding autotransporter protein from pathogenic Escherichia coli. J Biol Chem 280, 17339-17345.

Padrick, S. B., Cheng, H. C., Ismail, A. M. & other authors (2008). Hierarchical regulation of WASP/WAVE proteins. Mol Cell 32, 426-438.

Padrick, S. B. & Rosen, M. K. (2010). Physical mechanisms of signal integration by WASP family proteins. Annu Rev Biochem 79, 707-735.

363

Page, A. L., Ohayon, H., Sansonetti, P. J. & Parsot, C. (1999). The secreted IpaB and IpaC invasins and their cytoplasmic chaperone IpgC are required for intercellular dissemination of Shigella flexneri. Cell Microbiol 1, 183-193.

Pallen, M. J., Chaudhuri, R. R. & Henderson, I. R. (2003). Genomic analysis of secretion systems. Curr Opin Microbiol 6, 519-527.

Pantaloni, D., Le Clainche, C. & Carlier, M. F. (2001). Mechanism of actin-based motility. Science 292, 1502-1506.

Papadopoulos, M. & Morona, R. (2010). Mutagenesis and chemical cross-linking suggest that Wzz dimer stability and oligomerization affect lipopolysaccharide O-antigen modal chain length control. J Bacteriol 192, 3385-3393.

Pei, J. & Grishin, N. V. (2009). The Rho GTPase inactivation domain in Vibrio cholerae MARTX toxin has a circularly permuted papain-like thiol protease fold. Proteins 77, 413- 419.

Perdomo, J. J., Gounon, P. & Sansonetti, P. J. (1994). Polymorphonuclear leukocyte transmigration promotes invasion of colonic epithelial monolayer by Shigella flexneri. J Clin Invest 93, 633-643.

Peterson, J. H., Woolhead, C. A. & Bernstein, H. D. (2003). Basic amino acids in a distinct subset of signal peptides promote interaction with the signal recognition particle. J Biol Chem 278, 46155-46162.

Peterson, J. H., Szabady, R. L. & Bernstein, H. D. (2006). An unusual signal peptide extension inhibits the binding of bacterial presecretory proteins to the signal recognition particle, trigger factor, and the SecYEG complex. J Biol Chem 281, 9038-9048.

Peterson, J. H., Tian, P., Ieva, R., Dautin, N. & Bernstein, H. D. (2010). Secretion of a bacterial virulence factor is driven by the folding of a C-terminal segment. Proc Natl Acad Sci U S A 107, 17739-17744.

Philpott, D. J., Edgeworth, J. D. & Sansonetti, P. J. (2000a). The pathogenesis of Shigella flexneri infection: lessons from in vitro and in vivo studies. Philos Trans R Soc Lond B Biol Sci 355, 575-586.

Philpott, D. J., Yamaoka, S., Israel, A. & Sansonetti, P. J. (2000b). Invasive Shigella flexneri activates NF-kappa B through a lipopolysaccharide-dependent innate intracellular response and leads to IL-8 expression in epithelial cells. J Immunol 165, 903-914.

Pohlner, J., Halter, R. & Meyer, T. F. (1987). Neisseria gonorrhoeae IgA protease. Secretion and implications for pathogenesis. Antonie Van Leeuwenhoek 53, 479-484.

364

Prevost, M. C., Lesourd, M., Arpin, M., Vernel, F., Mounier, J., Hellio, R. & Sansonetti, P. J. (1992). Unipolar reorganization of F-actin layer at bacterial division and bundling of actin filaments by plastin correlate with movement of Shigella flexneri within HeLa cells. Infect Immun 60, 4088-4099.

Pruyne, D., Evangelista, M., Yang, C., Bi, E., Zigmond, S., Bretscher, A. & Boone, C. (2002). Role of formins in actin assembly: nucleation and barbed-end association. Science 297, 612-615.

Purdy, G. E., Hong, M. & Payne, S. M. (2002). Shigella flexneri DegP facilitates IcsA surface expression and is required for efficient intercellular spread. Infect Immun 70, 6355- 6364.

Purdy, G. E., Fisher, C. R. & Payne, S. M. (2007). IcsA surface presentation in Shigella flexneri requires the periplasmic chaperones DegP, Skp, and SurA. J Bacteriol 189, 5566- 5573.

Purins, L., Van Den Bosch, L., Richardson, V. & Morona, R. (2008). Coiled-coil regions play a role in the function of the Shigella flexneri O-antigen chain length regulator WzzpHS2. Microbiology 154, 1104-1116.

Qualmann, B. & Kelly, R. B. (2000). Syndapin isoforms participate in receptor-mediated endocytosis and actin organization. J Cell Biol 148, 1047-1062.

Raetz, C. R. & Whitfield, C. (2002). Lipopolysaccharide endotoxins. Annu Rev Biochem 71, 635-700.

Raivio, T. L. & Silhavy, T. J. (2001). Periplasmic stress and ECF sigma factors. Annu Rev Microbiol 55, 591-624.

Rajakumar, K., Jost, B. H., Sasakawa, C., Okada, N., Yoshikawa, M. & Adler, B. (1994). Nucleotide sequence of the rhamnose biosynthetic operon of Shigella flexneri 2a and role of lipopolysaccharide in virulence. J Bacteriol 176, 2362-2373.

Ramesh, N., Anton, I. M., Hartwig, J. H. & Geha, R. S. (1997). WIP, a protein associated with wiskott-aldrich syndrome protein, induces actin polymerization and redistribution in lymphoid cells. Proc Natl Acad Sci U S A 94, 14671-14676.

Ramesh, N. & Geha, R. (2009). Recent advances in the biology of WASP and WIP. Immunol Res 44 , 99-111.

Rathman, M., Jouirhi, N., Allaoui, A., Sansonetti, P., Parsot, C. & Tran Van Nhieu, G. (2000). The development of a FACS-based strategy for the isolation of Shigella flexneri mutants that are deficient in intercellular spread. Mol Microbiol 35, 974-990.

365

Reeves, P. R., Hobbs, M., Valvano, M. A. & other authors (1996). Bacterial polysaccharide synthesis and gene nomenclature. Trends Microbiol 4, 495-503.

Reggiori, F. & Klionsky, D. J. (2005). Autophagosomes: biogenesis from scratch? Curr Opin Cell Biol 17, 415-422.

Rhodius, V. A., Suh, W. C., Nonaka, G., West, J. & Gross, C. A. (2006). Conserved and variable functions of the sigmaE stress response in related genomes. PLoS Biol 4, e2.

Rizzitello, A. E., Harper, J. R. & Silhavy, T. J. (2001). Genetic evidence for parallel pathways of chaperone activity in the periplasm of Escherichia coli. J Bacteriol 183, 6794- 6800.

Robbins, J. R., Monack, D., McCallum, S. J., Vegas, A., Pham, E., Goldberg, M. B. & Theriot, J. A. (2001). The making of a gradient: IcsA (VirG) polarity in Shigella flexneri. Mol Microbiol 41, 861-872.

Robert, V., Volokhina, E. B., Senf, F., Bos, M. P., Van Gelder, P. & Tommassen, J. (2006). Assembly factor Omp85 recognizes its outer membrane protein substrates by a species-specific C-terminal motif. PLoS Biol 4, e377.

Robinson, R. C., Turbedsky, K., Kaiser, D. A., Marchand, J. B., Higgs, H. N., Choe, S. & Pollard, T. D. (2001). Crystal structure of Arp2/3 complex. Science 294, 1679-1684.

Rodal, A. A., Sokolova, O., Robins, D. B., Daugherty, K. M., Hippenmeyer, S., Riezman, H., Grigorieff, N. & Goode, B. L. (2005). Conformational changes in the Arp2/3 complex leading to actin nucleation. Nat Struct Mol Biol 12, 26-31.

Rohatgi, R., Ho, H. Y. & Kirschner, M. W. (2000). Mechanism of N-WASP activation by CDC42 and phosphatidylinositol 4, 5-bisphosphate. J Cell Biol 150, 1299-1310.

Rohatgi, R., Nollau, P., Ho, H. Y., Kirschner, M. W. & Mayer, B. J. (2001). Nck and phosphatidylinositol 4,5-bisphosphate synergistically activate actin polymerization through the N-WASP-Arp2/3 pathway. J Biol Chem 276, 26448-26452.

Rossiter, A. E., Leyton, D. L., Tveen-Jensen, K. & other authors (2011). The essential beta-barrel assembly machinery complex components BamD and BamA are required for autotransporter biogenesis. J Bacteriol 193, 4250-4253.

Ruiz-Perez, F., Henderson, I. R., Leyton, D. L., Rossiter, A. E., Zhang, Y. & Nataro, J. P. (2009). Roles of periplasmic chaperone proteins in the biogenesis of serine protease autotransporters of Enterobacteriaceae. J Bacteriol 191, 6571-6583.

Ruiz-Perez, F., Henderson, I. R. & Nataro, J. P. (2010). Interaction of FkpA, a peptidylprolyl cis/trans isomerase with EspP autotransporter protein. Gut Microbes 1, 339-344.

366

Ruiz, N., Kahne, D. & Silhavy, T. J. (2006). Advances in understanding bacterial outer- membrane biogenesis. Nat Rev Microbiol 4, 57-66.

Ruiz, N., Gronenberg, L. S., Kahne, D. & Silhavy, T. J. (2008). Identification of two inner- membrane proteins required for the transport of lipopolysaccharide to the outer membrane of Escherichia coli. Proc Natl Acad Sci U S A 105, 5537-5542.

Ruiz, N., Kahne, D. & Silhavy, T. J. (2009). Transport of lipopolysaccharide across the cell envelope: the long road of discovery. Nat Rev Microbiol 7, 677-683.

Rybicki, E. P. & von Wechmar, M. B. (1982). Enzyme-assisted immune detection of plant virus proteins electroblotted onto nitrocellulose paper. J Virol Methods 5, 267-278.

Sagot, I., Rodal, A. A., Moseley, J., Goode, B. L. & Pellman, D. (2002). An actin nucleation mechanism mediated by Bni1 and profilin. Nat Cell Biol 4, 626-631.

Sakaguchi, T., Kohler, H., Gu, X., McCormick, B. A. & Reinecker, H. C. (2002). Shigella flexneri regulates tight junction-associated proteins in human intestinal epithelial cells. Cell Microbiol 4, 367-381.

Sandlin, R. C., Lampel, K. A., Keasler, S. P., Goldberg, M. B., Stolzer, A. L. & Maurelli, A. T. (1995). Avirulence of rough mutants of Shigella flexneri: requirement of O antigen for correct unipolar localization of IcsA in the bacterial outer membrane. Infect Immun 63, 229- 237.

Sandlin, R. C., Goldberg, M. B. & Maurelli, A. T. (1996). Effect of O side-chain length and composition on the virulence of Shigella flexneri 2a. Mol Microbiol 22, 63-73.

Sandlin, R. C. & Maurelli, A. T. (1999). Establishment of unipolar localization of IcsA in Shigella flexneri 2a is not dependent on virulence plasmid determinants. Infect Immun 67, 350-356.

Sansonetti, P. J., Kopecko, D. J. & Formal, S. B. (1982). Involvement of a plasmid in the invasive ability of Shigella flexneri. Infect Immun 35, 852-860.

Sansonetti, P. J., Arondel, J., Fontaine, A., d'Hauteville, H. & Bernardini, M. L. (1991). OmpB (osmo-regulation) and icsA (cell-to-cell spread) mutants of Shigella flexneri: vaccine candidates and probes to study the pathogenesis of shigellosis. Vaccine 9, 416-422.

Sansonetti, P. J. (2001a). Rupture, invasion and inflammatory destruction of the intestinal barrier by Shigella, making sense of prokaryote-eukaryote cross-talks. FEMS Microbiol Rev 25, 3-14.

Sansonetti, P. J. (2001b). Microbes and microbial toxins: paradigms for microbial-mucosal interactions III. Shigellosis: from symptoms to molecular pathogenesis. Am J Physiol Gastrointest Liver Physiol 280, G319-323. 367

Santapaola, D., Del Chierico, F., Petrucca, A., Uzzau, S., Casalino, M., Colonna, B., Sessa, R., Berlutti, F. & Nicoletti, M. (2006). Apyrase, the product of the virulence plasmid- encoded phoN2 (apy) gene of Shigella flexneri, is necessary for proper unipolar IcsA localization and for efficient intercellular spread. J Bacteriol 188, 1620-1627.

Sauri, A., Soprova, Z., Wickstrom, D., de Gier, J. W., Van der Schors, R. C., Smit, A. B., Jong, W. S. & Luirink, J. (2009). The Bam (Omp85) complex is involved in secretion of the autotransporter haemoglobin protease. Microbiology 155, 3982-3991.

Sawa, J., Heuck, A., Ehrmann, M. & Clausen, T. (2010). Molecular transformers in the cell: lessons learned from the DegP protease-chaperone. Curr Opin Struct Biol 20, 253-258.

Schlapschy, M., Dommel, M. K., Hadian, K., Fogarasi, M., Korndorfer, I. P. & Skerra, A. (2004). The periplasmic E. coli chaperone Skp is a trimer in solution: biophysical and preliminary crystallographic characterization. Biol Chem 385, 137-143.

Selkrig, J., Mosbahi, K., Webb, C. T. & other authors (2012). Discovery of an archetypal protein transport system in bacterial outer membranes. Nat Struct Mol Biol 19, 506-510, S501.

Sellge, G., Magalhaes, J. G., Konradt, C. & other authors (2010). Th17 cells are the dominant T cell subtype primed by Shigella flexneri mediating protective immunity. J Immunol 184, 2076-2085.

Shere, K. D., Sallustio, S., Manessis, A., D'Aversa, T. G. & Goldberg, M. B. (1997). Disruption of IcsP, the major Shigella protease that cleaves IcsA, accelerates actin-based motility. Mol Microbiol 25, 451-462.

Shibata, T., Takeshima, F., Chen, F., Alt, F. W. & Snapper, S. B. (2002). Cdc42 facilitates invasion but not the actin-based motility of Shigella. Curr Biol 12, 341-345.

Sijbrandi, R., Urbanus, M. L., ten Hagen-Jongman, C. M., Bernstein, H. D., Oudega, B., Otto, B. R. & Luirink, J. (2003). Signal recognition particle (SRP)-mediated targeting and Sec-dependent translocation of an extracellular Escherichia coli protein. J Biol Chem 278, 4654-4659.

Simmons, D. A. (1993). Genetic and biosynthetic aspects of Shigella flexneri O-specific lipopolysaccharides. Biochem Soc Trans 21, 58S.

Singer, M. & Sansonetti, P. J. (2004). IL-8 is a key chemokine regulating neutrophil recruitment in a new mouse model of Shigella-induced colitis. J Immunol 173, 4197-4206.

Skillman, K. M., Barnard, T. J., Peterson, J. H., Ghirlando, R. & Bernstein, H. D. (2005). Efficient secretion of a folded protein domain by a monomeric bacterial autotransporter. Mol Microbiol 58, 945-958. 368

Sklar, J. G., Wu, T., Gronenberg, L. S., Malinverni, J. C., Kahne, D. & Silhavy, T. J. (2007a). Lipoprotein SmpA is a component of the YaeT complex that assembles outer membrane proteins in Escherichia coli. Proc Natl Acad Sci U S A 104, 6400-6405.

Sklar, J. G., Wu, T., Kahne, D. & Silhavy, T. J. (2007b). Defining the roles of the periplasmic chaperones SurA, Skp, and DegP in Escherichia coli. Genes Dev 21, 2473-2484.

Snapper, S. B., Takeshima, F., Anton, I. & other authors (2001). N-WASP deficiency reveals distinct pathways for cell surface projections and microbial actin-based motility. Nat Cell Biol 3, 897-904.

Soprova, Z., Sauri, A., van Ulsen, P., Tame, J. R., den Blaauwen, T., Jong, W. S. & Luirink, J. (2010). A conserved aromatic residue in the autochaperone domain of the autotransporter Hbp is critical for initiation of outer membrane translocation. J Biol Chem 285, 38224-38233.

Southwick, F. S., Adamson, E. D. & Purich, D. L. (2000). Shigella actin-based motility in the presence of truncated vinculin. Cell Motil Cytoskeleton 45, 272-278.

Sperandeo, P., Lau, F. K., Carpentieri, A., De Castro, C., Molinaro, A., Deho, G., Silhavy, T. J. & Polissi, A. (2008). Functional analysis of the protein machinery required for transport of lipopolysaccharide to the outer membrane of Escherichia coli. J Bacteriol 190, 4460-4469.

Spiess, C., Beil, A. & Ehrmann, M. (1999). A temperature-dependent switch from chaperone to protease in a widely conserved heat shock protein. Cell 97, 339-347.

Steinbacher, S., Baxa, U., Miller, S., Weintraub, A., Seckler, R. & Huber, R. (1996). Crystal structure of phage P22 tailspike protein complexed with Salmonella sp. O-antigen receptors. Proc Natl Acad Sci U S A 93, 10584-10588.

Steinhauer, J., Agha, R., Pham, T., Varga, A. W. & Goldberg, M. B. (1999). The unipolar Shigella surface protein IcsA is targeted directly to the bacterial old pole: IcsP cleavage of IcsA occurs over the entire bacterial surface. Mol Microbiol 32, 367-377.

Surrey, T. & Jahnig, F. (1995). Kinetics of folding and membrane insertion of a beta-barrel membrane protein. J Biol Chem 270, 28199-28203.

Suzuki, T., Lett, M. C. & Sasakawa, C. (1995). Extracellular transport of VirG protein in Shigella. J Biol Chem 270, 30874-30880.

Suzuki, T., Saga, S. & Sasakawa, C. (1996). Functional analysis of Shigella VirG domains essential for interaction with vinculin and actin-based motility. J Biol Chem 271, 21878- 21885.

369

Suzuki, T., Miki, H., Takenawa, T. & Sasakawa, C. (1998). Neural Wiskott-Aldrich syndrome protein is implicated in the actin-based motility of Shigella flexneri. EMBO J 17, 2767-2776.

Suzuki, T. & Sasakawa, C. (2001). Molecular basis of the intracellular spreading of Shigella. Infect Immun 69, 5959-5966.

Suzuki, T., Mimuro, H., Suetsugu, S., Miki, H., Takenawa, T. & Sasakawa, C. (2002). Neural Wiskott-Aldrich syndrome protein (N-WASP) is the specific ligand for Shigella VirG among the WASP family and determines the host cell type allowing actin-based spreading. Cell Microbiol 4, 223-233.

Szabady, R. L., Peterson, J. H., Skillman, K. M. & Bernstein, H. D. (2005). An unusual signal peptide facilitates late steps in the biogenesis of a bacterial autotransporter. Proc Natl Acad Sci U S A 102, 221-226.

Teh, M. Y., Tran, E. N. H. & Morona, R. (2012). Absence of O antigen suppresses Shigella flexneri IcsA autochaperone region mutations. Microbiology 158, 2835-2850.

Teh, M. Y. & Morona, R. (2013). Identification of Shigella flexneri IcsA Residues Affecting Interaction with N-WASP, and Evidence for IcsA-IcsA Co-Operative Interaction. PLoS One 8, e55152.

Tomasevic, N., Jia, Z., Russell, A. & other authors (2007). Differential regulation of WASP and N-WASP by Cdc42, Rac1, Nck, and PI(4,5)P2. Biochemistry 46, 3494-3502.

Tran, A. X., Trent, M. S. & Whitfield, C. (2008). The LptA protein of Escherichia coli is a periplasmic lipid A-binding protein involved in the lipopolysaccharide export pathway. J Biol Chem 283, 20342-20349.

Tran, A. X., Dong, C. & Whitfield, C. (2010). Structure and functional analysis of LptC, a conserved membrane protein involved in the lipopolysaccharide export pathway in Escherichia coli. J Biol Chem 285, 33529-33539.

Tran, C. N., Giangrossi, M., Prosseda, G., Brandi, A., Di Martino, M. L., Colonna, B. & Falconi, M. (2011). A multifactor regulatory circuit involving H-NS, VirF and an antisense RNA modulates transcription of the virulence gene icsA of Shigella flexneri. Nucleic Acids Res 39, 8122-8134.

Tran, E. N. H. (2007). Molecular characterisation of Shigella flexneri outer membrane protease IcsP. PhD dissertation, University of Adelaide, Australia.

Tsai, C. M. & Frasch, C. E. (1982). A sensitive silver stain for detecting lipopolysaccharides in polyacrylamide gels. Anal Biochem 119, 115-119.

370

Vaara, M. & Vaara, T. (1983). Sensitization of Gram-negative bacteria to antibiotics and complement by a nontoxic oligopeptide. Nature 303, 526-528.

Vaara, M. (1992). Agents that increase the permeability of the outer membrane. Microbiol Rev 56, 395-411.

Van Den Bosch, L., Manning, P. A. & Morona, R. (1997). Regulation of O-antigen chain length is required for Shigella flexneri virulence. Mol Microbiol 23, 765-775.

Van Den Bosch, L. & Morona, R. (2003). The actin-based motility defect of a Shigella flexneri rmlD rough LPS mutant is not due to loss of IcsA polarity. Microb Pathog 35, 11-18.

Veiga, E., de Lorenzo, V. & Fernandez, L. A. (1999). Probing secretion and translocation of a beta-autotransporter using a reporter single-chain Fv as a cognate passenger domain. Mol Microbiol 33, 1232-1243.

Veiga, E., Sugawara, E., Nikaido, H., de Lorenzo, V. & Fernandez, L. A. (2002). Export of autotransported proteins proceeds through an oligomeric ring shaped by C-terminal domains. EMBO J 21, 2122-2131.

Velarde, J. J. & Nataro, J. P. (2004). Hydrophobic residues of the autotransporter EspP linker domain are important for outer membrane translocation of its passenger. J Biol Chem 279, 31495-31504.

Voulhoux, R., Bos, M. P., Geurtsen, J., Mols, M. & Tommassen, J. (2003). Role of a highly conserved bacterial protein in outer membrane protein assembly. Science 299, 262- 265.

Voulhoux, R. & Tommassen, J. (2004). Omp85, an evolutionarily conserved bacterial protein involved in outer-membrane-protein assembly. Res Microbiol 155, 129-135.

Wagner, J. K., Heindl, J. E., Gray, A. N., Jain, S. & Goldberg, M. B. (2009). Contribution of the periplasmic chaperone Skp to efficient presentation of the autotransporter IcsA on the surface of Shigella flexneri. J Bacteriol 191, 815-821.

Walsh, N. P., Alba, B. M., Bose, B., Gross, C. A. & Sauer, R. T. (2003). OMP peptide signals initiate the envelope-stress response by activating DegS protease via relief of inhibition mediated by its PDZ domain. Cell 113, 61-71.

Walton, T. A. & Sousa, M. C. (2004). Crystal structure of Skp, a prefoldin-like chaperone that protects soluble and membrane proteins from aggregation. Mol Cell 15, 367-374.

Walton, T. A., Sandoval, C. M., Fowler, C. A., Pardi, A. & Sousa, M. C. (2009). The cavity-chaperone Skp protects its substrate from aggregation but allows independent folding of substrate domains. Proc Natl Acad Sci U S A 106, 1772-1777.

371

Wang, R. F. & Kushner, S. R. (1991). Construction of versatile low-copy-number vectors for cloning, sequencing and gene expression in Escherichia coli. Gene 100, 195-199.

Wei, J., Goldberg, M. B., Burland, V. & other authors (2003). Complete genome sequence and comparative genomics of Shigella flexneri serotype 2a strain 2457T. Infect Immun 71, 2775-2786.

Welch, M. D., DePace, A. H., Verma, S., Iwamatsu, A. & Mitchison, T. J. (1997). The human Arp2/3 complex is composed of evolutionarily conserved subunits and is localized to cellular regions of dynamic actin filament assembly. J Cell Biol 138, 375-384.

Wells, T. J., Totsika, M. & Schembri, M. A. (2010). Autotransporters of Escherichia coli: a sequence-based characterization. Microbiology 156, 2459-2469.

Wing, H. J., Yan, A. W., Goldman, S. R. & Goldberg, M. B. (2004). Regulation of IcsP, the outer membrane protease of the Shigella actin tail assembly protein IcsA, by virulence plasmid regulators VirF and VirB. J Bacteriol 186, 699-705.

Wood, P. K., Morris, J. G., Jr., Small, P. L., Sethabutr, O., Toledo, M. R., Trabulsi, L. & Kaper, J. B. (1986). Comparison of DNA probes and the Sereny test for identification of invasive Shigella and Escherichia coli strains. J Clin Microbiol 24, 498-500.

Wu, T., Malinverni, J., Ruiz, N., Kim, S., Silhavy, T. J. & Kahne, D. (2005). Identification of a multicomponent complex required for outer membrane biogenesis in Escherichia coli. Cell 121, 235-245.

Wu, T., McCandlish, A. C., Gronenberg, L. S., Chng, S. S., Silhavy, T. J. & Kahne, D. (2006). Identification of a protein complex that assembles lipopolysaccharide in the outer membrane of Escherichia coli. Proc Natl Acad Sci U S A 103, 11754-11759.

Xu, X., Wang, S., Hu, Y. X. & McKay, D. B. (2007). The periplasmic bacterial molecular chaperone SurA adapts its structure to bind peptides in different conformations to assert a sequence preference for aromatic residues. J Mol Biol 373, 367-381.

Yang, C., Huang, M., DeBiasio, J., Pring, M., Joyce, M., Miki, H., Takenawa, T. & Zigmond, S. H. (2000). Profilin enhances Cdc42-induced nucleation of actin polymerization. J Cell Biol 150, 1001-1012.

Yarar, D., To, W., Abo, A. & Welch, M. D. (1999). The Wiskott-Aldrich syndrome protein directs actin-based motility by stimulating actin nucleation with the Arp2/3 complex. Curr Biol 9, 555-558.

Yen, Y. T., Kostakioti, M., Henderson, I. R. & Stathopoulos, C. (2008). Common themes and variations in serine protease autotransporters. Trends Microbiol 16, 370-379.

372

Yorimitsu, T. & Klionsky, D. J. (2005). Autophagy: molecular machinery for self-eating. Cell Death Differ 12 Suppl 2, 1542-1552.

Yoshida, S., Katayama, E., Kuwae, A., Mimuro, H., Suzuki, T. & Sasakawa, C. (2002). Shigella deliver an effector protein to trigger host microtubule destabilization, which promotes Rac1 activity and efficient bacterial internalization. EMBO J 21, 2923-2935.

Yoshida, S., Handa, Y., Suzuki, T., Ogawa, M., Suzuki, M., Tamai, A., Abe, A., Katayama, E. & Sasakawa, C. (2006). Microtubule-severing activity of Shigella is pivotal for intercellular spreading. Science 314, 985-989.

Yoshimori, T. (2004). Autophagy: a regulated bulk degradation process inside cells. Biochem Biophys Res Commun 313, 453-458.

Zalucki, Y. M. & Jennings, M. P. (2007). Experimental confirmation of a key role for non- optimal codons in protein export. Biochem Biophys Res Commun 355, 143-148.

Zettl, M. & Way, M. (2002). The WH1 and EVH1 domains of WASP and Ena/VASP family members bind distinct sequence motifs. Curr Biol 12, 1617-1622.

Zhai, Y., Zhang, K., Huo, Y. & other authors (2011). Autotransporter passenger domain secretion requires a hydrophobic cavity at the extracellular entrance of the beta-domain pore. Biochem J 435, 577-587.

373