INFORMATION TO USERS
This manuscript has been reproduced from the microfilm master. UMI films the text directly from the original or copy submitted. Thus, some thesis and dissertation copies are in ^ ew riter face, while others may be from any type of computer printer.
The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins, and improper aligmnent can adversely affect reproduction.
In the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion.
Oversize materials (e.g., maps, drawings, charts) are reproduced by sectioning the original, beginning at the upper left-hand comer and continuing from left to right in equal sections with small overlaps. Each original is also photographed in one exposure and is included in reduced form at the back of the book.
Photographs included in the original manuscript have been reproduced xerographically in this copy. Higher quality 6” x 9” black and white photographic prints are available for any photographs or illustrations appearing in this copy for an additional charge. Contact UMI directly to order. UMI A Bell & Howell Information Company 300 North Zeeb Road, Ann Arbor M3 48106-1346 USA 313/761-4700 800/521-0600
GENETIC ENGINEERING APPROACHES TO IMPROVE
AGRONOMIC TRAITS IN CASSAVA (MANIHOT ESCULENTA CRANTZ)
DISSERTATION
Presented in Partial Fulfillment of the Requirements for the
Degree of Doctor of Philosophy in the Graduate
School of The Ohio State University
By
Diana Isabel Arias-Garzon, B.S.
*****
The Ohio State University
1997
Dissertation Committee;
Dr. Richard T. Sayre, Adviser Apjjroved by: Dr. Zhenbiao Yang
Dr. Michael Evans Advis
Plant Biology Department I3MI Number: 9801635
UMI Microform 9801635 Copyright 1997, by UMI Company. All rights reserved.
This microform edition is protected against unauthorized copying under Title 17, United States Code.
UMI 300 North Zeeb Road Ann Arbor, MI 48103 ABSTRACT
Cassava (Manihot esculenta Crantz) is a tropical tuber crop that is grown for its starchy, thickened roots. The cassava roots are used mainly as a food source or for animal feed. Due to the presence of cyanogenic glycosides, however, cassava is potentially toxic.
This and other aspects of cassava are potentially amenable to improvement through genetic manipulation. Cassava is a highly heterozygous plant with low natural fertility which makes genetic manipulation via traditional breeding methods very long and difficult. Genetic engineering is an alternative approach to circumvent this problem and modify some aspects of cassava such as: starch quality and quantity, resistance to pests and diseases, and reduction of cyanogenic potential.
Linamarin, a cyanogenic glycoside, is stored in the root, stems and leaves of cassava and upon tissue damage (such as food preparation) is broken down by linamarase to produce acetone cyanohydrin. Acetone cyanohydrin can break down to produce acetone and hydrogen cyanide either spontaneously or by the action of hydroxynitrile lyase (HNL). O f these three cyanogens (linamarin, acetone cyanohydrin, and hydrogen cyanide) acetone cyanohydrin is the main contributor to consumer cyanide exposure.
11 Here, we report for the first time the stable transformation of cassava via
Agrobacterium-vaed^dXod. system with a gene of agronomic interest. We have cloned a
HNL cDNA into an Agrobacterium binary vector under the control of a double CaMV
35S promoter. The modified binary vector was transformed into two different strains o f Agrobacterium, LB A 4404 and EHA105 which were used for stable transformation of cassava. In vitro apical leaves and germinated somatic embryos of a cassava cultivar, Mcol 2215, were used to regenerate transgenic cassava plants resistant to paromomycin after co-cultivation with Agrobacterium. The overall efficiency of transformation was approximately 2.8%, however, when only apical leaves were co cultivated with the modified LBA4404, the transformation efficiency increases to
5.5%. All plant DNA evaluated so far by PCR amplification of specific introduced genes indicates integration of the selectable marker, nptfL, and the gene of interest,
HNL.
Hydroxynitrile lyase fi'om leaves and stems of untransformed plants had an activity of 1.7 mmol HCN/mg protein/h versus 2.4, 3.8,4.0 mmol HCN/mg protein/h firom three different transformed plants. Western blots of untransformed and transformed leaf-stem total protein support the higher activity of hydroxynitrile lyase in at least one of the transformed plants. However, HNL has not yet been detected in root tissues of transformed plants.
Ill Dedicated to Mauricio
and my parents,
Luis Elder and Margarita.
IV ACKNOWLEDGMENTS
I wish to thank my adviser. Dr. Richard T. Sayre, for his guidance, support, and encouragement. His insight and patience made this dissertation possible. I would also like to thank the members of my committee. Dr. Mike Evans and Dr. Zhenbiao Yang for their critical review of my dissertation.
I would also like to acknowledge the remarkable support that I received from the people in my lab, Ron Hutchison, Evangeline Ricks, Wanda White, Stuart Ruffle,
Jennifer McMahon, Svetlana Makova, Xiao-Hua Cai, Uzoma Diemere, Dimuth Siritunga,
Chris Brown, and last but not least. Sue Lawrence. I would like to thank Dr. Pablo
Jourdan for his collaboration at the initial steps of the establishment of the tissue cultures protocols, as well as Rodrigo Sarria for his advice about cassava transformation.
I am grateful to Anton and Claire Bartolo, Angel Arroyo, Maria Claudia Sanchez and my Colombian friends. Thanks to all them for their invaluable friendship and making my life outside of the university more enjoyable.
I would like to thanks those who prepared me for my work here at OSU. I thank the faculty of “Universidad del Valle”, specially members of the Biology Department.
Special thanks goes to Dr. William Roca and the members of the Biotechnology Research
Unit at CIAT for introducing me into the world of plant research. I thank my family for their support and encouragement through all these years of studying. Lastly, I extend my gratitude and acknowledgments to my husband,
Mauricio, for his constant support, scientific discussions, companionship and assistance not only doing this dissertation but also during all these years of graduate school.
VI VITA
January 4,1963 ...... Bora - Cali, Valle, Colombia. 1987 ...... B.S. Plant Biology, Universidad del Valle, Cali, Valle, Colombia. 1986 - 1990...... Research Assistant, International Center for Tropical Agriculture, Cali, Colombia. 1991- present ...... Graduate Teaching and Research Associate, The Ohio State University.
PUBLICATIONS
Research Publication
1. Arias, D.I., 1987. Effect of sucrose and mannitol levels on the in vitro growth of six cassava varieties. Thesis.
2. Chavez, R., Roca, W.M. Arias D.I., Withers, L., Williams, T., 1988. Cooperative EBPGR and CIAT pilot project tests feasibility of in vitro conservation. Diversity 16:8-10.
3. Roca, W.M., Chavez, R., Marin, M.L., Arias D.I., Mafia, G., Reyes, R., 1989. In vitro methods of germplasm conservation. Genome 31: 813-817.
Vll 4. Roca, W.M., Arias, D.I., Chavez, R., 1991. Metodos de conservacion in vitro de germoplasma. In: Cultive de tejidos en la agricultura: Fundamentos y Aplicaciones. Roca W.M. y Mroginski L.A. (eds.). Centro Intemacional de Agricultura Tropical. Cali, Colombia, p. 697-713.
5. Angel, P., Arias, D.I., Tohme J., Iglesias C., Roca W.M., 1993. Toward the construction of a molecular map of cassava (Manihot esculenta Crantz): comparison of restriction enzymes and probe sources in detecting RFLP's. J. of Biotech., 31: 103-113.
6. Arias-Garzon, D.I., Sayre, R.T., 1993. Tissue specific inhibition of transient gene expression in cassava (Manihot esculenta Crantz). Plant Science, 93:121-130.
7. Arias-Garzon, D.I., Sayre, R.T. 1992. Correlation between the frequency of transient gene expression and DNase activity in cassava tissues. Roca, W.M. and Thro, A.M. (eds.). Proceedings of the First International Scientific Meeting of the Cassava Biotechnology network, Cartagena, Colombia, August 1992. Cali, Colombia: Centro Intemacional de Agricultura Tropical pp 239-243.
8. Arias-Garzon, D.I., Sarria, R., Gelvin S., Sayre, R.T., 1994. New Agrobacterium tumefaciens plasmids for cassava transformation. Proceedings of the Second International Scientific Meeting, Bogor, Indonesia, August 1994. pp 245-256.
9. Arias-Garzon, D.I., Sayre, R.T., 1995. Optimization of transient transformation in cassava (Manihot esculenta, Crantz). Plant Physiology 108:152.
FIELDS OF STUDY
Major Field: Plant Biology
V lll TABLE OF CONTENTS
Abstract ...... ii
Dedication ...... iv
Acknowledgments ...... v
Vita...... vii
List of Tables ...... xiii
List of Figures ...... xv
Abbreviations ...... xvi
Chapters:
1 Introduction ...... 1
1.1 General information about cassava ...... 1
1.2 Cyanogenesis in cassava ...... 5
1.3 Regeneration of cassava ...... 12
1.4 Cassava transformation ...... 15
IX 1.5 Agrobacterium T-DNA transfer...... 19
1.6 Objectives ...... 25
2. Transient gene expression in cassava tissues ...... 28
2.1 Introduction ...... 28
2.2 Methods ...... 29
2.2.1 Plant material ...... 29
2.2.2 Transient DNA transformation ...... 30
2.2.3 In situ uidA gene expression...... 31
2.2.4 Crude protein extracts...... 31
2.2.5 (3-glucuronidase activity ...... 32
2.2.6 Luciferase enzyme assay ...... 32
2.2.7 DNase activity ...... 33
2.3 Results...... 34
2.3.1 Transient uidA gene expression ...... 34
2.3.2 Luciferase activity ...... 40
2.3.3 Inhibition of P-glucuronidase activity ...... 40
2.3.4 DNase activity...... 44
2.4 Discussion ...... 47
3. Screening of Agrobacterium tumefaciens strains for cassava transformation ...... 49
3.1 Introduction ...... 49
X 3.2 Methods ...... 52
3.2.1 Micropropagation and somatic embryogenesis ...... 52
3.2.2 Bacterial strains and growth conditions ...... 53
3.2.3 Histochemical localization of GUS activity ...... 56
3.3 Results...... 57
3.3.1 GUS activity inmediated transiently transformed cassava. 57
3.3.2 Cassava varietal response to Agrobacterium transformation ...... 59
3.4 Discussion ...... 60
4.0ptimization of transient transformation in cassava ...... 65
4.1 Introduction ...... 65
4.2 Methods ...... 67
4.2.1 Plant Material ...... 67
4.2.2 New binary vector for cassava ...... 67
4.2.3 Co-cultivation conditions ...... 71
4.2.4 In situ localization and enzymatic activity of the uidA. gene ...... 71
4.3 Results...... 72
4.4 Discussion ...... 77
5.Stable transformation of cassava ...... 83
5.1 Introduction ...... 83
xi 5.2 Methods ...... 85
5.2.1 Binary vector ...... 85
5.2.2 Agrobacterium transformation ...... 89
5.2.3 Plant material ...... 92
5.2.4 Co-cultivation conditions ...... 92
5.2.5 Polymerase Chain Reaction ...... 94
5.2.6 Crude protein extractions ...... 96
5.2.7 HNL enzymatic analysis ...... 96
5.2.8 Western Blot ...... 97
5.2.9 Genomic DNA extraction ...... 99
5.3 Results...... 100
5.3.1 Plant transformation efficiency ...... 100
5.3.2 PCR analysis ...... 102
5.3.3 HNL enzymatic activity ...... 106
5.4 Discussion ...... 112
Bibliography ...... 116
Xll LIST OF TABLES
1.1 Comparison of selected tuber and cereal productivity yields ...... 4
1.2 Summary of cassava transient and stable transformation ...... 17
1.3 Proteins involved in Agrobacterium-pXzai interactions ...... 24
2.1 Number of transient GUS expressing spots in cassava leaf and root tissues following transformation with pBI221 using the helium particle inflow gun under a variety of conditions ...... 36
2.2 Transient expression of the GUS activity driven by the CaMV 35S-GUS (pBI221) and glutamine synthetase (pBinGSGUS) promoters in cassava and soybean tissues ...... 39
2.3 Comparative analysis of the DNase activity of cassava root and leaf protein extracts...... 46
3.1 Strains used for transient expression in cassava ...... 54
3.2 A. tumefaciens-meàidXeà transient transformation of cassava (Mcol 2215) ...... 58
3.3 Transient transformation efficiency in young leaves of three cassava varieties...... 61
4.1 Agrobacterium tumefaciens (At 803) mediated transformation of cassava tissues...... 73
4.2 Average GUS activity in cassava tissues determined qualitatively by an enzyme assay using MUG as the substrate ...... 75
5.1 Cassava-cocultivation experiments ...... 101
X lll 5.2 Hydroxynitrile lyase activities of two different crude extracts of transformed and untransformed plants ...... 107
5.3 Hydroxynitrile lyase activities of four different crude extracts of transformed (9A1) and untransformed plants ...... 108
5.4 Densitometry analysis of western blot for HNL ...... 111
XIV LIST OF FIGURES
1.1 The cassava (Manihot esculenta Crantz) plant ...... 3
1.2 The cyanogenesis pathway in cassava ...... 7
2.1 Histochemical localization of GUS activity in vitro cassava leaves and roots after bombardment with a CaMV 35S-GUS construct ...... 37
2.2 Luciferase activity in transiently transformed (pD0432) cassava tissues ...... 41
2.3 Inhibition of in vitro GUS activity by cassava and soybean crude protein extracts...... 43
2.4 Time course of DNA degradation by cassava and soybean tissue extracts visualized by U.V fluorography after electrophoresis ...... 45
3.1 Binary vectors pCNL29, pCNL30, pCNL35 ...... 55
4.1 Somatic embryogenesis in cassava ...... 68
4.2 T-DNA region of the new binary vector for cassava transformation ...... 69
4.3 Histochemical localization of GUS activity in germinated somatic embryos after tissue wounding with the particle gun ...... 74
5.1 New binary vector pKYLX-HNL used for stable transformation of cassava ...... 86
5.2 Amplification of a 860 bp nos promoter-npt U cassette fragment by PCR ...... 103
5.3 Amplification of a 800 bp HNL fragment by PCR using the cDNA HNL as a template ...... 105
5.4 Inmunoblot of hydroxynitrile lyase using 25, 15, 5 pg of total protein from cassava leaf and stem tissues from untransformed and transformed plants ...... 110
XV ABBREVIATIONS
AL, apical leaves; Aocs, octopine synthetase activator; Amas, mannopine synthetase activator; BAP, benzyl aminopnrine; BP, before present; BSA, bovine serum albumine;
CaMV, Cauliflower Mosaic Virus; cDNA, complimentary deoxyribonucleic acid; °C, degrees Celcius, DTT, dithiothreitol; 2,4 D, 2,4-Dichlorophenoxyacetic Acid; DNA, deoxyribonucleic acid; EDTA, ethylenediaminetetraacetic acid; G A, giberellic acid;GSE, germinated somatic embryos; GUS, P-glucuronidase; ha, hectare; HCN, hydrogen cyanide; HEPES, N-2-hydroxyethylpiperazine- N’2-ethanesulfonic acid; HNL, hydroxynitrile lyase; Kb, kilobase; kDa, kilodalton; HNL, hydroxynitrile lyase; LB,
Luria broth; LUC, luciferase; Meal, millicalorie; MES, morpholinoethane-sulfonic acid;
MOPS, morpholinopropane sulfonic acid; MS, Murashige and Skoog; 4-MU, 4- methylumbelliferyl; NAA, napthalene acetic acid; NBT, nitro blue tétrazolium; NOS, nopaline synthetase; PG, particle gun; PPT, phosphinothricine; Pmas, marmopine synthetase promoter; PMSF, phenylmethylsulfonyl fluoride; Pnos, nopaline synthetase promoter; psi, pounds per square inch; PVP, polyvinyl pyrrolidone; RNA, ribonucleic acid; SDS-PAGE, sodium dodecyl sulfate polyacrylamide gel electrophoresis; SSC, sodium chloride and sodium citrate buffer; TBE, tris boric acid ethylenediamine-
XVI tetraacetic acid buffer; T-DNA, transfer deoxyribonucleic acid; TCA, trichloroacetic acid;
Ti, tumor inducing plamid; Tricine, N-tris-[hydroxymethyi]methyI glycine; Tween-20, monolaurate polyoxyathylene sorbitan; TBS, tris buffered saline; X-gluc, 5-bromo-4- chloro-3-indolyl-P-D-glucuronic acid; YEP, yeast extract peptone medium.
xvu CHAPTER 1
INTRODUCTION.
1.1 General information about cassava.
Cassava (Manihot esculenta, Crantz) is a member of the Euphorbiaceae family. It is grown for its starchy, thickened roots throughout the lowland tropics. The usefulness of cassava as food source was recognized by the earliest conquistadors from the old world, who transported it to the Congo Basin in the 16* century, from there cassava spread throughout West and South-West Africa. Cassava was introduced to India, East Africa and the Far East in the late 1700s. By the end of the 19* century the crop was dispersed all over lowland tropical Asia and Oceania (Cooke and Coursey, 1981).
The origin and evolution of cassava are unresolved. It is not known whether the ancestors of domesticated cassava were one or several species (Norman et al., 1995). It is likely, however, that the variability of cultivated cassava has been increased by hybridization with several wild cultivars. Two possible areas of domestication have been identified: Amazonia (Northeastern Brazil, Venezuela) and Mesoamerica (Mexico,
Guatemala). Fossil plant material identified as cassava and dated 2500 BP has been found in Mexico (Norman et al., 1995). The cassava plant is extremely variable in form and many thousands of varieties are known (CIAT, 1993). It is a perennial shrub that grows from 1 to 5 meters in height. The leaves are petiolated with a palmate lamina usually of 5 to 7 lobes. The flowers (usually white or cream) are arranged in axillary influorescenses at stem branching points. The root system that forms from stem cuttings is fibrous, however, 5 to 10 roots develop secondary thickenings and accumulate large amounts of starch (Cooke and Coursey, 1981) (Fig. 1.1). Starch deposition in roots may be first observed 25 days after planting.
Domestication has been for larger storage organs, more erect and less branched growth, and ability to grow from stem cuttings (Jennings, 1976). When an influorescence is formed branching occurs, thus selection for erect growth type produces less floriferous types. This together with vegetative propagation has resulted in sparse flowering and lower fertility in present day cassava cultivars.
Cassava is the fourth most important staple crop in the tropics. In the developing world it is surpassed only by maize, rice and sugarcane as source of calories (Bradbury,
1988). It is a drought tolerant crop and grows in extremely poor or exhausted soils. Under favorable conditions, it is one of the most efficient producers of edible carbohydrate; See
Table 1.1 (Cock, 1982, CIAT, 1993). The cassava roots are used primarily as food source or animal feed, but they are also used in industry including production of: paper, alcohol, textiles, adhesives, and starch derivatives such as mannitol, sorbitol, fructose, etc (CIAT,
1993). The leaves are also eaten as a green vegetable in many parts of the world, but principally in Afiica (Cooke and Coursey, 1981).
2 Figure 1.1. The cassava {Manihot esculenta, Crantz) plant CROP YIELD CALORIES
ton/ha Mcal/ha
Cassava 10* 12 Potato 15 6 Sweet potato 8 7 Yam 9 7 Maize 2 8 Wheat 1 4 Rice 2 5
* Under experimental agronomic practices this yield can be 9-fold higher (CIAT, 1993). Adapted from Onwueme, 1978.
Table 1.1 Comparison of selected tuber and cereal productivity yields 1.2 Cyanogenesis in cassava.
Cassava, due to the presence of cyanogenic glycosides, is potentially toxic. The cyanogenic glycosides linamarin and lotaustralin are present in all parts of the mature cassava plant with the exception of seeds (Conn, 1994). Linamarin accounts for 95 % of the total cyanogenic glycosides present in intact cassava tissues (Bagalopalan et al.,
1985). In cassava, linamarin is stored in the vacuole (McMahon et al., 1995), and its degrading enzyme, linamarase, is localized in the cell wall (Mkpong et al., 1990).
Therefore, release of cyanide occurs only after tissue damage such as that performed by herbivores or during food processing (Belloti and Arias, 1993; Cock, 1985; Balagopalan,
1985 ).
In plants, amino acids are the precursors for cyanogenic glycosides. Linamarin and its glucoside linustatin, probably the two most common of over 60 cyanogenic glycosides, are synthesized from valine. Other cyanogenic glycosides are produced from isoleucine (lotaustralin), tyrosine (dhurrin), and phenylalanine (prunasin) (Narsdet, 1985).
The first committed step in the synthesis of linamarin is the conversion of valine to acetone cyanohydrin, the non-glycosylated form of linamarin.The initial reactions are catalyzed by a series of cytochrome P450 (s) (Koch et al., 1992). Acetone cyanohydrin is then glycosylated by a soluble UDPG-glucosyltransferase to form linamarin (Koch et al.,
1992; Bokanga et al., 1993). These reactions take place on membrane fractions (Koch et al., 1992). However, recently it has been suggested that acetone cyanohydrin is probably sysnthesized by tonoplast enzymes (McMahon et al., 1995). As demonstrated by Sayre’s
5 group, valine was converted to linamarin in a NADPH-dependent reaction by partially purified vacuoles (White et al., 1994). This suggests that the cytochrome P450s involved in the initial biosynthetic steps are localized in the tonoplast and that the UDP- glucosyltransferase is a vacuolar enzyme (White et al., 1994). The generation of cyanide from linamarin in cassava is a two-step process involving the initial deglycosylation of linamarin by linamarase and the cleavage of acetone cyanohydrin (Fig. 1.2). The second step is catalyzed by a hydroxynitrile lyase (HNL) which forms a ketone and hydrogen cyanide (HCN). This final reaction can also occur spontaneously at temperatures greater than 35 °C or pHs > 5.0 (White et al., 1994, Hughes et al., 1994).
There are two classes of HNLs, namely those which contain flavin groups, and those which do not (Hickel et al., 1996). Members of the Rosacea family, such as black cherry, have an FAD-containing enzyme. That means that the active enzyme contains the non-covalently bound prosthetic group favine adenine dinucleotide (FAD), giving a typical absorption spectrum with maxima at 380-390 and 460-480 nm (Hickel et al.,
1996). FAD appears to be an important structural component that is bound near the N- terminus of the protein (Cheng and Poulton, 1993). In its oxidized state FAD is required for HNL activity but is not involved in a redox reaction. On the other hand, FAD- independent HNLs are more heterogeneous in structure and have been identified from monocot and dicot plants. They differ, however, in carbohydrate content, molecular mass, and primary structure. In addition, they are not related to FAD-dependent HNLs, neither at the level of protein amino acid sequence nor at the antigenic surface structure (Hickel Hydroxynitrile lyase or O C = N HO C = N spontaneous breakdown Limamanue @>3fCorpH> 5.0 * ^ GLUCOSE + c ^ ^ Ç, + HCN / \ / \ / \ CHj CHj CHj CHj CH3 CH3
Linamarin Acetone cyanohydrin Acetone Hydrogen cyanide
Figure 1.2. The cyanogenesis pathway in cassava et al., 1996). Examples of FAD-independent HNLs are from the genera Sorghum, Hevea,
Manihot, Linum, Phlebodium, Ximenia and Sambucus. In general these enzymes have an acidic character, with isoelectric points in the range of 3.9 - 4.6 and require more than
100-fold purification to reach homogeneity (Wajant et al., 1994; Hasslacher et al., 1996;
Hughes et al., 1994; White et al., 1996; Hickel et al., 1996).
Cassava HNL has been found in substantial quantities in the apoplast of leaves
(White et al., 1994). The molecular weight of HNL remains somewhat controversial.
Carvalho (1981), originally reported a molecular weight for cassava HNL of 15 kDa, but it was later reported as being 29 kDa (White et al., 1994). Hydroxynitrile lyase eluted from a Sephacryl S-200 at a volume of 123 ml. This volume represents a native molecular weight of 50.1 kDa. Since the molecular weight of HNL on SDS-PAGE is 29 kDa, the native molecular weight represents a dimer (White, 1996). This is in contrast with the results reported by Wajant et al., 1995 and Hughes et al., 1994 who reported that the size of the purified native protein was 124 and 92 kDa respectively. These represents tetramer and trimer sizes of the 28.5 kDa subunit, respectively.
It is noteworthy to mention that all three determinations support the implubished results of Carvalho (1981), who detected different quaternary structures as a fimction of protein and salt concentration. White’s protocol to determine the molecular weight included low protein concentration and high salt concentrations, both of which were reported to decrease oligomerization (White, 1996).
Because of the instability of its substrate (acetone cyanohydrin), kinetic values for
HNL have often been inaccurately reported. Hughes et al,. (1994) did not obtain first-
8 order enzyme kinetics using their HNL preparations, and were unable to obtain substrate saturation with up to 0.3 M substrate. More accurate observations on HNL kinetics were obtained by White (1996), who calculated activity of the enzyme subtracting the spontaneous breakdown of the substrate. A specific activity for HNL of 1 Immol HCN # /mg protein/hr, purified 200-fold over that of crude leaf extracts, has been reported. A higher specific activity of 24 mmol HCN/mg protein/hr was obtained using proteins from apoplastic extracts (White et al., 1994).
Genes encoding several hydroxynitrile lyases have been cloned recently. These include those of sorghum (Wajant et al., 1994), black cherry (Cheng and Poulton, 1993), rubber tree (Hasslacher et al., 1996), and cassava (Hughes et al., 1994 and White, 1996).
In 1994, Hughes and coworkers, published the first gene sequence for the non- flavoprotein HNL from cassava. A cDNA clone of approximately 1 Kb was isolated with an open reading frame encoding a protein of 258 amino acids. This clone had greatest similarity to the HNL gene from rubber tree, which encodes a protein of 257 amino acids.
Previously, the dissimilar features of the non-F AD-dependent HNLs supported independent evolution of each species’ enzymes, however, the nucleotide and amino acid sequences of rubber tree and cassava HNL DNA sequence have 78% amino acid identity
(Hasslacher et al., 1996). Since both species are member of the Euphorbiacea family, the similarities support the idea of a common ancestor for the HNLs in this group. The proteins are also serologically similar. Antibodies raised against cassava or rubber tree
HNL react with both enzymes on western blots (Wajant et al., 1996). In cassava, linamarin is most likely stored in the vacuole (McMahon et al., 1995).
On the other hand, linamarase is localized in the cell wall (Mkpong et al., 1990). This was demostrated by inmimo-gold localization techniques. However, it seems that linamarase is not only an apoplastic enzyme. According to Pancoro and coworkers (1992), linamarase is also localized in laticifer cells. Because of the differential localization of substrate and cyanogenic enzymes cyanogenesis only occurs after tissue damage
(Poulton, 1990).
Cyanogenesis has been demonstrated to protect the plant against herbivores or fungal attack (Belloti and Arias, 1993; Hickel et al., 1996). Feeding deterrent studies using insect pests of cynogenic plants support the hypothesis that cyanogenic glycosides function as herbivory deterrents (Narstedt, 1985). For example, the mexican bean beetle
(Epilachna varivestis) causes greater crop damage to Phaseolus vulgaris, which produces
4-fold less cyanogenic glucosides, than to P. lunatus.
In humans, the ingestion of large quantities of cassava or prolonged exposure to improperly processed cassava food products has been associated with chronic cyanide toxicity in some areas of Africa (Tylleskar et al., 1992; Mlingi et al., 1992). Significantly,
HCN generated during cassava processing is volatilized or removed by washing and does not contribute to toxicity. The residual cyanogens, linamarin and acetone cyanohydrin, are the apparent source of CN toxicity and are converted to cyanide into the body. For an adult, consumption o f 50 to 100 mg or 2 mmol HCN within 24 hours is lethal and blocks cellular respiration (Rosling, 1993).
10 Exposure to lower CN levels can cause a variety of symptoms, such as vomiting and nausea, weakness and headache, and impaired vision (Rosling, 1988). Long term exposure to cyanide and low sulphur intake can result in neurological disorders, and paralysis due to a permanent damage of the spinal cord (Rosling, 1988). In addition, goitre and cretinism, which are caused by iodine deficiency, can be aggravated by continues dietary cyanide exposure. This effect is caused by the CN detoxification product, thiocyanate (SCN), which interfers with iodine uptake in the thyroid gland. HCN can be temporally sequestered by a reversible reaction by the red blood cells (Lundquist,
1985, cited in Rosling, 1993). Also, HCN can be converted to thiocyanate by rhodanese.
This reaction requires sulphur. Thus, a low intake of proteins rich in sulphur amino acids will decrease the rate of cyanide conversion to thyocyanate (Rosling, 1993).
The levels of cyanogens in cassava products can range from 0.6 to 144 mg CN equivalents per Kg dry weight (Essers, 1994; Mlingi et al., 1992). The level of CN equivalents depend on the type of cassava roots used as starting material (bitter or sweet) and the method of the food preparation (Tylleskar et al., 1992; Mlingi et al., 1992; Essers,
1994). HCN, linamarin, and acetone cyanohydrin are the three cyanogens found in some cassava food products. They occur in different concentrations and have different toxicity levels. HCN, is volatile and easily removed from cassava material by soaking (Nambisan et al., 1985; Tylleskar et al., 1992). Linamarin and acetone cyanohydrin remain in poorly processed cassava products, but the later is as toxic as HCN due to its instability at body temperature and blood pH (Tylleskar et al., 1992).
11 It has been demonstrated that infiltration of linamarase into cassava root tissues decreased the cyanide toxicity of the cassava food product by driving cyanogenesis to completition (Mkpong et al., 1990). It is proposed that by increasing or over-expressing the levels of linamarase and/or HNL in the cassava plant it will be possible to produce a safer, low cyanogen cassava food product.
As mentioned before, cassava is a highly heterozygous plant with low natural fertility which makes traditional plant breeding a very long and difficult system to improve cassava. An alternative to traditional breeding is genetic engineering, but this depends on the ability to transform and regenerate plants.
1.3 Regeneration of cassava.
Somatic embryogenesis is the process by which somatic cells differentiate into asexual embryos to give rise to a new complete plant (Merkle et al., 1990). A somatic embryo is a bipolar structure that arises mostly from a single cell and shows no vascular connection with the maternal tissue or explant (Terzi and Loschiavo, 1990; Raemarks et al., 1993). This process of dedifferentiation was first described by Stewart and Reinert in
1959 working with suspension cultures of carrot (Litz and Jarret, 1991). On the other hand, organogenesis is the process by which a group of cells in a specific tissue are forced to undergo changes that lead to the production of unipolar structures, either shoot or roots
12 whose vascular system might be connected to the parental tissue (Evans et al., 1981 ;
Terzi and Loschiavo, 1990).
Among the several parameters that affect the induction of somatic embryos are:
the genotype of the starting material, type of explant, and the media composition
(Ammirato, 1983; Sofiari,1996). An important factor in the culture media is the presence
of an exogenous auxin to induce the formation of somatic embryos. Naphthalene acetic
acid, 2,4 dichlorophenoxyacetic acid (2,4 D), pichloram, and dicamba have been
extensively used for that purpose. However, it is necessary to remove or decrease the
auxin concentration to very low levels to achieve development or embryo maturation and
plant regeneration (Evans et al., 1981; Ammirato, 1983).
Meristem and nodal stem tissue culture techniques are being routinely employed
for virus elimination, micropogation, conservation, and exchange of germplasm of
cassava (Kartha et al., 1974; Roca, 1984). However, cassava is one of those species in which the development of in vitro methods for regeneration of plants from somatic tissues, protoplasts, anthers, microspores or via organogenesis has proven difficult and success has only been reported in some cultivars using somatic embryogenesis or organogenesis (Tilquin et al., 1979; Stamp and Henshaw, 1982; Szabados et al., 1987;
Schopke et al., 1993; Sarriaet al., 1993; Sofiari, 1996; Li et al., 1996).
In cassava, regeneration has been reported via organogenesis from stem nodes
(Tilquin, 1979), and mesophyll protoplasts cultures (Sahin and Shepard, 1980). However, these results have been not reproduced. Similarly, Li and coworkers (1996) reported regeneration of cassava shoots via organogenesis from somatic embryo cotyledons using
13 benzylaminopurine (BA) as an inducer (1.0 mg/1). Nonetheless, organogenesis has not been reproduced (personal experience and U. Ihemere, personal communication).
Finally a recent report about cassava organogenesis describes an efficient mass propagation system for cassava (Konan et al., 1997). In this system benzylamino-purine is also used as an inducer of organogenesis but at higher levels (10 mg/1 BA) than the levels reported by Li et al., 1996 (1.0 mg/1 BA). Konan and coworkers 1997, claim that this system can be applied to cassava cultivars that are difficult to regenerate through somatic embryogenesis. It induces multiple shoots from axillary buds and from bud- derived meristems. To date the most common procedure for cassava regeneration is via somatic embryogenesis. It includes induction of somatic embryos on immature apical leaves on medium containing 2,4 D (8 to 12 mg/1). Once the somatic embryos are formed, they are transferred to a media without auxin for germination (maturation) and development of a new plant. Germinated somatic embryos can also be used for starting explants for a new cycle (Szabados et al., 1987; Raemarks et al., 1993; Schopke et al.,
1993; Arias-Garzon et al., 1994).
Recently, a new system of embryogénie suspension cultures was described
(Taylor et al., 1996; Schopke et al., 1996). It consists of clusters of embryogénie cells suspended in liquid medium in which a prolific, highly undifferentiated embryogénie callus has been induced and multiplied from the organized embryogénie structures by simple variation of the basal medium. The system comprises a series of different media for each stage o f development of the embryogénie suspensions. A high concentration of
14 pichloram (50 pM) was used for embryo induction which was later reduced to 5 pM for initiation of embryo differentiation. Finally cotyledons were induced with 5 pM naphthalene acetic acid and 4.4 pM ben 2 yIamino-purine is used to induce multiple shoots.
1.4 Cassava transformation.
To establish a reliable system of plant genetic transformation there are three aspects that must be considered: an optimal system for introduction of DNA into plant cells; the availability of appropriate selectable markers which arrest the growth of non transformed cells or kill them slowly and a good system for the recovery of abundant numbers of whole plants from original tissues (Klee et al., 1987; Sofiari, 1996; Christou,
1996). When choosing a selectable marker it should be considered that the selective agent be inhibitory to plant cell growth and division. However, not all compoimds which are toxic are good options as selective agents. Cells that are not transformed can release phenolic compounds to adjacent transformed cells which are toxic. Even high levels of expression of a resistance gene in the transformed cells might be insufficient to rescue them.
One selection marker which is fequently used in plant transformation is neomycin phosphotransferase, nptll (Sevan et al., 1983; De Block et al., 1984; Weising et al.,
1988). Resistance to kanamycin is conferred by the npiQ. gene product. NptU. was
15 originally isolated from the prokaryotic transposon Tn5 (Klee et al., 1987). Nptn detoxifies amynoglycosidic antibiotics such as kanamycin by phosphorylation. However, it seems that kanamycin is too toxic for many plants including cassava (Calderon, 1988),
Arabidopsis thaliana, var. Columbia (Loyd et al., 1986), and oat (Torbert et al., 1995).
There have been numerous unsuccessful attempts to stably transform cassava.
Therefore, transient gene expression has been used as a preliminary tool to establish parameters for cassava transformation (See table 1.2 for review). Calderon (1988), was the first to describe transformed embryogénie callus lines of cassava. He induced somatic embryogenesis in different cassava explants that had been inoculated with Agrobacterium tumefaciens harboring the uidk. gene (also referred as the gus gene) and the nptQ. gene.
He was able to isolate callus lines expressing the glucuronidase gene and which were resistant to kanamycin. However, those calli never developed into plants. When paromomycin, another amynoglycosidic antibiotic, was used for selection stable transformed cassava plants were obtained (Schopke et al., 1996). Similarly, several attempts to transform oat, using kanamycin or the relative G418 as selective agents, were unsuccessful. Stable transformation of oat was achieved however, when paromomycin was used (Torbert et al., 1995).
Concurrent with the report from Schopke and coworkers (1996), Li et al., 1996 described another system of stable transformation for cassava. In this case selection was carried out using the hpt gene which confers resistance to hygromycin. Both groups also
16 Explants Methods Results Integrated References genes Leaves, stems, A. tumefaciens Partial uidA, npt n, Calderon, embryog. callus transformation bar 1988 Leaf-discs Particle gim Transient uidA Franche et al., expression 1991 Stems, somatic A. tumefaciens, Partial uidA Fauquet et al., embryos particle gun transformation 1993 Somatic embryos A. tumefaciens Transient uidA, npt n, Chavarriaga et expression bar al., 1993 Protoplast Electroporation Transient uidA Cabrai et al., expression 1993 Leaves, roots Particle gun Transient uidA, Arias-Garzon expression Luciferase and Sayre, 1993 Leaf lobes and A. tumefaciens, Transient exp. uidA, npt n Schopke et al., discs, somatic particle gun and partial 1993 embryos transformation Somatic embryos A. tumefaciens Partial uidA, bar Sarria et al., transformation 1995 Somatic embryos A. tumefaciens Transient uidA Arias-Garzon expression et al., 1995 Axillary nodal Particle gun Transient uidA, nptO. Konan et al., buds expression 1995 Somatic embryos Electroporation Transient uidA Luong et al., expression 1995 Embryogénie Particle gun Transient uidA, npt n Schopke et al., suspensions expression 1995 Friable embryog. A. tumefaciens Stable Luciferase Raemarks et callus transformation al., in: Sofiari, 1996 Embryogénie Particle gun Stable uidA, npt n Schopke et al., suspensions transformation 1996 Somatic embryos A. tumefaciens Stable uidA, hpt Li et al., 1996 transformation Apical leaves, A. tumefaciens Stable HNL, nptU. This study, germinated transformation 1997 somatic embryos
Table 1.2. Summary of cassava transient and stable transformation.
17 tried geneticin as a selective agent for transformed plant material but in the end it was
not successful. These two reports differ not only in the selective agent of transformation,
but also in the system by which the foreign DNA was delivered into the plant cell.
Schopke and coworkers delivered the DNA via microparticle bombardment of
embryogénie suspension-derived tissues. On the other hand, Li and coworkers integrated
the DNA vidi Agrobacterium mediated T-DNA transfer.
These two systems, although successfully used for plant transformation (for
review see Christou 1996), have some drawbacks. The particle bombardment-mediated
gene transfer method has some problems associated with the pattern of integration of
DNA. Transformation by particle bombardment often results in integration at one locus
of multiple copies of the genes of interest as well as plasmid DNA sequences (Hansen
and Chilton, 1996). The multiple copies of the introduced genes by particle gun are
usually genetically linked and cannot be segregated in future plant generations, moroever,
multiple copies of transgenes can get inactivated. Klein et al., (1989) reported multiple
integration (1 to 8) of the intact npt II gene as well as of the uidA. gene in maize when
using the particle gun. Finally, another drawback of the particle gun is its cost and
availability, particularly in developing countries. In the case of Agrobacterium, the
biggest obstacle is related to host specificity, which has made it difficult to use
Agrobacterium Ti plasmid mediated transformation with some legumes and cereals.
Second, there might be problems with the release of transformed plants on which
Agrobacterium might persist within the tissues leading to the release of engineered
bacteria into the soil and into new plants (Christou, 1996).
18 1.5 Agrobacterium T-DNA transfer.
Agrobacterium tumefaciens is a soil bacterium that causes crown gall (tumor) disease in many dicotyledonous and gymnosperms and few monocots plants (Klee et al.,
1987; Zambrisky, 1988; Gelvin, 1991; Tinland, 1996). The association o îAgrobacterium and plant tumors has been known since the begining of the century (Zupan and
Zambrisky, 1995; Tinland et al., 1994). However, only about twenty years ago was it found that the bacterium can transfer a piece of DNA, called transferred DNA (T-DNA), to the nuclear plant DNA (Winans, 1992; Tinland et al., 1994; Tinland, 1996). The
Agrobacterium jp.plant cell interaction is one natural example of DNA transfer between two kingdoms (Winnans, 1992; Tinland and Hohn, 1995; Sheng and Citovsky, 1996).
The discovery of the transfer of a defined segment of the bacterium DNA to the plant host has made Agrobacterium one of the most useful systems for the production of transgenic plants.
In wild type Agrobacterium, three genetic components of the bacterium are required for plant cell transformation. Two components, the T-DNA and the vimlence iyir) genes, are located on the Ti plasmid or tumor inducing plasmid. The Ti plasmid is usually 150 to 200 Kb in size. The third component resides in the Agrobacterium chromosome (Zambryski, 1988; Chen et al., 1991; Liu et al., 1992; Tinland, 1996). The infection cycle of Agrobacterium is complex and involves a number of chemical signals emitted by both the pathogen and its host. In vivo, plant infection requires wounding of
19 the plant tissue which produces phenolic compounds, these compounds induce genes on the Ti plasmid harbored by all virulent strains of Agrobacterium (Binns, 1988; Winans,
1992; Zambryski, 1992; Gelvin, 1994; Sheng and Citovsky, 1996). The bacteria then attaches to the plant cells and transfers a portion of the Ti plasmid (T-DNA) to the plant cell. The T-DNA does not encode any important genes for the transfer process, but it has to be delimited by 25-bp direct repeats in order to be transferred. These borders are the only cis elements necessary to direct T-DNA processing (Zupan and Zambryski, 1995;
Gelvin, 1994; Sheng and Citovsky, 1996). By genetic manipulations of the T-DNA borders it has been shown that T-DNA transfer is directional. Deleting or reversing the orientation of the right border abolishes T-DNA transfer, on the other hand, manipulations of the left border have little effect. Thus, the right border seems to play a major role in T-DNA transfer. However, the 25-bp border sequences are highly homologous, suggesting they might each be capable of directing polar transfer
(Zambryski, 1992).
The T-DNA covalently integrates into the plant nuclear genome. Genes encoded by the T-DNA direct the synthesis of plant growth hormones, and novel amino acid derivatives called opines. These metabolites are formed by the condensation of an amino acid with a keto acid or sugar in the tumor cells (Sheng and Citovsky, 1996). Opines are used as carbon or nitrogen source by the bacteria. Agrobacterium sps. are usually classified on the basis of the type of opines encoded by the T-DNA. The most common opines are: agropine, octopine, and nopaline (Hooykaas et al., 1994; Gelvin, 1994). Opine
2 0 catabolism requires a specific set of enzymes that are encoded by the Ti plasmid. Since virtually no other soil microorganism can metabolize these compounds opines limit exploitation of the plant by other bacteria (Sheng and Citovsky, 1996; Zupan and
Zambryski, 1995).
The processing and transfer of T-DNA is mediated by the products of the vir genes which are also located on the Ti plasmid. The vir region is 30-35 Kb in size and organized into seven opérons, VirA, VirB, VirC, VirD, VirE, VirG, FirH (Binns, 1988;
Zambrisky, 1992; Gelvin, 1994; Zupan and Zambryski, 1995; Tinland, 1996). Control of gene expression is mediated by the VirA and the VirG proteins. The Vir A gene product specifies an inner membrane protein that recognizes and responds to the presence of phenolic compounds (acetosyringone) released by wounded plants resulting in phosphorylation. VirA phosphorylation of VirG then leads to induction of vir gene transcription (Zambryski, 1992; Winnans, 1992; Tinland, 1996). Complete induction requires a third protein encoded by the chromosomal chvE gene. It seems that the ChvE is a periplasmic protein involved in promoting the expression of the virulence genes in response to external inducers identified as simple sugars (Winnans, 1992; Kado, 1992).
Following induction of the vir regulon the production of a transfer intermediate begins with the generation of the T-strand, a single stranded copy of the T-DNA. Single stranded nicks occur at identical positions between the third and fourth base pairs from the left end of each border of the T-DNA (Winnans, 1992; Tinland and Hohn, 1995;
Zupan and Zambryski, 1995; Sheng and Citovsky, 1996). These scissions are used as
21 initiation and termination sites for the displacement of a linear ssDNA copy of the bottom strand of the T-DNA region. It has been shown that the top strand is either selectively degraded, or, more likely, is made double-stranded by synthesis of complimentary DNA
(Winnans, 1992). The T-strand is generated in a right to left direction (Zambryski, 1992).
Two vir products (VirDl and VirD2) have endonuclease activity and are essential for T- strand production. After nicking the T-DNA, VirD2 remains associated with the 5’ end of the T-strand forming a cap. This cap ensures that in further steps the 5’end will be the leading end (Herrera-Estrella et al., 1988). Once the T-strand is formed it must cross several membrane systems and cellular spaces before reaching its final destination in the plant nucleons. It has been demostrated that another Vir protein (VirE2) binds in a cooperative manner to the single stranded DNA as a protective coat (Zambryski, 1988;
Zupan and Zambr>'ski, 1995; Tinland, 1996). Consequently, degradation of the T-DNA by nucleases would be prevented. The association of the T-strand with the VirD2 and
VirE2 proteins is called the T-compIex (Zupan and Zambryski, 1995; Sheng and
Citovsky, 1996). Thus, it is actually the T-complex that enters the plant nucleous. Once in the nucleous, the T-srand becomes integrated into a plant chromosome. The molecular mechanisms by which the T-complex is transferred into the cytoplasm of the host cell as well as the mechanisms of integration in the plant nucleous are still unknown (Zupan and
Zambryski, 1995; Sheng and Citovsky, 1996). Agrobacterium is predicted to form a channel through the plant cell wall for the transfer of the T-complex. It seems likely that this channel is encoded by the virB locus, most of which is required for bacterial
2 2 virulence but not for T-strand production (Sheng and Citovsky, 1996). For a summary of
the Agrobacterium proteins involved in the transfer process see Table 1.3.
Transfer of the Agrobacterium T-DNA to the plant cell has a remarkable
similarity to bacterial conjugation. This was first noted by Stachel and Zambryski, 1986
after the discovery of the T-strand (Winans, 1992; LessI and lanka, 1994; Zupan and
Zambryski, 1995). Both systems require short sequences in cis {pri T and T-DNA right
border) to direct directional transfer of DNA. Transfer is initiated by nicks at the ends of
those sequences and a single stranded linear DNA is transferred following diplacement
from the plasmid.
Finally, the donor and the recipient cell have to be in contact for the transfer to
occur (Tinland et al., 1994; Tinland and Hohn, 1995; Winans, 1992; Zupan and
Zambryski, 1995). Later studies have confirmed these similarities and also have shown
similarities at the level of amino acid sequences, gene organization, and physical
properties of the trans-acting enzymes involved in the DNA transfer (Zupan and
Zambryski, 1995). Nevertheless, unlike bacterial conjugation the recipient cell in
Agrobacterium T-DNA transfer is an eukaryote. So, the delivery of the T-complex into the target cell is not totally similar to bacterial conjugation. The entrance into the cell nucleous and the integration into the nuclear genome might be more similar to viral integration (Sheng and Citovsky, 1996). The access of T-strand into the plant nucleous can occur only through the nuclear pore. The estimated size of the T-complex is about
50,000 kD which exceeds the size exclusion limit of the nuclear pore (60kD) suggesting a
23 Cellular Specific step Agrobacterium process proteins Cell-cell Binding of the bacteria to the plant ChvA ChvB, PscA, recognition cell receptors. Att. Signal Recognition of plant signal ChvE, VirA, VirG. transduction molecules and activation of T-DNA transfer. Transcriptional Expression of the vir genes after VirG. activation phosphorylation of the transcriptional activator. Conjugal DNA Nicking at the T-DNA borders and VirDl, VirD2, VirCl. metabolism mobilization of the T-strand. Intercellular Formation of protein-T-complex; VirE2, VirEl, VirD2, transport formation of a transmembrane VirD4, VirB4, VirBV, channel; export of the T-complex VirB9, VirBlO, into the plant cell cytoplasm. VirBll. Nuclear import Interaction with the plant cell nuclear VirD2, VirE2 signal receptors and transport of the T-complex through the nuclear pore. T-DNA Integration into the plant Proposed VirD2, integration chromosome; synthesis of the second VirE2 strand of the T-DNA.
Taken from Sheng and Citovsky, 1996.
Table 1.3. Proteins involved in/4gro6actenMm-Plant interactions.
24 requirement for active transport process (Zupan and Zambryski, 1995; Sheng and
Citovsky, 1996). Proteins larger than 40kD require a nuclear localization signal, which in the case of the T-complex is associated with the VirD2, VirE2 proteins. The T-strand is unlikely to have a signal since any foreign DNA located between borders can be transferred (Zupan and Zambryski, 1995). The final step of the transfer of the DNA is the actual integration of the DNA into a host chromosome. To date, the mechanics of this process remain unsolved. In situ hybridization and genetic mapping demostrated that T-
DNA insertions can occur in any portion of a chromosome but occur preferentially in transcriptionally active regions of plant DNA (Koncz et al., 1989). Gheysen and coworkers (1991), found short homologies between the T-DNA ends and the target sites as well as the presence of filler sequences at the junctions in the plant DNA. Based on those findings, they proposed T-DNA integration is similar to illegitimate recombination which occurs during integration of viral or transfected DNA into mammalian cells
(Gheysen et al., 1991).
1.6 Objectives.
The main objective of this research is to transform cassava with a gene of agronomic interest. A hydroxynitrile lyase (HNL) cDNA was cloned in our lab (White et al., 1997). It is our purpose to introduce this gene into cassava via Agrobacterium
25 tumefaciens mediated DNA transfer technique. HNL is not expressed in the cassava roots or its activity is very low (White et al., 1997). Since there is not a root specific promoter available for cassava yet, we will clone the gene encoding HNL under the control of a double CaMV 358 promoter. The nptQ., gene under the control of the NOS promoter, will be used as a selectable marker, but using paromomycin as a selective agent. We will analyze the pattern of DNA integration and HNL activity in different tissues of the transformed plants.
Our hypothesis is that it might be possible to over-express the levels of hydroxynitrile lyase (HNL) in the cassava plant to produce a safer, low cyanogenic food product. Increased activity of HNL will reduce the amounts of residual acetone cyanohydrin which are the main source of CN toxicity in the cassava products
(McMahon et al., 1996; White et al., 1997). In order to transform cassava with the HNL cDNA, it was necesary to: 1) Develop a transient gene expression system to screen gene root promoters in cassava. 2) Develop superior Ti plasmid vectors for cassava transformation. 3) Develop better transformation protocols for Agrobacterium infection of cassava.
Cassava has been stably transformed via particle bombardment (Schopke et al.,
1996) znà. Agrobacterium-mtéxdXed gene transfer (Li et al., 1996). However, these groups introduced a reporter gene (uidA), and a selectable marker but no genes of agronomic importance. Cassava is a very important cash crop in the tropics as discussed earlier this chapter in Section 1.1. There is a lot of interest in the cassava scientific community to
26 produce an improved cassava plant that can perform better in the tropics. There are several aspects of cassava, such as cyanogenesis, starch quantity and quality, that can be improved by genetic engineering. It is our hope that the results of this research will demonstrate the effectiveness of cassava transformation for the genetic improvement of cassava traits.
27 CHAPTER 2
TRANSIENT GENE EXPRESSION IN CASSAVA TISSUES
2.1 Introduction
It is estimated that over 300 million people subsist on a cassava based diet (Cock,
1982; Ekssittikul et al, 1988). Cassava roots, however, have a low protein content and contain cyanogenic glycosides which can cause neurological disorders (Bagalopalan et al.,
1988, Tylleskar et al., 1992; Mkpong et al., 1990). These and other aspects of the nutritional quality of cassava roots are potentially amenable to genetic modification via stable introduction and expression of recombinant DNA molecules. In order to genetically alter the nutritional quality of cassava roots, it is necessary to identify strong root specific gene promoters which can be used to direct the expression of introduced DNA sequences.
The cauhflower mosaic virus 35S (CaMV 35S) promoter has been shown to direct high levels of gene expression in a variety of plant tissues including tobacco root tissue and cassava leaf tissue (Benfey et al., 1989; Franche et al., 1991; Jefferson et al., 1987, Arias-
Garzon and Sayre, 1993). In order to determine whether the CaMV 35S promoter or a root
2 8 specific promoter would direct gene expression in cassava root tissue, we bombarded cassava roots with various promoter-reporter gene constructs and assayed for transient gene expression. Regardless of the transforming DNA used, we routinely observed significantly
fewer transformed regions or lower levels of reporter gene activity in root tissues than in leaves. The levels or firequency of reporter gene activity were, in all but one case, inversely correlated with the level of DNase activity. We propose that low firequencies of transient transformation may be due to degradation of transforming DNA associated with DNase activity.
2.2 Methods
2.2.1 Plant Material
Seeds and/or stem cuttings of cassava {Manihot esculenta Crantz) varieties Mcol
2215 and Mven 25 were obtained firom Dr. Clair Hershey at the International Center for
Tropical Agriculture (CIAT), Cali, Colombia. Plants were grown under greenhouse or in vitro conditions. Shoot apical meristems were grown on standard propagation medium for cassava (Roca, 1984) containing: MS salts (Murashige and Skoog, 1962), 1 mg/1 thiamine-
HCl, 100 mg/1 m-inositol, 2% (w/v) sucrose, 0.02 mg/1 naphthaleneacetic acid, 0.04 mg/1 benzylamino- purine and 0.05 mg/1 gibberellic acid; the medium was solidified with 0.7%
(w/v) Bacto-agar. Shoot cultures were maintained under a 12 hr per day photoperiod, at 27
29 °C and a light intensity of 50 fiE sec'^ (300 - 700 nm). Soybean seeds (c.v. Williams)
(kindly provided by Dr. Dietz Bauer, The Ohio State University) were genninated under the same conditions as for cassava shoot cultures.
2.2.2 Transient DNA Transformation
Cassava and soybean tissues were transiently transformed using either of three plasmids: pBI221 (Clontech), containing the CaMV 35S promoter fused to the 13- glucuronidase gene and a NOS 3' terminator sequence; pBinGSGUS, containing the soybean root-specific glutamine synthetase promoter fused to the GUS gene (Guo-Hua et al., 1991), or pD0432 containing the CaMV 35S RNA promoter-luciferase-NOS 3' terminator sequence in pUC 19 (Ow et al., 1986).
Plasmid DNA was precipitated onto tungsten or gold particles according to the procedure of Finer and McMullen, (Finer and McMullen, 1990). DNA coated particles were introduced into cassava and soybean leaf or root tissues using either a particle inflow gun at a helium pressure of 80 psi or a biolistic PDS-1000 particle delivery system (DuPont) with either gold or tungsten particles (MIO or Ml?) (Jefferson, 1987; Finer et al., 1992). In general, in vitro grown sterile leaves and roots were bombarded to avoid possible complications due to the expression of GUS activity firom contaminating microorganisms.
In each case, an equal area (3 cm circle) of plant material was shot in a petri dish containing standard medium for cassava tissue cultures (Roca, 1984).
30 2.2.3 In situ uidX gene Expression
Transient expression of GUS activity was visualized by staining with the chromogenic substrate X-Gluc (Jefferson, 1987). Following bombardment, the explants were incubated overnight in petri dishes containing MS basal medium at room temperature in complete darkness. The explants were then placed in 400 pi of a solution containing 50 pg X-Gluc (Research Organics) in 10 mM EDTA, pH 8.0; 100 mM sodium phosphate, pH
7.0; 5 mM potassium ferrocyanide; 5 mM potassium ferricyanide and 1 pi Triton X-100 for
16-24 hours at 37 °C to visualize GUS activity (Jefferson, 1987).
2.2.4 Crude Protein Extracts
Cassava or soybean soluble fractions were extracted from 0.8 g of in vitro (sterile) grown plant tissue. The plant tissue was ground to a fine powder in liquid nitrogen, transfered to 3 ml of 50 mM HEPES pH 7.5,5 mM MgCl 2 , and the solution centrifuged twice at 13,000 x g for 15 minutes to remove cell debris. The supernatant fraction was stored at -80 °C until used. Protein concentrations were determined by the method of
Bradford (Bradford, 1976).
31 2.2.5 P-glucuronidase Activity
Bacterial and plant expressed P-glucuronidase was assayed in a reaction mixture containing: 500 pi of 75 mM potassium phosphate buffer, pH 6.8 plus 0.1% (w/v) BSA;
250 pi of 3.0 mM p-nitrophenol P-D glucuronide in 50 mM HEPES, pH 7.5; in the absence or presence of various amounts of tissue extracts to give a final volume of 1.5 ml. The reaction was started by the addition of 5 pi (4 units) of the enzyme. Following 30 min incubation at 37°C, the reactions were stopped by addition of 5 ml of 0.2 M glycine, pH
10.4 and the nitrophenol produced was quantified spectrophotometrically at 400 nm.
Control blanks were prepared the same way except that the glycine stop buffer was added prior to addition of the P-glucuronidase solution. In some assays the tissue extract/p- glucuronidase mixtures were pre-incubated for various times, with and without 0.1 mM
PMSF, prior to initiation of the assay by addition of substrate (P-D glucuronide).
2.2.6 Luciferase Enzyme Assay
Luciferase activity was measured using cassava cmde tissue extracts with a luciferase assay kit (Promega El 500). After the plant tissues were bombarded, they were incubated overnight in petri dishes containing MS basal medium at 27°C in complete darkness. The tissues (0.8 g) were then ground in liquid nitrogen in 3 ml of cell culture lysis reagent (containing 25 mM Tris-phosphate, pH 7.8; 2 mM DTT, 2 mM 1,2
32 diaminocycIohexane-N,N,N'^-tetraacetic acid; 10% (v/v) glycerol and 1% (v/v) Triton X-
100), centrifiiged at 13,000 x g for 10 minutes at 4°C and the supernatant fraction filtered through sterile Miracloth to remove pelleted cell debris.
Luciferase activity was measured by introducing 50 fil of the crude tissue extract into a glass tube containing 100 p,l of luciferase assay buffer (20 mM tricine, pH 7.8; 1.07 mM (MgC0 3 )4Mg(0 H)2 .5H2 0 ; 2.67 mM MgSO^; 0.1 mM EDTA; 33.3 mM DTT; 270 pM coenzyme A; 470 pM luciferin and 530 pM ATP) and immediately assayed for luminescence using a Monolight 350 luminometer (Analytical Luminescence Laboratory,
San Diego, CA) with an integration time of 10 seconds. Assays for luciferase inhibitor activity were made in a reaction mixture containing: 24 ng/ml of firefly luciferase (Sigma) dissolved in glycine buffer (IM, pH 7.7), plus various amounts of crude cassava extract in a final volume of 200 pi. The reaction was started by the addition of 1 ml of luciferase assay buffer which contains 470 pM luciferin and 530 pM ATP. Luminescence was determined using the same conditions as in the luciferase enzyme activity.
2.2.7 DNase Activity
Lambda phage DNA (1 pg) was incubated for various time intervals with cassava or soybean crude tissue extract in 25 pi final volume of buffer containing 2.0 mM MgCl 2 and
25 mM HEPES, pH 7.5; at room temperature. The DNA was then subjected to
33 electrophoresis in a 1.2% (w/v) TBE agarose gel containing ethidium bromide (0.5 pg/ral) and photographed using a UV transilluminator.
DNase activity was also quantified by determination of precipitable DNA following incubation with crude cassava tissue extracts (Maniatis et al., 1982). Random primer ^^P- labelled DNA (30 ng) was incubated with 0.3 pg of crude cassava tissue extract in 2 mM
MgCl2 and 25 mM HEPES, pH 7.5 at room temperature in a final volume of 25 pi. The reaction was stopped after 30 min incubation by the addition of 100 ml of a solution containing salmon sperm DNA (500 pg/ml) and 20 mM EDTA pH 8.0, followed by addition of 14 pi of 100% (w/v) TCA. The solution was then incubated on ice for 15 min, pelleted at 13,500 x g for 15 min and washed with 1 ml of 10% (w/v) TCA followed by 1 ml of 70% (v/v) ethanol. The precipitated DNA was resuspended in 400 pi of water for quantification by liquid scintillation counting.
2.3 Results
2.3.1 Transient uidX gene expression.
Although P-glucuronidase (GUS) activity can be transiently expressed in cassava leaf tissue using either the CaMV 35S promoter or the ubiquitin 1 gene promoter fi-om
Arabidopsis thaliana (Franche et al., 1991), it is unclear, whether these or other promoters
34 would direct gene expression in cassava roots. In order to determine whether the CaMV
35S promoter would permit gene expression in different cassava tissues we introduced, via particle bombardment, a CaMV 35S-GUS reporter gene construct (pBI22l) into cassava and quantified the number of regions transiently expressing P-glucuronidase activity.
Various transformation procedures were tested in order to obtain optimal transient transformation frequencies, including: 1) the type of gun used to deliver the DNA coated particles (PDS-1000 particle delivery system (Dupont) using gun powder as an accelerant, or a particle inflow helium gun); 2) the type of DNA coated particles used (1.0 p gold particles versus 0.7 p or 1.1 p tungsten particles); 3) the distance between the gun orifice and tissue and 4) the type of tissue bombarded including, growth chamber grown and in vitro grown leaves and primary roots sectioned in various maimers.
We observed the highest transient transformation frequencies in leaves and roots when bombarded with the helium driven particle inflow gun using M-17 tungsten particles
(1.1 p) (Table 2.1, and data not shown). It is noteworthy that the conditions which we determined to be optimal for transient transformation of cassava were quite similar to those found for other plant species (Wang et al., 1988).
There were, however, significant differences in the transformation frequency (GUS expressing spots/unit area) between leaf and root tissues. Using the CaMV 35S-GUS reporter gene construct (pBI221) we observed several hundred (230/7 cm^) localized regions expressing GUS activity in transiently transformed cassava leaf tissue but virtually none in roots (< 1/7 cm^) (Fig. 2.1, Table 2.1). In only one case was GUS activity detected
35 Gun Level Plant Tissue Growth Average N® of S.D. Background blue spots 2 Leaf In vitro 110 25.8 3 Leaf In vitro 230 59.3 2 Root In vitro 0 3 Root In vitro 0.16 0.41 2 Root (xs) Soil 0 3 Root (xs) Soil 0 2 Root (Is) Soil 0 3 Root (Is) Soil 0
Gun level 2 is 12 cm and level 3 is 10 cm from the gun opening, xs, cross section; Is, longitudinal section. Values are the average of 6 experiments using equal areas of tissue
(7cm^).
Table 2.1. Number of transient GUS expressing spots in cassava leaf and root tissues following transformation with pBI221 using the helium particle inflow gim under a variety of conditions.
36 The blue spots are the results of the reaction catalized by GUS on the substrate (X-Gluc), producing an indigo dye precipitate at the site of enzymatic activity.
Figure 2.1. Histochemical localization of GUS activity in in vitro grown cassava leaves (A) and roots (B) after bombardment with a CaMV 35S-GUS constmct (pBI221).
37 in cassava root tissue. The intensity of the GUS product in the transformed root tissue was,
however, similar to that observed in leaves. Since root tissues were bombarded under a
variety of conditions, it is unlikely that tissue specific differences in cell number or physical
barriers to particle delivery account for the differences in transformation frequency between
roots and leaves. Furthermore, since the root tissues contained meristematic (primary cell wall, non-vacuolated) and fully expanded (secondary cell wall, vacuolated) cells it is also
unlikely that the developmental or metabolic state of the root tissue precluded transient
expression of introduced DNA.
It is generally assumed that tissue specific differences in transient gene expression
reflect differences in promoter specificity and/or transcriptional control factors (Benfey and
Chua, 1989; Wang et al., 1988; Battraw et al., 1990). In order to determine whether the lack of GUS expression in cassava roots simply reflects an inability of the CaMV 35S promoter
to direct transcription, we bombarded cassava with a root-specific glutamine synthetase promoter-GUS plasmid (pBinGSGUS). We observed no GUS expression in either cassava
leaves (as expected) or roots using pBinGSGUS. In order to verify that we could transiently transform root tissue we also bombarded soybean roots with the root specific glutamine synthetase promoter-GUS plasmid (pBinGSGUS) as well as the CaMV 35S-GUS plasmid
(pB1221). Both plasmids were expressed at equal frequencies in soybean roots suggesting that the efficiency of transient transformation in soybean roots was not determined by the promoter type used to drive GUS expression (Table 2.2).
Transient gene expression patterns in cassava and soybean tissues were similar in one respect. The frequency of CaMV 35S-GUS expression was significantly higher in
38 Plant Tissue Plasmid Average N® of SID.
blue spots
Cassava leaves pBI221 162 18.24 Cassava leaves pBinGSGUS 0 Cassava roots pBI221 0 Cassava roots pBinGSGUS 0 Soybean leaves pBI221 250 50.49 Soybean leaves pBinGSGUS 0 Soybean roots pBI221 12 3.65 Soybean roots pBinGSGUS 10 4.83
All shots were made at 10 cm from the gun opening. Values are the average of 4 experiments using equal areas of tissue.
Table 2.2. Transient expression of the GUS activity driven by the CaMV 35S (pBI221) and glutamine synthetase (pBinGSGUS) promoters in cassava and soybean tissues.
39 leaves than in roots for both species (Table 2.2). Thus it appears that in both species the efficiency o f root transient transformation is low relative to leaves.
2.3.2 Luciferase activity.
One possible reason for the reduced firequency of transient GUS gene expression in roots is inactivation of the en 2 yme. To test this possibility we bombarded cassava tissue with a luciferase reporter gene linked to the CaMV 35S promoter. The luciferase gene has been shown to be a sensitive reporter gene in a variety of animal and plant cells (Ow et al.,
1986; Subramani and DeLuca, 1988; Millar et al., 1992), and would presumably be insensitive to possible GUS enzyme inhibitors. As shown in Fig. 2.2, luciferase activity was substantially higher (4.0 fold) in leaf extracts than in root extracts, consistent with the results obtained for the fi-equency of GUS expression in the two tissue types.
2.3.3 Inhibition of P-glucuronidase activity.
Since transient transformation of cassava roots with the CaMV 35S-luciferase gave higher apparent transformation efficiency than that obtained with the CaMV 35S-GUS plasmid we explored the possibility that GUS activity in roots was reduced due to enzyme inhibitors or to proteolysis. To test this possibility bacterial P-glucuronidase or firefly
40 5000 -
4000 - §
i 3000 - s> u ui 2000 -
3O hJ
1000 -
Leaves Roots Cassava tissues
Rel units = light units/mg of crude protein/h Results are the average of 6 experiments. The bars indicate S.D. See methods for procedures.
Figure 2.2. Luciferase activity in transiently transformed (pD0432) cassava tissues.
41 luciferase was incubated with various amounts of root and leaf extracts and the relative activity was determined. As shown in Figure 2.3, root extracts inhibited P-glucuronidase activity in a concentration-dependent manner. The addition of 20 pg protein of cassava root extract (equivalent to 13% of the total assay volume) inhibited GUS activity by 34%.
Similarly, an equivalent volume of soybean root extract inhibited GUS activity by 23%.
Leaf extracts of both plants, however, were less effective in inhibiting GUS activity.
Expressed on a protein basis, 20 pg of cassava root protein extract was 5 fold more effective in inhibiting p-glucuronidase activity than was an equivalent amount of cassava leaf protein extract. Since the inhibition of GUS activity was rapid (< 1 minute) and did not increase with extended preincubation (< 60 minutes) of GUS with tissues extracts it is unlikely that the inhibition of GUS activity was due to proteolytic activity. Furthermore, the addition of
(10 pM) PMSF, a serine type proteinase inhibitor, to tissue extracts did not alter GUS activity (data not shown).
In contrast to their effects on GUS activity, neither cassava leaf or root extracts inhibited luciferase activity (data not shown). On the contrary, there was a slight enhancement of luciferase activity from added cassava root and/or leaf extracts.
These results indicate that the relative difference in GUS versus luciferase expression may in part result from inhibition of GUS activity in roots. These results, however, do not account for the low efficiency of transient transformation of roots when using the luciferase reporter gene.
42 3 0 0 - 3 0 0 -
2 5 0 - 250 u lU I Â
2 0 0 - 2 0 0 -
150 150 0 20 40 60 80 0 50 100ISO 200 o f protein n! o f crude extract
Rate: mmol nitrophenol, mg P-glucuronidase ’, h ’
Results are the average of four experiments from two separate tissue extractions expressed on the basis of quantity of protein (A) or volume (B) of tissue extract added. Total volume of assay was 1500 pi. Cassava roots H , cassava leaves □ , soybean roots ^ , soybean leaves ^
Figure 2.3. Inhibition of in vitro GUS activity by cassava and soybean crude protein extracts. 2.3.4 DNase activity
Another means by which the efficiency of transient gene expression can be reduced is by degradation of the introduced DNA by endogenous nuclease activity (Hughes et al.,
1979). In order to determine whether nuclease activity was present in cassava and soybean tissues, crude tissue extracts were incubated with lambda DNA for various time intervals followed by determination of the DNA integrity by gel electrophoresis (Fig 2.4). In the presence of cassava root extract (0.2 pg protein), lambda phage DNA was substantially degraded in as little as 10 min. In contrast, there was little evidence of DNA degradation in the presence of 20 fold higher levels of leaf protein (4 pg) even after 2 hours of incubation
(Fig 2.4). Similar to cassava, soybean root extracts had high levels of DNase activity whereas leaf extracts did not (Fig 2.4). The level of DNase activity in cassava tissues was then determined by quantification of the amount of TCA precipitable ^^P-labeled lambda phage DNA following incubation with crude tissue extracts. Reduced levels of precipitated
DNA would indicate the generation of fi"ee, non-precipitable nucleotides via the activity of
DNase(s). As indicated in Table 2.3, there was a 26% and 8% reduction in the level of precipitated labeled phage DNA when incubated with cassava root and leaf cmde tissue extract (0.3 pg protein), respectively. This represents a four fold higher apparent level of
DNase activity in roots than leaves. The high level of DNase activity in roots was even more apparent when we used reduced amounts of tissue extracts (0.15 pg of protein). Lesser amounts (<0.15 pg protein) of tissue extract did not alter the ratio of root/leaf degraded
DNA in the assay (Table 2.3).
44 910 1112 13 14 15 16 1718
10 1112 13 14 15 1617 18 B
Lane 1 : A.DNA digested with Hindm as marker, lane 2 and lane 11 negative controls, phage DNA without crude tissue extract, incubated for 60 and 180 min respectively; lane 3-10 contain 1 (ig of phage incubated with 0.2 |ig of crude extract for 1, 2, 5, 5,10,15, 20, 30, and 60 min respectively; lane 12-18 contain Ipg of phage DNA incubated with 4 pg of leaf extract for 15, 30, 60, 90, 120, 150 and 180 min respectively.
Figure 2.4. Time course of DNA degradation by cassava (A) and soybean (B) tissue extracts visualized by U. V. fluorography after electrophoresis
45 Tissue Tissue extract Precipitable DNA Intact DNA Degraded Degraded (pg protein) (counts/min) (%) DNA(%) DNA root/leal ratio Control 0 64329 100 0 Root 0.3 47840 74 26 Leaf 0.3 59444 92 8 3.25 Root 0.15 52167 81 19 Leaf 0.15 61476 96 4 4.75
The activity is expressed as the percentage of intact DNA following incubation with or without crude tissue extracts. See methods for details. Each value corresponds to the average of two assays from three different tissue extractions.
Table 2.3. Comparative analyses of the DNase activity of cassava root and leaf protein extracts.
46 While the loss in TCA precipitable counts indicates that there is higher DNase activity in root than in leaf tissues, this assay may underestimate the effect of root DNase activity on the integrity of introduced DNA since only the loss of free nucleotides and not precipitable oligonucleotide fragments would be detected by this assay.
It is apparent from Figure 2.4 that the DNase activity in cassava roots can cause substantial damage to high molecular weight DNA. Similar effects were observed when using pBI221 plasmid DNA as a substrate. At present, the cellular location of the DNase activity is not known, however, preliminary studies indicate that the pH optimum for this activity is between 6.0 and 6.5, suggesting that it may not be cytoplasmic.
2.4 Discussion
It is apparent that efficiency of transient transformation is substantially reduced in roots relative to leaf tissues. The fact that neither a broad tissue range promoter such as the
35S CaMV or the root specific promoter glutamine synthetase were expressed at high levels in either cassava or soybean roots suggests that factors other than promoter specificity may limit transient and subsequent stable transformation efficiency.
The reduced expression of GUS in transformed roots can in part be attributed to
GUS enzyme inhibitors. GUS inhibitors are, however, unlikely to account for the reduced levels of apparent transformation, since luciferase expression was also substantially reduced in cassava root tissues relative to leaf tissue but its activity was not reduced by cassava
47 tissue extracts. Therefore, it is likely that other factors reduce the efiticiency of transient transformation in cassava roots. The presence of high levels of DNase activity in roots and the absence of significant DNase activity in leaves most likely accounts for the reduced transient transformation efiBciency of cassava and soybean roots.
Transforming DNA which is delivered by microprojectiles passes through a variety of cell compartments prior to arrival in the nucleus. Root DNase(s) could presumably degrade or damage the introduced DNA thereby reducing transformation efiBciency.
Therefore, in order to identify root specific promoters in cassava it will be necessary to use other experimental systems including: analysis of reporter gene expression in stable transformed plants or in transiently transformed protoplasts.
48 CHAPTERS
SCREENING OF Agrobacterium tumefaciens STRAINS FOR CASSAVA
TRANSFORMATION
3.1 Introduction
Many plant species have been stably transformed using Agrobacterium tumefaciens Ti plasmid mediated integration of foreign DNA. Agrobacterium tumefaciens species carry a large plasmid, where the tumor inducing (Ti), on which the T-DNA and the genes involved in gene transfer and virulence, the v/r-region, are located. Transfer of this
DNA requires the products of about 25 virulence (yir) genes arranged in seven opérons
(Chen et al., 1991). The processes involved in Agrobacterium-meàiaüeà genetic transfer comprises the combined functions of genes on both the chromosome and the Ti plasmid
(Liu et al., 1992). In wild type Ti plasmids, the border regions encompass genes encoding enzymes which are involved in the synthesis of one of three types of opines, agropine, octopine, or nopaline. Transcription of the integrated T-DNA, and the subsequent translation of the T-DNA encoded products, leads to the production and secretion of opines
49 (i.e octopine, nopaline, agropine, mannopine). The opines are used as an energy source by the bacteria, and some opines can induce the conjugal transfer of the Ti plasmid between
Agrobacterium cells. The recipient cells can utilize the opines, and participate in further rounds of plant infection (Gelvin, 1992). Agj’obacterium-vae^aieà. transformation has also been used to study transient gene expression in plant tissues (Liu et al., 1992; Li et al., 1992; Vancanney et al., 1990; Kapila et al., 1997).
Products of the vir region are sufficient to transfer a DNA firagment that is located on a plasmid in the bacterium if flanked by border sequences. This led to the development of the binary system for gene transfer, in which two plasmids are maintained in
Agrobacterium: One is a small plasmid (binary vector) containing only the border sequences of the T-DNA region, a multiple cloning site, an origin of rephcation for E. colt and Agrobacterium, and genes encoding a plant and bacteria selectable markers. The second plasmid is a disarmed Ti plasmid lacking the T-DNA but providing the virulence functions
(Hooykaas, 1989). The activation of the vir genes results in the processing of the T-DNA fi'om the binary vector and its transfer to the plant. Foreign genes located between the border sequences can then be effectively mobilized into plant cells (Horsch et al., 1985).
Recently it has been demostrated that the transformation efficiency of various
Agrobacterium strains and Ti plasmid vectors can vary by several orders of magnitude depending on the plant species. Supervirulence, for example, has been shown to be associated with the presence of different types and or copies of the virG gene whose product acts as a positive transcriptional regulator for its expression and the expression of some
50 other vir genes (Liu et al., 1992). Gelvin and coworkers have found that various
combinations of T-DNA borders (octopine-type or nopaline-type) on the binary vector and
vir gene complements within the A. tumefaciens may influence transient transformation
frequency of maize (Ritchie et al., 1991). Multiple copies o f an octopine-type or an agropine-type virG gene in an agropine-type Agrobacterium, substantially increased the
transient transformation frequencies in celery and rice (Liu et al., 1992). However, the same combinations did not increase the transformation frequency in carrot. The system that worked the best in carrot was a combination of multiple copies of an octopine-type virG gene in a noplaine-type vir gene background (Liu et al., 1992).
In order to establish a reliable system of cassava transformation using A. tumefaciens we screened a variety ofv4 tum^aciens strains. In those, we combined different binary vectors, different Ti plasmid types, and different types and numbers of extra virG genes to determine the most effective vector system for cassava transformation. In order to determine the efBciency of transformation, small pieces (10 mm^) of germinated somatic embryos were cocultivated for 24 hours with preinduced bacterial cultures. After the cocultivation treatment, the explants were washed with somatic embryo induction mediiun plus cefotaxime to eliminate the bacteria. Finally the explants were incubated on solid somatic embryo induction medium plus cefotaxime under the normal conditions for embryo induction. At this point some of the explants were taken for histochemical evaluation of transient expression of the uidA. gene. Regions expressing GUS activity were restricted to the borders (woimded tissue) and the midveins of the explants. None of
51 the expiants showed evidence of GUS expression when treated with the control strains, which contain the binary vector but no Ti plasmid.
The highest number of transient transformation events, i.e. blue spots, were induced by two different Agrobacterium strains. Those strains have different binary vector, but the same type (Nopaline) of binary vector borders, and same type of Ti plasmid (Agropine).
3.2 Methods.
3.2.1 Mlcropropagation and Somatic Embryogenesis.
Shoot apical meristems of cassava varieties MCol 2215, MCol 1505 and MPer 183 were cultured on MS basal medium (Murashige and Skoog, 1962) supplemented with: 1 mg/L thiamine, 100 mg/L myo-inositol, 2% (w/v) sucrose, 0.02 mg/L NAA, 0.04 mg/L
BAP and 0.05 mg/L GA; the medium was solidified with 0.7% (w/v) Bacto-agar and the pH was adjusted to 5.7 with IN KOH (Roca 1984). Shoot cultures were maintained under a
12 h/day photoperiod, at 27 °C and a light intensity of 50 pE S’* (300 - 700 nm). Apical leaves, including small (immature leaves 5 mm long), medium (1 cm long) and large sizes
(>1 cm) were excised from plants not older than 20 days for induction of somatic embryos.
Leaf lobes were placed on MS basal medium (Murashige and Skoog, 1962) supplemented with 2% (w/v) sucrose, 8 mg/L 2,4-D, Gamborg’s B-5 vitamins (Gamborg,
52 1968), 50 mg/L casein and 0.5 mg/L CuSO^ (Chavarriaga-Aguirre et al., 1993); the pH was adjusted to 5.7 and the medium was solidified with 0.2% (w/v) phytagel. The cultures were kept under 12 h/day photoperiod, at 27 °C and 5 pE S’*. Once the embryos were formed, they were removed from the callus and transferred to a "germination medium" to induce development of cotyledonary leaves. This medium contained: MS basal medium
(Murashige and Skoog, 1962) supplemented with 1 mg/L thiamine, 100 mg/L myo-inositol,
2% (w/v) sucrose, 0.01 mg/L 2,4-D, 1.0 mg/L BAP and 0.5 mg/L GA; the pH was adjusted to 5.7 with IN KOH and the medium was solidified with 0.2% (w/v) phytagel.
3.2.2 Bacterial strains and growth conditions.
The Agrobacterium tumefaciens strains used in this study are listed in Table 3.1. All the constructs were developed in the laboratory of Dr. S. Gelvin, Purdue University. The construction of most of the binary vectors is described elsewhere (Liu et al., 1992, Fig.3.1).
A. tumefaciens strains were prepared for explant inoculation by first growing single colonies on YEP solid medium plus antibiotics, followed by growth of the single colony in AB- sucrose minimal medium and grown to an optical density at 550 nm of 0.9 (Chilton et al.,
1974). Then, the bacteria culture was mixed with AB salts, 1% glucose, 20mM MES, pH
5.6,2mM sodium phosphate pH 5.6, supplemented with 100 uM acetosyringone. Cultures were incubated in this preinduction medium at room temperature for 16 hours before inoculation. For growth and maintenance of the bacterial strains, the antibiotics rifampicin,
53 STRAINS DESCRIPTION HOST BINARY BORDERS ON TYPE OF Ti TYPE OF BACKGROUND VECTOR BINARY VECTOR PLASMID MULTIPLE virG
At 767 A136= C58 Chrom. PCNL29 Nopaline Type None Octopine At 696 pCNL30 Nopaline Type None None At 763 PCNL35 Nopaline Type None Agropine
At 651 EH A105= 136+Disann. pCNL29 Nopaline Type Agropine Octopine pTiBo542 At 650 pCNL30 Nopaline Type Agropine None At 652 PCNL35 Nopaline Type Agropine Agropine
At 654 At 503= A136 H-Disarm pCNL29 Nopaline Type Nopaline Octopine pTiC58Z707 !K! At 653 PCNL30 Nopaline Type Nopaline None At 655 PCNL35 Nopaline Type Nopaline Agropine
At 699 EHA105= 136+Disarm. pCNL65 Nopaline Type Agropine None pTiBo542
Binary vectors described in Liu et al., 1992. All the strains have the CaMV 35S-GUS gene, except in the case of At 699 that has the CaMV 35S-GUS intron containing gene.
Table 3. 1 Strains used for transient expression in cassava. RB nptU
Kan pCNLSO 17000 bp UidA
358 LB
RB RB nptU Kan nptn Kan amp
uldA UldA LB Ol
LB pCNL35 358 virD 358 21800 bp
amp amp virC
Mr O
Vectors pCNL29 and pCNL35 contain additional copies of the octopine and nopaline vir genes respectively. For details see Liu et al., 1992.
Figure 3.1. Binary vectors pCNL29, pCNL30 and pCNL 35 used for transient expression experiments. kanamycin and carbenicillin were used in the media at concentrations o f5/50/50 mg/L, respectively. For bacterial inoculation, small pieces (10 mm^) of cotyledonary leaves of germinated somatic embryos and young in vitro leaves were used. A volume (20 ml) of the preinduced bacteria culture covered the explant and the bacteria and embryos were co cultivated for 24 hours at 25°C in darkness.
After the co-cultivation treatment, the explants were washed several times with liquid somatic embryo induction medium containing 400 mg/L cefotaxime to kill the
Agrobacterium. Finally, the explants were cultured in solid somatic embryo induction medium plus cefotaxime under the normal conditions for embryo induction (Sarria et al.,
1993).
3.2.3 Histochemical localization of GUS activity.
After elimination of the bacteria the explants were taken for evaluation of transient expression of the GUS gene. GUS activity was determined histochemically according to
Jefferson (1987), as described in Chapter 2, section 2.2.3.
56 3.3 Results
3.3.1 GUS activity in Agrobacterium mediated transiently transformed cassava.
We tested the transient transformation efficiency of a number of different
Agrobacterium strains in cassava tissues. These strains can be grouped by several criteria based on the features of the host chromosome and the plasmid DNA, including: binary vector type, the type of borders of the binary vector, type of Ti plasmid and the presence and type of extra virG gene copies (Table 3.1). All strains listed in Table 3.1 but one (At
699) have a modified 35S-uidA gene in the T-DNA. The modification consists of an eukaryotic translational initiator that destroyed the consensus bacterial ribosome-binding site (Liu et al., 1992). It has been show that this modification minimizes the expression of the uidA gene in the bacteria (Janssen and Gardner, 1989). Thus, any GUS expression (blue spots) in the cassava explants after Agrobacterium cocultivation is due to the integration of the T-DNA in the plant genome. On the other hand, strain At 699 carries a binary vector containing a chimeric u/^/A-intron containing gene, which harbors three stops codons, one in each reading firame in the intron (Vancanneyt et al., 1990). In this way, the 13- glucuronidase reporter gene can be expressed in plant cells but not in the bacteria (which cannot splice out introns).
Cotyledonary leaves which developed from somatic embryos as well as young leaves were infected with A. tumefaciens and assayed histochemically for GUS activity
57 STRAIN DESCRIPTION 1 TYPE OF EXPLANT AVERAGE # OF BLUE SPOTS/ EXPLANTS At 767 A136 -pCNL29 Young leaves 0 Cotyledonary leaves 0 At 696 A136 -pCNL30 Young leaves 0 Cotyledonary leaves 0 At 763 A136 -pCNL35 Young leaves 0 Cotyledonary leaves 0
At 651 EHA105 - pCNL29 Young leaves 9 Cotyledonary leaves 11 At 650 EHA105-pCNL30 Young leaves 5 Cotyledonary leaves 27 At 652 EHA105 - pCNL35 Young leaves 0 Cotyledonary leaves 6
At 654 At503 - pCNL29 Young leaves 0 Cotyledonary leaves 0 At 653 At503 - pCNL30 Young leaves 2 Cotyledonary leaves 6 At 655 At503 - pCNL35 Young leaves 3 Cotyledonary leaves 0 At 699 EHA105 - pCNL65 Young leaves 0 Cotyledonary leaves 0
1 : host strain - plasmid type. Values represent the average of 10 explants per treatment. Three experiments were performed. The average size for each explant was 10 mm^.
Table 3.2. A. tume/aciens-mediated transient transformation of cassava (Mcol 2215).
58 (Table 3.2). GUS activity (blue spots) was found in the borders (wounded tissue) and in the midvein region of cotyledonary and young leaves. None of the explants showed evidence of
GUS expression when treated with the control Agrobacterium strains At696, At763, At767, which contain the binary vector pCNL30, pCNL35 and pCNL29, respectively but no Ti- plasmid (Table 3.1). When strain At699 (Table 3.1), containing an intron interrupted uidA gene (plasmid p35S-GUS-INT) was used, no blue spots were found.
In cassava. Agrobacterium strains At650 and At651 presented the highest frequency of blue spots, followed by At653 (Table 3.2). At650 presented 5 blue spots in average in explants from young leaves and 27 in cotyledonary leaves, whereas At651 presented 9 and 11 blue spots in young leaves and cotyledonary leaves. On the other hand,
At653 presented 2 blue spots in young in vitro leaves and 6 in cotyledonary leaves.
3.3.2 Cassava varietal response toAgrobacterium transformation.
When the strains (At650 and At651) that presented the highest number of GUS expression in cassava were tested using young leaves of three different cassava varieties
(MCol 2215, MCol 1505 and MPer 183) strain At651 presented the highest number of blue spots (Table 3.3). At651 is identical to At650 with the exception that it contains multiple copies of the octopine type virG gene. Mcol 1505 followed by Mper 183 presented the highest average number of blue spots per explant when infected with either strain. In summary, the features which gave the highest levels of transient expression were agropine
59 type Ti plasmid, and multiple copies of the octopine type virG gene in the host background
EHA105.
3.4 Discussion
None of the explants showed evidence of GUS expression when the cassava explants were inoculated with the control A^obacterium strains At696, At763, and At767, which contain a binary vector with a modified 358 promoter fused to the uidk gene but no
Ti-plasmid (Table 3.1). These results indicated that the expression of GUS activity in cassava occurred via the transfer and expression of the uidA gene. Sarria and coworkers
(1992) found no endogenous GUS activity in leaf, stem or root tissues of cassava when using the Jefiferson (1987) or Kosugi (1990) protocols for GUS staining. However, they detected endogenous P-glucuronidase activity in somatic embryos. When the histochemical
GUS assays were performed with germinated somatic embryos they found that Jefferson’s protocol gave 10 times higher endogenous enzyme activity than Kogusi’s protocol. The
Kosugi protocol includes methanol which apparentely suppresses endogenous P- glucuronidase activity in the plant tissues (Kosugi et al., 1990). Similarly, Schopke et al.,
1992, using the histological GUS assay (Jefferson, 1987) with nontransformed somatic embryos, found that those explants have a weak endogenous p-glucuronidase expression.
After 8 hours in the assay solution, a few light blue cells were observed, and after 24 hours nearly all the cells firom the hypocotyl were blue in some embryos.
60 STRAIN DESCRIPTION HOST VARIETY AVERAGE # OF BLUE BACKGROUND SPOTS/EXPLANT
At 650 EHA105 (pCNLSO) Mper 183 2.7 Mcol 2215 2.0 Mcol 1505 1.5
At 651 EHA105 (pCNL29) Mper 183 5.0 Mcol 2215 2.5 Mcol 1505 7.0 Values represent the average of 20 explants per treatment. Two experiments were performed. The average size of the explant was 10 mm^.
Table 3.3 Transient transformation efSciency in young leaves of three cassava varieties.
61 Endogenous GUS activity has been reported for a few species and for different types of tissue (Plegt and Bino, 1989; Hu et al., 1990; Sarria et al., 1992). It has been shown that the endogenous P-glucuronidase of different plant families have their optimum activities atpH 5.0, while the P-glucuronidase from E. coli used for plant transformation has its optimum near pH 7.0.
When a histological detection of GUS activity was performed at pH 5.0, the non transformed somatic embryos were stained completely blue (Schopke et al., 1992), indicating the presence of endogenous p-glucuronidase. Non-transfromed in vitro leaves were stained light blue at pH 5.0, while at pH 7.0 no color was observed (Schopke et al.,
1992). The data of GUS activity presented in Table 3.1 was performed at pH 7.0 according to Jefferson (1987). No blue background was observed in any of the explants that were evaluated. Moroever, only defined blue spots were seen.
When the strain At 699 was used to transiently transform cassava, no blue spots were detected. At699 contains an intron intermpted uidA gene (plasmid p35S-GUS-INT).
This intron is a portable intron from the ST-LSl gene finm potato which was introduced into the bacterial gene coding for GUS (Vancanney et al., 1990). A. tumefaciens strains carrying the p35S-GUS-INT plasmid showed no detectable GUS expression in bacteria
(Vancaraieyt et al., 1990). The same construct used in rice (Li et al., 1992), Phaseolus sp., poplar, tobacco (Kapila et al., 1997) and in apple (De Bondt et al., 1994) was reported to give transient expression of GUS activity. Furthermore, the GUS expression in rice roots and shoots was not dependent on the Ti plasmid type (agropine or octopine). Chavarriaga-
Aguirre and coworkers, 1993, used the same intron ST-LSl interrupted uidK gene under the
62 control of the CaMV 35S promoter and two different polyadenyiation signals in four
àxs\m.ciAgrobactenum strains. They found different levels of GUS expression in cassava embryogénie tissues. The differences range from 57% to only 5% of the explants with GUS expression. They argued that the variation found could be due to the different polyadenyiation signals or the presence of the intron in the uidA. coding sequence or both.
These results suggest that the presence of a potato intron in the uidA gene interferes with effective expression of GUS activity in cassava.
The strains that gave the highest frequency of transient trasformation were At650 and At651. They have different binary vectors (pCNL30 and pCNL29) but have the same border type (nopaline) and same Ti plasmid type (agropine). On the other hand, At651 presents multiple virG (octopine type) gene copies whereas At650 lacks extra virG gene copies. The function of the VirG protein is to transcriptionally regulate the expression of its own and other vir genes after being phosphorylated by VirA protein (Gelvin,1992). The virG copy number and type can influence the behavior of Agrobacterium. When a nonsupervirulent strain (A348), containing the octopine Ti-plasmid pTiA6 was transformed with a 2.5 kb DNA fragment containing the virG gene and the 3’ end of the virB operon, the strain A348 became supervirulent. When the 3’ end of the virB operon was used, the strain A348 did not become supervirulent (Liu et al., 1992).
In rice and celery the frequency of transient GUS expression was enhanced when using agropine-type strains containing multiple copies of either an octopine or an agropine-type virG gene. Whereas in carrots a similar pattern of enhancement of transient
63 GUS expression was only obtained when multiple octopine-type virG genes were introduced into nopaline-type strains (Liu et al,, 1992).
It is apparent from these studies that the type of Ti plasmid (agropine, nopaline) may influence the level of enhancement o f the expression of the uid A gene by multiple virG gene copies.
64 CHAPTER 4
OPTIMIZATION OF TRANSIENT TRANSFORMATION IN CASSAVA
4.1 Introduction
Many plant species have been stably transformed using Agrobacterium Ti plasmid
mediated integration of foreign DNA. Using apical leaves and cassava somatic embryos we have screened a variety of Agrobacterium tumefaciens strains for transient transformation by monitoring expression of the integrated GUS reporter gene. These strains can be grouped by several criteria based on the features o f the host chromosome and the plasmid DNA, including: the binary vector type, type of Ti plasmid and the presence and type of extra virG gene copies (Arias-Garzon et al., 1994; and Chapter 3 this study).
Based on those results, we have developed a new binary vector (pCAS 1) which has been optimized for transformation of cassava. In this vector the uidA gene is under the control of a chimeric promoter, the Pmas Amas + Aocs, which incorporates subdomains of the mannopine synthase promoter and mannopine and octopine synthase activator regions (Ni et al., 1995). Relative to the CaMV 35S promoter this promoter has
65 been shown to increase the expression of the uidA gene in tobacco (Ni et al., 1995) and cassava (Arias-Garzon et al., 1994). Additionally, it has been demonstrated that this promoter is preferentially expressed in root tissues. The basic procedure for gene transfer via Agrobacterium mediated Ti plasmid, includes co-cultivation of the explants with a bacteria suspension culture (Horsch et al., 1985). The explants should present wounding regions either by a cork borer, in the case o f leaf discs, or by a scalpel when leaf pieces or germinated somatic embryos are used. Wounding of plant tissue is necessary for
Agrobacterium infection. The release of phenolic compounds from the wounding regions induces the vir genes located on the Ti plasmid and thus initiates events leading to gene transfer (Gelvin, 1992 and Winans, 1994).
Recently, there have been reports of improvement o f Agrobacterium Ti plasmid transformation efficiencies using the particle gun or glass beads to wound the tissue prior to co-cultivation with the bacteria (Bidney et al., 1992, Graybum et al., 1995). Tobacco leaves wounded with a particle gun prior to Agrobacterium treatment produced at least
100 times more kanamycin resistant calli and higher levels of GUS expression than leaves without pre-treatment (Bidney et al., 1992). Similarly, Graybum and Vick, 1995, enhanced transformation frequency in sunflower by shaking the tissues with glass beads before co-cultivation with Agrobacterium.
In addition, it has been shown that ultrasonic treatment of plant tissues results in a large enhancement of Agrobacterium-vaeàxsXoà. transformation of soybean (John Finer, personal communication). The cavitation caused by the ultrasonic treatment presumably wounds the tissues and causes production of phenolic compounds for the Agrobacterium
6 6 infection. This system is still under study in different target tissues of soybean, maize and
cowpea and other crops (John Finer, personal communication).
In this chapter, we describe a transformation procedure which has been optimized
for cassava and that includes wounding of germinated somatic embryos and pre-induction
of the bacteria before co-cultivation.
4.2 Methods
4.2.1 Plant Material
Shoots of a cassava variety MCol 2215 were cultured on MS basal medium as described in Chapter 3, section 3.2.1. Apical leaves of in vitro plants as well as
germinated somatic embryos were used îox Agrobacterium co-cultivation. Somatic
embryos were induced from immature leaves (5-10 mm long) from plants not older
than a month, also as described in Chapter 3, section 3.2.1 (Fig. 4.1).
4.2.2 New binary vector for cassava
A new Agrobacterium tumrfaciens strain (At 803) was constructed which consists of the EHA105 chromosomal background and a modified binary vector (Fig. 4.2).
67 Figure. 4,1
Somatic embryogenesis in cassava
A) Embryonic callus from an apical leaf. B) Clump of somatic embryos
C) Germinated somatic embryos. X b a l H ind 111
pCASl 13 Kb
Figure 4,2. T-DNA region of the new binary vector constructed for cassava transformation. A. tumefaciens EHA105 was generated from EHAlOl (Hood et al., 1986) by deleting the kanamycin resistance gene from the Ti plasmid (Li et al., 1992). A pBIlOl derivative binary vector (pCASl) was introduced in by triparental mating
(Li et al., 1992). The T- DNA of this vector includes the bar gene conferring resistance to the herbicide phosphinothricin (PPT) and the uidA gene (Fig 4.2). The bar gene is under the control of the nopaline synthase promoter (Pnos). The uidK gene is under the control of the mannopine synthase promoter, the mannopine synthase activator and the octopine synthase activator (Pmas Amas + Aocs) (Ni et al., 1995). The second vector introduced contains the vir genes with additional copies of the octopine type virG gene (Liu et al., 1992).
Non-induced A. tumefaciens strains were prepared for explant inoculation by first growing single colonies on YEP solid medium plus 5 mg/1 rifampcin and 50 mg/1 kanamycin, followed by overnight growth of the single colony in 5 ml YEP medium plus antibiotics. Pre-induced Agrobacterium were grown similarly but after over night growth in
YEP, 500 pi of cells were inoculated in 25 ml AB-sucrose minimal medium (Chilton et al.,
1974). Bacteria then were pelleted at 3000 rpm for 10 min at room temperature and resuspended in 25 ml AB salts, 1% glucose, 20mM MES pH 5.6,2mM NaPO^, pH 5.6; supplemented plus 100 |nn acetosyringone (Liu et al., 1992). Bacteria cultures were incubated in this pre-induction medium at room temperature for at least 16 hours before co cultivation with the explants. Just before co-cultivation, the cell number for both types of
Agrobacterium treatments (pre-induced and non-induced) was brought to an optical density
(600 nm) of 0.7, either by adding liquid media or concentrating the cells.
70 4.2.3 Co-cultivation conditions
Apical leaves and germinated somatic embryos were excised from the in vitro plants or from the clumps of germinated somatic embryos a few hours before co-cultivation, and organized in petri dishes. Some tissues were additionally wounded with a particle inflow gun using 1.1 pm (average diameter) tungsten particles accelerated under 80 psi pressure
(Arias and Sayre, 1993). The plant material then was placed in a petri dish containing standard tissue culture medium for cassava (Roca, 1984) covering an area of 3 cm circle.
Pre-induced or non-induced Agrobacterium cultures (3 ml) were placed over the explants.
The tissues were co-cultivated for 24 hours at 28°C in darkness. After the co-cultivation treatment, the explants were washed several times over three days with cassava liquid standard culture medium containing 400 mg/1 cefotaxime or 200 mg/1 carbenicillin to kill the Agrobacterium.
4.2.4In situ localization and enzymatic activity of uidAthe gene.
Once the bacteria were eliminated some of the explants were taken for evaluation of expression of the uidA gene. The rest of the expiants were left in somatic embryogenesis media (see chapter 3, section 3.2.1) plus 200 mg/1 carbenicillin or 400 mg/1 cefotaxime and
1.0 mg/1 phosphinotricin, as selectable agents. GUS activity was determined histochemically using 5-Bromo-4chloro-3 indolyl, B-D glucuronic acid (X-gluc) as a
71 substrate or assayed enzymatically using the fluorogenic substrate methylumbelliferyl li-D glucuronide (MUG) and tissue extracts according to Jefferson (1987). Protein concentration was determined by the method of Bradford (1976). GUS activity was also determined histochemically for pre-induced and non induced bacteria.
4.3 Results
As shown in Table 4.1, additional wounding of cassava tissues with a particle gun prior to Agrobacterium infection increases the extent of tissue transient transformation. The highest number of explants with GUS expression was obtained when the explants were wounded with the particle gun before co-cultivation (Figure 4.3). Half of the apical leaves
(55 %) and 92 % of the germinated somatic embryos treated with extra wounding and inoculated with pre-induced bacteria were completely blue due to GUS expression. When the germinated somatic embryos were not wounded before co-cultivation the percentage of blue explants was reduced to 28 %.
Because of the difGculties to histochemically evaluate explants that presented none, partial, or complete GUS expression, it was necesary to do enzymatic analysis of the i«dA expression using MUG as substrate (Jefferson, 1987). By this assay, it was verified that wounding the explants with the particle gun increased the magnitude o f transient expression of the uidA gene (Table 4.2).
72 Tissue Additional Pre Number of Expiants with no Completely Expiants Wounding induced explants GUS expression Blue Explants Showing Blue Treatment Culture (%) (%) Spots (%)
AL PG - 40 32 18 50 AL none - 35 80 0 20 AL PG + 36 6 55 39 AL none + 35 40 49 11 GSE PG - 37 74 22 4
GSE none - 41 44 5 51 GSE PG + 38 8 92 0 GSE none + 36 55 28 17
AL: Apical Leaves GSE: Germinated Somatic Embryos PG: Particle Gun Values are the result o f two experiments, two replicates each. See Methods for details.
Table 4.1 Agrobacterium tumefaciens (At 803) mediated transformation of cassava tissues.
73 The expiants were co-cultivated with induced Agrobacterium culture. The tissues were cleared with 70% ethanol after the GUS assay. Notice the two explants that had no GUS expression at all. See Methods for details.
Fig. 4.3 Histochemical localization of GUS activity in germinated somatic embryos after tissue wounding with the particle gun..
74 Tissue Wounding Pre-induced GUS Activity * Treatment Agrobacterium Culture
AL PG - 8.0 ± 2.2
AL None - 4.2 ± 1.0 AL PG + 88.6 ± 6.6 AL None + 52.2 ± 1.6
GSE PG - 12.8 ± 2.9
GSE None - 21.0 ± 1.5 GSE PG + 80.0 ± 5.0 GSE None + 59.6 ± 4.0
* Specific activity is expressed as nmol 4-MU /mg protein /h. AL: Apical Leaves. GSE: Germinated Somatic Embryos. PG: Particle Gun. The data presented are the mean of two experiments, two replicates each.
Table 4.2 Average GUS activity in cassava tissues determined quantitatively by an enzyme assay using MUG as the substrate.
75 Apical leaves and germinated somatic embryos that were wounded with the particle gun before co-cultivation and that were infected with pre-induced bacteria presented higher
GUS activity than those tissues that were not exposed to wounding. The highest level of
GUS activity (88.6 nmol 4-MU/mg protein/h) was found in the apical leaves wounded with the particle gun and infected with pre-induced bacteria.
Pre-induction o f Agrobacterium with 100 pM acetosyringone also enhanced transient transformation (GUS activity) in apical leaves and germinated somatic embryos
(Table 4.1 and 4.2). GUS activity assays (Table 4.2) demonstrate that transformation with pre-induced cultures gave 5 to 10-fold higher GUS activity than transformation with non- induced cultures. Furthermore, pre-wounding of tissues resulted in increased GUS expression (> 50%) in all examples except somatic embryos treated with non-induced cultures (Table 4.2). Both types of explants presented similar levels of GUS activity when co-cultivated with pre-induced bacteria with either wounding treatment (Table 4.2).
However, the enzyme activity in the germinated somatic embryos was 2 to 5 times higher than in the apical leaves with or with out extra wounding treatment.
At this point, the bar gene was imder study as a selectable marker for stable transformation of cassava. Both types of explants were incubated in somatic embryogenesis media (see Chapter 3, section 3.2.1 ) plus 200 mg/1 carbenicillin or 400 mg/1 cefotaxime and
1.0 mg/1 phosphinotricin, as selectable agent. However, it was not possible to recover primary or secondary somatic embryos from either type of explant, respectively.
76 4.4 Discussion
We demonstrate that microprojectile bombardment of cassava tissues is an effective method for increasing transient transformation frequencies hy Agrobacterium tum^aciens
Ti plasmids. Similar results have been reported for tobacco and sunflower (Bidney et al.,
1992, Graybum et al., 1995). Particle gun mediated wounding of cassava tissues may facilitate bacterial infection of the explants over a large surface area compared to cutting or wounding the tissues with a blade. Wounding may also produce signaling molecules
(phenolic compounds) which induce the vir genes on the Ti plasmid facilitating the transfer of the T-DNA. In addition, pre-induction o f Agrobacterium prior to inoculation resulted in higher GUS expression. Apical leaves and germinated somatic embryos wounded with the particle gun and co-cultivated with the pre-induced Agrobacterium had 3-10 fold greater
GUS activity than tissues inoculated with non-induced bacteria cultures.
Graybum and Vick, 1995, reported a protocol for improvment of transformation of sunflower. Normally the shoot apex of sunflower seedlings are exposed by cutting off the cotyledons to inoculate the Agrobacterium (Graybum, 1993 cited in Graybum and Vick,
1995). In the improved system, the decapitated seedlings are shaken with glass beads to generate cavities to facilitate the bacterial infection. This treatment increased the yields of transformed plants and reduced the number of chimeras or partially transformed plants
(Graybum and Vick, 1995).
Also in sunflower, Bidney et al., 1992, were able to detect GUS activity in exposed meristems only after wounding them with a particle gun before co-cultivation with
77 Agrobacterium. When the meristems were inoculated with bacteria and then wounded by microprojectile bombardment, no GUS expression was detected. Similarly, the wounds created by the impact of the particles on a tobacco leaf produces sites conducive to
Agrobacterium infection over much of the surface area (Bidney et al., 1992). This group was able to show higher NPTII activity in tobacco leaves that were wounded by particle bombardment before Agrobacterium co-cultivation than leaves that were bisected or unwounded before cocultivation (Bidney et al., 1992).
Agrobacterium-vas^^icà transient expression has been used basically for studying the T-DNA transfer and for optimizing plant transformation protocols. Van Montagu’s group designed a system for efScient transient expression system to study general gene expression for intact leaves of Phaseolus, poplar and tobacco, based on vacuum infiltration
Agrobacterium suspensions (Kapila et al., 1997). They found high transient expression of an intron interrupted uidA. gene when the bacteria was inoculated by vacuum infiltration after induction of the vir gene, i.e. in the presence of acetosyringone at pH 5.6. The GUS expressing sectors comprised between 20-90% of the leaf area. This high yield of transient transformation efficiency was decreased when the bacteria was not pre-induced or when induced at neutral pH. Leaves that were not infiltrated, but submerged in the bacterial suspension for 20 min showed GUS activity only at the wounding sites of the leaves which were generated during explant handling (Kapila et al., 1997).
It is noteworthy to mention that transient expression mediated by Agrobacterium refers to expression of genes that are integrated into the plant nuclear DNA but the explants are not allowed to regenerate new plants. On the contrary, transient expression via particle
78 bombardment or electroporation refers to DNA uptake into the plant nucleons but that not necessarily integrated into the plant genome (De Bondt., et al 1994). The optimum physiological status for DNA uptake (transient expression) is not necessarily optimal for integration of foreign DNA in the host genome (stable expression). DNA uptake has often been suggested to be cell cycle dependent, whereas DNA integration may primarily rely on the availability of DNA repair enzymes (De Bondt., et al 1994).
It was noticed that the strain At803 showed GUS activity when it was preinduced with acetosyringone with no exposure to plant material (data not shown).This may result from the presence of the bacterial ribosome-binding site on this GUS construct. The binary vector (pBIlOl) in strain At803 does not have any modification in the CaMV35-«/dA gene, therefore, the bacteria can express GUS activity if it remains alive within the plant tissue. It may have been possible that some of the blue patchy spots in some of the explants co cultivated with strain At803, were due to internal expression of the uidA. gene by bacteria that were not get eliminated by cefotaxime treatment. However, as explained in methods
(section 4.2.4), the explants were washed several times with cassava liquid media plus 200 mg/1 carbenicillin or 400 mg/1 cefotaxime before doing the GUS analysis. Moreover, it was possible to see GUS expression in some apical leaves or germinated somatic embryos two weeks after co-cultivation even though there was no re-growth of the bacteria around the explants.
In order to get stable cassava transformants, we also co-cultivated explants with the bacteria. After several washes with cassava liquid media plus 200 mg/1 carbenicillin or 400 mg/1 cefotaxime, they were incubated in somatic embryogenesis induction media plus
79 antibiotic and phosphinothricin (PPT). The T- DNA of the modified pBIlOl binary vector of strain At803 includes the bar gene as a selectable marker and the uidA gene as a reporter gene (Fig 4.2). The bar gene, which encodes for the enzyme phophinothricin acetyl
transferase (PAT) confers resistance to the herbicide bialaphos, a tripeptide containing l - phosphinothricin (De Block et al., 1987; De Block et al., 1995; Vasil, 1996).
Phosphonothricin, upon removal of L-glutamic acid and two L-alanine residues by a peptidase, is a potent inhibitor of glutamine synthetase. This enzyme catalyses an ATP- dependent incorporation of ammonium into the amide position of glutamate, resulting in the formation of glutamine. This is the major way for capturing the toxic ammonium released by: nitrate reduction, amino acid degradation, photorespiration, and other catabolic and anabolic processes. Inhibition of glutamine synthetase by PPT causes rapid accumulation of ammonia, increases the production of free radicals, stops photorespiration and photosynthesis and induces chloroplast dismption leading to plant cell death (De Block et al., 1987). The bar gene, isolated from Streptomyces hygroscopicus, encodes a phosphinothricin acetyltransferase which acetylates the free NH 2 group of PPT in the presence of acetyl coenzyme A and prevents cell death. The acetylated form of PPT is stable in plants and has no herbicidal activity (Vasil, 1996).
The bar gene has been sucesfully introduced in several economic important crops including, oats, barley, tomato, rice, potato, maize, etc (Vasil, 1996). In cassava, it has been used by several groups working in stable transformation (Sarria et al., 1993; Sarria et al.,
1995; Cabral et al., 1995; Schopke et al., 1993; and this study). However, none of them have been able to select for stable transformed plants using the bar gene as a selectable
8 0 marker. It seems that there are differences in the levels of suceptibility of the different cassava tissues to the pure active compound (PPT-Sigma) or to the commercial herbicides
(Basta or Bialaphos) whose main ingredient is PPT.
Sarria and coworkers used Basta (16 to 32 mg/1 PPT) as selective agent, however, it is apparent that they could not isolate the chimeras from the transformed plants (Sarria et al., 1993 and 1995). Similarly, Cabral’s group used Basta, but in their report it is not mentioned what concentrations were used (Cabral et al., 1995). They did not get stable transformed cassava plants either. Finally, Schopke et al., 1993, reported the use of 2.5 to
10 mg/1 of phosphinothricin to inhibit development of secondary embryos from cassava embryo clumps. They tried to select transformed plants using the bar gene as a selectable marker with no success. Not until they switched to nptO. which confers resistance to kanamycin or paromomycin was stable transformation of cassava reported (Schopke et al.,
1996).
In this study, we used the pure compound PPT (Sigma) to select for stable transformation of cassava co-cultivated with strain At803. In preliminary sudies (data not shown) it was found that the levels required to inhibit induction of primary somatic embryos from apical leaves was 0.5 to 1.0 mg PPT/1, while for induction of secondary somatic embryos from germinated somatic embryos was 0.2 mg/1. When some of the explants that were co-cultivatd with strain At803 were left under selection, it was not possible to recover any somatic embryos (primary or secondary) from any of treatments.
It seems the pure compound was too toxic for the explants. Small changes in the
PPT concentration represented drastic responses in terms of the viability of the explants. In
81 general, the expiants did not produce callus, a transitional step in the induction of somatic embryos. Based on these results it was necesary to look for a new selectable marker for the stable transformation of cassava.
8 2 CHAPTERS
STABLE TRANSFORMATION OF CASSAVA
5.1 Introduction
The release of hydrogen cyanide (HCN) from plant tissues or other organisms has been demonstrated in more than 3000 species to date. In about 10% of those species,
HCN comes from cyanogenic glycosides and cyanolipids (Hickel et al., 1996).
Cyanogenic glycosides may have several functions in plants. They may serve as nitrogen storage compounds in rubber tree seedlings (Selmar et al., 1987; Hickel et al., 1996).
Another function of these compounds is to serve as inactive precursors which are activated in response to damage or pathogen attack. Because of the toxicity of HCN to most organisms, primarily as respiratory poison, the function of cyanogensis has been generally associated with defense against herbivores or pathogens (Arias and Belloti,
1984; Hughes et al., 1994; Osbourn, 1996; Hickel et al., 1996).
In cassava, the hydrolysis of linamarin is initiated by cleavage of the carbohydrate moiety by a P-glucosidase, linamarase. Following hydrolysis, the product, acetone cyanohydrin, is further broken down to acetone and hydrogen cyanide. Cyanogenesis
83 from acetone cyanohydrin can occur spontaneously at pHs above 4.0 and/or temperatures which are higher than 35°C or via hydroxynitrile lyase enzymatic activity (White et al.,
1993).
Genes encoding several hydroxynitrile lyases have been cloned recently. These include those o f sorghum (Wajant et al., 1994), black cherry (Cheng and Poulton, 1993), rubber tree (Hasslacher et al., 1996) and cassava (Hughes et al., 1994 and White, 1996).
Recently, White 1996, reported another cDNA HNL sequence for cassava. The cDNA sequence analysis predicted a 1118 bp gene, which encodes a 258 amino acid protein.
The nucleotide sequence was nearly identical, with the exception of 13 amino acids, to the sequence previously published by Hughes’ group in 1994. Eleven of the 13 amino acids differences occurred in an area where there were two nucleotide sequence differences due to a frame shift. Some of the differences include: Hughes’ sequence is missing a cytosine at position 553, at position 519, the Hughes’ sequence has a guanidine inserted. The 13 amino acids in White’s sequence were mainly uncharged, while Hughes’ had more charged amino acids. Finally, White’s sequence has 8 out of those 13 amino acids similar with the rubber tree (Hasslacher et al., 1996) sequence while Hughes sequence does not. Southern blot analysis supported the existence of one copy of the hydroxynitrile lyase gene in the cassava genome (Hughes et al., 1994; White, 1996).
Expression of the HNL gene was found mainly in cassava leaves, although detectable amounts from stems and roots were seen on some blots. The transcripts found in stems and roots were only 2 and 6 percent of the leaf expression, respectively (White,
1996). This indicates that HNL transcripts do not accumulate to high levels in cassava
84 roots. Since, the roots are the main source of food from a cassava plant it is proposed that by overexpressing HNL in the cassava root ceils it is possible to increase the rate of degradation of acetone cyanohydrin during root processing. This will result in a safer cassava food product, without impeding the protective fimction of the cyanogenic glycosides in the plant.
We cloned the cDNA HNL gene isolated by White (1996), into the binary vector pKYLX 71 (An et al., 1985; Schardl et al., 1987) under the control of a double CaMV
358 promoter. To date there is no a cassava root specific promoter. Thus, we chose a strong constitutive promoter that might drive the expression of our gene of interest in all cassava tissues. The modified pKlfXX-HNL was cloned into two different strains of
Agrobacterium, LBA 4404 and EHA105, which were used for stable cassava transformation.
5.2 Methods
5.2.1 Binary vector
The binary vector used for the stable transformation of cassava was pKYLX71
(An et al., 1985; Schardl et al., 1987). This plasmid was modified by cloning a Xho I-
Xba I fragment (containing the cDNA HNL gene) of pBKS+ to create the pKYLX-HNL binary vector (Fig. 5.1). Plasmid DNAs were purified through QIAGEN columns
85 Xba 1
RB
oo O n pKYLX - HNL 13 Kb
Figure 5.1. New binary vector pKYLX - HNL used for stable transformation of cassava according to the methods described by the manufacturers. Overnight bacterial cultures
(25-50 ml) were grown under selection and pelleted at 5000 rpm for 15 min. at 4°C. The pellet was resuspended in 4 ml of buffer containing 100 pg/ml RNase, 50 mM Tris-HCl, pH 8.0,10 mM EDTA, pH 8.0. Cells were lysed by the addition of 4 ml of 0.2 M NaOH,
1% (w/v) SDS and incubated at room temperature for 5 min. Bacterial debris was precipitated by the addition of 4 ml of 3 M potassium acetate, pH 5.5. After incubation on ice for 15 min. the cellular debris was pelleted at 14000 rpm at 4°C for 15 min.
The supernatant was passed through a QIAGEN column that was previously equilibrated with 4 ml of buffer containing, 750 mM NaCl, 50 mM MOPS, pH 7.0,15 %
(v/v) ethanol, 0.15 % (v/v) Triton XIOO. Then, the column was rinsed twice with 10 ml of buffer containing 1.0 M NaCl, 50 mM MOPS, pH 7.0, 15 % (v/v) ethanol.
The DNA was eluted into a 15 ml corex tube with 5 ml of buffer containing 1.25
M NaCl, 50 mM Tris-HCl, pH 8.5,15 % (v/v) ethanol. The DNA was precipitated by the addition of 0.7 vol. isopropanol at room temperature and pelleted immediately at 10000 rpm., at 4°C for 30 min. DNA pellet was 70 % (v/v) ethanol washed, air dried for 10 min. and resuspended in 200 pi TE buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA).
Cohesive ends ligations were carried out for 1 h at room temperature using 300 ng vector and 100 ng insert using 1 unit T4 DNA ligase (Gibco-BRL) in buffer containing
250 mM Tris-HCl, (pH 7.6), 50 mM MgCl;, 5mM ATP, 5 mM DTT, 25% (w/v) polyethylene glycol-8000. Ligation samples were used to heat-shock transform DH5a E. coli competent cells at 42°C for 35 seconds (Maniatis et al., 1982). Cells were grown in 1 ml LB liquid media at 37°C for 1 hour.
87 Transformants were grown overnight on solid LB media supplemented with 12.5 mg/1 tetracycline. Plasmid DNA was screened using the alkalyne lysis minipreps according to the methods of Ausubel et al. (1994). Aliquots of 1.5 ml were removed from
5 ml overnight bacterial cultures and bacteria pelleted at 13000 rpm at room temperature for 1 min. Supernatant was discarded and the pellets were resuspended in 100 |il GTE buffer containing: 50 mM glucose, 25 mM Tris-HCl, pH 8.0,10 mM EDTA and incubated 5 min at room temperature. Bacterial cells were lysed by the addition o f200 pi of 0.2 M NaOH, 1% (w/v) SDS and incubated on ice for 5 min. Bacterial debris and nuclear DNA were precipitated by the addition of 150 pi of 5 M potassium acetate, pH
4.8. After incubation on ice for 5 min, the cellular debris was pelleted at 13000 rpm at room temperature for 5 min. The supernatant was removed and double stranded DNA was precipitated by the addition of 2.5 vol. 95% ethanol and incubated at -20 °C for at least 30 min. DNA was pelleted by centrifugation at 13000 rpm for 10 min at 4 °C .
Pelleted DNA was washed with 70% ethanol. The pellet was dried in a speed-vac and re suspended in 30 pi TE buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA).
Screening of the colonies was performed by 1 hour digestion at 37°C of 2.5 pi of plasmid DNA with 5 units of Xho I and Xba I, which generates a 12 and a 0.8 Kb band if the ligation was correct. Once a correct colony was selected, DNA was purified through
QIAGEN column as described above.
88 5.2.2 Agrobacterium transformation
The new binary vector, pKYLX-HNL was cloned into Agrobacterium tumefaciens strains LBA4404 (Gibco-BRL) by electroporation and into EHAI05 (Li et ai., 1992) by triparental mating (Walkerpeach and Velten, 1994). Transformation of LBA4404 was carried out by electroporation of 20 pi of ElectroMAX™ LBA4404 cells (Gibco-BRL) with 100 ng pKYLX-HNL. A Bio-Rad electroporator was used for that purpose using the following settings: 1.8 kV, 25 pF, 200 Q and 4.8 msec. After electroporation cells where incubated in I ml YM medium (0.04% yeast extract, 1.0% mannitol, 1.7 mM NaCl, 0.8 mM MgS0 4.7H2 0 , 2.2 mM K2 HPO4.3 H2 O, pH 7.0) at 225 rpm (30°C) for 3 hours. After the expression period 100 pi o f cell suspension was spread onto solid YM supplemented with 100 mg/1 streptomycin and 12.5 mg/1 tetracycline for 2-3 days at 30°C for selection of transformants.
Putative transformants were screened by mini plasmid preparation analysis
(Walkerpeach and Velten, 1994). Aliquots of 3.0 ml were removed from 5 ml two-day old Agrobacterium cultures and pelleted at 13000 rpm at room temperature for 10 min.
Supernatant was discarded and the pellets re-suspended in GTE buffer containing 50 mM glucose, 25 mM Tris-HCl, pH 8.0, 10 mM EDTA. Bacterial cells were incubated with 20 pi of a 20 mg/ml lysozyme solution at 37°C for 15 min. Lysis of the bacteria ceils was carried out by the addition of 200 pi of 0.2 M NaOH, 1% (w/v) SDS. Bacterial debris and nuclear DNA were precipitated by the addition of 150 pi of 3 M sodium acetate, pH
5.2 and 50 pi of phenol equilibrated with 2 volume of cell lysis solution. The cellular
89 debris was pelleted at 13000 rpm at room temperature for 5 min. The supernatant was removed, and double stranded DNA was precipitated by the addition of 2.5 vol. 95% ethanol and incubated on ice for 10 min. DNA/RNA was pelleted by centrifugation at
13000 rpm for 10 min at room temperature. Pelleted DNA was washed with 70% ethanol.
The pellet was dried in a speed-vac and re-suspended in 50 pi TE buffer. Mini plasmid preparations were screened by overnight digestion at 37 °C of 12 pi of DNA with 10 units of Xba I and Xhol. Samples were run on a 0.6% agarose gel. DNA was visualized by supplementing the gel with 50 ng/ml ethidium bromide. Since digested Agrobacterium mini-prep DNA is difficult to discern on gels, they were evaluated by Southern blotting as described by Maniatis et al, (1982). Gels were denatured in 1.5 M NaCl, 0.5 M NaOH for 1 hour, followed by washing in neutralization buffer, 1 M Tris-HCL pH 8.0, 1.5 M
NaCl for 1 hour. Southern transfer onto Duralon-UV (Stratagene) was set up overnight with lOX SSC (20X SSC: 3M NaCl, 0.3 sodium citrate, pH 7.0). The DNA was cross- linked to the nylon membrane by vacuum drying at 80 °C for 2 hours. Prehybridization was performed at 65 °C for 3 hours in buffer containing 6X SSC, 5X Denhardt’s, 10 mM
EDTA, 100 pg/ml sheared calf thymus DNA, 1 mg/ml SDS. ^^P-radiolabeled pKYLX-
HNL plasmid (25 ng) was prepared using the Radprime DNA labeling system following the manufacturer’s instructions (Gibco-BRL). After addition of the denatured labeled probe, the blot was hybridized overnight at 65 °C. Southern blot was washed once in 2X
SSC, 0.1 % (w/v) SDS for 10 min at room temperature. Then, the washing solution was changed to 0.1 X SSC, 0.1 % (w/v) SDS and washing continued at 65 °C for 1 hour with one change of buffer. After washing, the blot was exposed to X-ray film at -80 °C. The
90 new LB A4404 Agrobacterium strain transformed with the binary vector pKYLX was named Agt 1. The new binary vector, pKYLX-HNL was also cloned into Agrobacterium strain EHA105 (Li et al., 1992) by triparental mating (Walkerpeach and Velten, 1994) using the mobilization functions of pRK2013 (Ditta et al., 1980). EHA105 was grown for two days at 30 °C in 5 ml YEP medium (lOg/L Bacto yeast, lOg/L Bacto peptone, 5 g/L
NaCl) plus 10 mg/L rifampycin. E. coli harboring the plasmid pRK2013 and the binary vector pKYLX-HNL were grown overnight at 37 °C in 5 ml YEP medium supplemented with 25 mg/1 kanamycin and 12.5 mg/1 tetracycline. A mating plate containing 10 g/1 tryptone, 8 g/1 NaCl, 15 % (w/v) agar was inoculated with a mixture o f 100 pi of each three parental bacteria strains and incubated overnight at 30 °C. Bacterial lawn was re suspended in 3 ml of sterile 10 mM MgCl; and incubated at room temperature for 30 min. Finally, 10° to 10"^ dilutions of the bacterial suspension were inoculated in solid
YEP medium supplemented with 10 mg/l rifampycin and 12.5 mg/1 tetracycline and grown at 30 °C for two days. Antibiotic resistant colonies were inoculated in 5 ml YEP supplemented with the respective antibiotics for mini plasmid preparation as well as
Southern analysis as described above. The new modified Agrobacterium strain EHA105 was named Agt2.
91 5.2.3 Plant Material
Shoots of a cassava variety MCoI 2215 were cultured on MS basal medium as described in Chapter 3, section 3.2.1. Somatic embryogenesis was induced from immature leaves (5-10 mm long) also as described in Chapter 3. Apical leaves of in vitro plants as well as germinated somatic embryos not older than a month were used for
Agrobacterium co-cultivation. After co-cultivation, primary (from apical leaves) or secondary (from germinated somatic embryos) embryos were induced as described in section 3.2.1, Chapter 3.
5.2.4 Co-cultivation conditions
Agtl and Agt2 A. tumrfaciens strains were prepared for explant inoculation by first growing single colonies on YM solid medium plus 100 mg/l streptomycin and 10 mg/l rifampycin respectively plus 12.5 mg/l tetracycline, followed by two days growth of the single colony in 5 ml YM medium plus antibiotics. Bacteria were pelleted at 7500 rpm for 7 min. at 4°C, and resuspended in MS (Murashige and Skoog, 1962) medium supplemented with 200 pM acetosyringone until an ODggq of 0.5-0.7 was reached. Bacteria cultures were incubated in this pre-induction medium at 28°C for 2 to 4 hours before co-cultivation with the explants.
92 Apical leaves and germinated somatic embryos were excised from the in vitro plants or from the clumps of germinated somatic embryos a few hours before co-cultivation. The explants were rinsed in MS medium plus Tween 20 and organized in petri dishes containing standard cassava somatic embryogenesis medium (Chapter 3), suplemented with 100 pM acetosyringone. ^Q-mà\xceé Agrobacterium cultures (20-50 pi) were placed over the explants. The tissues were co-cultivated for two days at 28°C in darkness. There were two different types of controls: in one, the explants were cultivated as in normal induction of somatic embryogenesis (Chapter 3); for the other control at least 10 % of the explants were not co-cultivated with the bacteria cultures but other than that they were treated similarly.
After the co-cultivation treatment, the explants were transferred to somatic embryogenesis medium supplemented with 500 mg/l carbenicillin and 75 mg/l paromomycin for at least three weeks. The explants were incubated at 28 °C, 12 hour photoperiod at 5-10 pE m'^s*'.
At least twice a week the explants were evaluated under a dissecting scope and overgrowth callus was eliminated. After three-four weeks clumps of somatic embryos were transferred to cassava regeneration medium (MS salts, 20 % (w/v) sucrose, 0.1 mg/l benzylamino purine, 1 mg/l giberellic acid, 1 mg/l thiamine, 100 mg/l myo-inositol, pH 5.7,
0.2 % (w/v) phytagel) supplemented with 500 mg/l carbenicillin and 75 mg/l paromomycin and incubated at 28 °C, 12 hour photoperiod and 20-30 pE m'^s‘* for about four weeks.
Once the germinated somatic embryos formed shoots, they were transferred to cassava micropopagation medium (MS salts, 20 % (w/v) sucrose, 0.04 mg/l benzylamino purine,
0.05 mg/l giberellic acid, 0.02 NAA, 1 mg/l thiamine, 100 mg/l myo-inositol, pH 5.7,0.8 %
(w/v) agar) for normal plant growth.
93 5.2.5 Polymerase Chain Reaction
Genomic DNA was extracted from 30 mg of in vitro leaves of putative transformed and control plants (Sweeney et al., 1994). Tissue was ground in 400 pi of extraction buffer containing 200 mM Tris-HCl, pH. 7.5,290 mM NaCl, 25 mM EDTA, pH. 8.0,0.5 % (w/v) SDS. Proteins and polysaccharides were removed via centrifugation at 13000 rpm for 5 min. Supernatant was transferred to a fresh tube containing 300 pi of isopropanol. DNA was pelleted at 13000 rpm for 7 min. The DNA pellet was phenol- chlorofonn extracted and DNA was reprecipitated by the addition of 1/10 vol. 3 M sodium acetate, pH. 5.2, and 2.5 vol. 95 % (v/v) ethanol.
Polymerase chain reaction (PCR) was used to detect the presence of the nptVi and the HNL genes that were introduced into cassava via the Agrobacterium T-DNA. PCR reactions were performed in a total volume of 50 pi containing: 5 pi of lOX PCR buffer
(500 mM KCl, 100 mM Tris-HCl, pH 8.4, 15 mM MgCl^, 1 mg/ml gelatin), 20 to 100 ng of leaf DNA of transformed and untrasformed in vitro plants, 0.1 pM each of N0SNPT5’ and N0SNPT3’ or HNL5’ and HNL3’ primers, 0.5 mM MgCla, 0.05 mM dNTP’s and
0.5 units Taq polymerase (BRL). The reaction to amplify the n p tll gene also contained
2.5 pi of DMSO.
Primers were synthesized by IDT, Inc. (Coralville, LA) and amplify a 860 bp fragment o f the nos-np/U region and a 800 bp region of the HNL cDNA gene. As positive controls for the PCR reactions, 20 ng of the binary vector pKYLX-HNL was used as template. The sequences of the primers are:
94 N0SNPT5’: 5’CCGCCGATGACGCGGGACAAGCC3’
N0SNPT3’: 5’GGTCCGCCACACCCAGCCGGCCA3’
HNL5’: 5’AAAGTCGACATGGTAACTGCACATTTTGTT3’
HNL3’: 5’AAAGAATTCTCAAGCATATGCATCAGCCAC3’
PCR reactions were overlaid with 40 jil of light mineral oil and DNA was amplified by 30 PCR cycles in a Perkin Elmer thermocycler (Norwalk, CT). DNA was denatured by a 1 min incubation at 94 °C, followed by 1 min annealing step at 63 or 55
°C (NOSNPT5’-NOSNPT3’ and HNL5’-HNL3’ respectively) and 1 min extension step at 72 °C. Aliquots were taken directly from the reaction samples and were run on a 0.8%
(w/v) agarose gel containing 0.5 pg/ml ethidium bromide for visualization under UV light.
The absence of residual Agrobacterium contaminants was tested in all plants by using two primers that amplify a 1093 bp fragment of the vir zone A located outside of the T-DNA (Pavingerova et al., 1997) following a protocol described by Moore et al.,
(1993). To test the feasibility of these primers 4 pi of overnight Agrobacterium culture plus 80 pi of H 2O were boiled for 5 min and used as template DNA in a PCR reaction containing IX PCR buffer (500 mM KCl, 100 mM Tris-HCl, pH 8.4, 15 mM MgCl 2 , 1 mg/ml gelatin), 0.5 pM primers, 0.1 mM dNTP’s, 10 mM MgCl 2 , 0.5 units Taq polymerase (Gibco-BRL). These samples were heated to 94 °C for 4 min, followed by 40 cycles of 94 °C for 50 sec, 55 °C for 30 sec, 72 °C for 1 min, with an extension step of
95 72 “C for 5 min in a Perkin Elmer thermal cycler. The same PCR amplification conditions were used for genomic plant DNA (20 ng).
5.2.6 Crude protein extractions
In vitro cassava leaf-stem and roots of putative transformed and untransformed plants (100 mg) were frozen in liquid nitrogen and ground with a mortar and pestle in 500
|il of 100 mM sodium phosphate, pH 5.0,500 mM NaCl, 3 mM DTT, 1 % (w/v) polyvinyl pyrrolidone. To avoid protein dénaturation, the mortar and the buffer were kept on ice. Debris were eliminated by spinning the samples at 13000 rpm, at 4 °C for 15 min.
Supernatant was collected and centrifugated again at 13000 rpm, at 4 °C for 5 min.
Supernatants were stored at -20 °C. Protein concentrations were determined by the bicinchoninic acid (BCA) method (Akins and Tuan, 1992) using a BSA standard.
5.2.7 HNL enzymatic analysis
Hydroxynitrile lyase assays were performed in 1 ml in the presence of 50 mM sodium phosphate, pH 5.0, 20 pg total protein, 28 mM acetone cyanohydrin (Sigma) and
96 incubated for 30 min. at 28 °C in capped tubes. After incubation, 10 pi of the reaction mixture was added to 20 ml of 50 mM sodium phosphate, pH 4.0 and HCN was determined using the Spectroquant 14800 cyanide detection kit (EM Science, Gibbstown,
NT). In the assay, cyanide binds to the nitrogen of pyridine, forming 1-cyanopiridium which spontaneously degrades to form glutacone dialdehyde cyanamide, which condenses with 2 molecules of 1,3-dimethyl barbituric acid producing a lavander colored compound. The color change is measured at 585 nm. Potassium cyanide was used to make the standard curve for cyanide concentration. Spontaneous rates of acetone cyanohydrin breakdown were always subtracted from the enzyme catalyzed reactions.
5.2.8 Western Blot
Proteins were separated by sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE). Protein samples were loaded onto 12 % polyacrylamide gels with 6 % stacking gels (Harlow and Lane, 1988). The final buffer concentration for the stacking gels was 0.12 M Tris-HCl, pH 6.8 and for separating was 0.4 M Tris-HCl, pH 8.8. The running buffer contained 0.03 M Tris, 0.2 M glycine and 1 % (w/v) SDS.
Prior to loading, protein samples were solubilized in 12.5 % (v/v) glycerol, 33 mM DTT,
0.1 % (w/v) SDS, and 0.1 % (w/v) bromophenol blue, and were boiled for 5 min. For western bloting 25 to 5 pg leaf-stem total protein and 75 pg root total protein were loaded per lane.
97 Following electrophoresis, proteins were transferred to Inmobilon-P (Millipore) using a Sartorius semi-dry horizontal electroblotter at 20 V for 1:5 hours. Transfer buffer contained; 25 mM Tris, 0.2 M glycine, pH. 8.5, and 20% (v/v) methanol. Western blots were washed in TBS (20 mM Tris, 500 mM NaCl, pH. 7.5) and blocked for 30 min at room temperature in TBS plus 3 % (w/v) gelatin. The blots were then washed with 0.05
% (v/v) Tween-20 in TBS (TTBS) and incubated overnight at room temperature with the primary antibody (1:5000 dilution) in 1 % (w/v) gelatin, 0.05 % (v/v) Tween-20 in TBS.
The blot was then washed twice with TTBS, and incubated in a 1:3000 dilution of the secondary antibody, goat anti-mouse IgG alkaline phosphatase conjugate (Promega), for
1 hour at room temperature. Blots were then washed again twice with TTBS, once with
TBS and once with bicarbonate buffer (0.1 M sodium bicarbonate, 1 mM MgCl 2 , pH.
9.8). Cross-reaction of hydroxynitrile lyase with antibodies was visualized by adding alkaline phosphate substrate solution (0.15 mg/ml bromochloroindol phosphate in 100 % dimethyl formamide, 30 mg/ml nitroblue tétrazolium in 70 % (v/v) dimethyl formamide in 50 ml bicarbonate buffer). Color development was stopped after 15-30 min by washing the blots twice with ddH20. Polyclonal antibodies were raised against partially purified apoplast hydroxynitrile lyase by the Ohio State University Antibody Center
(White, 1996).
98 5.2.9 Genomic DNA extraction
Genomic DNA was extracted from the leaf-stem and roots of putative transformed and untransformed in vitro plants using the method of Dellaporta et al., (1983). Plant tissue (0.5 to 1.0 g) was frozen and ground in liquid nitrogen to a fine powder. While the tissue was still frozen, 10 to 15 ml of extraction buffer was added (100 mM Tris-HCl, pH
8.0,500 mM NaCL, 1 % (w/v) polyvinyl pyrrolidone, 10 mM p-mercaptoethanol). Once the tissue was thawed, 1 ml of 20 % (w/v) SDS was added and the tubes were shaken vigorously. The samples were incubated at 65 °C for 10 min. Then, 5 ml of 5M potassium acetate pH 5.5 was added, mixed and incubated on ice for 1 hour. Proteins and polysaccharides were removed by centrifugation at 15000 rpm for 20 min at 4 °C. The supernatant was poured through a sterile Miracloth filter into tubes containing 10 ml of isopropanol. DNA was precipitated at -20 °C for 1 hour and pelleted at 15000 rpm for 20 min. at 4 °C. DNA pellets were air-dried for 10 min. DNA was resuspended in 300 ml of
TE buffer (50 mM Tris-HCl, 10 mM EDTA, pH 80). RNA was removed by incubation of the solution with 20 pi of RNase (2.5 mg/ml) for 30 min at 37 °C. DNA was purified by phenol-chloroform extraction and re-precipitated with 1/10 volume of 3 M sodium acetate pH 4.8, 2.5 vol. 95 % (v/v) ethanol. DNA was pelleted by centrifugation at 15000 rpm, for 20 min at 4 °C. The DNA pellet was washed with 70 % (v/v) ethanol, dried and resuspended in 100 TE buffer.
99 5.3 Results
5.3.1 Plant transformation efficiency.
A total of 17 individual cassava co-cultivation experiments was performed, (See
Table 5.1). Apical leaves (444) or germinated somatic embryos (2447) were co-cultivated for two days with Agrobacterium strains Agtl or Agt2. The explants were transferred to cassava somatic induction medium supplemented with 500 mg/l carbenicillin and 75 mg/l paromomycin. Once a week the explants were evaluated under a dissecting scope and excess callus was eliminated. After about three weeks o f induction of somatic embryogenesis the explants, now clumps of somatic embryos, were transferred for regeneration on media containing 500 mg/l carbenicillin and 75 mg/l paromomycin. As of
August, 1997, the regenerated somatic embryos produced shoots that were transferred to cassava micropropagation medium. Each shoot was considered an individual transformed plant and its identification has been kept through all the stages of micropropagation. The controls were treated similarly but they were not co-cultivated with the bacteria. Most of the control explants also produced somatic embryos in the presence of paromomycin, however, they died later in the regeneration medium.
To evaluate the efficiency of cassava transformation it will be considered that
100% efficiency is when each explant regenerates a new plant. Based on this assumption, the efficiency of producing putative transformed plants was 2.8 %. Apical leaves
100 N° of co Strain type Type of N«of Putative Efficiency of cultivation expiants expiants transformed transformation experiments plants 8 Agtl GSE 1857 60 3.2 % 4 Agtl AL 306 17 5.5 % 3 Agt2 GSE 590 3 0.5 % 2 Agt2 AL 138 0 ---
Agtl: LBA 4404 + pKYLX-HNL Agt2: EHA 105 +pKYLX-HNL Two different types of explants were used, germinated somatic embryos (GSE) and in vitro apical leaves (AL). Putative transformed plants refer to plants that were regenerated under selection with 75 mg/l paromomycin.
Table 5.1 Cassava co-cultivation experiments.
101 cocultivated with Agtl showed the highest efficiency of transformation at 5.5 %, whereas, germinated somatic embryos were lower (3.2 %). Agrobacterium strain Agtl produced the highest number of putative transformed plants (77), compared to Agt2 with only 3 plants. When apical leaves were co-cultivated with Agt2 strain, no plants were recovered. It was observed that Agtl (LBA 4404-pKYLX- HNL) was easier to handle than Agt2 (EHA105- pKYLX- HNL) in terms of growing, pelleting, and eliminating bacteria after plant co-cultivation.
5.3.2 PCR analysis
Primers N0SNPT5’ and N0SNPT3’ amplify a 860 bp DNA fragment of the nos promoter-nptU cassette of pKYLX-HNL. When genomic DNA isolated from leaf and stems of nine putative transformed plants was amplified with these primers, all produced the expected PCR product, whereas, the control plant did not (Fig. 5.2). All the PCR products had the same intensity on the gel.
The Nos-nptn fragment has an unique Pst I site which is predicted to cut the fragment into a 460 and 410 bp piece. When some of the PCR products from the putative transformed plants were cut with Pst I, the right size fragments were obtained (data not shown), verifying the nature of that DNA.
1 0 2 M 1 10 11
1Kb
M: 1Kb ladder; 1 : untransfonned plant; 2 to 10: transformed plants 54B4,6’3,5’1, 5.4, 5’2,9A1,4.1, 5.1 and 5.3 respectively; 11 : binary vector pKYLX - HNL. For PCR conditions see methods.
Figure 5.2 Amplification of a 860 bp nos promoter - npt H cassette fragment by PCR.
103 The cDNA HNL gene in the binary vector pKYLX-HNL was amplified with primers HNL5’ and HNL3’ that correspond to the 5’ and 3’ region. These primers amplify a DNA firagment of 800 bp. Initial PCR reactions with 20 ng of plant DNA did not produce any product, but when it was increased to 100 ng all the plant DNAs amplified the cDNA HNL gene (Fig 5.3). However, the intensity of the bands was not the same in all the tracks. Plants 9.A.1, 5.2,4.1 and 5.4 presented the most intense bands.
Few of the plant DNAs that were analysed by PCR are not present in both Figure 5.2 and
5.3 due to availability of DNAs at the moment of doing the different PCR reactions. No plant DNA amplified the endogenous HNL, possibly due to its size. White (1996), reported a 7 Kb gene with introns.
So far, there is no indication of partial integration of the Agrobacterium T-DNA in the plants tested by PCR. In order to test that there were no bacteria present in the transformed plants primers specific for the Vir A gene of the bacteria were designed. The
Vir A gene is present in the Ti plasmid and is not transferred to the plant genome. When those primers were used with overnight Agrobacterium culture in a PCR reaction (as described in section 2.2.5) a 1.1 Kb band was obtained as expected. No PCR products were obtained in any of the transformed plants with those primers (data not shown).
104 M 10 11
I Kb
M: 1 Kb ladder; 1: untransfonned plant; 2 to 10 transformed plants: 6’2, 5’1, 9A1, 5.2,4,1,5’2, 5.4, 5.land 5.3 respectively; 11: binary vector pKYLX-HNL. For PCR conditions see methods.
Figure 5.3. Amplification of 800 bp HNL fragment, using the cDNA HNL as a template.
105 5.3.3 HNL enzymatic activity.
Leaf plus stem crude extracts from transformed plants had up to two fold higher hydroxynitrile lyase activity than crude extracts from untransformed plants (Table 5.2).
Spontaneous rates of acetone cyanohydrin decomposition were always subtracted from the enzyme catalyzed reactions. Results presented in Table 5.2 are the average of two different crude extracts, two repUcates each. Hydroxynitrile lyase from untransformed plants (leaf-stems) had an activity of 1.7 mmol HCN/mg protein/h versus 4.0,2.4, 3.8 mmol HCN/mg protein/h from three different transformed plants (9.A.1, 5.2.4,5’2 respectively). Previously, White (1996), reported HNL activities for cassava crude apoplast and partially purified extract of 0.61,2.4 and 11.5 mmol HCN/mg protein/h respectively. Our results show an improvement of White’s protocol to assay HNL in crude extracts. The improvements include a reduction of the volume from 4 ml to 1 ml for the first set o f reactions of the hydroxynitrile lyase assay. In addition, our reactions were carried out in a small capped glass vials to reduce the loss of HCN. In order to perform statistical analyses of the cyanide assays, four different extractions of leaf-stem tissues of untransformed and one transformed plant (9.A.1) were performed (Table 5.3).
Unfortunately, because of the slow growth rate of the in vitro plants it was not possible to perform the analysis in more samples. As shown in Table 5.3, the means of four different experiments showed significantly differences at 0.05 level. The transformed plant (9.A.1) had two-fold higher HNL activity than the imtransformed plant.
10 6 Specific activity Standard Deviation (mmol/mg/protein/h) Untransformed plant 1.7 0.5 Transformed plant 9A1 4.0 1.0 Transformed plant 5.2.4 2.4 0.4 Transformed plant 5’2 3.9 0.3
Specific activities are the means of two replicates each.
Table 5.2 Hydroxynitrile lyase activities assayed from two different crude extracts of untransformed and transformed plants.
107 Specific activity Standard Deviation (mmol/mg/protein/h) Untransformed plant 1.83 A* 0.7 Transformed plant 9.A.1 3.75 B 0.3
* Means with different letters are significantly different at the 0.05 level.
Specific activities are the means of two replicates each.
Table 5.3 Hydroxynitrile lyase activities assayed from four different crude extracts of untransformed and transformed plants (9.A. I).
108 Crude extracts from roots of untransformed or transformed plants did not exhibit
hydroxynitrile lyase activity (data not shown). The amounts of HCN released in the
presence of cassava root crude extracts (transformed and untransformed plants) were not
higher than the amounts released by spontaneous breakdown of acetone cyanohydrin.
Comparative western blot analyses HNL abundance in untransformed and
transformed leaf-stem total protein extracts are consistent with the higher activity of
hydroxynitrile lyase in at least one of the transformed plants (Figure 5.4). Three different concentrations of total protein from leaf-crude extracts were used to screen for differences
in HNL protein in untransformed vs. transformed plants (Figure 5.4). After the transfer of
the proteins to the membranes the gels were stained with Coomasie Blue to verify the complete transfer. Only high molecular weight standards were seen in the gels. At 25 pg protein differences in the levels of HNL from transformed and untransformed plants were not easily detected. However, when the total protein was decreased to 15 pg or 5 pg differences in the abundance of HNL between the transformed (9.A.1) and the imtransformed plant can be appreciated (Figure 5.4). To quantify the differences, the western blot was scarmed and analyzed using a densitrometry program (Table 5.4), where the band intensities are given as relative units. At the three different protein concentrations the band intensity of plant 9.A.1 (transformed) is twice that of the untransformed plant. At 15 pg of total protein the HNL band from transformed plants
5.2.4 and 5’2 show 1.2 and 1.4 times the intensity of the untransformed plant. However, at the lowest level of total protein (5 pg) the transformed plant 5.2.4 shows lower band intensity than the control.
109 25 ng 15 ng 5 Hg
29 kD-
l:untransformed plant; 2 to 4 transformed plants: 9A1, 5.2.4 and 5’2 respectively.
Figure 5.4. Inmunoblot of hydroxynitrile lyase using 25,15 and 5 pg of total protein from cassava leaf and stem tissues from untransformed and transformed plants.
1 1 0 Total Protein Band Intensity Ratio of T/U* Untransformed Plant 25 pg 2783.9 Transformed Plant 9.A.1 25 pg 4595.5 1.6
Transformed Plant 5.2.4 25 pg 1727.0 0.5 Transformed Plant 5’2 25 pg 1720.9 0.5
Untransformed Plant 15 pg 856.4 Untransformed Plant 9.A.1 15 pg 2029.0 2.3 Transformed Plant 5.2.4 15 pg 1011.0 1.2 Transformed Plant 5’2 15 pg 1224.5 1.4
Untransformed Plant 5pg 445.0 Untransformed Plant 9.A.1 5pg 748.4 1.6 Transformed Plant 5.2.4 5pg 147.0 - Transformed Plant 5’2 5pg 540.0 1.2 * T; Transformed plant. U: Untransformed plant. Band intensity is given in absolute values.
Table 5.4 Densitometry analysis of western blot for HNL.
I ll No hydroxynitrile lyase protein was detected on western blots of root crude extracts, not even when 75 pg of total protein was loaded (data not shown). It had been shown previously that cassava root rind and root parenchyma do not have detectable hydroxynitrile lyase on western blots (White, 1996). Based on standardization studies of the HNL amounts in different cassava tissues it seems that in cassava roots the total amount of HNL is less than 0.3 % of the total protein.
So far, transformed plant 9.A.1 shows consistent evidence for the integration of foreign genes (HNL and nptH) into its genome. That evidence includes: 1) amplification by PCR of the npt H gene fragment, and the HNL gene (with a high band intensity for
HNL); 2) increased (2x) HNL enzyme activity level in leaves relative to untransformed plants, and 3) increased (2x) HNL leaf protein (western) levels when compared to the untransformed plant.
5.4 Discussion
The production of transgenic cassava has been previously demonstrated
(Raemarks et al., in Sofiari, 1996; Schopke et al., 1996 and Li et al., 1996). However, here we are reporting for the first time transformation of cassava with a gene of agronomic interest. This was accomplished by combining somatic embryogenesis and
Agrobacterium mediated transformation with paromomycin as selective agent. This amynoglycosidic antibiotic was used by Schopke et al. (1996) to select for embryogénie
112 suspension lines that had been bombarded with a plasmid containing the nptU. gene. They found that 15 mg/1 o f paromomycin was the best concentration to select for transformed cassava embryogénie suspension cultures. However, when we used 15 mg/1 of paromomycin to select for transformed somatic embryos after co-cultivation with
Agrobacterium none of the expiants (including the controls) died (data not shown).
Therefore, it was necessary to increase the concentration of antibiotic to 75 mg/1 to reduce the growth of non-transformed tissues. At this level some of the control expiants developed somatic embryos, however, these did not regenerate into plants.
To compare the efficiency of the new system of cassava transformation with the previous systems it will be necessary to know the number of initial expiants. Schopke et al., (1996) did not state the number of original explants transformed since they used embryogénie suspension cultures which are not easily quantified. They were able to produce 18 embryogénie lines resistant to paromomycin. Four of those lines hybridized to the uid A gene, but only one renegerated plant showed stable integration of the uid A gene by Southern blot analysis. On the other hand, Li and coworkers (1996), produced 30 putative transformed plants resistant to hygromycin firom 1735 original explants via organogenesis. This is equal to a 1.7 % efficiency of transformation. Here, we are reporting a protocol with an average of 2.8 % transformation efficiency. When only apical leaves are evaluated the efficiency goes up to 5.5 %.
Agrobacterium strain LBA 4404 (Agt 1) gave the highest number (77) of stable transformed plants. Similarly, Ishida et al. (1996) and Li et al. (1996) reported LBA 4404 as the best strain to transform maize and cassava, respectively. When strain EHA105
113 (Agt2) was used to transform cassava only three putative transformed plants were obtained. This strain had been reported as the best Agrobacterium recipient for transient transformation of cassava (Arias-Garzon et al., 1995). However, the bacteria is difBcult to eliminate after co-cultivation and the elimination process might exert extra stress on the plant tissues. EHA105 has been shown to be supervimlent on several species, including rice (Li et a l., 1992), sunflower (Graybum and Vick, 1995), and pea (Puonti-Kaerlas,
1991, cited in Li et al., 1996).
DNA was extracted from leaf plus stems of in vitro grown putative transformed and control plants to determine whether the plants were transformed. This DNA was subjected to PCR analysis using oligonucleotide primers specific for the nos-nptU cassette and for the cDNA HNL gene cloned in pKYLX-HNL. All plant DNA from putative transformed plants amplified the expected PCR products (Figure 5.2 and 5.3).
Primers N0SNPT5’ and N0SNPT3’ amplified an homogenous DNA fragment in all
DNAs from transformed plants (Figure 5.2), while the primers for the HNL fragment produced different abundance of PCR products (Figure 5.3). This might be due to the differences in amounts of template DNA (20 ng for the nos-nptU fragment vs. 100 ng for the HNL fragment) or to directional insertion of the T-DNA. If multiple copies of the T-
DNA were integrated into the plant genome, with incomplete integration of some of them, it might be possible to have more or less copies of one section of the T-DNA to amplify by PCR. The insertion of the T-DNA has been shown to be directional, from right to left border (Zambrisky, 1992). The binary vector pKYLX-HNL has the nos promoter- npt II cassette close to the right border, thus partial integration of this sector
114 might had been ocurred. In addition, PCR analysis with primers specific for a region of
the vir A locus did not gave rise to a product.
Increased levels of hydrxynitrile lyase activities were found only in crude protein
extracts from leaf plus stem tissues of transformed plants when compared to
untransformed plants (Figure 5.4). Hydroxynitrile lyase from leaves and stems of
untransformed plants had an activity of 1.7 mmol HCN/mg protein/h versus 4.0,2.4,3.8
mmol HCN/mg protein/h from three different transformed plants (Table 5.2). However,
HNL has not been detected yet in root tissues of transformed plants.
Some posible explanations why HNL activity is not expressed in roots include: 1)
low levels of transcription from the double 358 promoter, 2) chimeric plants lacking
HNL DNA in roots, 3) reduced protein synthesis in roots and 4) toxicity of HNL to roots
and localized patterns of cell death. Possible solutions for those factors listed above are:
1) to use homologous or heterologous root specific promoters, 2) to screen more plants,
3) to target HNL to amyloplasts so it can’t produce HCN in apoplast of roots in vivo, or
4) there is no readily apparent solution.
115 BIBLIOGRAPHY
Ammirato, P.V. 1983. Embryogenesis, In: Handbook of Plant Cell Culture., MacMillan Publishing, New York
An, G., Watson, B.D., Stachel, S., Gordon, M.P., Nester, E.W. 1985. New cloning vehicles for transformation of higher plants., EMBO journal, 4,277-284
Arias-Garzon, D.I., Sarria, R., Gelvin, S.B., Sayre, R.T. 1995. New Agrobacterium tumefaciens plasmids for cassava transformation.. In: The Cassava Biotechnology Network, Proceedings of the Second International Scientific Meeting. Indonesia, August 1994., CIAT, Cali, Colombia
Arias-Garzon, D.I., Sayre, R.T. 1993. Tissue specific inhibition of transient gene expression in cassava (Manihot esculenta Crantz), Plant Science, 93, 121-130
Ausubel, F., Brent, R., Kingston, R., Moore, D., Seidman, J., Smith, J., Struhl, K., Albright. L., Coen, D., Varki, A., Janssen, K. 1994. Current Protocols in Molecular Biology, John Wiley & Sons Inc., USA
Balagopalan, C., Padmaja, G., Nanda, S., Morthy, S. 1985. Cassava in Food, Feed, and Industry., CRC Press., Boca Raton, FI.
Battraw, M.J., Hall, T.C. 1990. Histochemical analysis of CaMV 35-S promoter-P- glucoronidase gene expression in transgenic rice plants.. Plant Molecular Biology, 15, 527-538
Belloti, A., Arias, B. 1993. The possible role of HCN on the biology and feeding behavior of the cassava burrowing bug (Cyrtomenus bergi Froeschner)., In: The Cassava Biotecnology Network, Proceedings of the First International Scientific Meeting. August 1992. Cartagena, Colombia., CIAT, Cali, Colombia
Benfey, P., Ren, L., Chua, N-H. 1989. The CaMV 35S enhancer contains at least two domains which can confer different developmental and tissue-specific expression patterns., EMBO, 8, 2195-2202 116 Bevan, M.W., Flavell, R.B., Chilton, M.D. 1983. A chimeric antibiotic resistance gene as a selectable marker for plant cell transformation.. Nature, 304,184-187
Bidney, D., Scelonge, C., Martich, J., Burrus, M., Sims, L., HufiBtnan, G. 1992. Microprojectile bombardment of plant tissues increases transformation frequencies by Agrobacterium tumefaciens. Plant Molecular Biology, 18, 301-313
Binns, A.N. 1988. Cell biology of Agrobacterium infection and transformation of plants., Annual Review of Microbiology, 42, 575-606
Bokanga, M. 1994. Distribution of cyanogenic potential in cassava germplasm., Acta Horticulturae, 375,117-123
Bradbury, J.H. 1988. The chemical composition of tropical roots crops, ASEAN Food Journal, 4, 3-13
Bradford, M. 1976. A rapid and sensitive method for quantification of microgram quantities of protein utilizing the principle of protein-binding. Annals of Biochemistry, 72, 248-254
Cabral, G.B., Aragao, F.J.L., Monte-Neshich, D C., Rech, E.L. 1993. Transient gene expression in cassava protoplast.. In: The Cassava Biotecnology Network, Proceedings of the First International Scientific Meeting. August 1992. Cartagena, Colombia., CIAT, Cali, Colombia
Calderon-Urrea, A. 1988. Transformation of Manihot esculenta (cassava) using Agrobacterium tumefaciens and expression of the introduced foreign genes in transformed cell lines. MSc. Thesis., Vrije Universiteit, Brussel, Belgium
Chavarriaga-Aguirre, P., Schopke, C., Sangare, A., Fauquet, C., Beachy, R.N. 1993. Transformation of cassava {Manihot esculenta Crantz) embryogénie tissues using Agrobacterium tumefaciens.. In: The Cassava Biotecnology Network, Proceedings o f the First International Scientific Meeting. August 1992. Cartagena, Colombia., CIAT, Cali, Colombia
Chen, C.Y., Wang, L., Winans, S.C. 1991. Characterization of the supervimlent vz>G gene of the Agrobacterium tumefaciens plasmid pTiBo542, Mol Gen Genet, 230, 302- 309
Cheng, I.-P., Poulton, J. 1993. Cloning of cDNA of Prunus serotonina (R)-(+)- mandelonitrile lyase and identification and a putative FAD-binding site.. Plant Cell Physiol., 34, 1139-1143
117 Chilton, M.D., Currier, T.C., Farrand, S.K., Bendich, A.J., Gordon, M.P., Nester, E.W. 1974. Agrobacterium tumefaciens DNA and PS8 bacteriophage DNA not detected in crown gall turners., PNAS, 71,3672-3676
Christou, P. 1996. Transformation technology. Nature Biotechnology, 14,423-430
CIAT 1993. Cassava the latest facts about an ancient crop., CIAT, Cali
Cock, J.H. 1982. Cassava: A basic energy source in the tropics. Science, 218, 755-762
Cock, J.H. 1985. Cassava: new potential for a neglected crop, Westfield Press, London
Conn, E. 1994. Cyanogenesis a personal perspective., Acta Hort., 375,31-43
Cooke, R., Coursey, D. 1981. Cassava: A major cyanide containing food crop.. In: Cyanide in Biology, Academic Press., London
De Bondt, A. Eggermont, K., Druart, P., De Vil M., Goderis, I., Vanderleyden, J. 1994. Agrobacterium-mQ(^dieà. transformation of apple: an assesment of factors affecting gene transfer during early transformation steps.. Plant Cell Reports, 13, 587-593
De Block, M., Botterman, J., Vandewile, M., Dockx, J., Thoen, C., Gossele, V., Rao, N., Thompson, C., Van Montagu, M., Leemans, J. 1987. Engineering herbicide resistance in plants by expression of a detoxifying enzyme, EMBO journal, 6,2513-2518
De Block, M., De Sonville, A., Debrouwer, D. 1995. The selection mechanism of phosphinothricin is influenced by the metabolic status of the tissue., Planta, 197, 619-626
De Block, M., Herrera-Estrella, L., Van Montagu, M., Schell, J., Zambrisky, P. 1984. Expresion of foreign genes in regenerated plants and their progeny, EMBO journal, 3, 1681-1689
Dellaporta, S.L.. Wood, J., Hicks, J.B. 1983. A plant DNA minipreparation: version H., Plant Molecular Biology Reporter., 1, 19-21
Essers, A., Witjes, C., Schurink, E., Nout, M. 1994. Role of fungi in cyanogens removal during solid substrate fermentation of cassava.. Biotec. Letters, 16, 755-758
Evans, D.A., Sharp, W.R., Flick, C.E. 1981. Growth and behavior of cell cultures: Embryogenesis and Organogenesis., In: Tissue Culture: Methods and Applications in Agriculture., Academic Press, New York
Finer, J.J., Vain, P., Jones, M.W., McMullen, M.D. 1992. Development of a particle inflow gun for delivery of DNA to plant cells. Plant Cell Reports, 11,323-328
118 Franche, C., Bogusz, D., Schopke, C., Fauquet, C., Beachy, R.N. 1991. Transient gene expression in cassava using hih-velocity microprojectiles. Plant Molecular Biology, 17, 493-498
Gamborg, O.L., Miller, R.A., Ojima, K. 1968. Nutrient requirement of suspension cultures of soybean and carrot cells., Exp. Cell. Res., 50,151-158
Gelvin, S B. 1992. Chemical signal hQtwten Agrobacterium and its plant host, In: Molecular signals in plant-microbe communications, CRC Press, Boca Raton, FI
Gheysen, G., Villaroel, R., Van Montagu, M. 1991. Illegitimate recombination in plants: a model for T-DNA integration.. Genes & Development, 5,287-297
Graybum, W.S., Vick, B. 1995. Transformation of sunflower following wounding with glass beads. Plant Cell Reports, 14,285-289
Guo-Hua, M., Hirel, B., Marsolier, M.C., Ridge, R.W. 1991. Ammonia-regulated expression of soybean gene encoding cytosolic glutamine synthetase in transgenic Lotus comiculatus.. Plant Cell, 3, 11-22
Hansen, G., Chilton, M. 1996. "Agrolistic" transformation of plant cells: Integration of T-strands generated in planta, PNAS, 93,14978-14983
Hasslacher, M., Schall, M., Hayn, M., Griengl, H., Kohlwein, S., Schawb, H. 1996. Molecular cloning of the full lenght cDNA of (S)-hydroxynitrile lyase from Hevea brasiliensis.. Journal Biology Chemistry, 271, 5884-5891
Hickel, A., Hasslacher, M., Herfried, G. 1996. Hydroxynitrile lyases: Functions and properties. Physio logia Plantarum, 98,891-898
Hooykaas, P.J.J., Beijersbergen, A G.M. 1994. The virulent system of Agrobacterium tumefaciens. Annual Review of Phytopatology, 32, 157-179
Horsch, R.B., Klee, H.J. 1986. Rapid assay of foreign gene expression in leaf discs transformed by Agrobacterium tumefaciens: role of the T-DNA in the transfer process., PNAS, 83,4428-4432
Hu, C.Y., Chee, P.P., Chesney, R.H., Zhou, J.H., Miller, P.D., O'Brien, W.T. 1990. Intrinsic GUS activity in seed plants.. Plant Cell Reports., 9,1-5
Hughes, B. White, F., Smith, M. 1979. Fate of bacterial plasmid DNA during uptake by barley and tobacco protoplast: II protection by poly-L-omithine, Plant Science Letters, 14, 303-306
119 Hughes, J., Carvahlo, F., Hughes, M. 1994. Purification, characterization and cloning of a-hydroxynitrile lyase from cassava {Manihot esculenta Crantz), Archives of Biochemistry and Biophysics, 311,496-502
Ishida, Y., Saito, H., Ohta, S., Hiei, Y., Komari, T., Kumashiro, T. 1996. High efficiency transformation o f maize (Zea mays L.) mediated hy Agroabacterium., Nature Biotechnology, 14, 745-750
Janssen, B.J., Gadner, R. 1989. Localized transient expression of GUS in leaf discs following cocultivation with Agrobacterium., Plant Molecular Biology, 14,61-72
Jefferson, R.A. 1987. Assaying chimeric genes in plants: the GUS gene fusion system. Plant Molecular Biology Reporter, 5, 387-405
Jennings, D.I. 1976. Cassava: Manihot esculenta (Euphorbiaceae), In: Evolution of crop plants., Longman, London
Kado, C.1.1992. Chromosomal and Ti plasmid-mediated regulation o f Agrobacterium virulence genes: Molecular intercomunication. In: Molecular Signals in Plant-Microbe Communications. CRC Press, Boca Raton, FI.
Kapila, J., De Rycke, R., Van Montagu, M., Angenon, G. 1997. An Agrobacterium- mediated transient expression system for intact leaves.. Plant Science, 122,101-108
Kartha, K.K., Gamborg, O.L., Constabel, F., Shyluk, J.P. 1974. Regeneration of cassava from shoot apical meristems. Plant Science Letters., 2,107-113
Klee, H., Horsch, R., Roger, S. 1987. Agrobacterium-modiated plant transformation and its further application to plant biology.. Annual Review of Plant Physiology., 38,467-486
Klein, T.M., Komstein, L., Sanford, J.C., Fromm, M.E. 1989. Genetic transformation of maize cells by particle bombardment., Plant Physiology, 91,440-494
Koch, B., Halkier, V.S., Isen, C.E., Moller, B.L. 1992. The biosynsthesis of cyanogenic glucosides in seedlings of cassava {Manihot esculenta Crantz), Arch. Biochem. Biophys., 292,141-150
Konan, N.K., Schopke, C., Carcamo, R., Beachy, R.N. 1997. An efficient mass propagation system for cassava {Manihot esculenta Crantz) base on nodal explants an axillary bud-derived meristems.. Plant Cell Reports, 16,444-449
Lessi, M., Lanka, E. 1994. Common mechanisms in bacterial conjugation and Ti- mediated T-DNA transfer to plant cells. Cell, 77,321-324
1 2 0 Li, H.- Q, Sautter, C., Potrykus, L, Puonti-Kaerlas, J. 1996. Genetic transforaiation of cassava {Manihot esculenta Crantz) Nature Biotechnology, 14, 736-740
Li, X-Q., Liu, C.-N., Ritchie, S.W., Peng, J.-Y., Gelvin, S. B., Hodges, T.K. 1992. Factors influencing /4grohactenMm-mediated transient expression of gusA in rice.. Plant Molecular Biology, 20,1037-1048
Li, X.Q., Liu, C.N., Ritchie, S.W., Peng, J.Y., Gelvin, S.B., Hodges, T.K. 1992. Factors influencing Agrobacterium-vaeàxsAjeà transient expression of gusA in rice.. Plant Mol. Biol., 20, 1037-1048
Litz, R.E., Jarret, R.L. 1991. Regeneracion de plantas en el cultivo de tejidos: Embriogenesis somatica y organogenesis. In: Cultivo de tejidos en la agricultura, fundamentos y aplicaciones., CIAT, Cali, Colombia
Liu, C.N., Li, X.- Q., Gelvin, S.B. 1992. Multiple copies of virG enhance the transient transformation of celery, carrot and rice tissues by Agrobacterium tumefaciens.. Plant Molecular Biology, 20, 1071-1087
Maniatis, T., Fritsch, E.F., Sambrook, J. 1982. Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York
McMahon, J., White, W., Sayre, R. 1995. Cyanogenesis in cassava {Manihot esculenta Crantz), Journal of Experimental Botany, 46, 731-741
Merkle, S.A., Parrot, W.A., Williams, E.G. 1990. Applications of soatic embryogenesis and embryo cloning.. In: Plant Tissue Culture: Applications and Limitations.,,
Millar, A.J., Short, S.R., Chua, N.- H., Kay, S.A. 1992. A novel circadian phenotype based on firefly luciferase expresion in transgenic plants. Plant Cell, 4, 1075-1087
Mkpong, O., Yan, H., Chism, G., Sayre, R.T. 1990. Purification, characterization and localization of linamarase in cassava.. Plant Physiology., 93,176-181
Mlingi, N., Poulter, N., Rosling, H. 1992. An outbreak of acute intoxications from consumption of insufficiently prcessed cassava in Tanzania., Nutrition Research., 12, 677-687
Moore, G.A., Jacono, C.C., Neidigh, J.L., Lawrence, S.D., Cline, K. 1992. Agrobacterium-va&dxdXcà transformatin of Citrus stem segments and regeneration of transgenic plants.. Plant Cell Reports, 11, 238-242
Murashige, T., Skoog, F. 1962. A revised medium for rapid growth and bioassays with tobacco tissue cultures.. Physiol. Plant., 15,473-479
121 Nambisan, B., Sundaresan, S. 1985. Effect of processing on the cyanoglucoside content of cassava., J. Sci. Food Agric., 36,1197-1203
Narstedt, A. 1985. Cyanogenic compounds as protecting agents for organisms.. Plant Systematics and Evolution., 150,35-47
Ni, M., Cui, D., Einstein, J., Narasimhulu, S., Vergara, G.E., Gelvin, S.B. 1995. Strength and tissue specificity of chimeric promoters derived from the octopine and mannopine synthase genes.. The Plant Journal, 7, 661-676
Norman, M., Pearson, Searle, P. 1995. The ecology of tropical food crops., Cambridge University Press, England
Onwueme, I.C. 1978. The tropical tuber crops., John Wiley and Sons., England
Osbourn, A. 1996. Preformed antimicrobial compounds and plant defense against fungal attack.. The Plant Cell, 8, 1821-1831
Ow, D.W., Wood, K.V., DeLuca M., Wet, J.R., Helinski, D.R., Howell, S.H. 1986. Transient and stable expression of the firefly luciferase gene in plant cells and transgenic plants.. Science, 234, 856-859
Pancoro, A., Hughes, M. 1992. In situ localization of cyanogenic P-glucosidase (linamarase) gene expression in leaves of cassava (Manihot esculenta Crantz) using non isotopic riboprobes.. The Plant Journal, 2, 821-827
Pavingerova, D., Briza, J., Kodytek, K., Nidermeirova, H 1997. Transformation of Rhododendron spp. using Agrobacterium tumefaciens with a GUS-intron chimeric gene.. Plant Science, 122, 165-171
Plegt, L., Bino, R.J. 1989. P-glucuronidase activity during development of the male gametophyte from transgenic and non-transgenic plants.. Mol. Gen. Genet., 216, 321-327
Poulton, J. 1990. Cyanogenesis in plants. Plant Physiology, 94,401405
Raemakers, C.J.J.M., Schavemaker, C.M., Jacobsen, E., Visser, R.G.F. 1993. Improvements of cyclic somatic embryogenesis of cassava (Manihot esculenta Crantz), Plant Cell Reports, 12, 226-229
Roca, W. 1984. Cassava, In: Handbook of Plant Cell Culture, MacMillan Publishing, New York
Rosling, H. 1986. Cassava cyanide, and epidemic spastic paraparesis, Acta Universitatis Upsaliensis., 19,1-52
1 2 2 Rosling, H. 1988. Cassava toxicity and food security., UNICEF, Geneva
Rosling, H. 1993. Cyanide exposure from linseed.. Lancet, 341,177.
Sarria, R., Gomez, A., Catano, M., Vidal, P., Calderon-Urrea, A., Mayer, I.E., Roca, W. 1993. Towards the development o f Agrobacterium tumefaciens and particle bombardment-mediated cassava transformation.. In: The Cassava Biotecnology Network, Proceedings of the First International Scientific Meeting. August 1992. Cartagena, Colombia., CIAT, Cali, Colombia
Schardl, C.L., Byrd, A.D., Benzion, G., Altschuler, M.A., Hildebrand, D.F., Hunt, A.G. 1987. Design and construction of a versatile system for the expression of foreign genes in plants.. Gene, 61,1-11
Schopke, C., Franche, C., Bogusz, D., Chavarriaga, P., Fauquet, C., Beachy, R.N. 1993. Transformation in cassava {Manihot esculenta Crantz), In: Biotechnology and Agriculture in Forestry, Springer-Verlag, Berlin
Schopke, C., Taylor, N., Carcamo, R., Konan, N.K., Marmey, P., Genshaw, G.G., Beachy, R.N., Fauquet, C. 1996. REgeneration of transgenic cassava plants {Manihot esculenta Crantz) from microbombardment embryogénie suspension culture.. Nature Biotechnoly, 14, 731-736
Selmar, D., Lieberei, Biehl, B., Conn, E. 1989. Hydroxynitrile lyase in Hevea brasiliensis and its significance for rapid cyanogensis., Physiologia Plantarum, 75, 97- 101
Sheng, J., Citovski, V. 1996. Agrobacterium-^XzmX cell DNA transport: Have virulence proteins will travel., The Plant Cell, 8, 1699-1710
Sofiari, E. 1996. Regeneration and transformation of cassava {Manihot esculenta Crantz), Wageningen Agricultural University, Netherlands
Stamp, J.A., Henshaw, G.G. 1982. Somatic embryogenesis in cassava., Z. Planzenphysiol., 105,183-187
Subramani, S., DeLuca, M. 1988. Applications of the firefly luciferase as a reporter gene.. In: Genetic Engenieering, Plenun Press, New York
Szabados, L., Hoyos, R., Roca, W. 1987. In-vitro somatic embryogenesis and plant regeneration of cassava. Plant Cell Reports, 6,248-251
123 % lylor, N., Edwards, M., Kieman, R., Davey, ' r '.ake,^ )96. Development of friable embryogénie c; , ai* i e /stems in cassava {Manihot esculenta Grant iti I' Terzi, M., Loschiavo, F. 1990. Somatic emt - niquin, J.P. 1979. Plant regeneration from it allu - ^ 1761-1763 g r j Tinland, B. 1996. The integration of T-Dh —tr iLji Science, 1, 178-184 ^
Tinland, B. Hohn, B. 1995. Recombinatic * ce:' «u Integration of Agrobacterium tumefaciens ' A i o i ^ Engineering, Plenun Press, New York ^
Tinland, B., Hohn, B., Puchta, H. 1994. stranded transferred DNA (T-DNA) into . 'xznt c.li
Tor, M., Mantell, S.H., Ainsworth, C. 1' - .. Endi phyt glucuronidase cause false positives in tr * t?
Torbert, K., Rines, H., Somers. 1995. v d n:c-J transformation. Plant Cell Reports, 14, ■ i X
Tylleskar, T., Banea, M., Bikangi, N., ^ kc 7 . _ ^ Cassava cyanogens and konzo, an upy • t^ ku Lancet, 339,208-211 % f Vancanneyt, G., Schmidt, R., O'Con 'a .c ' % ^ ^ 1990. Construction of an intron-coni " ; • - -nd*:. - transgenic plants and its use in mon a ar • ev,,»-; transformation.. Mol. Gen. Genet., ' 7 r - ' :C
Wajant, H., Mundry, K.- W., Pfizei ■ jer, '. v '- lyase from Sorghum bicolor L. Hoi • ' ^ ji ' > se' »;>• Biology, 26, 735-746
Walkerpeach, C., Velten, J. 1994 \ \ic.t ur^ cointegrate and binary vector syst -, ’L Academic Publishers., Belgium
L Taylor, N., Edwards, M., Kieman, R., Davey, C.D.M., Blakesley, D., Henshaw, G.G. 1996. Development of finable embryogénie callus and embryogénie suspension culture systems in cassava (Manihot esculenta Crantz., Nature Biotechnology, 14, 726-730
Terzi, M., Loschiavo, F. 1990. Somatic embryogenesis. In: Plant Tissue Culture,,
Tilquin, J.P. 1979. Plant regeneration from stem callus of cassava.. Can. J. Bot., 57, 1761-1763
Tinland, B. 1996. The integration of T-DNA into plant genomes. Trends in Plant Science, 1,178-184
Tinland, B. Hohn, B. 1995. Recombination between prokaryotic and eukaryotic DNA: Integration of Agrobacterium tumefaciens T-DNA into the plant genome.. In: Genetic Engineering, Plenun Press, New York
Tinland, B., Hohn, B., Puchta, H. 1994. Agrobacterium tumefaciens transfers single stranded transferred DNA (T-DNA) into the plant cell nucleus, PNAS, 91, 8000-8004
Tor, M., Mantell, S.H., Ainsworth, C. 1992. Endophytic bacteria expressing (3- glucuronidase cause false positives in transformation of Dioscorea species.. Plant Cells Reports, 11, 452-456
Torbert, K., Rines, H., Somers. 1995. Use of paromomycin as a selective agent for oat transformation. Plant Cell Reports, 14, 635-640
Tylleskar, T., Banea, M., Bikangi, N., Cooke, R.D., Poulter, N.H., Rosling, H. 1992. Cassava cyanogens and konzo, an upper motoneuron disease found in Afiica., The Lancet, 339, 208-211
Vancanneyt, G., Schmidt, R., O'Connor-Sanchez, A , Willmitzer, L., Rocha-Sosa, M. 1990. Construction of an intron-containing marker gene: Splicing of the intron in transgenic plants and its use in monitoring early events in Agrobacterium-mcdxsità. plant transformation.. Mol. Gen. Genet., 220, 245-250
Wajant, H., Mundry, K.- W., Pfizenmaier, K. 1994. Molecular cloning of hydroxynitrile lyase fi-om Sorghum bicolor L. Homologies to serine carboxypeptidases.. Plant Molecular Biology, 26, 735-746
Walkerpeach, C., Velten, J. 1994. Agrobacterium-rnQf^aXod gene transfer to plant cells: cointegrate and binary vector systems.. In: Plant Molecular Biology Manual., Kluwer Academic Publishers., Belgium
124 Wang, Y.- C., Klein, T.M., Fromm, M., Cao, J., Sanford, J.C., Wu, R. 1988. Transient expression of foreing genes in rice, wheat and soybean cells following particle bombardment.. Plant Molecular Biology, 11,433-439
Weising, K., Schell, J., Kahl, G. 1988. Foreing genes in plants: transfer, structure, expression and applications.. Annual Review of Genetics, 22,421-477
White, W.L.B., McMahon, J.M., Sayre, R.T. 1994. Regulation of cyanogenesis in cassava., Acta Hort., 375, 69-78
Winans, S.C. 1992. Interactions hQtwQoa. Agrobacterium tumefaciens and its host plant cells. In: Plant Gene Research, genes involved in plant defense. Springer-Verlag, Berlin
Zambryski, P. 1988. Basic processes imderlying Agrobacterium-mediai'&é DNA transfer to plant cells.. Annual Review o f Genetics, 22,1-30
Zambryski, P.C. 1992. Chronicles from \he Agrobacterium-VXsni cell DNA transfer story. Annual Review Plant Physiology and Plant Molecular Biology, 43,465-490
Zupan, J.R., Zambryski. P. 1995. Transfer of T-DNA from Agrobacterium to the plant cell. Plant Physiology, 107,1041-1047
125