Molecular Analysis of Hprt Gene Mutations in Skin Fibroblasts of Rats Exposed in Vivo to N-Methyl-N-Nitrosourea Or N-Ethyl-N-Nitrosourea'

ICANCER RESEARCH54, 2478-2485, May 1, 19941 Molecular Analysis of hprt Gene Mutations in Skin Fibroblasts of Rats Exposed in Vivo to N-Methyl-N-nitrosourea or N-Ethyl-N-nitrosourea'

Jacob G. Jansen,2 George it Mohn, Harry Vrieling, Come M. M. van Teijlingen, Paul H. M. Lohman, and Albert A. van Zeeland MGC-Department ofRadiation Genetics and Chemical Mutagenesis, State University ofLeiden, Wassenaarseweg 72, 2333 AL Leiden (J. G. J., H. V., C. M. M. v. T., P. H. M. L, A. A. v. Z.J; Laboratory of Carcinogenesis and Mutagenesis, National Institute of Public Health and Environmental Protection, Bilthoven [C. R. M.]; and J. A. Cohen Institute, Interuniversity Research Institute for Radiopathology and Radiation Protection, Leiden (H. V., A. A. v. Z.J, the Netherlands

ABSTRACT apart from 06-guanine alkylation, MNU methylates preferentially the N-7 position of guanine and at a lower frequency the N-3 The granuloma pouch assay in the rat is a model system in which position of adenine, while ENU alkylates mostly phosphodiesters; relative frequencies of genetic and (pro-) neoplastic changes induced in vivo by carcinogenic agents can be determined within the same target and at lower frequencies the @2position of thymine and the N-7 tissue. The target is granuloma pouch tissue and consists of a population position of guanine. Ethylation by ENU at the N-3 position of of (transient) proliferating fibroblasts which can be cultured in vitro.hprt adenine, the 0â€• position of thymine, and the @2position of gene mutations were studied in granuloma pouch tissue of rats treated cytosine occurs at much lower frequencies. It is believed that with single doses of direct acting alkylating agents N-methyl-N-nitro alkylation at oxygen residues of DNA bases results in mutagenic mum (MNU) or N-ethyl-N-nitrosourea (ENU). Both agents showed an events while N-alkylation leads to cytotoxic lesions (6). exposure-dependent increase in the hprt mutant frequency. Thirty-seven Most of the mutational spectra generated by MNU or ENU in MNU (60 mgfkg)- and 43 ENU (100 mgfkgJ-induced hprt mutant cell clones were analyzed at the molecular level. Twenty-two MNU-induced Escherichia coli, in yeast, and in vitro in eukaryotic cells show that and 36 ENU-induced mutants carried a single base pair change in exon the predominant base pair alterations induced by these mutagens are sequences ofthe hprt gene. The predominant base pair alterations induced GC to AT transitions (7â€”12).In carcinogenicity studies, MNU was by MNU were GC to AT transitions (18 of22), which are probably caused shown to induce various types of tumors in rats and mice, which by O'-methylguanine lesions. For most of the GC to AT transitions (16 of contained activated ras oncogenes with mutations predominantly at 18), the G was located in the nontranscribed strand, suggestinga strand codons 12 and 13 (GC to AT transitions) and to a minor extent at bias in the repair of O'-methylguanine lesions. ENU-induced mutations occurred predominantly at AT base pairs (28 of 36), beIng mostly AT to codon 61 (AT to TA transversions) (3, 13â€”15).These types of muta TA and AT to CG transversions, and are probably caused by O@-ethyI tions in tumors were similar to those observed after MNU exposure in thymidine. Also here, DNA repair processes seem to act with different in vitro mutation assays. However, ENU showed a different picture. rates/efficiencies on DNA adducts in the 2 strands of the hprt gene, since Rats exposed transplacentally to ENU developed neuroblastomas all the 24 transversions observed at AT base pairs had the thymidine which contained the neu oncogene activated by mutations predomi residue in the nontranscribed strand. GC to AT transitions were only nantly at AT base pairs (16). Furthermore, it was shown that the present at a low frequency among ENU-induced mutations, suggesting development of lung tumors in mice upon exposure to ENU was that O@-ethylguaninelesions were repaired efficiently before mutations were fixed during replication. The mutational spectra of MNU- and accompanied by the activation of ras protooncogenes as a result of ENU-induced hprt mutant clones were different from spontaneously oc mutations mostly at the AT base pair in codon 61 (17). These results curling hprt mutant clones. These results indicate that MNU and ENU indicate that ENU induces a quite different pattern of gene mutations induce different mutational spectra in vivo and that DNA repair systems in vivo than in vitro. remove O'-methylguanlne, (Y, and/or O@-ethylthymldinemuch faster Several studies show that mutational spectra generated by in vitro from the transcribed strand than the nontranscribed strand of the hprt assays may not always be representative for the in vivo situation. gene in these rat fibroblasts. Recently, spectra of mutations induced by MNU or ENU in Drosoph ila melanogaster, rodents, and monkeys have been reported and clear INTRODUCTION differences were seen when these spectra were compared with in vitro The monofunctional alkylating agent MNU3 and its ethyl ana results (18â€”21).These studies indicated that less frequent lesions such logue ENU have been studied extensively with regard to their as O@-and 04-ethylthymine are important mutagenic lesions induced DNA-alkylating properties. Both compounds react with DNA in by ENU in vivo, since mutations at AT base pair were found at high vitro and in vivo at more than 12 different nucleophilic sites (1). frequencies. Among other adducts, MNU and ENU alkylate the @6position of An assay allowing the direct comparison of short term effects (e.g., guanine, which is an important premutagenic and precarcinogenic gene mutations) and long term effects (fibrosarcomas) within the event (2, 3) giving rise to GC to AT transitions, with relative high same target tissue is the granuloma pouch assay (22). The target tissue efficiencies (2, 4, 5). However, the proportions of the various DNA consists of skin fibroblasts which proliferation is induced by injecting adducts induced by these compounds show marked differences: sterile air s.c. into the backs of young adult male rats. Shortly after mutagen exposure of the rats, skin fibroblasts can be isolated from the Received 12/13/93; accepted 3/3/94. pouch and subcultured in vitro for the analysis of different genetic end Thecostsof publicationofthisarticleweredefrayedinpartby thepaymentofpage points, including gene mutations at the hprt locus (23). Mutations in charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. the coding sequence of the rat hprt gene can be analyzed at the 1 Parts of these studies were supported by grants from the Commission of the European molecular level, since the hprt cDNA from the rat has been cloned and Communities Environmental Programme (Contracts EV4V-0047-NL and EV5V-CT'91- its nucleotide sequence determined (24â€”26).In this paper, the induc 0012) and from the Dutch Cancer Society (Project IKW-89.14). 2 To whom requests for reprints should be addressed. tion of mutations in skin fibroblasts of rats following exposure in vivo 3 The abbreviations used are: MNU, N-methyl-N-nitrosourea; ENU, N-ethyl-N-nitro to MNU or ENU is presented. In addition to comparative hprt mu sourea; hprt, hypoxanthine-guanine phosphoribosyltransferase; eDNA, complementary DNA; PCR, polymerasechain reaction;AGT, alkylguanine-DNAalkyltransferase; tagenesis studies, this study reports the molecular analysis of 37 MNNG, N-methyl-N'-nitro-N-nitrosoguanidine. MNU- and 43 ENU-induced hprt mutant cell clones. 2478

vivoCompoundTreatment Table 1 hprt mutant frequencies induced byMNU or ENU in rat skin fibroblasts in of of cells no. of clone-forming of animals isolated cells tested for 6@TGr frequency 10_6)ENU0 mg/kg mmol/kgModeadministrationaNo. testedNo. (X 10@)CEb (%)Total mutants X106Ã§@C (%)Mutant (x 10_6)Range(X Â±4.0â€• Â±15 Â±6.7 30 0.256 4 7.5 7.2 Â±4.6 2.3 29 Â±3 49 Â±17 27â€”69 60 0.512 i.p. 6 12.1 7.6 Â±5.3 3.2 24 Â±10 103 Â±51 48â€”167 80 0.680 i.p. 3 3.9 7.6 Â±2.4 2.9 39 Â±5 109 Â±70 68â€”190 100 0.854 i.p. 4 9.9 6.9 Â±4.1 1.6 24 Â±4 135 Â±71 64â€”232 160 1.366 i.p. 6 7.2 8.9 Â±4.6 2.9 23 Â±8 206 Â±61 152â€”319 153â€”447MNU6.52500 2.135i.p. i.p.15 629.0 9.311.7 7.4 Â±4.511.1 2.930 24 Â±107.1 284 Â±1171.5â€”25

Â±5.1 Â±10 Â±2 15 0.146 i.p. 2 3.6 7.6 1.2 31 113 109â€”116 30 0.291 i.p. 9 15.4 12.3 Â±4.9 7.3 35 Â±9 126 Â±53 45â€”223 45 0.438 i.p. 2 4.1 7.8 1.6 40 194 177â€”210 51â€”430MNU6.5600.063 0.582i.p. i.p.3 86.0 13.216.2 9.3 Â±4.42.6 6.532 36 Â±148 262 Â±1316.1â€”10

Â±3.0 Â±7 Â±37 13 0.126 p.o. 4 6.8 7.2 Â±3.1 3.3 31 Â±14 68 Â±61 3â€”146 30 0.291 p.o. 4 8.8 6.5 Â±3.4 2.3 22 Â±16 102 Â±99 27â€”244 600.063 0.582p.o. p.o.6 611.9 9.710.1 4.5 Â±2.47.8 5.844 33 Â±650 168 Â±13012â€”12097â€”433 @ a chemical administered in air pouch; 6@TGr, 6-thioguanine-resistant. b Cloning efficiency (CE) of pouch cells directly after isolation. CCloning efficiency of cells used for 6-TG selection. dMean Â±SD.

MATERIALS AND METhODS 94-ruin dish) and incubated for 12â€”14days at 37Â°Cunder 10% CO2. Next, 6-thioguanine resistant clones were isolated and cultured in selective medium. Animals. Random-bred albino male Wistar RIV:TOX rats (National Insti Molecular Characterization of 6-Thioguanine-resistant Clones. MNU tate of Public Health and Environmental Protection, Bilthoven, the Nether induced and spontaneously occurring hprt mutant clones were expanded up to lands), weighing 220â€”280g, were used for the induction of a granuloma pouch 10â€”12 X 106 cells. Isolation of total cytoplasmic RNA, eDNA synthesis of rat and recovery of fibroblast cells. hprt mRNA and in vitro amplification of the cDNA was performed as de Pouch Introduction and Chemical Exposure. Air pouches were intro scribed earlier (26). ENU-induced hprt mutant cells were expanded up to duced by injecting s.c. 25 ml ofsterile air into the midpoint of the scapular area approximately 10@cells, a part of which was used for RNA isolation and on the back of the rats. Forty-eight h thereafter, the animals were given single eDNA synthesis essentiallly according to the method of Yang et aL (28). doses of MNU (up to 60 mg/kg) or ENU (up to 250 mg/kg). The chemicals Briefly, 3000 cells were washed twice with 300 gd phosphate-buffered saline. were dissolved in phosphate buffer (pH 6.0) (27) and injected either locally in Each time, the cells were centrifuged for 5 mm at 1500 rpm in an Eppendorf the air pouch or i.p. Forty-eight h later, the fibroblastic pouch cells were centrifuge. The cell pellet was resuspended in a buffer containing 50 mM recovered and subcultured in vitro for hprt mutant frequency determination. Tris-HC1(pH 8.55), 75 mM KC1,3 mM MgC12,2.5% Nonidet P-40, 10 mM Pouch Cell Recovery. Granulomapouch tissue was removed from the 1,4-dithiothreitol, 20 pmol oligonucleotide ratllMl3, 2 units avian myeloblas skin, kept in 1 ml of phosphate-buffered saline (jH 7.4; 4Â°C),and dissected tosis virus reverse transcriptase (Promega), 0.5 m@i concentrations each of into small pieces. These pieces were treated 3 times with a 0.25% trypsin deoxynucleotide triphosphates (Pharmacia), and 15 units RNase inhibitor 0.02% EDTA solution. Each time, 10 ml trypsine-EDTA solution (37Â°C)were (RNAguard; Pharmacia). The mixture was incubated for 1 h at 37Â°C and 10 added and the suspension was incubated with gentle stirring for 20 mm at ruin at 90Â°C,respectively. eDNA (2.5 pJ) was used as template in standard 37Â°C.Afterthe incubation, the cells were collected and resuspended in 10 ml PCR reactions (35 cycles). PCR products were separatedby agarose gel of culture medium (Dulbecco's modified essential medium supplemented with electrophoresis using a 1% Nusieve GTG agarose gel (Biozym). Isolation of 10% fetal calf serum and antibiotics) at 4Â°C.Then the suspensions were the PCR products from Nusieve agarose, binding of the biotinylated PCR filtered through a filter (NBPI; Emmer-Compascuum, the Netherlands) and products to magnetic Dynabeads, and subsequent DNA sequence analysis was centrifuged for 10 mm at 1000 rpm (Sorvall GLC-2B; DuPont Instruments). performed as described (29). Subsequently, cell pellets were resuspended in 30 ml culture medium and the number of cells per ml was determined (Coulter Counter). RESULTS 6-Tbioguanine Selection for Mutant Frequencies. Three 94-mm dishes, each containing 1000 cells plus 10@autologous feeder cells in culture medium, MNU- and ENU-induced hprt Mutant Frequencies in Rat were incubated for 8â€”10days(37Â°C,10% CO@)in order to determine the Fibroblasts in Vivo. Young adult male rats, containing a 2-day-old clone-forming ability of the cells. Feeder cells were prepared by irradiating air pouch, were exposed to a single dose of MNU or ENU. MNU was fibroblasts from untreated rats with 60 Gy X-rays. The remaining target cells were cultured in culture medium for 7 days at 37Â°Cunder10% CO2.Then the administered either i.p. or directly into the pouch, in order to study the cells were trypsinized and reseeded in 25 dishes (10@cells/94-mm dish) effect of local or systemic exposure on the hprt mutant frequency in containing selection medium (Dulbecco's modified essential medium supple the target cell population. ENU was administered i.p. only. Two days mented with 15% newborn calf serum, antibiotics, and 6-thioguanine (2 after administration of the chemicals, skin fibroblasts were isolated @g/ml)).The6-thioguanine-resistant clones were stained and counted after and cultured in vitro for the determination of the hprt mutant fre 11â€”14daysof incubationat37Â°Cunder10%CO2.Also 500 cells were seeded quency (Table 1). An exposure-dependent increase in hprt mutant in triplicate in 94-mm dishes containing nonselective culture medium and 10@ frequency was found after exposure to ENU as well as MNU (Fig. 1). feeder cells/dish for determination of the cloning efficiency. hprt mutant Only a small difference in hprt mutant frequency was observed when frequencies were expressed as the number of 6-thioguanine-resistant clones/ different modes of administration of MNU were used. However, a 106 clone-forming cells. comparison of the mode of administration of MNU and the cloning Isolation of Independently Induced, 6-Thioguanine-resistant Mutants. Granuloma pouch tissue was divided into 3â€”5segments and cells were isolated efficiency directly after isolation of the cells (which reflects the from each segment separately. Fibroblastic cells were cultured in vitro in cytotoxic/cytostatic effect of the test chemical) showed that MNU was nonselective medium as described above. After 7 days, cells from each significantly more cytotoxic for pouch skin fibroblasts when admin segment were seeded in 10 dishes containing selection medium (10@cells/ istered locally than i.p. while the induced hprt mutant frequency was 2479

transversions (17 of 28), but also AT to CG (7) and AT to GC base 400 substitutions (4) were found. Aberrant splicing ofthe hprt mRNA was found noted in 7 of 43 mutants (16%). A very strong strand bias for transversions at AT base pairs was observed in all 24 mutants of this I type the mutated thymidine was located in the nontranscnbed strand of the gene. a. 0

C DISCUSSION

E In vivo exposure of rat skin fibroblasts to the monofunctional t alkylating agents MNU and ENU caused a dose-dependent increase in 0. I hprt mutant frequency. MNU appeared to be a slightly more potent 0 mutagen than ENU when compared at equal exposure levels. This 0.00 0.63 1.25 1.88 2.50 higher mutagenic potential of MNU could not be predicted on fore hand since, in contrast to ENU which can be considered as an Dose( mmol/kg) O-alkylating agent, MNU alkylates mostly nitrogen atoms in the DNA (1). N-Alkylated purines are expected to be mainly involved in block Fig. 1. Effect of exposure level of alkylating agent on the hprt mutant frequency in rat ing DNA replication (30) and in the formation of chromosomal skin tibroblasts in vivo. Rats containing an air pouch were exposed to a single dose of MNU administered directly into the air pouch (S), MNU administered i.p. (0), or ENU aberrations, rather than gene mutations (6). In contrast to N-alkylated administered i.p. (A). Bars, SEM. Two days after treatment, the skin fibroblasts were purifies, several of the O-alkylated bases were shown to have mis isolated and cultured in vitro for 7 days. Then the cells were plated in 6-thioguanine to determine the number of hprt mutants. In parallel, a small number of cells were plated in coding properties. Furthermore, 06-ethylguanine lesions are less ef nonselective medium for determination of the cloning efficiency. hprt mutant frequencies ficiently repaired by AGT than by 06-methylguanine lesions (31). were determined as the number of 6-thioguanine-resistant elones/106clone-forming cells. However, the overall reactivity of MNU toward nucleophilic centra in the DNA is much higher than that of ENU (32) and recent studies on the levels of 06-alkyl- and 7-alkylguanine in DNA of granuloma similar upon either way of administration (Student's t test, P < 0.05). pouch skin fibroblasts of rats exposed in vivo to MNU or ENU The results also demonstrate a tendency, although statistically not showed that the absolute frequency of DNA adducts introduced by significant, that MNU is a more potent inducer of hprt mutations than MNU was much higher than for ENU when compared on the basis of ENU at equimolar exposure levels. exposure level (33). Furthermore, it was shown that the frequency of Mutational Spectra of hprt Mutants Induced by MNU in Rat 06-methylguanine upon MNU exposure at 60 mgfkg remained rela Fibroblasts in Vivo. Two different groups of MNU-induced hprt tively high with time and was associated with a slow recovery of AGT mutants were analyzed at the molecular level. The two groups activity, resulting in a high level of unrepaired 06-methylguanine consisted of 18 and 19 independently induced hprt mutants, iso which can contribute in mutation induction. In the case of ENU, lated from pouch tissue after local (MNUpo) and i.p. (MNUip) 06-ethylguanine was detected at very low frequencies and AGT administration of a single dose of 60 mg MNU/kg, respectively. activity was quickly recovered, suggesting a low contribution of this The results are listed in Table 2 and summarized in Table 4. lesion in ENU-induced mutagenesis (33). The chemically induced Apparently, no major differences in the kinds of mutations are hprt gene mutations in skin fibroblasts of rats in the granuloma pouch detected when the spectra of both groups are compared. A single assay most likely reflect mutagenesis in vivo, since (a) 41% of the base pair substitution in the hprt cDNA sequence was found in skin fibroblasts were shown to replicate DNA in vivo at the time of approximately 50 and 70% of the hprt mutants induced by local or chemical treatment and (b) the percentage of skin fibroblasts in the i.p. treatment with MNU, respectively. GC to AT transitions dom granuloma pouch tissue was shown to increase from 25% to 65% mated among the base pair changes found: 7 of 9 for MNUpo hprt between 1 and 4 days after introduction of the air pouch (34). mutants and 11 of 13 for MNUip hprt mutants. Deletions and However, the in vivo half-lives of 0- and N-alkylated bases can be insertions of DNA sequences in the coding sequence of in vitro several days (1, 33, 35) indicating that fixation of mutations due to amplified hprt cDNA were found in 8 MNUpo and 6 MNUip hprt persistent DNA adducts in cells replicating in vitro cannot be mutants. These alterations probably reflect misspliced hprt excluded. mRNAs, since in most cases complete exons were deleted from The mutational spectra of MNU- and ENU-induced mutations at cDNA. Deletion of exon 7 from cDNA was found in 4 of 7 MNUpo the hprt gene of rat skin fibroblasts in vivo show that MNU induced hprt splice mutants. When the mutation spectra of both groups are predominantly GC to AT transitions, while ENU induced mostly combined into 1 spectrum, 5 of the 37 MNU induced hprt mutants mutations at AT base pairs. GC to AT transitions were shown to be contained GC to AT transitions at position 419 in the coding induced by 06-methylguanine and 06-ethylguanine adducts in pro region. Futhermore, in 89% (16 of 18) of the GC to AT transitions karyotic and eukaryotic cells (4, 5, 36) probably through mispairing of the mutated guanine was located in the nontranscribed strand. In 14 06-alkylguanine with thymidine during DNA replication. The spec of 18 GC to AT transitions, this guanine was flanked at the 5' site trum of MNU-induced mutations in the hprt gene of the rat in vivo is by a purine. very similar to the spectra of MNU-induced mutations in the hprt gene Mutational Spectrum of hprt Mutants Induced by ENU in Rat of hamster V79 cells (12), in the lad or the gpt gene in E. coli (7, 8), Fibroblasts in Vivo. Forty-three independently induced hprt mutants and in the URA3 gene in yeast (10). Furthermore, the spectrum of were isolated from pouch tissue after a single dose of ENU (100 MNU-induced mutations in the hprt gene of rats correlates very well mg/kg i.p.) and analyzed at the molecular level. The result of this with the kind of mutations found in activated ras oncogenes in DNA analysis is shown in Table 3 and summarized in Table 4. GC to AT from tumors in rodents treated with MNU (3, 13â€”15).The MNU transitions were present only at a low frequency (5 of 43), whereas 28 induced mutational spectra in the different species are probably so of the 43 mutants (66%) were found to contain mutations at AT base alike because only very low amounts of important mutagenic lesions pairs. These alterations at AT base pairs consisted mostly of AT to TA other than 06-methylguanine adducts are present in the DNA adduct 2480

Tablei.p.MNUCPositionâ€•MutationStrands'Target 2 Mutationalspectrum of hprt gene mutations occurringin skin fibroblastsof rats exposed in vivo to MNU(60 mg/kg) administereddirectly inthe pouchor

sequence acid @ changep.o.i.p.Transitions3GC > 3@Amino

lie2074GC > ATNThTCAT(G)TCGAMet > LeuI01 > ATTSATAC(C)TAATPro > Glu02134GC19GC > ATNmCTAG(G)ACTGGly > Lys01209GC > ATNmGACA(G)GAC1'Mg > Glu02212GC > ATNi'SAAGG(G)GGGCGly > Asp01285GC > ATNTSGGGG(G)CTATGly > IleI0419GC > ATNi'SCTAT(G)ACTGMet > Asp23425GC > ATNmACFG(G)TAAAGly > lie01539GC > ATTSAAAA(C)AATGThr > Glu01569GC > ATNi'SGTTG(G)A1TFGly > Glu10170AT > ATNTSGTI'G(G)ATATGly > Thi01Transversions196AT > OCGAGA(T)GGGAMet >

SerI0409AT > TACCTC(T)GTGTCys > PheI0610Oc > TATATA(A)TI'GAIle > Mn01Splice>TATSGAAT(C)ATGTHis >

@ Cryptic splice intron 1d 19 base pairs intron 1 Exon2 0 1 Exon4 I 1 Cryptic splice 0 1 intron 5e Exon6 1 0 Exon7 4 0 Cryptic splice exon 8/ â€”21 1 0 base pairs exon 8 Cryptic splice2Others exon 9,5 18 01 base pairs exon 90

208â€”212 Frame-shift â€”1 GGGG(G)CFAT 10I0 No PCR product a Position 1 is the first base of the start codon in the hprt coding sequence. b Strand containing the putative mutagenic lesion 06-methylguanine; TS, transcribed strand; NTS, nontranscribed strand. @ Number of mutants found: p.o., MNU administered directly in the pouch. 5' . . . GTCGTG/atgagccagggggactccg ATFAGT . . .3' Exon 1 Exon 2 Sequence in italics is incorporated in eDNA. Nueleotide in boldface is presumably the result of a G to A transition in the invariant GT splice donor site. 5' . . . lTGAAlataagttctacatttacttttgatatactgtttacagttttctaaattg GATATAA . . .3' Exon 5 Exon 6 I 5' . . . AGACI7rfGUGGA@GAAAUCCAGACAAG1TrGT . . .3' Exon 7 Splice Exon 8 Sequence underlined is deleted in eDNA. g 5' . . . TGAAT/CATG1TrGTGTCATCAGCGAAAGT . . .3' Exon 8 Splice Exon 9

spectrum after MNU exposure (1). Thus, even after extensive repair of In contrast to the MNU spectrum, the spectrum of ENU-induced 06-methylguanine lesions, the 06-methylguanine adducts remaining mutations in vivo at the hprt gene of rat fibroblasts is not dominated still stay the major cause of MNU-induced mutations. Mutations at by GC to AT transitions. Therefore, the 06-ethylguanine adduct, AT base pairs can in principle be caused by either adenine or thymine considered to be the most important mutagenic lesion induced by adducts. In the case of MNU, the frequency of O@-and Oâ€•-methyl ENU in E. coli, Saccharomyces cerevisiae, and D. melanogaster (7,8, thymine is low or not detectable (1) and are not expected to contribute 10, 18), is probably efficiently repaired by AGT in rat skin fibroblasts significantly in MNU-induced mutagenesis unless most of the O6@ in vivo. Because of efficient repair of 06-ethylguanine adducts, other methylguanine is efficiently repaired. Then, O'@-methylthymine is O-alkylated lesions like O@-ethyl- and 04-ethylthymidine become probably a good candidate, since this adduct is detectable in DNA important in the induction of mutations. 04-Ethyl- and O@-ethylthy alkylated in vivo by MNU (1) and a mutagenic lesion in vivo (37). midine lesions in DNA are very slowly repaired (35, 44, 45) and can Another possibility is the formation of apunnic sites derived from induce AT to GC and AT to TA alterations due to misincorporation of N-3-methyladenine, which is introduced at relatively high frequen nucleotides opposite the lesion during DNA replication (46â€”49).Also cies, either by chemical instability of the adducted base (Ref. 1 and N-3-ethylthymidine lesions have been shown to induce AT to TA references therein) or the action of N-3-methyladenine-DNA glyco transversions (50). The mutational spectrum detected in vivo in rats sylases present in rat cells (38). Apurinic sites have been shown to exposed to ENU is very similar to the ones observed in the hprt gene blockDNAsynthesis(39)andleadto transversion-typemutations in T-lymphocytes of mice and monkeys exposed in vivo to ENU (20, during DNA replication (40â€”43). 21) and in an excision repair and AGT proficient human lymphoblas 2481

Tableratfibroblasts 3 Mutational spectrum of ENU-induced mutations in the hprt gene of differences between the spectra of the chemically induced and spon isolated from animals exposedmg/kg)Target in vivo to ENU (100 taneously occurring hprt mutant skin fibroblasts from the rat suggest ENUPosition sequence Amino acid that most of the induced hprt mutants were the result of chemical i.p.Transitions145 Mutation Stranda 5@> 3@ change exposure in vivo of the target cells. A striking observation in the MNU- and ENU-induced mutational spectra as described in the present study is the distribution of the 1425 GC > AT AAGA(C)TFOC Leu > Phe 1551 OC > AT AAAA(C)AATG Thr > He putative mutagenic lesions among the strands of the target gene. For 1568 GC > AT ATI'C(C)AGAC Pro > Leu MNU-induced mutations, mutagenic 06-methylguanine adducts were 1628 GC > AT TGTF(G)GATA Gly > Arg located mostly (89%) at the nontranscribed strand of the gene, which 1140 GC > AT CAGC(G)AAAG Glu > Lys 1401 AT > GC TS ACFG(A)AAGA Glu > Gly cannot be explained solely by the observed bias towards the nontran 1491 AT > GC TS GTTG(A)AGAT Glu > Gly scribed strand for mutable 0 residues in mammalian hprt genes (60%) I530 AT > GC Ni'S rFGC(T)GGTG Leu > Pro (26). Mutable G residues are those guanines in the coding region of 1Transversions2AT > GC TS CCAG(A)C1TF Asp > Gly the hprt gene where a mutation has been identified earlier in a large set of mutants induced by a variety of agents. This result suggest that 123 AT > TA Ni'S GTCA(T)GTCG Met > Lys in the rat skin fibroblasts in vivo 06-methylguanine lesions are pref 282 AT > TA NTS AGCG(T)CGTC Val > Asp 184 AT > TA N@I'S TCAT(T)ATGC Tyr > Asn erentially repaired from the transcribed strand of the gene, possibly by 295 AT > TA NTS ATFA(T)GCFG Tyr > stop the action of AGT. A strand bias of mutagenic 06-methylguanine 1104 AT > TA N@1'S GATF(T)GGAA Leu > stop lesions toward the nontranscribed strand was also noted in in vitro 1245 AT > TA NTS AAGG(T)G1TF Val > Glu 1284 AT > TA NTS TACAIF)TAAA lie > Mn studies using V79 Chinese hamster and human cells exposed to MNU 1318 AT > TA NTS CCrA@GATC Met > Lys or MNNG (12, 54). Since V79 cells are AGT deficient, the strand bias 1398 AT > TA Ni'S ACFG('I)AATG Cys > stop in mutation induction could also be the result of strand-specific action 1407 AT > TA NTh ATFG(I')TGAA Va! > Asp 2428 AT > TA Ni'S GATA(T)AATF Ile > Lys of nucleotide excision repair on 06-methylguanine residues. How 1491 AT > TA NTS ACAA(T)GCAG Met > Lys ever, no strand bias was found for MNNG-induced mutations in 1563 AT > TA NTS TFGC(T)GGTG Leu > Gln AGT-proficient and -deficient human fibroblasts (53), suggesting that 162 AT > TA NTh 1T1'G(T)TGU Val > Asp 2233 AT > CG NTh GATT(T)A1TF Lcu > stop strand-specific repair of 06-methylguanine lesions was absent under 1395 AT > CO NTS GACC(T)GCFG Leu > Arg those conditions. Data concerning repair of alkali-labile alkylation 1428 AT > CG NTh TFGA(T)TGTF lie > Ser 1532 AT > CO NTS ACAA(T)GCAO Met > Arg damage in DNA of eukaryotic cells indicate that actively transcribed 1571 AT > CO NTS AOAC('I)TTGT Phe > Val genes are repaired more efficiently than inactive genes for these 15 AT > CO NTS TGGA(T)ATOC Tyr > Asp lesions (56, 57). However, no data are yet available on strand-specific 1222 OC > TA ATOT(C)OACC Ser > stop 1527 OC > TA AO'fl'(C)lTFO Phe > stop repair of specific types of alkylated bases in active genes. Base @ OC1SpliceExon3 > TA AOGC(C)AOAC Pro > Oln substitutions at T after ENU treatment, presumably caused by ethylthymidine or O@-ethylthymidine, showed also a strong strand bias toward the nontranscribed strand. Among the 24 transversions at 1Exon4 1Exon7 AT base pairs, which are probably caused by 02-ethylthymidine, all T 3Cryptic residues were in the nontranscribed strand. This strand bias is not due 1base splice exon 8b 21 8Crypticpairs exon to the distribution of T residues among the strands of the coding 1base splice exon 9C â€”17 sequence of the gene (T residues are equally distributed among the 9a pairs exon two strands) and is much more pronounced than the strand bias 02-Ethylthymine or 04-ethylthymine are assumed to be the mutagenie lesions. The existing for mutable T residues in the hprt gene (61% of these T strand used for transcription is indicated as iS, the other strand as NTS. residues are located at the nontranscribed strand) (26). The observed 5' ..3'Exon . . AGACF1VFOUGOA@GAAAUCCAO ACAAO . . strand bias was also noted in hprt coding sequences of mice and 7 Splice Exon 8 monkeys exposed to ENU in vivo (20, 21) and in human cells exposed 5' . . . TGAAT/CATO1TfOTOTCATCAO COAAA . . .3' to ENU in vitro (51) and suggests strand specific removal of ENU Exon 8 Splice Exon 9 induced mutagenic lesions from the hprt gene. A similar strand bias Sequence underlined is deleted eDNA. for mutations at AT base pairs has been found in Chinese hamster cells exposed to N-ethyl-N'-nitro-N-nitrosoguanidine (58). 02-Ethyl

toid cell line exposed in vitro (51). The predominance of base changes at T induced by ENU confirms the occurrence of these type of Table 4 Overview of mutations detected in MNU- and ENU-induced mutations as observed in activated neu oncogenes in neuroblastomas rat hprt mutants in vivo in rats (16), in activated ras oncogenes in lung tumors in mice (17), and in a mutated locus in the specific locus assay in mice (52) after i.p. ENU exposure. These results indicate that mutational spectra for a mutants)TransitionsOC>AT7115AT>OC14TransversionsAT>TA217AT>CO7OC>TA13OCMutationsMNUENU (18mutants)Pouch mutants)i.p. (19 (43 specific mutagen may differ dramatically between different species or cell types, because of differences in the activity of specific repair systems (11, 53), the dose (54, 55), and the time between adduct formation and fixation of mutation (19). The MNU- and ENU-induced mutational spectra were clearly dif ferent from a spectrum of spontaneously occurring hprt mutant skin fibroblast clones showing different kinds of base pair changes, + 1 >COSplice767Frame-shift1No frame-shift mutations, putative splice mutations/exon deletions, or giving no PCR product which may be due to either point mutations in the promotor region or large alterations in the hprt gene (Table 5). The PCR product1 2482

Table 5 Mutational spectrum of spontaneouslyskinTarget occurring hprt mutations in mutants. The base pair alterations responsible for these events are fibroblasts of rat?gene unknown, because the nucleotide sequences of the regions involved in ofPositionMutation sequenceAmino acidNo. the correct splicing of the rat hprt precursor mRNA have not been 3'changemutantsTransitions212OC 5' > determined yet. However, these mutations probably represent mostly GC to AT transitions in the 5' or 3' consensus splice donor or acceptor sites as has been demonstrated for MNU- and MNNG-induced spectra Asp1635OC > AT 000G(O)CFATOly > Olu1530AT > AT AOTO(O)AAAAOly > at the hprt gene in hamster and human cells (12, 54). Oly1223Transversions > GC CCAO(A)CITFAsp > Comparisons of MNU-, MNNG-, and ENU-induced mutational spectra at the hprt gene of different mammals showed that some base Val1473AT AT > CO OUC(T)TFGGPhe > pair changes are induced at identical positions, indicating the exis Oly1600OC > CO ATGG(T)TAAOVal > tence of hot spots for formation of mutagenic lesions in the coding Ser1211OC > TA TCAO(O)OATFMg > Arg1610OC > CO GGGO(G)OCTAOly > sequence. It remains to be determined, by analyzing more mutants, Asp1Splice/exon> CO OAAT(C)ATGTHis > whether these hot spots are due to a limited number of positions at the hprt coding sequence available for methylation which can subse deletions quently lead to a mutant phenotype. The strong preference for the @ Cryptic splice intron 1b 19 base pairs intron 1 induction by MNU of GC to AT alterations at 0 residues flanked at Exon2 1 the 5' site by a purine has also been observed in spectra of human and Exons 2â€”3 1 hamster cells and appears to be a general phenomenon of methylating Exons 2â€”5 1 1400OC +1 agents (reviewed in Ref. 65). It has been suggested that this observa > TA TOTF(O)AAOA > stop1 tion may reflect either preferential alkylation, variations in DNA Exon3 Exon4 2 polymerase fidelity, or a decrease in repairability of the 06-methyl Exons4â€”5 1 guanine lesion when 5' flanked by G (65â€”68). Exon5 1 In conclusion, the present study shows that MNU and ENU induce Cryptic splice exon 6,c .54 1 base pairs exon 6 mutations in the hprt gene in a dose-dependent manner in rat fibro Exon7 2 blasts in vivo. These mutations are predominantly GC to AT transi 1Others27 Cryptic splice exon 8d â€”21 tions after MNU exposure and AT to TA transversions after ENU base pairs exon 8Olu exposure. The spectra of in vivo ENU-induced mutants differ drasti cally from those observed in vitro, which indicates that care must be CGTO(A)ATFA1216or 28Frame-shift +1 taken in extrapolating in vitro mutagenesis data to the in vivo situa or 217Frame-shift + 1 CI'ATmAAOT tion. The present study confirms that the granuloma pouch assay is a No PCR product 9 No mutation in 1 convenient procedure for the short-term analysis of in vivo induced coding sequence1 hprt gene mutations in the rat. The fact that the fibroblastic granuloma a 6-Thioguanine-resistant mutants were isolated from complete or segmented granu tissue is also a target tissue for tumorigenesis (fibrosarcomas) mdi loma pouch tissue as described in â€œMaterialsandMethodsâ€•.hprtmutant clones containing cates the suitability of this animal model system for the quantitative the same mutation and isolated from the same cell population were not regarded as independentmutants. (potency) and qualitative (spectrum) comparison of genetic and neo 5' . . . OTCOTO/gagagccagggggactccg ATI'AO . . .3' plastic changes induced by mutagenic carcinogens within one tissue. Exonl Exon2 Sequence in italics is incorporated in eDNA. Nucleotide in boldface is presumably the result of a T to A transversion in the invariant 01 splice donor site. REFERENCES 5' . . . A/OATATAATFOACACFOO Exon 5 Splice 1. Beranek, D. T. Distribution of methyl and ethyl adducts following alkylation with monofunctional alkylating agents. Mutat. Res., 231: 11â€”30,1990. TAAAACAATGCAGAC1TFOC1TFC@OGTCAAGCAOTA . . .3' 2. Basu, A. K., and Essigmann, J. M. Site-specifically alkylated oligonueleotides: probes Exon 6@ for mutagenesis, DNA repair and the structural effects of DNA damage. Mutat. Res., Sequence underlined is deleted in eDNA. 233: 189â€”201,1990. d 3. Zarbl, H. S., Sukumar, S., Arthur, A. V., Martin-Zanca, D., and Barbaeid, M. Direct 5' . . . AGACFIrTGTFGGA1TFOAAArFCCAGACAAO . . .3' mutagenesis of the Ha-ras-1 oncogenes by N-mtroso-N-methylurea during initiation Exon 7 Splice Exon 8 of mammary carcinogenesis in rats. Nature (Lond.), 315: 382â€”385,1985. 4. Loeehler, E. L., Oreen, C. L., and Essigmann, J. M. In vivo mutagenesis by O@ methylguanine built into a unique site in a viral genome. Proc. Natl. Acad. Sci. USA, thymidine and Oâ€•-ethylthymidine have been found to be poor sub 81:6271â€”6275,1984. 5. Ellison, K. S., Dogliotti, E., Connors, T. D., Basu, A. K., and Essigmann, J. M. strates for mammalian alkyltransferases, suggesting that other DNA Site-specific mutagenesis by O@-alkylguanines located in the chromosomes of mam repair activities are responsible for strand-specific removal of these malian cells: influence of the mammalian 06-alkylguanine-DNA alkyltransferase. lesions. These DNA repair activities may be similar to those which are Proc. Natl. Acad. Sci. USA, 86: 8620â€”8624, 1989. 6. Vogel, E., and Natarajan, A. T. The relation between reaction kinetics and mutagenie involved in the repair of DNA damage induced by UV radiation and action of monofunetional alkylating agents in higher eukaryotic systems. I. recessive (Â±)-7@,8a-dihydroxy-9a,10a-epoxy-7,8,9,10-tetrahydrobenzo lethal mutations and translocations in Drosophila. Mutat. Res., 62: 51â€”100,1979. 7. Richardson, K. K@,Richardson, F. C., Crosby, R. M., Swenberg, J. A., and Skopek, (a)pyrene, which also caused the occurrence of strand specific muta T. R. DNA base changes and alkylation following in vivo exposure of Escherichia tion induction in the nontranscribed strand of the hprt gene (59â€”63). coli to N-methyl-N-nitrosourea or N-ethyl-N-nitrosourea. Proc. NatI. Acad. Sci. USA, Alternatively, there might be a difference in the fidelity of DNA 84: 344â€”348,1987. 8. Burns, P. A., Oordon, A. J. E., and Olickman, B. W. Mutational specificity of replication between the two strands of the gene; i.e., the bypass of N-methyl-N-nitrosourea in the lad gene of Escherichia coli. Carcinogenesis (Lond.), lesions in the template for the leading strand synthesis might occur 9: 1607â€”1610,1988. with a different error rate than the bypass of lesions present in the 9. Eckert, K. A., Ingle, C. A., Klinedinst, D. K., and Drinkwater, N. R. Molecular analysis of mutations induced in human cells by N-ethyl-N-nitrosourea. Mol. template for the lagging strand synthesis as suggested by Vrieling Carcinog., 1: 50â€”56,1988. et al. (64). 10. Lee, 0. S-F., Blonsky, K. S., Lee Van On, D., Savage, E. A., Morgan, A. R., and Von Borstel, R. C. Base alterations in yeast induced by alkylating agents with differing Mutations resulting in missplicing of the hprt mRNA were present Swain-Scott substrate constants. J. Mol. Biol., 223: 617â€”626,1992. at high frequency in the mutation spectrum of MNU-induced hprt 11. Moriwaki, S., Yagi, T., Nishigori, C., Imamura, S., and Takebe, H. Analysis of 2483

N-methyl-N-nitrosourea-induced mutations in a shuttle vector plasmid propagated in 38. 0' Connor, T. R., and Laval, F. Isolation and structure of a eDNA expressing a mouse O@-methylguanine-DNAmethyltransferase-deficientcells in comparison with mammalian 3-methyladenine-DNA glycosylase. EMBO J., 9: 3337â€”3342, 1990. proficient cells. Cancer Res., 51: 6219â€”6223, 1991. 39. Schaaper, R. M., Kunkel, T. A., and Loeb, L A. Infidelity of DNA synthesis 12. Zhang, L-H., and Jenssen, D. Site specificity of N-methyl-N-nitrosourea-indueed associated with bypass of apurinie sites. Proc. Natl. Acad. Sci. USA, 80: 487â€”491, transition mutations in the hprt gene. Careinogenesis (Land.), 12: 1903â€”1909,1991. 1983. 13. Sukamar, S., Notario, V., Martin-Zanca, D., and Barbaeid, M. Induction of mammary 40. Sagher, D., and Strauss, B. Insertion of nucleotides opposite apurinie/apyrimidinic carcinomas in rats by nitrosomethylurea involves malignant activation of H-ras-1 sites in deoxyribonucleic acid during in vitro synthesis: uniqueness of adenine locus by sinle point mutations. Nature (Lond.), 306: 658â€”661,1983. nueleotides. Biochemistry, 22: 4518â€”4526,1983. 14. Newcomb, E. W., Steinberg, J. J., and Pellicier, A. ras oncogenes and phenotypic 41. Kamiya, H., Suzuki, M., Komatsu, Y., Miura, H., Kikuehi, K., Sakaguehi, T., Murata, staging in N-methylnitrosourea and @sirradiation induced thymie lymphomas in N., Masutani, C., Hanaoka, F., and Ohtsuka, E. An abasie site analogue activates a C57BL/6J mice. Cancer Res., 48: 5514â€”5518, 1988. e-Ha-ras gene by a point mutation at modified and adjecent positions. Nucleic Acids 15. You, M., Candrian, U., Maronpot, R. R., Stoner, R. D., and Anderson, M. W. Res., 20: 4409â€”4415,1992. Activation of the Ki-ras protooncogene in spontaneously occurring and chemically 42. Cabral Neto, J. B., Gentil, A., Caseira Cabral, R. E., and Sarasin, A. Mutation induced lung tumors of the strain A mouse. Proc. Natl. Acad. Sci. USA, 86: spectrum of heat-induced abasie sites on a single-stranded vector replicated in 3070â€”3074,1989. mammalian cells. J. Biol. Chem., 267: 19718â€”19723,1992. 16. Peratoni, A. 0., Rice, J. M., Reed, C. D., watatani, M., and wenk, M. L Activated 43. Dianov, 0., Price, A., and Lindahl, T. Generation of single nueleotide repair patches iieu oncogene sequences in primary tumors of peripheral nervous system induced in following excision of uradil residues from DNA. Mol. Cell. Biol., 12: 1605â€”1612, rats by transplacental exposure to ethylnitrosourea. Proc. Nat!. Acad. Sci. USA, 84: 1992. 6317â€”6321,1987. 44. Richardson, F. C., Dyroff, M. C., Boucheron, J. A., and Swenberg, J. A. Differential 17. You, M., wang, Y., Lineen, A. M., Ounning, w. T., Stoner, 0. D., and Anderson, repair of 04-alkylthymidine following exposure to methylating and ethylating hepa M. w. Mutagenesis of the K-ras protooncogene in mouse lung tumors induced by tocareinogens. Carcinogenesis (Lond.), 6: 625â€”629, 1985. N-ethyl-N-nitrosourea or N-nitrosodiethylamine. Careinogenesis (Lond.), 13: 45. Wani, A. A., Wani, 0., and D'Ambrosio, S. M. A human DNA repair activity specific 1583â€”1586,1992. for O@-ethylthymine:identification and partial characterization. Carcinogenesis 18. Pastink, A., Vreeken, C., Nivard, M. J. M., Searles, L L, and Vogel, E. W. Sequence (Lond.), 11: 1419â€”1424,1990. analysis of N-ethyl-N-nitrosourea-indueed vermilion mutations in Drosophila mela 46. Singer, B., Sprengler, S. J., Fraenkel-Conrat, H., and Kusmierek, J. T. O@-methyl, nogaster. Oeneties, 123: 123â€”129,1989. -ethyl, or -isopropyl substituents on thymidine in poly(dA-dT) all lead to transitions 19. Nivard, M. J. M. Genetic and molecular analysis of alkylation-induced DNA damage upon replication. Proc. Natl. Acad. Sci. USA, 83: 28â€”32,1986. in Drosophila melanogaster. Thesis. Leiden, the Netherlands: State University of 47. Preston, B. D., Singer, B., and Loeb, L. A. Comparison of the relative mutagenieities Leiden, 1991. of O-alkylthymines site specifically incorporated into OX174 DNA. J. Biol. Chem., 20. Skopek, T. R., Walker, V. E., Coehrane, J. E., Craft, T. R., and Cariello, N. F. 262:13821â€”13827,1987. Mutational spectrum at the Hprt locus in splenic T-cells of B6C3F, mice exposed to 48. Klein, J. C., Bleeker, M. J., Lutgerink, J. T., Van Dijk, W. J., Brugghe, H. F., Van den N-ethyl-N-nitrosourea. Proc. Natl. Acad. Sci. USA, 89: 7866â€”7870, 1992. Elst, H., Van der Marel, 0. A., Van Boom, J. H., Westra, J. G., Berns, A. J. M., and 21. Harbach, P. R., Fiipunas, A. L., Wang, Y., and Aaron, C. S. DNA sequence analysis Kriek, E. Use of shuttle vectors to study the molecular processing of defined of spontaneous and N-ethyl-N-nitrosourea-induced hprt mutations arising in vivo in carcinogen-induced DNA damage: mutagenicity of single O@-ethylthymine adducts in Cynomolgus monkey T-lymphocytes. Environ. Mol. Mutagen., 20: 96â€”105,1992. HeLa cells. Nucleic Acids Res., 18: 4131â€”4137,1990. 22. Maier, P. The granuloma pouch assay. In: F. J. de Serres (e4i), Chemical Mutagens: 49. Bhanot, 0. S., Orevatt, P. C., Donahue, J. M., Gabrielides, C. N., and Solomon, J. J. PrinciplesandMethodsfortheirDetection,Vol.9, pp.233â€”260.NewYork:Plenum In vitro DNA replication implicates O@-ethyldeoxythymidine in transversion mu Publishing Corp., 1984. tagenesis by ethylating agents. Nucleic Acids Res., 20: 587â€”594,1992. 23. Maier, P., and Schawalder, H. P. Hepatocareinogens induce gene mutations in rats in 50. Orevatt, P. C., Donahue, J. M., and Bhanot, 0. S. The role of N3-ethyldeoxythymi fibroblast-like cells from a subcutaneous granulation tissue. Carcinogenesis (Lond.), dine in mutagenesis and cytotoxicity by ethylating agents. J. Biol. Chem., 266: 9: 1363â€”1368,1988. 1269â€”1275, 1991. 24. Mohn, 0. R., Jansen, J., and Lohman, P. H. M. Hprt mutation spectra and other 51. Bronstein, S. M., Cochrane, J. E., Craft, T. R., Swenberg, J. A., and Skopek, T. R. genetic alterations in rat skin fibroblasts in vivo. Environ. Mol. Mutagen., 17: 52, Toxicity, Mutagenicity, and mutational spectra of N-ethyl-N-nitrosourea in human 1991. cell lines with different DNA repair phenotypes. Cancer Res., 51: 5188â€”5197, 25. Chiaverotti, T. A., Battula, N., and Monnat, R. J. Rat hypoxanthine phosphoribosyl 1991. transferase eDNA cloning and sequence analysis. Oenomies, 11: 1158â€”1160,1991. 52. Favor, J., NeuhSuser-Klaus, A., and Ehling, U. E. The induction of forward and 26. Jansen, J. 0., Vrieling, H., Van Zeeland, A. A., and Mohn, 0. R. The gene encoding reverse specific-locus mutations and dominant cataract mutations in spermatogonia of hypoxanthine-guanine phosphoribosyltransferase as target for mutational analysis: treated strain DBA/2 mice by ethylnitrosourea. Mutat. Rca., 249: 293-300, 1991. PCRcloningandsequencingoftheeDNAfromtherat.Mutat.Res.,266: 105â€”116,53. Lukash, L L, Boldt, J., Pegg, A. E., Dolan, M. E., Maher, V. M., and McCormick, 1992. J. J. Effect of (P-alkylguanine-DNA alkyltransferase on the frequency and spectrum 27. Mohn, 0. R., Kerklaan, P. R. M., Van Zeeland, A. A., Ellenberger, J., Baan, R. A., of mutations induced by N-methyl-N'-nitro-N-nitrosoguarndine in the HPRT gene of Lohman, P. H. M., and Pons, F-W. Methodologies for the determination of various diploid human fibroblasts. Mutat. Res., 250: 397â€”409, 1991. genetic effects in permeable strains of E. coli K-12 differing in DNA repair capacity. 54. Yang, J-L., Hu, M-C., and Wu, C-W. Novel mutational spectrum induced by N- Quantification of DNA adduct formation, experiments with organ homogenates and methyl-N'-nitro-N-nitrosoguanidine in the coding region of the hypoxanthine (gua hepatocytes, and animal-mediated assays. Mutat. Res., 125: 153-184, 1984. nine) phosphoribosyltransferase gene in diploid human fibroblasts. J. Mol. Biol., 221: 28. Yang, J-L, Maher, V. M., and McCormick, J. J. Amplification and direct nucleotide 421â€”430,1991. sequencing of eDNA from the lysate of low numbers of diploid human cells. Oene, 55. Wei, S-J. C., Chang, R. L, Bhaehech, N., Cui, X. X., Merkier, K. A., Wong, C-Q., 83: 347â€”354,1989. Hennig, E., Yagi, H., Jerina, D. M., and Conney, A. H. Dose-dependent differences 29. Rossi, A. M., Tates, A. D., Van Zeeland, A. A., and Vrieling, H. Molecular analysis in the profile of mutations induced by (+)-7R,8S-dihydroxy-95,1OR-epoxy-7,8,9,10- of mutations affecting hprt mRNA splicing in human T-lymphocytes in vivo. Environ. tetrahydrobenzo(a)pyrene in the coding region of the hypoxanthine (guanine) phos Mol.Mutagen.,19:7â€”13,1992. phoribosyltransferase gene in Chinese hamster V-79 cells. Cancer Res., 53: 3294â€” 30. Larson, K., Sahm, J., Shenkar, R., and Strauss, B. Methylation-induced blocks to in 3301, 1993. vitro DNA replication. Mutat. Res., 150: 77â€”84,1985. 56. LeDoux, S. P., Patton, N. J., Nelson, J. W., Bohr, V. A., and Wilson, 0. L 31. Pegg, A. E., Seicehitano, D., and Dolan, M. E. Comparison of the rates of repair of Preferential repair of alkyli-labile sites within the active insulin gene. J. Biol. Chem., 06-alkylguanines in DNA by rat liver and bacterial O@-alkyIguanine-DNAtrans 265: 14875â€”14880,1990. ferase. Cancer Res., 44: 3806â€”3811,1984. 57. Bartlett, J. D., Seicehitano, D. A., and Robison, S. H. Two expressed human genes 32. Veleminsky, J., Osterman-Golkar, S., and Ehrenberg, L. Reaction rates and biological sustain slightly more DNA damage after alkylating agent treatment than an inactive action of N-methyl- and N-ethyl-N-nitrosourea. Mutat. Rca., 10: 169â€”174,1970. gene. Mutat. Res., 255: 247â€”256,1991. 33. Jansen, J. 0., Dc Oroot, A. J. L, Van Teijlingen, C. M. M., Lohman, P. H. M., Mohn, 58. Fortini, P., Calcagnile, A.. Vrieling, H., Van Zeeland, A. A.. Bignami, M., and 0. R., Vrieling, H., and Van Zeeland, A. A. Formation and persistence of DNA Dogliotti, E. Mutagenie processing of ethylation damage in mammalian cells: the use adducts in pouch skin fibroblasts and liver tissue of rats exposed in vivo to the of methoxyamine to study apurinie/apyrimidinie site-induced mutagenesis. Cancer monofunctional alkylating agents N-methyl-N-nitrosourea or N-ethyl-N-nitrosourea. Res.,53: 1149â€”1155,1993. Mutat. Rca., 307: 95â€”105,1994. 59. Menichini, P., Vrieling, H., and Van Zeeland, A. A. Strand-specific mutation spectra 34. Maier, P. Naehweis und Charakterisierung von mutagenen und kanzerogenen Chemi in repair-proficient and repair-deficient hamster cells. Mutat. Res., 251: 143â€”155, kalien mit Hilfe von zellbiologisehen Methoden in vivo und in vitro beim Sauger. 1991. Habilitationsschrift. Zurich, Switzerland: Universitat of Zurich, 1991. 60. Vrieling, H., Venema, J., Van Rooyen, M-L, Van Hoffen, A., Menichini, P., 35. Den Engelse, L, Dc Oraaf, A., Dc Brij, R-J., and Menkveld, 0. J. O2@and O@ Zdzienieka, M. Z., Simons, J. W. I. M., Mullenders, L. H. F., and Van Zeeland, ethylthymine and the ethylphosphotriester dTp(Et)dT are highly persistent DNA A. A. Strand specificity for UV-induced DNA repair and mutations in the Chinese modifications in slowly dividing tissues of the ethylnitrosourea-treated rat. Careino hamster HPRT gene. Nucleic Acids Res., 19: 2411â€”2415,1991. genesis (Lond.), 8: 751â€”757,1987. 61. McGregor, W. 0., Chen, R-H., Lukash, L., Maher, V. M., and McCormick, J. J. Cell 36. Pletsa V., Oentil, A., Margot, A., Armier, J., Kyrtopoulos, S. A., and Sarasin, A. cycle-dependent strand bias for UV-induced mutations in the transcribed strand of Mutagenesis by Os-meG residues within codon 12 of the human Ha-ras proto excision repair-proficient human fibroblasts but not in repair-deficient cells. Mol. oncogene in monkey cells. Nucleic Acids Res., 20: 4897â€”4901, 1992. Cell. Biol., ii: 1927â€”1934,1991. 37. Dosanjh, M. K., Singer, B., and Essigmann, J. M. Comparative mutagenesis of 62. Chen, R-H., Maher, V. M., and McCormick, J. J. Effect of excision repair by diploid O@-methyIguanine and Oâ€•-methylthymine in Escherichia coli. Biochemistry, 30: human fibroblasts on the kinds and locations of mutations induced by (Â±)7@,8a- 7027â€”7033,1991. dihyroxy-9a,lOa-epoxy-7,8,9,1O-tetrahydrobenzo[ajpyrene in the coding region of 2484

the HPRT gene. Proc. Natl. Acad. Sci. USA, 87: 8680-8684, 1990. of DNA repair. Environ. Mol. Mutagen., 15: 107â€”122,1990. 63. Andersson, B., Falt, S., and Lambert, B. Strand specificity for mutations induced by 66. Dolan, M. E., Oplinger, M., and Pegg, A. E. Sequence specificity of guanine (+)-anti BPDE in the hprt gene in human T-lymphocytes. Mutat. Res., 269: 129â€”140, alkylation and repair. Careinogenesis (Lond.), 9: 2139â€”2143, 1988. 1992. 67. Richardson, F. C., and Richardson, K. K. Sequence-dependent formation of alkyl 64. Vrieling, H., Zhang, L-H., Van Zeeland, A. A., and Zdzienicka, M. Z. UV-induced adducts: a review of methods, results, and biological correlates. Mutat. Res., 233: hprt mutations in a UV-sensitive hamster cell line from complementation group 3 are 127â€”138,1990. biased towards the transcribed strand. Mutat. Res., 274: 147â€”155,1992. 68. Oeorgiadis, P., Smith, C. A., and Swann, P. F. Nitrosamine-induced cancer: selective 65. Horsfall, M. J., Gordon, A. J. E., Burns, P. A., Zielenska, M., Van der Vliet, G. M. repair and conformational differences between O@-methylguanine residues in differ E., and Gliekman, B. W. Mutational specificity of alkylating agents and the influence ent positions in and around codon 12 of rat H-ras. Cancer Res., 51: 5843â€”5850,1991.

2485

Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 1994 American Association for Cancer Research. Molecular Analysis of hprt Gene Mutations in Skin Fibroblasts of Rats Exposed in Vivo to N-Methyl-N-nitrosourea or N-Ethyl-N -nitrosourea

Jacob G. Jansen, George R. Mohn, Harry Vrieling, et al.

Cancer Res 1994;54:2478-2485.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/54/9/2478

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/54/9/2478. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.