JOBNAME: horts 44#1 2009 PAGE: 1 OUTPUT: December 29 22:22:52 2008 tsp/horts/180127/03204
HORTSCIENCE 44(1):27–31. 2009. many of the H. paniculata cultivars available in the United States are relatively recent intro- ductions, little is known about their parent- Simple-sequence Repeat Marker age. In addition to named cultivars, a few wild-collected H. paniculata accessions are Analysis of Genetic Relationships available in the United States. Two of these were collected in Taiwan and appear to be the within Hydrangea paniculata only H. paniculata germplasm in the United States that was not either introduced from Sandra M. Reed1 Japan or bred from Japanese germplasm. USDA-ARS, Floral and Nursery Plants Research Unit, Tennessee State Microsatellite, or simple-sequence repeat University Otis L. Floyd Nursery Research Center, 472 Cadillac Lane, (SSR), markers provide a useful method for characterizing genetic diversity within a plant McMinnville, TN 37110 species. SSR markers were recently used to Timothy A. Rinehart study relationships among 114 H. macro- phylla (Thunb.) Ser. genotypes (Reed and USDA-ARS, Southern Horticultural Laboratory, 810 Highway 26 West, Rinehart, 2007). Genetic similarities were Poplarville, MS 39470 found among remontant, variegated, and Additional index words. breeding, molecular markers, panicle hydrangea double-flowered cultivars. Some presumed synonyms were valid, whereas others were Abstract. Genetic diversity studies using 26 simple-sequence repeat (SSR) markers were not. Potentially unexploited sources of germ- conducted with 36 cultivars, breeding lines, and wild-collected accessions of Hydrangea plasm within H. macrophylla were identified. paniculata Sieb. The SSR markers were highly variable among the genotypes, producing The objective of this study was to use SSR a mean of 5.8 alleles per marker. Three cultivars (Boskoop, Compact Grandiflora, and markers to study genetic relationships within Webb) were either identical to or sports of the popular cultivar Grandiflora. The name H. paniculata. We were particularly inter- ‘Pee Wee’ appears to have been applied to two phenotypically different compact forms of ested in rectifying synonym confusion and H. paniculata, one of which seems to be a sport of ‘Tardiva’, whereas the other is likely possible mislabeling errors and studying derived from ‘Grandiflora’. No close genetic similarity was observed among several relationships between cultivars developed cultivars from a long-term Belgium breeding program, although many had one parent in through the same and different breeding common. Early-flowering genotypes clustered separately from genotypes that flower in programs. midsummer, but close genetic relationships were not observed among early-flowering cultivars. Two genotypes from Taiwan were genetically similar but were distinctly Materials and Methods different from the Japanese genotypes. These, along with the early-flowering genotypes and a new collection from Japan, may represent unexploited sources of germplasm for Plant materials. The 36 H. paniculata improvement of H. paniculata. genotypes tested in this study are listed in Table 1. In addition to 28 cultivars, four wild- collected genotypes (BSWJ 3802, DJHT The genus Hydrangea L. consists of 23 loid, tetraploid, and hexaploid forms of 99157, HC 970618, PI 479429) and four species and has an American–Asiatic distri- Hydrangea paniculata have been reported, breeding lines (BL 16-02, BL 22-02, G-881, bution (McClintock, 1957). Several species but only the tetraploid chromosome number NA 74383) were examined. Twelve cultivars are cultivated as ornamentals, of which H. (2n =4x = 72) has been reported for horti- (Brussels Lace, Floribunda, Grandiflora, paniculata is the most cold-hardy (Dirr, cultural forms of the species (Funamoto and Greenspire, Kyushu, Limelight, Pink Dia- 2004). This species, which is also known by Ogawa, 2002; Funamoto and Tanaka, 1988; mond, Praecox, Silver Dollar, Tardiva, the common name of panicle hydrangea, is Haworth-Booth, 1984; Sax, 1931; Van Laere Unique, and White Lace) included in this native to Japan, eastern and southern China, et al., 2008; Zonneveld, 2004). study have been reported to be tetraploids and Taiwan (Dirr, 2004; McClintock, 1957). Hydrangea paniculata is cultivated pri- (Sax, 1931; Van Laere et al., 2008; Zonneveld, McClintock (1957) placed H. paniculata in marily as a garden plant, but there is also 2004); ploidy level has not been reported for Section Hydrangea Maxim., Subsection Het- interest in using it in the cut flower industry any of the other genotypes. A single plant was eromallae Rehder, along with H. heteromalla (Leeson et al., 2004). Most forms grow 3 to used for 26 H. paniculata genotypes. Three D. Don. Molecular data supported the rela- 4.5 m in height with a similar spread and seedlings of G-881, obtained from open- tionship between these two species and also produce long (15 to 20 cm) panicles in mid- pollinations of ‘Dharuma’, and two seedlings indicated that they share considerable genetic summer. Like with most other members of of DJHT 99157 were analyzed; data from similarity with Schizophragma Sieb. and the genus, H. paniculata inflorescences con- these plants are presented individually. Two Zucc. (Rinehart et al., 2006). Diploid, trip- sist of a combination of small, inconspicuous or three plants each of ‘Brussels Lace’, perfect flowers and large, imperfect flowers ‘Chantilly Lace’, ‘Floribunda’, ‘Grandiflora’, with showy sepals. Flowers open white or ‘Greenspire’, ‘Tardiva’, ‘Unique’, and cream-colored, but in some cultivars turn ‘White Moth’ were analyzed; because all Received for publication 25 Aug. 2008. Accepted for publication 7 Oct. 2008. pale to deep pink as they age. Rated as hardy duplicate samples of these cultivars yielded We thank David Creech and Barbara Stump (Mast to between –34 to –37 C (Rose et al., 2001), comparable data, data from only one repre- Arboretum at Stephen F. Austin State University), H. paniculata is recommended for USDA sentative are presented. Plant tissue was Kristin VanHoose (Amethyst Hill Nursery), Don cold-hardiness zones 4 to 8 (Dirr, 2004). obtained from plants in our collection at the Shadow (Shadow Nurseries), and Mark Widrlech- Approximately 50 extant cultivars of H. Nursery Research Center in McMinnville, ner (North Central Regional Plant Introduction paniculata have been described (Dirr, 2004; TN, or from public or commercial sources Station) for graciously donating tissue and plants Mallet, 1994; Mallet et al., 1992; van Gelderen (Table 1). Four H. heteromalla selections from their collections for this research. and van Gelderen, 2004). A few (‘Flori- were included in the analysis for rooting the Mention of trade names or commercial products in bunda’, ‘Grandiflora’, ‘Kyushu’, ‘Praecox’) phenogram. this article is solely for the purpose of providing specific information and does not imply recom- originated in Japan and have been in cultiva- Simple-sequence repeat development and mendation or endorsement by the U.S. Department tion for over 100 years. Many others were sample processing. Previously described of Agriculture. developed through breeding efforts in Europe SSR-enriched libraries (Rinehart et al., 1To whom reprint requests should be addressed; and have been introduced to the United States 2006) were screened for polymorphic loci e-mail [email protected]. only during the past 10 to 15 years. Although against a panel of 12 H. paniculata cultivars.
HORTSCIENCE VOL. 44(1) FEBRUARY 2009 27 JOBNAME: horts 44#1 2009 PAGE: 2 OUTPUT: December 29 22:22:56 2008 tsp/horts/180127/03204
Table 1. Hydrangea paniculata genotypes evaluated with 26 simple-sequence repeat markers and sources of tissue. Source of leaf Expected Genotypes tissuez heterozygosity Big Ben NRC BL 16-02 MAST BL 22-02 MAST Boskoop NRC Allelic
Brussels Lace AHN; NRC richness BSWJ 3802 MAST Burgundy Lace NRC Chantilly Lace MAST; NRC Compact Grandiflora MAST
Dharuma NRC (bp) DJHT 99157 NRC Dolly NRC Allele range Quick Fireä (Bulk) SN Floribunda MAST; NRC G-881 NRC No.
Grandiflora MAST; NRC alleles (PeeGee; Pee Gee) Greenspire AHN; MAST; NRC HC 970618 MAST Kyushu NRC Limelight NRC NA 74383 NRC Pee Wee NRC Phantom SN PI 479429 NCRPIP Pink Diamond NRC Pinky Winkyä NRC (DVPinky) Praecox MAST Silver Dollar NRC Tardiva AHN; NRC The Swanä (Barbara) NRC Unique AHN; NRC Webb NRC White Lace MAST White Lady NRC White Moth MAST; NRC White Tiara NRC zAHN = Amethyst Hill Nursery, Aurora, OR; genotypes. MAST = Stephen F. Austin MAST Arboretum, Nacogdoches, TX; NCRPIS = North Central Regional Plant Introduction Station, Ames, IA; NRC = Tennessee State University Nursery Research Center, McMinnville, TN; SN = H. paniculata Shadow Nursery, Winchester, TN.
DNA was extracted from 1-cm2 pieces of fresh leaf tissue using a Qiagen Plant Mini Kit (Qiagen, Valencia, CA) and quantified using a NanoDrop Spectrophotometer (Nanodrop Technologies, Wilmington, DE). SSR amplification was performed using a modified three-primer protocol (Rinehart et al., 2006). Fluorescence-labeled polymer- ase chain reaction (PCR) fragments were visualized by automated capillary gel electro- phoresis on an ABI3100-Avant or ABI3730xl (Applied Biosystems, Foster City, CA) using ROX-500 size standard. GeneMapper ver- sion 4.0 (Applied Biosystems, Foster City, CA) was used to recognize and size peaks. SSR markers are described in Table 2 and
all sequences were submitted to the Na- DQ521440 (TCA)8 AGAGGTCAGGCCTTGGAAAGATACDQ521451 (TCG)6 AGAGGTCAGGCCTTGGAAAGATAC CTTCTTCCTCTTCTTTGGTGGTTGDQ521449 (GCA)10 5 AGAGAATGGAGATGACGACGATGDQ521448 TCCATCGAGTTCAACTTCTTCTCCDQ521447 159–171DQ521446 (CTG)8 (GCC)4 (CCA)5 0.139 AGTCGCAGATCTCACTTATTTCGG 6 CAGCCACCACTGCTACTGCTACTA GGGCAAAATGGTAACCTTCCTATG AGTGCCAGCATCACCACTAACATA 0.3263 154–187 GATCCACCATTTTAGTGATTCGGA 8 TGAAAAGTAATGCCTACCGATGCT 0.167 AACTATGGAAGTGGAGGCGGTTAT 151–179 0.6833 7 2 0.222 7 162–183 123–126 140–165 0.7419 0.194 0.056 0.194 0.7405 0.5686 0.7922 tional Center for Biotechnology Information
GenBank. z z z z z
Data analysis. Data from 26 SSR markers z were compiled for the 36 genotypes and analyzed for shared allele frequencies. Nei’s minimum genetic distance was calculated Previously published in Rinehart et al. (2006). Table 2. Description of simple-sequence repeat (SSR) markers used to analyze 36 z STAB 73-74STAB 77-78STAB 87-88STAB 95-96 FJ032275STAB 105-106 FJ032276STAB 111-112 FJ032277 (AAACC)4STAB 121-122 FJ032278 FJ032279 (ATAA)4STAB 127-128 (CTT)10STAB 141-142 TTTATCTGCTGTGTCGATCCAAAA FJ032280 (TCA)6 (CAT)4STAB 145-146 FJ032281STAB TTCCCTTCTATTATTTAGCAACAAAACG 147-148 FJ032282 (GAT)10STAB 157-158 TCCAGTCTTCATCTCCTTCTAGAACTTT FJ032283 (TCA)7STAB CAATGTTCGAAGTGTCAGAAATGC 167-168 FJ032284 AGTACTCCCCCATTGAGGATGAAG AGGATTCATATAGCCAACCCCAAT ATCATCACCATCAACATCAGCATC (TCA)7STAB 233-234 CCCCCTTCACGTTATTTTATTTCC (TGA)8STAB 265-266 GGGATCTTGCTCCATTAGGTGTAA FJ032285 (CTGTTT)5STAB 267-268 FJ032286 CATTTCTGACCTCAACATCGTTTGSTAB 285-286 FJ032287 GTGGTGGACAGTATGTGGCATTC CTCCACTGCCCACTAAGCTACAAC (ACA)7STAB GATGATGACGAGCCTAACAAGGAT 2 309-310 TGTGAAGCTATCAGCTGTTCAAGG FJ032288 GTTGTGATGGGTGTTCAGTGATGT 8 (TCT)8STAB 311-312 TGTCACATCAACTCTTTTCTCTTACAAA (CAG)4STAB 337-338 5 (CAG)7STAB 339-340 GACGGAGTGAGAGATGAAGGAGAA 161–165 AATTAAAGCAAGGGAACAACAGCASTAB TAGGAGCCGAAGATGGAAATGTAG 355-356 129–164 CCAAGTTAACATGAGTAATGGCGA FJ032289 8 3STAB TCACTTTGAATCTCTGCAATGAGG GATAGCTTCACAACTCAATCATGGC 407-408 FJ032290 7 TATTACAAAGACACGCTCAGCAGC 117–170STAB 441-442 FJ032291 0.056 ACCAGCACACCAACACCAAC (TCA)10STAB 581-582 0.222 GCTGCTGAGCGTGTCTTTGTAATA FJ032292 5 (TGA)7 101–116 114–123 FJ032293 7 0.139 (ATC)8 AAGCTTCTCAAAATCTGAGGGGAG 3 99–118 FJ032294 5 GTCATTTCCAACTAGTCCATTGGC (TCA)8 AGGAGCCGAAGAATTCGAACTAAC 0.2401 (AGA)6 0.222 143–159 0.7932 0.083 GTATCTCTGAACAACCAACGGTGT (TACGAG)4 148–184 0.194 154–167 5 0.6701 GCAAAAACACAACCACTTTCAACA 169–187 GTGCTCGGAGTAAGAACTACCGTT TAACATCCAAACATGTCCATCACC TCCAGTCCGGCTTGAGTTTATTAG 8 AGGGGTTAGGGAAAAACAAGAATG 0.139 GACACTTGGTAATCAACCACTCCC 0.7997 3 0.5159 0.194 0.083 AGCTTCCATCTTCAACTTCACCAT 170–185 0.139 0.7800 AATCCGGCATGGTTATAGGTCTCT 137–171 CTTCTCAGAGGAAGGAGACGAGG 4 0.6821 GCCTCTAAAGGTTGTTTCTACCGTG 166–183 5 TCACACTTGTAGGACATGAATCATCA 0.6937 0.139 0.3117 0.7756 0.222 8 117–131 0.083 6 134–146 8 12 4 0.3400 0.7009 0.111 90–116 0.139 164–179 0.3597 148–177 122–141 74–113 0.222 0.4556 0.167 0.7266 0.333 0.111 0.222 0.7117 0.7374 0.6780 0.6096 0.6183 SSR marker GanBank Repeat Forward primer Reverse primer for all samples (Nei, 1972). Gene diversity STAB 45-46
28 HORTSCIENCE VOL. 44(1) FEBRUARY 2009 JOBNAME: horts 44#1 2009 PAGE: 3 OUTPUT: December 29 22:22:57 2008 tsp/horts/180127/03204
estimates were produced using Nei’s 1987 Diamond’ for this marker. Only a single peak marily of showy, imperfect flowers (Dirr, estimator for heterozygosity and expected was observed for 343 PCR reactions and 2004). The weight of the large inflorescences gene diversity was determined using these were coded as four doses of that pulls the slender stems downward giving the FSTATS software (Goudet, 1995; Saitou particular allele. Four peaks were produced plant a distinctive drooping form. The 26 and Nei, 1987). In cases in which two or from 668 PCR reactions, as expected from a SSR markers used in this study could not three peaks were observed for a marker, tetraploid with four unique allele sizes at a separate ‘Grandiflora’ from ‘Boskoop’, relative peak height was used to determine particular locus. ‘Compact Grandiflora’, ‘Webb’, or ‘White how many copies of each allele was present. Only five of the SSR markers never Lace’ (Fig. 1). ‘White Lace’ is described as POPULATIONS version 1.2.28 was used displayed more than three alleles. Six of the being very similar to ‘Brussels Lace’, which for phenetic analyses (Langella, 2002). Prin- SSR markers never displayed more than two has upright inflorescences with a mixture of cipal coordinate analysis (PCoA) plots and different alleles in any given sample. No SSR showy and inconspicuous flowers (Dirr, tree dendograms were based on Nei’s mini- marker had a single allele for all samples. The 2004). ‘White Lace’ will not be included in mum genetic distance matrix and plots were remaining 15 SSR markers showed four further discussions of genetic relationships generated using NTSys software (Rohlf, different alleles in some genotypes, but never because this indicates that the plant used 1992). Neighbor-joining with 1000 bootstrap more than four alleles in any genotype. Thus, in this study was likely incorrectly labeled. replicates for statistical support was used to most of the SSR markers produced data The other three cultivars may be vegetative generate a tree phenogram, which was visu- consistent with amplification of all possible sports of ‘Grandiflora’. ‘Boskoop’ no longer alized with TreeView (Page, 1996). All alleles, including ‘‘hidden alleles,’’ which we appears to be available in commerce, but our genotypes were included in the tree dendo- included based on peak height. specimen is phenotypically very similar to gram, but only H. paniculata germplasm Not including the H. heteromalla and ‘Grandiflora’. ‘Webb’ is described as an introduced from Japan or cultivars bred from duplicate samples, 17 of the 936 PCR ampli- improved form of ‘Grandiflora’ that was Japanese germplasm were included in the fications failed to produce any data and were selected by J.A. Webb of Huntsville, AL PCoA plot. coded as missing. Ten of these failures (Dirr, 2004). Based on its name, ‘Compact occurred with BSWJ 3802 and DJHT Grandiflora’ appears to have originated as a Results 99157, both of which are wild-collected sport of ‘Grandiflora’ selected for its reduced genotypes from Taiwan and separated from plant habit. The 26 SSR markers were highly variable the major cluster of H. paniculata cultivars ‘Pee Wee’ is described by Dirr (2004) as among the H. paniculata genotypes analyzed (Fig. 1). Excluding identical genotypes, being phenotypically very similar to ‘Gran- (Table 2). The largest number of alleles genetic distances ranged from 3.5% between diflora’, but shorter and with smaller leaves recovered from any SSR marker was 12 and ‘Unique’ and NA 74383% to 50.8% between and finer-textured branches. The ‘Pee Wee’ the average number of alleles per marker was ‘Pee Wee’/‘Tardiva’ and DJHT 99157 (plant 2). plant used for this study could not be sepa- 5.8. Two markers generated only two alleles. Average pairwise genetic distance for the rated from ‘Tardiva’ using our markers (Fig. Allelic richness, calculated by the number of H. paniculata genotypes examined in this 1). This ‘Pee Wee’ specimen has upright alleles for each marker divided by the number study was 21.25% using Nei’s minimum inflorescences composed of a mixture of of samples, ranged from 0.056 to 0.333. genetic distance (Nei, 1972). showy and inconspicuous flowers and, other Twenty-two markers were trinucleotide The 26 SSR markers used in this study than being reduced in size, appears similar to repeats. One marker was tetranucleotide and were unable to separate the following four ‘Tardiva’. A search for descriptions and three were pentanucleotide repeats. Allele groups of cultivars: Boskoop, Compact Gran- images of ‘Pee Wee’ on the Internet found size variation corresponded to repeat motif diflora, Grandiflora, Webb, and White Lace; both those that matched Dirr’s description for all markers except for a few rare alleles White Moth and White Tiara; Pee Wee and and those similar to the plant in our collec- found only in a few genotypes. The range of Tardiva; and, Burgundy Lace and Kyushu tion. We believe that there are at least two alleles found for each SSR marker generally (Fig. 1). Genetic relationships were observed compact forms of H. paniculata in the trade matched the expected sizes predicted by among the following genotypes: ‘Unique’ that are referred to as ‘Pee Wee’. The sequence data. and NA 74383; ‘Burgundy Lace’/‘Kyushu’ ‘Compact Grandiflora’ specimen in this study Expected heterozygosity was calculated and ‘Greenspire’; ‘Limelight’ and ‘Silver may be the same plant as the ‘Pee Wee’ for each SSR marker and ranged from 0.2401 Dollar’; ‘Dharuma’ and three plants of described by Dirr. Because there is already a to 0.7997. Observed heterozygosity was not G-881; and BSWJ 3802 and two plants of H. quercifolia named ‘Pee Wee’ and the calculated because all loci were represented DJHT 99157. Other subgroups were observed same cultivar name should not be used for by four alleles making up the tetraploid in the dendrogram but did not have good plants in the same genus (Brickell et al., genome. Including the duplicate samples, bootstrap support. 2004), we recommend that new cultivar but not the H. heteromalla genotypes or The PCoA plot in Figure 2 does not names be applied to the two distinctly differ- failed PCR, 5096 alleles were included in include H. heteromalla samples, BSWJ ent compact forms of H. paniculata in the this analysis. Of these, 1396 alleles were not 3802, or DJHT 99157 and represents 65% trade. visible as separate peaks from markers dis- of the total variation. The two Taiwanese Seven of the cultivars included in this playing two or three alleles. Hidden alleles samples, BSWJ 3802 and DJHT 99157, were study were introduced by Jelena and Robert for these markers were confirmed by visual eliminated from the PCoA because they were De Belder of the Kalmthout Arboretum in inspection of relative peak heights. Peaks outliers that made relationships among the Belgium (Dirr, 2004; Mallet, 1994; Mallet with twice the relative fluorescent units other genotypes more difficult to visualize. et al., 1992; van Gelderen and van Gelderen, (rfu) indicated two alleles of the same size Clustering seen in the plot corresponds to the 2004). ‘Unique’ was selected from an open- were amplified and were coded twice in the subgroups seen in the tree dendogram (Fig. 1) pollinated seedling population of ‘Flori- genotype. For example, ‘Greenspire’ pro- despite the lack of bootstrap support for most bunda’. ‘Brussels Lace’, ‘Burgundy Lace’, duced 138, 143, and 148 bp alleles for clusters. ‘Greenspire’, and ‘Pink Diamond’ are seed- STAB73-74, a pentanucleotide repeat SSR lings of ‘Unique’, presumably originating marker. The peak for the 138 bp allele was Discussion from open-pollinations but possibly from twice as high as the 143 and 148 bp alleles controlled hybridizations. According to pat- and was included twice in the tetraploid Hydrangea paniculata ‘Grandiflora’, ent information, ‘Barbara’ (The Swanä) was genotype for ‘Greenspire’ for this SSR which is often referred to as Pee Gee or developed from a cross of two unnamed marker. Similarly, ‘Pink Diamond’ produced PeeGee hydrangea, has long been the stan- selections (U.S. Patent Office, 2003). No allele sizes of 138 and 143 bp for this SSR dard form of H. paniculata in cultivation. references to the parentage of ‘White Moth’ marker, both at equal rfu. Both alleles were Introduced in the 1860s by von Siebold from could be found. No close genetic relationship included twice in the genotype for ‘Pink Japan, it has large panicles consisting pri- was found between any of the De Belders
HORTSCIENCE VOL. 44(1) FEBRUARY 2009 29 JOBNAME: horts 44#1 2009 PAGE: 4 OUTPUT: December 29 22:22:57 2008 tsp/horts/180127/03204
strap support was not high, ‘Dolly’, ‘White Lady’, and ‘Phantom’ appear to have a genetic relationship and cluster with ‘Lime- light’ and ‘Silver Dollar’ in the PCoA (Fig. 2). ‘Big Ben’ did not appear genetically similar to the other five Zwijnenburg intro- ductions. ‘White Tiara’ appears genetically identi- cal to ‘White Moth’. No information con- cerning the origins of ‘White Tiara’ was located and, because the plant from which we took our leaf samples from is no longer alive, no phenotypic comparison between it and ‘White Moth’ can be made. However, because ‘White Tiara’ no longer seems to be available in the trade, the need to verify its genetic identity is probably a moot point. Although H. paniculata exhibits gameto- phytic self-incompatibility, it is possible to obtain a few self seedlings (Reed, 2004). NA 74383 is a seedling obtained from controlled self-pollinations of ‘Unique’ that was selected for its compact growth habit. It shows a close genetic relationship with its parental cultivar. Three open-pollinated seedlings obtained from ‘Dharuma’ (G-881, plants 2, 4, and 9) were also examined. Based on the morphological similarity of these plants to ‘Dharuma’, plus the fact that no other H. paniculata cultivar was in flower at the same time as ‘Dharuma’, we had specu- lated that these seedlings were the result of self-pollination. The SSR marker data sup- port this assumption. Although most H. paniculata cultivars flower in midsummer, a few flower in late spring to early summer. Three early flower- ing cultivars, Dharuma, Bulk (Quick Fireä), and Praecox, were included in this study. Although bootstrap support was not strong, there did appear to be relationships among these cultivars (Fig. 1). PI 479429, which was selected from a collection made in Japan, also flowers early (Mark Widrlechner, personal communication) and was in the same clade as the other early-flowering genotypes. These four genotypes, along with the three self- progeny of ‘Dharuma’, were outside the main cluster of H. paniculata cultivars (Fig. 2). In addition to flowering time, ‘Dharuma’ and PI 479429 differ from most H. paniculata culti- vars in size, rarely exceeding 1.2 m in height Fig. 1. Neighbor-joining phenogram generated using Nei’s minimum genetic distance matrix for 26 single- (Dirr, 2004; Mark Widrlechner, personal sequence repeat markers among 36 Hydrangea paniculata genotypes. Bootstrap values out of 1000 communication). However, the inflorescen- replicates are shown if 50% or higher. Three cultivars are listed by their trademarked names: Early ces of these two cultivars are less attractive Sensation (‘Bulk’), Pinky Winky (‘DVPinky’), The Swan (‘Barbara’). Tree was rooted with four than those of several of the new, late-flowering accessions of H. heteromalla: A = DJHC 793; B = HWJCM 180; C = DJHC 98263; and, D = var. introductions such as ‘Limelight’, ‘Silver xanthoneura NA 67857. Dollar’, and ‘DVPinky’ (Pinky Winkyä). Although hybridization between the early- and late-flowering cultivars is difficult cultivars examined, even those in which Six cultivars that were bred by Pieter because their flowering times do not overlap, ‘Unique’ served as a parent. Presumably, Zwijnenburg in The Netherlands (van Gel- this problem could likely be overcome by none of these cultivars were full-sibs. Sur- deren and van Gelderen, 2004) were included short-term storage of pollen. prisingly, ‘Burgundy Lace’ appeared identi- in this study. The only parentage information In addition to PI 479429, three other wild- cal to ‘Kyushu’, a cultivar that was available about these cultivars is that ‘Lime- collected accessions were included in this introduced from Japan but was distributed light’ came from a cross of two unnamed study. Both BSWJ 3802 and DJHT 99157 by the De Belders (Dirr, 2004; van Gelderen selections (U.S. Patent Office, 2002). ‘Lime- were collected in Taiwan, the former in 1996 and van Gelderen, 2004). Because only a light’ appears closely related to ‘Silver Dol- by Bleddyn and Sue Wynn-Jones and the single plant of both of these cultivars was lar’ (Fig. 1) and they may have been derived latter in 1999 by Dan Hinkley (Heronswood examined, it is impossible to speculate as to from the same cross; these two cultivars also Nursery, 2000, 2003). Both accessions are which, if either, plant was mislabeled. have phenotypic similarities. Although boot- described as having bluish green foliage. The
30 HORTSCIENCE VOL. 44(1) FEBRUARY 2009 JOBNAME: horts 44#1 2009 PAGE: 5 OUTPUT: December 29 22:23:06 2008 tsp/horts/180127/03204
COluHWT2d1GmBE&hl=en&sa=X&oi= book_ result&resnum=1&ct=result/>. Langella, O. 2002. POPULATIONS, a free popula- tion genetics software. 28 Feb. 2006. HORTSCIENCE VOL. 44(1) FEBRUARY 2009 31