DOCSLIB.ORG

Simple-Sequence Repeat Marker Analysis of Genetic Relationships

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

JOBNAME: horts 44#1 2009 PAGE: 1 OUTPUT: December 29 22:22:52 2008 tsp/horts/180127/03204 HORTSCIENCE 44(1):27–31. 2009. many of the H. paniculata cultivars available in the United States are relatively recent intro- ductions, little is known about their parent- Simple-sequence Repeat Marker age. In addition to named cultivars, a few wild-collected H. paniculata accessions are Analysis of Genetic Relationships available in the United States. Two of these were collected in Taiwan and appear to be the within Hydrangea paniculata only H. paniculata germplasm in the United States that was not either introduced from Sandra M. Reed1 Japan or bred from Japanese germplasm. USDA-ARS, Floral and Nursery Plants Research Unit, Tennessee State Microsatellite, or simple-sequence repeat University Otis L. Floyd Nursery Research Center, 472 Cadillac Lane, (SSR), markers provide a useful method for characterizing genetic diversity within a plant McMinnville, TN 37110 species. SSR markers were recently used to Timothy A. Rinehart study relationships among 114 H. macro- phylla (Thunb.) Ser. genotypes (Reed and USDA-ARS, Southern Horticultural Laboratory, 810 Highway 26 West, Rinehart, 2007). Genetic similarities were Poplarville, MS 39470 found among remontant, variegated, and Additional index words. breeding, molecular markers, panicle hydrangea double-flowered cultivars. Some presumed synonyms were valid, whereas others were Abstract. Genetic diversity studies using 26 simple-sequence repeat (SSR) markers were not. Potentially unexploited sources of germ- conducted with 36 cultivars, breeding lines, and wild-collected accessions of Hydrangea plasm within H. macrophylla were identified. paniculata Sieb. The SSR markers were highly variable among the genotypes, producing The objective of this study was to use SSR a mean of 5.8 alleles per marker. Three cultivars (Boskoop, Compact Grandiflora, and markers to study genetic relationships within Webb) were either identical to or sports of the popular cultivar Grandiflora. The name H. paniculata. We were particularly inter- ‘Pee Wee’ appears to have been applied to two phenotypically different compact forms of ested in rectifying synonym confusion and H. paniculata, one of which seems to be a sport of ‘Tardiva’, whereas the other is likely possible mislabeling errors and studying derived from ‘Grandiflora’. No close genetic similarity was observed among several relationships between cultivars developed cultivars from a long-term Belgium breeding program, although many had one parent in through the same and different breeding common. Early-flowering genotypes clustered separately from genotypes that flower in programs. midsummer, but close genetic relationships were not observed among early-flowering cultivars. Two genotypes from Taiwan were genetically similar but were distinctly Materials and Methods different from the Japanese genotypes. These, along with the early-flowering genotypes and a new collection from Japan, may represent unexploited sources of germplasm for Plant materials. The 36 H. paniculata improvement of H. paniculata. genotypes tested in this study are listed in Table 1. In addition to 28 cultivars, four wild- collected genotypes (BSWJ 3802, DJHT The genus Hydrangea L. consists of 23 loid, tetraploid, and hexaploid forms of 99157, HC 970618, PI 479429) and four species and has an American–Asiatic distri- Hydrangea paniculata have been reported, breeding lines (BL 16-02, BL 22-02, G-881, bution (McClintock, 1957). Several species but only the tetraploid chromosome number NA 74383) were examined. Twelve cultivars are cultivated as ornamentals, of which H. (2n =4x = 72) has been reported for horti- (Brussels Lace, Floribunda, Grandiflora, paniculata is the most cold-hardy (Dirr, cultural forms of the species (Funamoto and Greenspire, Kyushu, Limelight, Pink Dia- 2004). This species, which is also known by Ogawa, 2002; Funamoto and Tanaka, 1988; mond, Praecox, Silver Dollar, Tardiva, the common name of panicle hydrangea, is Haworth-Booth, 1984; Sax, 1931; Van Laere Unique, and White Lace) included in this native to Japan, eastern and southern China, et al., 2008; Zonneveld, 2004). study have been reported to be tetraploids and Taiwan (Dirr, 2004; McClintock, 1957). Hydrangea paniculata is cultivated pri- (Sax, 1931; Van Laere et al., 2008; Zonneveld, McClintock (1957) placed H. paniculata in marily as a garden plant, but there is also 2004); ploidy level has not been reported for Section Hydrangea Maxim., Subsection Het- interest in using it in the cut flower industry any of the other genotypes. A single plant was eromallae Rehder, along with H. heteromalla (Leeson et al., 2004). Most forms grow 3 to used for 26 H. paniculata genotypes. Three D. Don. Molecular data supported the rela- 4.5 m in height with a similar spread and seedlings of G-881, obtained from open- tionship between these two species and also produce long (15 to 20 cm) panicles in mid- pollinations of ‘Dharuma’, and two seedlings indicated that they share considerable genetic summer. Like with most other members of of DJHT 99157 were analyzed; data from similarity with Schizophragma Sieb. and the genus, H. paniculata inflorescences con- these plants are presented individually. Two Zucc. (Rinehart et al., 2006). Diploid, trip- sist of a combination of small, inconspicuous or three plants each of ‘Brussels Lace’, perfect flowers and large, imperfect flowers ‘Chantilly Lace’, ‘Floribunda’, ‘Grandiflora’, with showy sepals. Flowers open white or ‘Greenspire’, ‘Tardiva’, ‘Unique’, and cream-colored, but in some cultivars turn ‘White Moth’ were analyzed; because all Received for publication 25 Aug. 2008. Accepted for publication 7 Oct. 2008. pale to deep pink as they age. Rated as hardy duplicate samples of these cultivars yielded We thank David Creech and Barbara Stump (Mast to between –34 to –37 C (Rose et al., 2001), comparable data, data from only one repre- Arboretum at Stephen F. Austin State University), H. paniculata is recommended for USDA sentative are presented. Plant tissue was Kristin VanHoose (Amethyst Hill Nursery), Don cold-hardiness zones 4 to 8 (Dirr, 2004). obtained from plants in our collection at the Shadow (Shadow Nurseries), and Mark Widrlech- Approximately 50 extant cultivars of H. Nursery Research Center in McMinnville, ner (North Central Regional Plant Introduction paniculata have been described (Dirr, 2004; TN, or from public or commercial sources Station) for graciously donating tissue and plants Mallet, 1994; Mallet et al., 1992; van Gelderen (Table 1). Four H. heteromalla selections from their collections for this research. and van Gelderen, 2004). A few (‘Flori- were included in the analysis for rooting the Mention of trade names or commercial products in bunda’, ‘Grandiflora’, ‘Kyushu’, ‘Praecox’) phenogram. this article is solely for the purpose of providing specific information and does not imply recom- originated in Japan and have been in cultiva- Simple-sequence repeat development and mendation or endorsement by the U.S. Department tion for over 100 years. Many others were sample processing. Previously described of Agriculture. developed through breeding efforts in Europe SSR-enriched libraries (Rinehart et al., 1To whom reprint requests should be addressed; and have been introduced to the United States 2006) were screened for polymorphic loci e-mail [email protected]. only during the past 10 to 15 years. Although against a panel of 12 H. paniculata cultivars. HORTSCIENCE VOL. 44(1) FEBRUARY 2009 27 JOBNAME: horts 44#1 2009 PAGE: 2 OUTPUT: December 29 22:22:56 2008 tsp/horts/180127/03204 Table 1. Hydrangea paniculata genotypes evaluated with 26 simple-sequence repeat markers and sources of tissue. Source of leaf Expected Genotypes tissuez heterozygosity Big Ben NRC BL 16-02 MAST BL 22-02 MAST Boskoop NRC Allelic Brussels Lace AHN; NRC richness BSWJ 3802 MAST Burgundy Lace NRC Chantilly Lace MAST; NRC Compact Grandiflora MAST Dharuma NRC (bp) DJHT 99157 NRC Dolly NRC Allele range Quick Fireä (Bulk) SN Floribunda MAST; NRC G-881 NRC No. Grandiflora MAST; NRC alleles (PeeGee; Pee Gee) Greenspire AHN; MAST; NRC HC 970618 MAST Kyushu NRC Limelight NRC NA 74383 NRC Pee Wee NRC Phantom SN PI 479429 NCRPIP Pink Diamond NRC Pinky Winkyä NRC (DVPinky) Praecox MAST Silver Dollar NRC Tardiva AHN; NRC The Swanä (Barbara) NRC Unique AHN; NRC Webb NRC White Lace MAST White Lady NRC White Moth MAST; NRC White Tiara NRC zAHN = Amethyst Hill Nursery, Aurora, OR; genotypes. MAST = Stephen F. Austin MAST Arboretum, Nacogdoches, TX; NCRPIS = North Central Regional Plant Introduction Station, Ames, IA; NRC = Tennessee State University Nursery Research Center, McMinnville, TN; SN = H. paniculata Shadow Nursery, Winchester, TN. DNA was extracted from 1-cm2 pieces of fresh leaf tissue using a Qiagen Plant Mini Kit (Qiagen, Valencia, CA) and quantified using a NanoDrop Spectrophotometer (Nanodrop Technologies, Wilmington, DE). SSR amplification was performed using a modified three-primer protocol (Rinehart et al., 2006). Fluorescence-labeled polymer- ase chain reaction (PCR) fragments were visualized by automated capillary gel electro- phoresis on an ABI3100-Avant or ABI3730xl (Applied Biosystems, Foster City, CA) using ROX-500 size standard. GeneMapper ver- sion 4.0 (Applied Biosystems, Foster City, CA) was used to recognize and size peaks. SSR markers are described in Table 2 and all sequences were submitted to the Na- DQ521440 (TCA)8 AGAGGTCAGGCCTTGGAAAGATACDQ521451 (TCG)6 AGAGGTCAGGCCTTGGAAAGATAC CTTCTTCCTCTTCTTTGGTGGTTGDQ521449
Recommended publications
  • "National List of Vascular Plant Species That Occur in Wetlands: 1996 National Summary."

    "National List of Vascular Plant Species That Occur in Wetlands: 1996 National Summary."

    Intro 1996 National List of Vascular Plant Species That Occur in Wetlands The Fish and Wildlife Service has prepared a National List of Vascular Plant Species That Occur in Wetlands: 1996 National Summary (1996 National List). The 1996 National List is a draft revision of the National List of Plant Species That Occur in Wetlands: 1988 National Summary (Reed 1988) (1988 National List). The 1996 National List is provided to encourage additional public review and comments on the draft regional wetland indicator assignments. The 1996 National List reflects a significant amount of new information that has become available since 1988 on the wetland affinity of vascular plants. This new information has resulted from the extensive use of the 1988 National List in the field by individuals involved in wetland and other resource inventories, wetland identification and delineation, and wetland research. Interim Regional Interagency Review Panel (Regional Panel) changes in indicator status as well as additions and deletions to the 1988 National List were documented in Regional supplements. The National List was originally developed as an appendix to the Classification of Wetlands and Deepwater Habitats of the United States (Cowardin et al.1979) to aid in the consistent application of this classification system for wetlands in the field.. The 1996 National List also was developed to aid in determining the presence of hydrophytic vegetation in the Clean Water Act Section 404 wetland regulatory program and in the implementation of the swampbuster provisions of the Food Security Act. While not required by law or regulation, the Fish and Wildlife Service is making the 1996 National List available for review and comment.
  • Hydrangea Paniculata Neiill Lancaster Bottaniisstt,, RHS Garrden Wiisslley

    Hydrangea Paniculata Neiill Lancaster Bottaniisstt,, RHS Garrden Wiisslley

    RHHSS PLAANNTT TRIALSS BULLLEETIN Numberr 23 Deccemmberr 2008 Hydrangea paniculata Neiill Lancaster Bottaniisstt,, RHS Garrden Wiisslley Wendy Weslley Trriiallss Offficerr,, RHS Garrden Wiisslley The RHS Trial of Hydrangea paniculata Background to the trial H. paniculata in the wild and in Although Hydrangea paniculata has been cultivated in cultivation European gardens for well over a century, for most of that H. paniculata is native of cool temperate and sub-tropical period there has been little choice beyond a handful of regions of Japan, China and Sakhalin, where it grows as a very early introductions. H. paniculata , the panicled deciduous shrub or small tree to 8m in height, at altitudes hydrangea, has invariably played second fiddle to the more to about 1300m. It is often stated to be a very variable colourful H. macrophylla , or hortensia, even though it is species in the wild, but not all authors agree on this. generally easier to grow and more reliably hardy. The first edition of Michael Haworth-Booth’s The Hydrangeas , H. paniculata was first described and named in 1829 by the published in 1950, included over 300 hortensias, but only German physician and botanist Philipp Franz von Siebold 3 types of H. paniculata , namely the cultivars ‘Floribunda’, while working for the Dutch East India Company based on ‘Grandiflora’ and ‘Praecox’. Deshima Island within Nagasaki harbour, Japan. Granted limited access to the mainland to carry out his medical After the 1950s, the range of cultivars started to increase duties, at a time when other foreigners were excluded, with the appearance of the first de Belder introductions Siebold used the opportunity to collect and describe the and slowly gathered pace in the 1970s and 1980s as new native plants, including H.
  • Hydrangeas for Plant Connoisseurs

    Hydrangeas for Plant Connoisseurs

    TheThe AmericanAmerican GARDENERGARDENER® TheThe MagazineMagazineMagazine ofof thethe AAmericanmerican HorticulturalHorticultural SocietySocietySociety MayMay / June 2014 Hydrangeas for plant Connoisseurs CharmingCharming NicotianasNicotianas Four-SeasonFour-Season TreesTrees NewNew HerbHerb TrendsTrends Did you know that you can give the American Horticultural Let your home Society a residence, farm or vacation property, gain a charitable work for you! gift deduction, and retain the right to live in the property? A gift of real estate can provide the following benefits: • Produce a substantial charitable income tax deduction • Reduce capital gains taxes • Save estate taxes • Leave a legacy of a greener, healthier, more beautiful America • Membership in the Horticultural Heritage Society We would be pleased to discuss how a gift of real estate can benefit both you and the American Horticultural Society. Please contact Scott Lyons, Director of Institutional Advancement, at [email protected] or (703) 768-5700 ext 127. contents Volume 93, Number 3 . May / June 2014 FEATURES DEPARTMENTS 5 NOTES FROM RIVER FARM 6 MEMBERS’ FORUM 8 NEWS FROM THE AHS Bequest of longtime AHS member Wilma L. Pickard establishes new AHS fellowship for aspiring horticulturists, Susie and Bruce Usrey are Honorary co-Chairs of 2014 Gala, birds of prey visit River Farm during annual Spring Garden Market. 12 AHS MEMBERS MAKING A DIFFERENCE Joan Calder. page 1414 44 GARDEN SOLUTIONS Avoiding or preventing late-blight infestations on tomatoes. 14 CHARMING NICOTIANAS BY RAND B. LEE 46 TRAVELER’S GUIDE TO GARDENS Beloved for their fragrance and attractiveness to pollinators, these The Rotary Botanical Gardens. old-fashioned cottage-garden favorites are back in style. 48 HOMEGROWN HARVEST Sweet and tart crabapples.
  • Fragrant Annuals Fragrant Annuals

    Fragrant Annuals Fragrant Annuals

    TheThe AmericanAmerican GARDENERGARDENER® TheThe MagazineMagazine ofof thethe AAmericanmerican HorticulturalHorticultural SocietySociety JanuaryJanuary // FebruaryFebruary 20112011 New Plants for 2011 Unusual Trees with Garden Potential The AHS’s River Farm: A Center of Horticulture Fragrant Annuals Legacies assume many forms hether making estate plans, considering W year-end giving, honoring a loved one or planting a tree, the legacies of tomorrow are created today. Please remember the American Horticultural Society when making your estate and charitable giving plans. Together we can leave a legacy of a greener, healthier, more beautiful America. For more information on including the AHS in your estate planning and charitable giving, or to make a gift to honor or remember a loved one, please contact Courtney Capstack at (703) 768-5700 ext. 127. Making America a Nation of Gardeners, a Land of Gardens contents Volume 90, Number 1 . January / February 2011 FEATURES DEPARTMENTS 5 NOTES FROM RIVER FARM 6 MEMBERS’ FORUM 8 NEWS FROM THE AHS 2011 Seed Exchange catalog online for AHS members, new AHS Travel Study Program destinations, AHS forms partnership with Northeast garden symposium, registration open for 10th annual America in Bloom Contest, 2011 EPCOT International Flower & Garden Festival, Colonial Williamsburg Garden Symposium, TGOA-MGCA garden photography competition opens. 40 GARDEN SOLUTIONS Plant expert Scott Aker offers a holistic approach to solving common problems. 42 HOMEGROWN HARVEST page 28 Easy-to-grow parsley. 44 GARDENER’S NOTEBOOK Enlightened ways to NEW PLANTS FOR 2011 BY JANE BERGER 12 control powdery mildew, Edible, compact, upright, and colorful are the themes of this beating bugs with plant year’s new plant introductions.
  • Trees, Shrubs, and Perennials That Intrigue Me (Gymnosperms First

    Trees, Shrubs, and Perennials That Intrigue Me (Gymnosperms First

    Big-picture, evolutionary view of trees and shrubs (and a few of my favorite herbaceous perennials), ver. 2007-11-04 Descriptions of the trees and shrubs taken (stolen!!!) from online sources, from my own observations in and around Greenwood Lake, NY, and from these books: • Dirr’s Hardy Trees and Shrubs, Michael A. Dirr, Timber Press, © 1997 • Trees of North America (Golden field guide), C. Frank Brockman, St. Martin’s Press, © 2001 • Smithsonian Handbooks, Trees, Allen J. Coombes, Dorling Kindersley, © 2002 • Native Trees for North American Landscapes, Guy Sternberg with Jim Wilson, Timber Press, © 2004 • Complete Trees, Shrubs, and Hedges, Jacqueline Hériteau, © 2006 They are generally listed from most ancient to most recently evolved. (I’m not sure if this is true for the rosids and asterids, starting on page 30. I just listed them in the same order as Angiosperm Phylogeny Group II.) This document started out as my personal landscaping plan and morphed into something almost unwieldy and phantasmagorical. Key to symbols and colored text: Checkboxes indicate species and/or cultivars that I want. Checkmarks indicate those that I have (or that one of my neighbors has). Text in blue indicates shrub or hedge. (Unfinished task – there is no text in blue other than this text right here.) Text in red indicates that the species or cultivar is undesirable: • Out of range climatically (either wrong zone, or won’t do well because of differences in moisture or seasons, even though it is in the “right” zone). • Will grow too tall or wide and simply won’t fit well on my property.
  • Illustration Sources

    Illustration Sources

    APPENDIX ONE ILLUSTRATION SOURCES REF. CODE ABR Abrams, L. 1923–1960. Illustrated flora of the Pacific states. Stanford University Press, Stanford, CA. ADD Addisonia. 1916–1964. New York Botanical Garden, New York. Reprinted with permission from Addisonia, vol. 18, plate 579, Copyright © 1933, The New York Botanical Garden. ANDAnderson, E. and Woodson, R.E. 1935. The species of Tradescantia indigenous to the United States. Arnold Arboretum of Harvard University, Cambridge, MA. Reprinted with permission of the Arnold Arboretum of Harvard University. ANN Hollingworth A. 2005. Original illustrations. Published herein by the Botanical Research Institute of Texas, Fort Worth. Artist: Anne Hollingworth. ANO Anonymous. 1821. Medical botany. E. Cox and Sons, London. ARM Annual Rep. Missouri Bot. Gard. 1889–1912. Missouri Botanical Garden, St. Louis. BA1 Bailey, L.H. 1914–1917. The standard cyclopedia of horticulture. The Macmillan Company, New York. BA2 Bailey, L.H. and Bailey, E.Z. 1976. Hortus third: A concise dictionary of plants cultivated in the United States and Canada. Revised and expanded by the staff of the Liberty Hyde Bailey Hortorium. Cornell University. Macmillan Publishing Company, New York. Reprinted with permission from William Crepet and the L.H. Bailey Hortorium. Cornell University. BA3 Bailey, L.H. 1900–1902. Cyclopedia of American horticulture. Macmillan Publishing Company, New York. BB2 Britton, N.L. and Brown, A. 1913. An illustrated flora of the northern United States, Canada and the British posses- sions. Charles Scribner’s Sons, New York. BEA Beal, E.O. and Thieret, J.W. 1986. Aquatic and wetland plants of Kentucky. Kentucky Nature Preserves Commission, Frankfort. Reprinted with permission of Kentucky State Nature Preserves Commission.
  • American Society for Horticultural Science Annual Conference Program

    American Society for Horticultural Science Annual Conference Program

    American Society for Horticultural Science Annual Conference Program New Orleans 2015 Image Analysis for Plant Science www.regentinstruments.com since 1991 [email protected] WinSCANOPY™ ࠮Canopy structure and Solar radiation ࠮Plant canopy health/stress (NDVI) ࠮*HTLYHJHSPIYH[LKÄZOL`LSLUZZLSMSL]LSPUNTV\U[LSLJ[YVUPJJVTWHZZ WinCELL™ ࠮Wood-cell structure parameters over annual rings ࠮Analysis of one or more rings per image ࠮Data computed on yearly basis in a format compatible with WinDENDRO™ WinDENDRO™ ࠮;YLLYPUNZMYVTKPZRZJVYLZ?YH`ÄSTZHUKKPNP[HS?YH`Z`Z[LTZ ࠮Cross-dating graphic, correlation functions, detrending,... ࠮Wood density and earlywood/latewood boundary WinFOLIA™ ࠮Leaf morphology ࠮3LHMZOHWL-YHJ[HSZHZWLJ[YH[PVHUKMVYTJVLɉJPLU[ ࠮Healthy, diseased and pest damage areas WinSEEDLE™ ࠮Seed and needle morphology ࠮Counts and classification of seeds and needles ࠮Healthy, diseased and pest damage areas WinRHIZO™ ࠮Washed root morphology, topology, link, and architecture ࠮Automatic analysis of Arabidopsis seedlings ࠮Healthy, diseased and pest damage areas WinRHIZO™ Tron ࠮Morphology, architecture and topology of roots growing in soil ࠮Roots must be traced manually with a mouse or by touching the screen of a tablet computer Need More Than One Software Program? Take Advantage of Our New Suites. Image acquisition hardware sold separately. Tous.indd 1 22-05-15 2:56 PM American Society for Horticultural Science 1018 Duke Street, Alexandria, Virginia 22314, USA Phone 703.836.4606 Fax 703.836.2024 August 2015 Dear ASHS 2015 Conference Participants, Welcome to the 2015 Conference of the American Society for Horticultural Science! As we prepare to enjoy The Big Easy and all of its historic charms, it is important to celebrate the city’s rebirth and cultural renewal.
  • JOURNALJOURNAL Friends of the “Shamrock” Hydrangea Collection

    JOURNALJOURNAL Friends of the “Shamrock” Hydrangea Collection

    JOURNALJOURNAL Friends of the “Shamrock” Hydrangea Collection Journal n° 23 - 2012 w w w . h o r t e n s i a s - h y d r a n g e a . c o m EDITORIAL by Bryan Woy, President Dear friends of the “Shamrock” Collection, C O N T E N T S As you can read in this Journal's Media Report, our collection's reputation continues to grow at the same rate as the number of plants it contains. We should note in particular the Belgian tele- E d i t o r i a l b y B r y a n W o y p . 1 - 2 vision broadcast “Jardins et Loisirs”, shown in late January, N e w m e m b e r s & T h a n k s p . 2 which painted a particularly vivid portrait; many thanks and M e d i a r e v i e w & N e w c u l t i v a r s p . 3 congratulations to the director. Also extremely satisfying is the Work in 2011 & News of our members p . 4 explicit support brought to us by professional breeders and nur- T h e h y d r a n g e a ' T h o m a s H o g g ' serymen during this crucial year: 2012 is likely to be a water- b y R o g e r D i n s d a l e p . 5 shed in our history. The highlight of the year will be the T h e 2 0 1 1 d r o u g h t International Symposium "Hydrangea 2012", to be held in b y R o b e r t M a l l e t p .
  • Japansese Beetle Potential Host Range

    Japansese Beetle Potential Host Range

    Japanese Beetle Potential Host Range in California D. G. Kelch, Ph.D. Primary Botanist, California Department of Food and Agriculture Japanese Beetle (Popillia japonica Newman) is a species introduced into North America that has spread widely throughout the eastern United States. In this area, infestations have proven extremely damaging to horticultural and agricultural plants. Yearly costs for management and mitigation of damage are estimated at US$500 million (USDA 2007). In addition, areas infested with Japanese beetle can be quarantined by trading partners, resulting in losses to farmers and nursery growers mounting into the millions of dollars per year (National Plant Board 2007; Smith et al. 1996). Japanese Beetle is not yet fully established in California, but recent detections in Sacramento County have raised concerns and triggered control activities by agencies tasked with protecting plants from pests. Japanese beetles have a broad range of host plants. The list of plants used as hosts by Japanese beetle contains more than 300 species (Potter & Held 2002). Because the focus has been on Japanese beetle attacks in gardens and lawns, the host list is dominated by garden plants. Most of the information on host susceptibility to Japanese beetle originated from a landmark survey summariZed by Fleming (1972). This rating system was based on written and oral accounts of Japanese beetle feeding damage noted from 1920 through 1963 primarily in the New England area (Fleming 1972). Although poorly documented, there is little doubt that Japanese beetle can attack many other species of plants not included on the host list (Miller et al., 2001; Potter & Held 2002).
  • Hydrangeas Demystified

    Hydrangeas Demystified

    Hydrangeas Demystified We love our hydrangeas but are often perplexed when they do not put on a show for us. The first step toward success is to understand the various kinds of hydrangeas and choose the right one for your needs. The six most widely planted hydrangea species in Shelby County include the following; Types of Hydrangeas for Mid-South 1. Macrophylla (mophead, hortensia, or French) Usually blooms in Late May or early June. It grows in a rounded shape, and it has big, shiny leaves and depending on variety either mophead or lacecap blooms. It needs regular water, especially in the heat of summer. There have been many new introductions so choose one that will fit your space so you won’t need to prune it for size. There are now reblooming varieties available in this class of hydrangea. Some Shelby County favorite varieties; • Reblooming Mophead; ‘Blushing Bride,’ ‘David Ramsey,’ ‘Decatur Blue,’ Endless Summer series, ‘Mini Penny,’ ‘Nantucket Blue,’ ‘Oak Hill’ and ‘Penny Mac.’ • Reblooming Lacecap; ‘Twist-n-Shout’. • Mophead; ‘All Summer Beauty,’ ‘Ami Pasquier,’ ‘Frillibet,’ ‘Générale Vicomtesse de Vibraye,’ ‘Mme. Emile Mouillère,’ ‘Mousseline’ and ‘Nikko Blue.’ • Lacecap ‘Blue Wave,’ ‘Lanarth White,’ ‘Lilacina,’ ‘Veitchii’ and ‘White Wave.’ 2. Arborescens (Smooth) This native hydrangea has mophead blooms that are always white. It is similar to the Macrophylla in appearance but blooms on new wood and is more cold hardy than the Macrophylla so it is a more dependable bloomer. Recent introductions are beginning to introduce color. Invincibelle Spirit is a dusty pink and is the exception to the all white bloom rule.
  • Chapter 1 Basic Botany, Physiology and Environmental Effects on Plant Growth

    Chapter 1 Basic Botany, Physiology and Environmental Effects on Plant Growth

    Chapter 1 Basic Botany, Physiology and Environmental Effects on Plant Growth Gymnosperms and Angiosperms .................................................................................................................. 1 Life Cycles ..................................................................................................................................................... 2 Principal Parts of Vascular Plants .................................................................................................................. 2 Roots ................................................................................................................................................................... 2 Types of Roots ................................................................................................................................................................. 2 Parts of a Root ................................................................................................................................................................. 3 Roots as Food .................................................................................................................................................................. 4 Stems Texture and Growth of Stems ........................................................................................................................................... 5 Diversified Stem Development ........................................................................................................................................
  • Pruning – Not a Mysterious Art Bruce Crawford March 16, 2021 State Program Leader, Home & Public Horticulture Crawford@Njaes.Rutgers.Edu

    Pruning – Not a Mysterious Art Bruce Crawford March 16, 2021 State Program Leader, Home & Public Horticulture [email protected]

    Cooperative Extension of Ocean County njaes.rutgers.edu/extension Extension Center 732-349-1227 4-H 1623 Whitesville Road 732-349-1246 Agriculture Toms River, NJ 08755-1199 732-505-3671 Environmental Resource Management ocean.njaes.rutgers.edu 732-349-1247 FCHS 732-349-1152 Fisheries/Aquaculture 732-349-1245 Rutgers Master Gardeners 732-505-8941 Fax Pruning – Not a Mysterious Art Bruce Crawford March 16, 2021 State Program Leader, Home & Public Horticulture [email protected] Introduction (Maintaining the Past for the Future) Good design, with good quality site preparation and installation followed by intelligent maintenance are the essential parameters for a garden to reach its full potential. There are few maintenance practices that can be more beneficial or more harmful to a residential, commercial or public garden landscape than pruning. Proper pruning helps preserve the vigor and health of shrubs and trees, allowing them to live to their full life expectancy. One important element to remember – we prune shrubs to retain their beauty in flowers and foliage, while we principally prune trees for safety. Proper pruning literally preserves the past while shaping the future of the landscape! Reading (Going beyond these Notes) An Illustrated Guide to Pruning (third edition) – Edward Gilman Published by Delmar Cengage Learning Why we Prune (Reasons for Pruning) 1. Sanitation. Removal of dead, diseased or insect infected wood. If diseased, tools should be dipped in a 10% bleach solution to prevent further contamination. Sanitation also includes the removal of crossing and rubbing branches; the constant abrasion from rubbing maintains an open wound and allows a port of entry for insect and disease.