G Model

DNAREP-1762; No. of Pages 11 ARTICLE IN PRESS

DNA Repair xxx (2013) xxx–xxx

Contents lists available at SciVerse ScienceDirect

DNA Repair

jo urnal homepage: www.elsevier.com/locate/dnarepair

SMC6 is an essential in mice, but a hypomorphic mutant in the

ATPase domain has a mild phenotype with a range of subtle abnormalities

a,1 a,1 a,2 b c

Limei Ju , Jonathan Wing , Elaine Taylor , Renata Brandt , Predrag Slijepcevic ,

d d,e d,f d,g d

Marion Horsch , Birgit Rathkolb , Ildikó Rácz , Lore Becker , Wolfgang Hans ,

d,h d,i,k d,j j e

Thure Adler , Johannes Beckers , Jan Rozman , Martin Klingenspor , Eckhard Wolf

f g,l h d,k

, Andreas Zimmer , Thomas Klopstock , Dirk H. Busch , Valérie Gailus-Durner ,

d,k d,i,k,l b

Helmut Fuchs , Martin Hrabeˇ de Angelis , Gilbertus van der Horst ,

a,∗

Alan R. Lehmann

a

Genome Damage and Stability Centre, University of Sussex, Falmer, Brighton BN1 9RQ, UK

b

Department of Cell Biology and Genetics, Erasmus university MC, Rotterdam, The Netherlands

c

Brunel Institute of Cancer Genetics and Pharmacogenomics, Division of Biosciences, School of Health Sciences & Social Care, Brunel University, Uxbridge,

Middlesex, UB8 3PH, UK

d

German Mouse Clinic, Institute of Experimental Genetics, Helmholtz Zentrum München - Deutsches Forschungszentrum für Gesundheit und Umwelt

(GmbH), Ingolstädter Landstraße 1, D-85764 Neuherberg, Germany

e

Institute of Molecular Animal Breeding and Biotechnology, Ludwig-Maximilian-Universität München, Genecenter, Feodor-Lynen-Str. 25, 81377 Munich, Germany

f

Institute of Molecular Psychiatry, University of Bonn, Sigmund-Freud-Straße 25, 53105 Bonn, Germany

g

Department of Neurology, Friedrich-Baur-Institut, Ludwig-Maximilians-Universität München, Ziemssenstraße 1, 80336 Munich, Germany

h

Institute for Medical Microbiology, Immunology, and Hygiene, Trogerstraße 30, Technische Universität München, 81675 Munich, Germany

i

Lehrstuhl für Experimentelle Genetik, Wissenschaftszentrum Weihenstephan, Technische Universität München, 85354 Freising, Germany

j

Molecular Nutritional Medicine, Else-Kröner Fresenius Center, Technische Universität München, 85350 Freising-Weihenstephan, Germany

k

Member of German Center for Diabetes Research (DZD), Ingolstädter Landstraße 1, 85764 Neuherberg, Germany

l

German Center for Vertigo and Balance Disorders, Marchioninistraße 15, 81377 Munich, Germany

a r t i c l e i n f o a b s t r a c t

Article history: Smc5-6 is a highly conserved complex related to and involved in the struc-

Received 29 August 2012

tural maintenance of . In yeasts the Smc5-6 complex is essential for proliferation and is

Received in revised form 5 February 2013

involved in DNA repair and . siRNA depletion of involved in the Smc5-

Accepted 16 February 2013

6 complex in cultured mammalian cells results in sensitivity to some DNA damaging agents. In order

Available online xxx

to gain further insight into its role in mammals we have generated mice mutated in the Smc6 gene. A

complete knockout resulted in early embryonic lethality, demonstrating that this gene is essential in

Keywords:

mammals. However, of the highly conserved serine-994 to alanine in the ATP hydrolysis motif

DNA repair

in the SMC6 C-terminal domain, resulted in mice with a surprisingly mild phenotype. With the neo gene

Mouse model

selection marker in the intron following the mutation, resulting in reduced expression of the SMC6 gene,

Sister-chromatid exchange

SMC Protein the mice were reduced in size, but fertile and had normal lifespans. When the neo gene was removed,

the mice had normal size, but detailed phenotypic analysis revealed minor abnormalities in glucose tol-

erance, haematopoiesis, nociception and global patterns. Embryonic fibroblasts derived

from the ser994 mutant mice were not sensitive to killing by a range of DNA damaging agents, but they

were sensitive to the induction of sister chromatid exchanges induced by ultraviolet light or mitomycin

C. They also accumulated more oxidative damage than wild-type cells.

© 2013 Elsevier B.V. All rights reserved.

Abbreviations: HR, homologous recombination; MEF, mouse embryonic fibroblast; MMC, mitomycin C; MMS, methyl methanesulfonate; SCE, sister chromatid

exchange; SMC, structural maintenance of chromosomes; UV, ultraviolet light.

∗

Corresponding author. Tel.: +44 1273 678120; fax: +44 1273 678121.

E-mail address: [email protected] (A.R. Lehmann).

1

These authors contributed equally.

2

Present address: Lancaster Medical School, Lancaster University, Bailrigg, Lancaster LA1 4YB, UK.

1568-7864/$ – see front matter © 2013 Elsevier B.V. All rights reserved.

http://dx.doi.org/10.1016/j.dnarep.2013.02.006

Please cite this article in press as: L. Ju, et al., SMC6 is an essential gene in mice, but a hypomorphic mutant in the ATPase domain has a mild

phenotype with a range of subtle abnormalities, DNA Repair (2013), http://dx.doi.org/10.1016/j.dnarep.2013.02.006

G Model

DNAREP-1762; No. of Pages 11 ARTICLE IN PRESS

2 L. Ju et al. / DNA Repair xxx (2013) xxx–xxx

1. Introduction N-terminal fragment of the protein was made. Mice homozygous

for this insertion were embryonic lethal, and we were unable to

The structural maintenance of chromosomes (SMC) are establish MEFs from early embryos, suggesting that smc6 is an

a family of related proteins that form the cores of three protein essential gene in mice. To generate a hypomorphic mouse with a

complexes. Cohesin, containing Smc1 and 3, keeps sister chro- good chance of being viable, we made use of our previous exten-

matids together after DNA replication, as well as having roles in sive analysis of S. pombe smc6 mutants. S. pombe smc6-S1045A is a

gene expression and DNA repair [1]. Condensin contains Smc2 and separation-of-function mutation and cells with this mutation were

4 and is responsible for condensation at mitosis [2]. viable but sensitive to DNA damaging agents [25]. Importantly this

The Smc5-6 complex is required for repair of DNA by homologous mutation is in the LSGG signature motif, which is conserved not

recombination (HR) but its exact role is not fully understood [3,4]. only in all SMC proteins, but also in the ABC family of ATPases [26].

The SMC protein cores of these complexes all adopt a similar The Rad50 protein has a structure closely related to that of the SMC

structure. The SMC proteins fold back on themselves via a hinge proteins. Mutation of the corresponding serine in the LSGG motif

in the centre of the molecule, such that N and C terminal globular of Rad50 abolishes ATP hydrolysis [26], so we infer that the same

domains are brought together to form an ATP binding and hydroly- is likely to be true in the SMC family. For these reasons, we chose

sis “head domain”. The N and C terminal domains are joined to the to generate Smc6 mice with the corresponding mutation, namely

hinge by long coiled coil domains. Each SMC protein interacts with S994A. Mice homozygous for SMC6-S994A were indeed viable. We

its partner protein via their hinge domains, and the head domains describe the mild phenotypic alterations of this mutant mouse line

of each partner are brought together to catalyse ATP hydrolysis. found in a comprehensive analysis of dysmorphology, behaviour,

The head domains also bind non-SMC components, including a neurology, pain response, energy metabolism, clinical chemistry,

so-called kleisin, which bridges the heads. steroid metabolism, immunological parameters, eye alterations,

Apart from Smc5 and 6, the yeast Smc5-6 complexes have six cardiovascular and lung functions as well as RNA expression profil-

additional components, Nse1-6 [5–7]. Nse1 is a RING finger protein, ing in liver, spleen and testis. We generated embryonic fibroblasts

with associated E3 ubiquitin ligase activity [8]. Nse2/Mms21 is a (MEFs) from the mice and report on the DNA damage sensitivity of

sumo ligase [6,9,10], which is bound to the Smc5 subunit [11] and these MEFs.

sumoylates Smc6 in Schizosaccharomyces pombe [9] and Smc5 in

Saccharomyces cerevisiae [6]. Nse3 is related to the MAGE protein

family [12] and Nse4 is the kleisin component [13]. At least four 2. 2.Results

of these Nse proteins (Nse1-4) have orthologs in human cells [12],

whereas orthologs of the poorly conserved Nse5 and 6 have not yet 2.1. SMC6 knock-outs

been identified [7,14].

In yeasts two different functions in HR have been delineated. The genes encoding the Smc5 and Smc6 proteins are essential

An early function is a requirement for Smc5-6 to load Rad52 in both budding and fission yeast [16]. However, extensive stud-

at sites of stalled replication forks [15], whereas the late func- ies using siRNA to deplete different components of the complex

tion is an involvement in resolving recombination intermediates in cultured human cells in our and other labs showed minimal

[16–19]. In addition Smc5-6 contributes to the regulation of cohesin effects on cell proliferation or viability. Furthermore it has been

loading and unloading: (a) the formation of double-strand breaks shown recently that a SMC5 knockout is viable in chicken DT40

in S. cerevisiae triggers genome-wide loading of cohesin, which cells [27]. We therefore considered it worthwhile to examine if

requires Smc6 [20]; (b) Smc5-6 is required for removal of cohesin the same was true in mice. We obtained from BayGenomics the

at mitosis in S. pombe [21]; (c) Smc5-6 promotes cohesin loading RRT274 strain of mice, which contained an exon trap (consist-

␤

at double-strand breaks in human cells [22]. Together the defects ing of a splice acceptor site upstream of the geo fusion gene) in

in homologous recombination and in cohesin regulation result in intron 6 of Smc6 (Fig. 1A), essentially rendering the Smc6 gene non-

chromosome segregation defects. The Smc5-6 protein components functional. Offspring from matings of heterozygous mice carrying

are essential in both yeasts. this mutation were genotyped using PCRs with a forward primer

The functions of the human Smc5-6 proteins have been stud- in exon 6 (E6F) together with a reverse primer either in intron 6

ied using siRNA depletion of individual components. By depleting (I6R) or in the ␤geo fusion gene (␤gR), which respectively gener-

hNse2/hMms21, Potts and coworkers identified roles for the ated products only from wild-type or mutant alleles (Fig. 1B). In

complex in repair of MMS-induced damage and prevention of 25 litters from these heterozygous matings, none of the 136 off-

MMS-induced apoptosis [10], in sister chromatid but not in spring was homozygous mutant, suggesting that disruption of the

−15

intrachromatid or extra-chromosomal HR [22], and in the ALT gene is indeed embryonic lethal (p < 10 that this might occur

HR-mediated pathway of telomere elongation [23]. A specific role by chance, using exact binomial test). 83 heterozygous and 53 wt

for the hSmc5-hNse2/Mms2 components in chromosome cohesion mice resulted from these matings, not significantly different from

and mitotic progression has been reported recently [24]. the expected values of 90.6 and 45.3 (p = 0.35). The heterozygotes

siRNA procedures are unlikely to deplete the endogenous pro- showed no abnormal phenotypes.

tein by more than 90–99%. Therefore any phenotype that depends Examination of the embryos of heterozygote crosses showed

on depletion to below this level will not be revealed in siRNA that severe abnormalities were evident at E9.5. The mice were

experiments. The siRNA experiments described above, as well as poorly developed with small body size and in some cases with-

many unpublished experiments carried out in our lab, did not indi- out discernible morphological structures, and often re-absorbed by

cate that the Smc5-6 complex was essential in mammalian cells, day E10.5 (Fig. 1C–E and Table 1). Remarkably when we genotyped

whereas it is essential in both budding and fission yeasts. However these abnormal embryos, we found that none of them (0 out of 8)

this left open the possibility that very low levels of the protein were was homozygous mutant – they were all normal (3/8) or heterozy-

sufficient for cell viability. gous (5/8). Likewise, all attempts to generate embryonic fibroblast

In order to address the function of the Smc5-6 complex more cultures from these embryos at E11.5 generated only wild-type or

definitively and to determine if it is indeed essential in mammals, heterozygote lines.

and to gain initial insights into its function in a whole mammalian There are at least two explanations for these observations.

−/−

organism, we have generated two Smc6 mutant mouse strains. The Firstly, it is possible that not only does the smc6 genotype

first one carried an exon trap in intron 6, such that only a short cause embryonic lethality, but also that these embryos affect the

Please cite this article in press as: L. Ju, et al., SMC6 is an essential gene in mice, but a hypomorphic mutant in the ATPase domain has a mild

phenotype with a range of subtle abnormalities, DNA Repair (2013), http://dx.doi.org/10.1016/j.dnarep.2013.02.006

G Model

DNAREP-1762; No. of Pages 11 ARTICLE IN PRESS

L. Ju et al. / DNA Repair xxx (2013) xxx–xxx 3

−/− +/+ +/−

Fig. 1. Embryonic lethality of Smc6 mice A, The intron trap in exon 6 of Smc6 indicating the primers used for genotyping. B, Genotyping of Smc6 and Smc6 mice. PCR

+/+ +/−

products from tail-snip DNA from Smc6 or Smc6 mice amplified with the primers indicated at the right. The ␤GR primer sequence is present in the gene-trap insert

and only gives a product form the heterozygous mice, whereas the I6R primer gives a PCR product from the wild-type allele, present in both wild-type and heterozygous

+/−

mice. C-E, Various abnormal embryos from crossing heterozygote Smc6 mice are shown. C, E10.5 undeveloped embryos (indicated by arrows) in utero; D, A normal and

undeveloped/absorbed embryo after removal from the uterus in C; E, poorly developed and normal E11.5 embryos.

viability of other embryos in the same yolk sac. Alternatively introduced into intron 25. The mutation introduces a NaeI or NgoM

embryonic development may be impaired in the uterus of heterozy- IV restriction site into the DNA, so that it can be readily detected in

gote mothers. genotyping, using primers P1 and P2, indicated in Fig. 2A (Fig. 2B).

Heterozygous and homozygous mice (SMC6-S994-neo) were gen-

erated from this targeting vector. We also crossed heterozygotes

2.2. SMC6-S994A mutant mice

with mice expressing the Cre gene, to generate a second strain of

mice in which the neo gene had been excised (SMC6-S994A). The

Since the S. pombe smc6-S1045A mutant had a separation-of-

phenotypes of the two strains were largely similar, but were in

function phenotype, we decided to produce the homologous S994A

some cases more marked in the neo containing strain. The heterozy-

mis-sense mutant in mice. In the related Rad50 protein, the LSGG

gous mice showed no abnormal phenotypes.

signature motif binds the ␥-phosphate of ATP and the mutation is

The homozygous SMC6-S994-neo mice were small (Fig. 2C),

expected to reduce the ATPase activity [26]. We constructed a tar-

with about a 40% reduction in body mass through development

geting vector, as indicated in Fig. 2A, in which the mutation was

(Fig. 2D), whereas in the SMC6-S994A mice, there was no signifi-

in exon 25 and the selectable neo gene flanked by LoxP sites was

cant reduction (Fig. 2E). In the SMC6-S994-neo, the reduction in size

could already be noted in E15.5 embryos (Fig. 2F, left panel). The

Table 1

approx. 30% reduction in body mass in the SMC6-S994-neo mice

+/−

Abnormal embryos from SMC6 matings.

was proportional – it was similar in all organs examined (except

Embryo Total number Well Abnormal Absorbed for the thymus, which was only 23% of the mass of heterozygote

age of embryos developed

littermates) (Table 2). Homozygotes of both strains were produced

9.5 12 7 3 2 at close to the expected Mendelian frequencies (Table 3, top), and

10.5 11 8 2 1 the lifespan was normal (>2 years for SMC6-S994A-neo and >2.5

10.5 12 5 3 4

years for SMC6-S994A) with no obvious adverse features in the

10.5 12 8 1 2

older mice.

11.5 9 6 1 2

One possible explanation for the more marked phenotype of

11.5 11 8 0 3

11.5 6 6 0 0 the SMC6-S994A-neo mice is that the neo gene integrated into

13.5 10 5 0 4

intron 25 might interfere with expression of the SMC6 gene. To

+/−

Following matings of heterozygous Smc6 mice, the pregnant mothers were dis- address this we extracted RNA from liver and testis of heterozy-

sected at the indicated times and the embryos examined. gous males of both strains, reverse-transcribed into cDNA and

Table 2

Reduced organ sizes in SMC6-S994A-neo mice.

Homozygote Heterozygote Ratio (%)

Whole body 20 g (18.4–21.3) 29 g (26.7–32) 69

Heart 130 mg (120–130) 190 mg (180–200) 68

Liver 1.125 g (0.89–1.31) 1.675 g (1.37–1.98) 67

Spleen 58 mg (50–65) 85 mg (80–90) 68

Kidneys 152 mg (140–160) 190 mg (190–190) 80

Testes 75 mg (60–80) 95 mg (80–110) 79

Brain 322 mg (280–340) 465 mg (450–480) 69

Lung 120 mg (90–140) 205 mg (180–230) 58

Thymus 34 mg (19–44) 148 mg (72–225) 23

Weights of organs were determined for 6-month old male littermates (means from 4 homozygotes and two heterozygotes).

Please cite this article in press as: L. Ju, et al., SMC6 is an essential gene in mice, but a hypomorphic mutant in the ATPase domain has a mild

phenotype with a range of subtle abnormalities, DNA Repair (2013), http://dx.doi.org/10.1016/j.dnarep.2013.02.006

G Model

DNAREP-1762; No. of Pages 11 ARTICLE IN PRESS

4 L. Ju et al. / DNA Repair xxx (2013) xxx–xxx

Table 3

amplified the region of cDNA flanking the mutation. The amplified

Viability of offspring and litter sizes.

DNAs were incubated with NgoM1V to give three species of DNA.

a

Viability WT Heterozygote Homozygote The largest, uncleaved, fragment was derived from the wild-type

cDNA, whereas the two smaller fragments resulted from cleavage

SMC6-S994A-neo (n = 78) 25 (19.5) 41 (39) 12 (19.5)

SMC6-S994A (n = 71) 24 (18) 28 (35.5) 19 (18) of the amplified mutant cDNA. Comparison of the relative intensi-

ties of mutant and wild-type products in the two strains showed a

b

Litter size Heterozygotes cross Homozygotes cross reduced level (45–60%) of mutant cDNA from the SMC6-S994A-

SMC6-S994A-neo 6.2 ± 2.1 2.7 ± 0.8 neo mice (Fig. 2G, lanes 3 and 4) compared with that from the

a SMC6-S994A mice (lanes 1 and 2). As described in the following

Number of offspring of the indicated genotype with expected Mendelian values

section, we derived MEFs from both strains of mice. We compared in parentheses.

b

Mean ± SD from 6 litters. the levels of Smc6 protein in the Smc6-S994A-neo homozygotes

Fig. 2. SMC6 mice are small. A, Targeting vector for generating SMC6-S994A-neo mutant mice. The positions of primers P1 and P2 used for genotyping are indicated. B,

Genotyping using NgoMIV. DNA from tail snips was amplified using primers P1 and P2 on either side of the mutation, and the products were analysed on agarose gels. The

S994A mutation generates a new NgoMIV site. C, Size differences among male littermates of indicated genotypes at 15 weeks. D, Growth-rate of wild-type, heterozygous and

homozygous SMC6-S994-neo mice. Results show mean ± SD of the weight of 4–14 mice from each genotype. E, Weight of SMC6-S994A mice at 3 and 6 months. Results show

means ± SD of 7 (3 mo) and 27 male mice (6 mo). F, Embryos of SMC6-S994-neo (left panel) and SMC6-S994 (middle panel) mice. Right panel, Yolk sac of heterozygote cross

of SMC6-S994A showing undeveloped embryos. G, RNA was extracted from liver and testis of SMC6-S994A and SMC6-S994A-neo heterozygous mice. RNA was amplified

by PCR and digested with NgoMIV to digest product from the mutant. The intensity of the doublet bands from the digested (mutant) products in each lane is expressed as

a proportion of the total intensity of the bands from undigested (wt) and digested (mutant) products. H, Smc6 protein levels in SMC6-S994A-neo MEFs. Immunoblots of

extracts of MEFs with the indicated SMC6-S994A-neo genotypes using anti-Smc6 antibody.

Please cite this article in press as: L. Ju, et al., SMC6 is an essential gene in mice, but a hypomorphic mutant in the ATPase domain has a mild

phenotype with a range of subtle abnormalities, DNA Repair (2013), http://dx.doi.org/10.1016/j.dnarep.2013.02.006

G Model

DNAREP-1762; No. of Pages 11 ARTICLE IN PRESS

L. Ju et al. / DNA Repair xxx (2013) xxx–xxx 5

Table 4

Systematic phenotyping of the SMC6-S994A mice.

a

Screens Phenotype Test Phenotype description

Dysmorphology, bone and cartilage No Morphological observation

Yes Bone densitometry, Trend of slightly reduced fat mass

No X-ray

Behavior No Open field

No Acoustic startle & PPI

Neurology Yes Modified SHIRPA protocol More tail elevation, less pelvic elevation

No Grip strength

No Rotarod Lactate

Eye No Funduscopy

No Laser interference biometry

No Slit lamp biomicroscopy

No Optomotoric vision test

Nociception Yes Hot plate assay Hypoalgesia

Energy metabolism No Indirect Calorimetry Trend of slightly increased food intake

No MiniSpec NMR body composition Slightly reduced fat mass

Clinical chemistry and hematology Yes Clinical chemistry Fasted mice: Slightly decreased HDL-Cholesterol,

HDL/nonHDL relation shifted towards higher

proportion of nonHDL Fed mice: Slightly increased

plasma glucose and calcium levels

Yes Hematology Mild to moderate effects on white blood cell,

platelet and red blood cell counts suggesting

effects on hematopoietic proliferation and

differentiation

Yes Simplified IpGTT Glucose values during the test slightly higher in

mutants (mainly males) compared to

controls » might be indication of impaired glucose

tolerance

Steroid metabolism No Corticosterone level

No Androstenedione level

No Testosterone level

Immunology No Flow cytometry Small changes with no relevance

(Yes) Immunoglobulin levels Slightly lower levels of IgG2b (both sexes)

Allergy No IgE level

Cardiovascular No Non-invasive tail-cuff blood pressure

measurement

No Heart weight

Lung function No Whole body plethysmography

Molecular phenotyping Genome-wide expression profiling assay Analysis of brain, spleen and testis: weak gene

regulation in brain and testis

Pathology No Macroscopical analysis Known phenotype: small size of the mutant mice

not confirmed

No Histological analysis internal organs

No Secondary screen: histological analysis of pituitary A spectrum of cytological changes in

somatothropic cells of the pars distalis observed in

6/12 mutant and 4/7 control mice.

a

No, no abnormal phenotype; Yes, abnormal phenotype.

with that in wild-type and heterozygote cells. Results in Fig. 2H In the absence of any overt defects, the SMC6-S994A mice were

show that, despite substantial variation between the two wild type subjected to a detailed examination at the German Mouse Clinic

cell lines, the level of Smc6 protein was much lower in the homozy- [28]. Morphological inspection and X-ray analysis showed nor-

gote mutant cells. Taken together, these data are consistent with mal morphology, but the mutant mice had a slightly reduced body

the idea that the stronger phenotype of the SMC6-S994A-neo mice mass (p = 0.114) and fat mass (p = 0.063) but unchanged lean mass,

results from reduced expression of the mutant SMC6 gene. as shown by both dual-energy X-ray absorption and qNMR. No

Both strains of homozygous mice were fertile, but the litter sizes abnormality was observed in a variety of behaviour tests. However

from breeding homozygous SMC6-S994A-neo mice were signifi- increased tail elevation and decreased pelvic elevation during walk-

cantly lower than those from heterozygous crosses. Examination ing in a viewing arena during a modified SHIRPA protocol (p = 0.02)

of yolk sacs at days E13-14 showed obviously defective embryos indicated a minor abnormality in muscle or lower motor neuron

being reabsorbed (Fig. 2F right panel). function. No problems were found in the eyes. Both male and female

mice had significantly longer response times to thermal stimulation

than wild-type controls (p < 0.001 in females). This could indicate

Table 5 hypoalgesia. The female mutant mice showed more pronounced

Telomere length analysis by Q-FISH (Quantitative-FISH).

hypoalgesia compared to the male mutant animals.

P1 P3 P4 A variety of genotype-related differences were found in our

clinical chemistry and haematological analyses. There was a slight

M2+/+ 23.9 ± 7.7 20.9 ± 4.7 25.6 ± 6.6

decrease in plasma levels of HDL-cholesterol after overnight fas-

M4+/− 21.2 ± 4.2 25.3 ± 8.2 23.5 ± 5.7

M7−/− 21.9 ± 7.8 22.0 ± 4.3 21.7 ± 5.6 ting, and mild increases in glucose and calcium concentrations in ad

libitum fed mice (p = 0.003–0.036). These together with decreased

Primary MEFs from wt, heterozygous or homozygous SMC6-S994A-neo mice were

incubated for 1, 3 or 4 passages prior to estimation of telomere length using Q-FISH. body fat could indicate minor effects on glucose metabolism.

±

Values are means SD of arbitrary fluorescence units. Haematological analysis showed mild to moderate increases of

Please cite this article in press as: L. Ju, et al., SMC6 is an essential gene in mice, but a hypomorphic mutant in the ATPase domain has a mild

phenotype with a range of subtle abnormalities, DNA Repair (2013), http://dx.doi.org/10.1016/j.dnarep.2013.02.006

G Model

DNAREP-1762; No. of Pages 11 ARTICLE IN PRESS

6 L. Ju et al. / DNA Repair xxx (2013) xxx–xxx

Fig. 3. Survival of SMC6-S994A-neo MEFs after exposure to DNA damaging agents. A, Plating efficiencies of different genotypes of primary SMC6-S994A-neo MEFs after

first and third passage in culture. 100 cells were plated and the number of colonies measured after two weeks. B-E, Transformed SMC6-S994A-neo MEFs were exposed to

the indicated DNA damaging agents prior to plating to form single colonies (C-E) or measurement of DNA synthesis 5 days later (B). Results represent means ± SD of 2–3

experiments or typical experiments. In B, C, E, results of individual MEF strains are shown. In D results from different wild-type and different −/− mutant animals have been

pooled.

white blood cell, platelet counts, and a trend towards a reduced No abnormalities were found in cardiovascular and lung screens.

red blood cell count associated with mild macrocytosis suggested The results are summarised in Table 4.

possible effects on hematopoietic proliferation and differentiation. Gene expression patterns in the brain, spleen and testis of

Analysis of immunoglobulin isotype levels in blood plasma (IgG1, four SMC6-S994A homozygous mice were compared with those in

IgG2b, IgG3, IgA, and IgM) revealed lower levels of IgG2b in the four heterozygous and wild-type mice, using Illumina Bead Arrays.

mutant mice. These organs were chosen because of known expression in the

Please cite this article in press as: L. Ju, et al., SMC6 is an essential gene in mice, but a hypomorphic mutant in the ATPase domain has a mild

phenotype with a range of subtle abnormalities, DNA Repair (2013), http://dx.doi.org/10.1016/j.dnarep.2013.02.006

G Model

DNAREP-1762; No. of Pages 11 ARTICLE IN PRESS

L. Ju et al. / DNA Repair xxx (2013) xxx–xxx 7

Fig. 4. Normal proliferation, cell cycle kinetics and p53 levels but increased induced SCEs in SMC6 mutant cell lines A, Proliferation rates of primary SMC6-S994A-neo

(left panel) and SMC6-S994A (right panel) MEFs with the indicated genotypes; B, Cell cycle parameters of primary wild-type and SMC6-S994A-neo MEFs. C, Normal (M2),

␥

heterozygous (M4) or homozygous (M6) Smc6-S994-neo primary fibroblasts were exposed to 0, 2 or 8 Gy of -irradiation and incubated for 2 h. D, M2 or M6 cells were

exposed to 0, 2 or 5 Gy ␥-irradiation and incubated for 2 or 4 h. The levels of total (C) or phosphorylated (D) p53 were analysed by immunoblotting using an antibody specific

for the phosphorylated form of p53. E, F SCEs induced by UV or MMC were measured in MEFs of the indicated genotypes.

brain, high expression in testis [29] and speculation of a possible and survivals measured by colony-forming ability. There were

involvement in the immune response. While no significant differ- no significant differences between wild-type, heterozygote and

ences were found in spleen, a limited number of genes showed homozygote SMC6-S994A-neo cell lines in their responses to UV,

weak but significant regulation in brain (16) and testis (50) between ionising radiation, MMS or MMC (Fig. 3B–E).

mutant (hom) and control (het + wt) mice (Supplementary Fig. 1a We generated further primary MEF cultures and maintained

and b). In the datasets of regulated genes, no over-represented func- them in the presence of 3% oxygen. Under these conditions there

tional annotations were identified by analysis. Also a were minimal differences in their proliferation rates (Fig. 4A), cell

literature-based network analysis found no relationships between cycle distributions (Fig. 4B) or telomere lengths (Table 5). p53 lev-

the differentially regulated genes. els were similar as was the stabilisation of p53 following exposure

to ionising radiation (Fig. 4C, D). However approximately twice

2.3. Phenotypes of MEFs as many sister chromatid exchanges (SCEs) were generated in

the homozygous SMC6-S994A or SMC6-S994A-neo cells following

MEFs were generated from embryos of both SMC6-S994A exposure to either UV or MMC than in the corresponding wild-type

strains. In the first series of experiments, they were grown in the cells (Fig. 4E, F).

␥

presence of 20% oxygen. The plating efficiency of the homozygous We also measured the accumulation of -H2AX foci when cells

SMC6-S994A-neo cells measured at the first and third passage of were prevented from proliferating by growth in medium contain-

the cells was much lower than in the wild-type or heterozygotes ing 0.5% fetal calf serum. Over a four-week period we observed the

␥

(Fig. 3A). Next, we generated spontaneously immortalized MEF accumulation of more -H2AX foci in homozygous SMC6-S994A-

lines by keeping the cells in culture until they passed through cri- neo cells (M7) than in wild-type cells (M2) (Fig. 5). This was seen

sis. These cells were exposed to different DNA damaging agents after growth in the presence of 3 or 20% oxygen, though it was more

Please cite this article in press as: L. Ju, et al., SMC6 is an essential gene in mice, but a hypomorphic mutant in the ATPase domain has a mild

phenotype with a range of subtle abnormalities, DNA Repair (2013), http://dx.doi.org/10.1016/j.dnarep.2013.02.006

G Model

DNAREP-1762; No. of Pages 11 ARTICLE IN PRESS

8 L. Ju et al. / DNA Repair xxx (2013) xxx–xxx

Surprisingly, in contrast to the corresponding S. pombe mutant,

the MEFs from the SMC6-S994A mice were not significantly sen-

sitive to any DNA damaging agents tested. We were able to detect

an increased level of SCEs induced by either UV or MMC (Fig. 4E,

F), as well as indications of decreased ability to repair oxidative

damage in non-dividing cells (Fig. 5). These data implicate the

Smc5-6 complex in protection of cells from aberrant recombina-

tion between sister chromatids and from some of the effects of

oxidative damage. Interestingly, increased spontaneous and MMC-

−/−

induced SCEs were also observed in the DT40 Smc5 cells [27],

whereas decreased camptothecin-induced SCEs were observed in

human 293 cells depleted for hNSE2/hMMS21 using siRNA [22].

The mild phenotype of our MEFs is surprising, because the

equivalent serine in the LSGG signature motif of Rad50 binds to the

Fig. 5. Increased DNA damage in non-proliferating Smc6-S994A-neo cells Serum- ␥

-phosphate of ATP [26] and is required for ATP hydrolysis. Since

starved wild-type (M2) or Smc6-S994A-neo (M7) cells were incubated in the

ATP hydrolysis is thought to be essential for the Smc protein fam-

presence of 3% or 20% oxygen for increasing periods of time up to four weeks. Cells

ily’s functions, a stronger phenotype may have been anticipated.

were harvested and the number of ␥H2AX foci analysed by immunofluorescence.

We speculate that in the dimeric heads domain of Smc5-6, the Smc5

head remains intact and capable of hydrolysing ATP, assuming that

marked with 20% oxygen and suggests that the SMC6-S994A-neo

the mode of action is similar to that of other Smc proteins. This may

cells were deficient in the repair of double-strand breaks generated

be sufficient to allow the complex to carry out most of its functions.

by oxidative damage.

In summary, we have shown that the SMC6 gene is essential in

mammals and that a SMC6 ATP hydrolysis mutant confers modest

3. Discussion sensitivity to induction of SCEs and oxidative damage and subtle

defects in phenotype.

The SMC proteins play crucial roles in chromosome mainte-

nance and genome stability. Although studies in yeasts and cultured

mammalian cells have shown that the Smc5-6 complex has both 4. Materials and methods

early and late roles in recombination, its precise mode of action

and especially its essential role remains enigmatic. Although there 4.1. Mice

have been several reports on the effects of siRNA depletion of Smc5-

6 components, there is only one study on genetic deletion of one The RRT274 mice were obtained from Bay Genomics as het-

of these genes (Smc5) in animal cells [27]. Intriguingly deletion of erozygotes in a C57Bl6/129 background. For the S994A mutant,

the Smc5 gene from chicken DT40 cells was not lethal, although it gene targeting was carried out in ES cells derived from 129ola-

conferred sensitivity to DNA damaging agents and reduced intra- E14 mice. The targeting construct was assembled from appropriate

chromatid recombination. fragments and the T corresponding to T2982 in Smc6 cDNA was

−/−

We have attempted to generate a smc6 knock-out mouse, mutated to G resulting in S994A in the encoded SMC6 protein.

but the homozygous mouse was embryonic lethal with no intact The neo-TK cassette was inserted into intron 25. The chimeric

embryos at E9.5. Thus Smc6 is essential in mammals at the level of mice were bred with C57Bl6 mice to generate heterozygotes in a

the whole organism. It is required early in development and may mixed background. To remove the neo-tk cassette, the strain was

well be needed, as in the yeasts, for cell proliferation. crossed with transgenic mice, expressing the Cre recombinase from

In contrast a knock-in SMC6-S994A mutant mouse had a rather the CAG promoter (a combination of the cytomegalovirus early

mild phenotype, even though the corresponding smc6-S1045A enhancer element and chicken beta-actin promoter). These were

mutant in S. pombe had a strong DNA-damage sensitivity phe- generated by injection of fertilized with linearized plas-

notype. The mice had some interesting subtle abnormalities that mid pCAGGS-CRE [31]. A detailed description of the generation and

were revealed in an extensive survey. These included hypoalge- characterization of this mouse line will be presented elsewhere.

sia, indications of decreased glucose tolerance and subtle immune FVB Cag::Cre mice to generate the SMC6-S994A strain in a hybrid

abnormalities. Our survey was wide-ranging and the anomalies C57Bl6-129ola-FVB background.

observed need to be analysed in more depth to understand their

relationship to the deficient SMC6, which is at present not clear and

must await a deeper understanding of the functions of the Smc5-6 4.2. Genotyping

complex. It is of interest, however, that impaired glucose tolerance,

which was indicated in our mice, has also been reported recently 5 mm of mouse tail tip in 100 ␮l of 25 mM NaOH was heated

◦

in a patient with the genome instability disorder Werner’s Syn- to 95 C for 1 h and neutralised with 400 ␮l of 10 mM tris–HCl. For

drome [30]. This suggests an as yet poorly understood link between RRT274 genotyping, 2 ␮l genomic DNA was amplified in a 25 ␮l

defective DNA damage responses and impaired glucose tolerance. PCR with forward primer CCGTGGTTTCTACTAGGAAAGA in exon 6

The hints of involvement in neuronal function (hypoalgesia) and of Smc6 (E6F) and reverse primer GCCTGATCTACATAGCGAGTTC in

immune response (decreased IgG2b) provide interesting leads for intron 6 (I6R), which gave a 704 bp PCR product in the absence of

future work with suggestion of a possible role for Smc6 in immune the gene-trap insertion. The same forward primer and the reverse

␤

development and neuronal function. The SMC6-S994A-neo mutant primer ATTCAGGCTGCGCAACTGTTG in the -geo marker gene of

␤

mice in which the neo gene used in generating the mouse remained the gene-trap construct ( gR) gave a 745 bp PCR product when the

in intron 25 were smaller than controls but otherwise healthy. The insertion was present.

␮

presence of the neo gene resulted in a reduction in transcription For Smc6-S994A genotyping, 2 l genomic DNA was amplified

of the Smc6 gene and reduced Smc6 protein levels that presum- in a 25 ␮l PCR with forward primer P1: CCCTGGTAAAGCATCCTAACT

ably resulted in the reduced size, implying that Smc6 is required and reverse primer P2: CAGGCAAACGCTCAAGATGTAC. The PCR

for normal development. product was digested with NgoMIV and the digestion products run

Please cite this article in press as: L. Ju, et al., SMC6 is an essential gene in mice, but a hypomorphic mutant in the ATPase domain has a mild

phenotype with a range of subtle abnormalities, DNA Repair (2013), http://dx.doi.org/10.1016/j.dnarep.2013.02.006

G Model

DNAREP-1762; No. of Pages 11 ARTICLE IN PRESS

L. Ju et al. / DNA Repair xxx (2013) xxx–xxx 9

on a 1% agarose gel. The S994A mutation introduces a NaeI/NgoMIV 4.3.5. Immunology

site into the product. The flow cytometric analysis of leukocyte populations in periph-

eral blood was based on two 10-parameter staining panels (as

described in: [28]), covering markers for B cells (CD19, IgD, B220),

4.3. Phenotypic analysis in the GMC

T cells (CD3, CD4, CD8, CD5), granulocytes (GR-1, CD11b), NK cells

(NKp46) and further subsets (CD44, CD62L, CD25, Ly6C). Cells were

A cohort of 40 mice, 20 mice per sex, and the same number of

prepared as described previously [34]. In short, after red blood cell

wild-type control littermates was phenotypically analyzed at the

lysis, cells were washed in FACS buffer (PBS, 0.5% BSA, 0.02% sodium

German Mouse Clinic in a two pipeline systematic primary pheno-

azide, pH 7.45) and incubated with Fc block (anti-mouse CD16/32),

typing screen as previously described [28], with ten mice per group

fluorescence-conjugated antibodies (BD Biosciences, Heidelberg,

being utilized for each test.

Germany) and propidium iodide. Cells were prepared on a 96-

well plate and acquired with a FACS LSR II-HTS (BD, San Diego,

4.3.1. Bone mineral density and body composition

USA), using the CD45 parameter as trigger channel. Approxi-

These were analyzed using a pDEXA Sabre X-ray Bone Densito-

mately 30,000 leukocytes per sample were acquired. Analysis was

meter (Norland Medical Systems. Inc., Basingstoke, Hampshire, UK;

done with FlowJo (Tree Star, Inc., Oregon USA); dead cells were

distributed by Stratec Medizintechnik GmbH, Pforzheim, Germany,

eliminated on the basis of their propidium iodide signal and sub-

scan speed 20 mm/s, resolution 0.5 mm × 1.0 mm, Histogram Aver-

populations gated for corresponding leukocyte markers.

2

aging Width setting 0.020 g/cm ) as previously described [32]. Body

Immunoglobulin isotype levels were measured using a com-

composition was analyzed by time domain nuclear magnetic res-

bined competitive and non-competitive multiplex bead assay.

onance (TD-NMR, (Bruker LF 60 MiniSpec) providing a method for ␮

Briefly, 25 l/well of blood plasma diluted in FACS buffer and sev-

the measurement of lean tissue and body fat in live mice without

enfold serial dilutions of unlabelled mouse IgG2b, IgG1, IgG2b, IgG3,

anaesthesia.

IgM and IgA for the standard curves were added in a 96-well plate,

respectively. The bead mixture which contained Luminex beads

of five different regions coupled with antibodies (Abs) specific for

4.3.2. Glucose tolerance

mouse IgG1, IgG2a, IgG3, IgM and IgA (Bioplex Bead coupling Kit,

Glucose tolerance was tested at the age of 13 weeks accord-

Biorad, CA, USA), and beads of a sixth region coupled with biotiny-

ing to the following protocol. After overnight fasting for 16–18 h,

lated antibodies (Abs) specific for mouse IgG2b was added and

the body mass of each mouse was determined and basal glucose

incubated for 10 min. A mixture of biotinylated immunoglobulin

levels were measured from a drop of blood collected from the

IgG1, IgG2a, IgG3, IgM, and IgA (competitive assay) was added to

tail vein using a hand-held glucometer (Accu Check Aviva, Roche,

the samples, incubated for further 20 min and washed three times

Mannheim, Germany). Thereafter mice were injected intraperi-

with FACS buffer. Streptavidin- PE was added to the plates and after

toneally with 2 g of glucose/kg body weight using a 20% glucose

10 min of incubation and washings, samples were measured and

solution (Braun, Melsungen). Blood glucose levels were determined

results obtained on a Bio-Plex reader (100 beads/region/analyte;

as described above 15, 30, 60 and 120 min after glucose injection,

Biorad).

using additional drops of blood collected from the same incision.

4.3.6. Neurology

4.3.3. Blood collection

Standardized neurological analysis was performed as described

Blood samples for the analyses of clinical chemical and hema-

earlier [28],[35] (http://empress.har.mrc.ac.uk/viewempress/

tological parameters were collected by retrobulbar puncture from

index.php?pipeline = EUMODIC + Pipeline+2). Briefly, a modified

isoflurane-anaesthetized mice. In pipeline 1, mice aged 15 weeks

SHIRPA protocol was used for the evaluation of general appearance

were fasted overnight for 16–18 h prior to blood collection. Blood

and basic neurological functions. In addition, Grip strength was

samples collected in heparinized tubes from fasted mice were

analyzed by measuring the force a mouse applies to a grid attached

stored in a rack on wet ice until being separated by centrifuga-

to a force meter. Coordination and balance were determined

tion. Samples collected from ad libitum fed mice in pipeline 2

with an accelerating rotarod (4–40 rpm in 5 min) in 3 trials with

were distributed in heparinized tubes and EDTA-coated tubes for

15-min intertrial intervals. For statistical analysis of grip strength

hematological analyses and processed as described previously [33].

and rotarod linear models were applied including genotype, sex

Plasma obtained from these heparin-blood samples was distributed

and body weight (and trial number for rotarod) and relevant

for different blood-based screens.

interactions in the analysis.

4.3.4. Clinical chemical and hematological analyses 4.3.7. Nociception

All clinical chemical parameters were determined using In the nociception screen we tested the pain reactivity of

an AU400 autoanalyzer (Olympus, Germany, distributed by the animals using the hotplate test. The first and second pain

Beckman-Coulter in the meantime) and adapted reagents from reactions were evaluated as described before [36]; http://empress.

Beckman-Coulter, Wako and. Plasma collected from fasted mice har.mrc.ac.uk/viewempress/index.php?pipeline = EUMODIC

was immediately analyzed for concentrations of total choles- +Pipeline+2)

terol, HDL–cholesterol, triglyceride, glucose, non-esterified fatty

acids (NEFA) and glycerol. Clinical chemistry analyses of a set 4.3.8. Expression profiling

of 18 parameters (concentrations of sodium, chloride, potassium, Total RNA was isolated just before processing from brain, testis

calcium, inorg. phosphorus, iron, total protein, albumin, urea, creat- and spleen of four homozygous, two heterozygous and two wild-

inine, total cholesterol, triglyceride, and glucose, as well as plasma type mice. For each selected organ one Illumina Bead Chip, was

␣

activities of ALAT, ASAT, AP, -amylase and LDH) from plasma sam- processed. Biological replicates for each genotype group were per-

ples collected in pipeline 2 were performed on the day of collection formed. Therefore, 500 ng of total RNA was amplified in a single

using 1:2 diluted samples. Hematological parameters were mea- round with the Illumina TotalPrep RNA Amplification Kit (Amibon).

sured from EDTA-blood, stored at room temperature on a rotary 750 ng of amplified RNA was hybridized on Illumina MouseRef8

agitator until analysis using the Abc-animal blood counter (Scil v2.0 Expression Bead Chips containing about 25 K probes

animal care company GmbH, Viernheim, Germany). (25.600 well-annotated RefSeq transcripts). Staining and scanning

Please cite this article in press as: L. Ju, et al., SMC6 is an essential gene in mice, but a hypomorphic mutant in the ATPase domain has a mild

phenotype with a range of subtle abnormalities, DNA Repair (2013), http://dx.doi.org/10.1016/j.dnarep.2013.02.006

G Model

DNAREP-1762; No. of Pages 11 ARTICLE IN PRESS

10 L. Ju et al. / DNA Repair xxx (2013) xxx–xxx

(Illumina HiScan Array reader) was done according to the Illumina 4.4.4. Smc6 protein levels

expression protocol. Whole cell extracts containing 30 ␮g of protein was run in

For statistical analysis of the data, Illumina Genomestu- each lane of a 10% acrylamide gel and blotted onto PVDF mem-

dio 2011.1 software was used for background correction and brane (Hybond ECL, GE Healthcare). The membrane was incubated

◦

normalization of the data (quantile algorithm). The remaining overnight at 4 C with rabbit anti-human Smc6 antibody 6A1

negative expression values were corrected by introducing an [29] at 1:1000 dilution followed by 20 min with secondary anti-

offset. The identification of significant gene regulation was per- body (Dako swine anti-rabbit HRP P0217) at 1:5000 dilution. After

formed using SAM (Significant Analysis of Microarrays) included washing, chemiluminescence reagent was added (Western Light-

in the TM4 software package [37–39]. The selection of the ning Plus-ECL). The gel image was obtained by exposure to film

top differentially expressed genes with reproducible up- or (Hyperfilm ECL, GE Healthcare) for 20 min. Band intensities were

down-regulation includes less than 10% false positives (FDR) obtained by recording chemiluminescence (ImageQuant LAS4000,

×

in combination with fold change > 1.3 . Expression data were GE Healthcare) and quantitating the resulting file in ImageQuant

submitted to the Gene Expression Omnibus (GEO) database 5.1 (Molecular Dynamics).

(http://www.ncbi.nlm.nih.gov/geo/) (GSE238737)..

4.4.5. p53 levels

4.4. MEF culture ␥

Cells plated on 6 cm plates were -irradiated with different

doses. At intervals cells were washed with PBS and extracted by

In an early series of experiments, fibroblast cultures were estab-

adding 100 ␮l of Laemmli buffer and scraping from the plate. 20 ␮l

lished from embryos and grown in Eagle’s DMEM supplemented

of cell extract was run in each lane of the gel. p53 levels were

with non-essential amino-acids and 15% fetal calf serum in the

analysed by immunoblotting.

presence of 20% oxygen. After crisis, established immortal lines

grew out of the cultures. In a subsequent set of experiments, pri-

Acknowledgments

mary cultures were grown and maintained in the presence of 3%

oxygen [40].

We would like to thank Reinhard Seeliger, Anke Bettenbrock,

Elfi Holupirek, Florian Schleicher, Waldtraud Stettinger, Susanne

4.4.1. Cell survival and SCE measurement

5 Wittich, and Anja Wohlbier as well as the GMC animal caretaker

For MMC and MMS treatment, 4 × 10 cells were plated in each

team for expert technical help.

of four 25 ml flasks. The next day the cells were washed with

Work in ARL’s lab was funded by MRC programme grants and EU

PBS and exposed to different concentrations of MMC in PBS for

◦ FP6 grants. The work of the GMC was funded by the German Federal

10 min, or MMS in medium for 1 h at 37 C. Cells were washed with

Ministry of Education and Research to the GMC (NGFN-Plus grant

PBS, trypsinized, counted, diluted and plated in triplicate in 10 cm

No. 01GS0850, 01GS0851, 01GS0852, GS0853; Infrafrontier grant

dishes. For ␥-irradiation, cells were trypsinized, irradiated in sus-

137 01KX1012), and and the German Center for Vertigo and Balance

pension in medium from a Cs irradiator and then plated as above.

Disorders (IFB grant 01 EO 0901). This work was funded in part by

After treatments, cells were incubated for 12–14 days and colonies

the Helmholtz Alliance ICEMED (Initiative and Network Fund of the

were stained with methylene blue.

Helmholtz Association) and the DZD (German Center for Diabetes

For UV-irradiation, survival was assessed by the ability of cells

3 Research).

to incorporate H thymidine five days after exposure to different

doses of UVC-irradiation.

Sister chromatid exchanges were analysed using the fluores- Appendix A. Supplementary data

cence plus Giemsa method. Cells were treated with mutagen and

then grown for two generations in 20 ␮M 5-bromodeoxyuridine. Supplementary data associated with this article can be

0.1 ␮g/ml colcemid was added 2 h before harvesting. Trypsinized found, in the online version, at http://dx.doi.org/10.1016/j.dnarep.

cells were allowed to swell for 20 min in 75 mM KCl, then fixed in 2013.02.006.

3:1 methanol:acetic acid and spread on slides. The dried slides were

incubated with 10 ␮g/ml Hoechst 33258 for 20 minutes, washed

References

with MacIlvane solution (pH7.0, 164 mM Na2HPO4, 16 mM citric

acid), covered with a coverslip and irradiated under 355–360 nm

[1] D. Dorsett, L. Strom, The ancient and evolving roles of cohesin in gene expres-

2

UVA at 0.4 J/m /s for 1 h. Slides were then immersed in 2×SSC at sion and DNA repair, Curr. Biol. 22 (2012) R240–R250.

◦

[2] A. Losada, T. Hirano, Dynamic molecular linkers of the genome: the first decade

60 C for 1 h, then stained with 3% Giemsa solution for 20 min.

of SMC proteins, Genes Dev. 19 (2005) 1269–1287.

[3] J.M. Murray, A.M. Carr, Smc5/6: a link between DNA repair and unidirectional

replication? Nat. Rev. Mol. Cell Biol. 9 (2007) 177–182.

4.4.2. Telomere length measurement

[4] P.R. Potts, The Yin and Yang of the MMS21-SMC5/6 SUMO ligase complex in

Telomere lengths were determined using interphase Q-FISH as

homologous recombination, DNA Repair (Amst) 8 (2009) 499–506.

described by [41]. [5] J. Sergeant, E. Taylor, J. Palecek, M. Fousteri, E. Andrews, S. Sweeney, H.

Shinagawa, F.Z. Watts, A.R. Lehmann, Composition and architecture of the Sch-

izosaccharomyces pombe Rad18 (Smc5-6) complex, Mol. Cell. Biol. 25 (2005)

4.4.3. -H2AX foci 172–184.

[6] X. Zhao, G. Blobel, A SUMO ligase is part of a nuclear multiprotein complex that

Primary MEFs growing in the presence of 5% CO2 and 3% O2

5 affects DNA repair and chromosomal organization, Proc. Natl. Acad. Sci. USA

were plated on glass coverslips in 3 cm dishes at 5 × 10 cells/dish

102 (2005) 4777–47782.

and grown further in either 3% or 20% O2. At intervals cells [7] S. Pebernard, J. Wohlschlegel, W.H. McDonald, J.R. Yates, M.N. Boddy III, The

were fixed in PBS with 3% paraformaldehyde and 2% sucrose for Nse5-Nse6 dimer mediates DNA repair roles of the Smc5–Smc6 complex, Mol.

Cell. Biol. 26 (2006) 1617–1630.

10 minutes at room temperature, then permeabilised with PBS and

[8] J.M. Doyle, J. Gao, J. Wang, M. Yang, P.R. Potts, MAGE-RING protein complexes

0.5% TritonX-100 for 5 min. Slides were probed with mouse mono-

comprise a family of E3 ubiquitin ligases, Mol. Cell 39 (2010) 963–974.

clonal anti-␥H2AX antibody (Upstate) diluted 1:1000 followed [9] E.A. Andrews, J. Palecek, J. Sergeant, E. Taylor, A.R. Lehmann, F.Z. Watts, Nse2, a

component of the Smc5-6 complex, is a SUMO ligase required for the response

by Alexafluor Cy555-conjugated anti-mouse secondary antibody

to DNA damage, Mol. Cell. Biol. 25 (2005) 185–196.

(Molecular Probes). DAPI was added to the secondary antibody at

[10] P.R. Potts, H. Yu, Human MMS21/NSE2 Is a SUMO ligase required for DNA repair,

0.000025% and foci were analysed by fluorescence microscopy. Mol. Cell. Biol. 25 (2005) 7021–7032.

Please cite this article in press as: L. Ju, et al., SMC6 is an essential gene in mice, but a hypomorphic mutant in the ATPase domain has a mild

phenotype with a range of subtle abnormalities, DNA Repair (2013), http://dx.doi.org/10.1016/j.dnarep.2013.02.006

G Model

DNAREP-1762; No. of Pages 11 ARTICLE IN PRESS

L. Ju et al. / DNA Repair xxx (2013) xxx–xxx 11

[11] X. Duan, P. Sarangi, X. Liu, G.K. Rangi, X. Zhao, H. Ye, Structural and functional [30] E. Raffan, L.A. Hurst, S.A. Turki, G. Carpenter, C. Scott, A. Daly, A. Coffey, S.

insights into the roles of the Mms21 subunit of the Smc5/6 complex, Mol. Cell Bhaskar, E. Howard, N. Khan, H. Kingston, A. Palotie, D.B. Savage, M. O’Driscoll,

35 (2009) 657–668. C. Smith, S. O’Rahilly, I. Barroso, R.K. Semple, Early diagnosis of Werner’s

[12] E.M. Taylor, A.C. Copsey, J.J. Hudson, S. Vidot, A.R. Lehmann, Identification of Syndrome using exome-wide sequencing in a single, atypical patient, Front.

the proteins, including MAGEG1, that make up the human SMC5-6 protein Endocrinol. (Lausanne) 2 (2011) 8.

complex, Mol. Cell. Biol. 28 (2008) 1197–1206. [31] K. Araki, M. Araki, J. Miyazaki, P. Vassalli, Site-specific recombination of a trans-

[13] J. Palecek, S. Vidot, M. Feng, A.J. Doherty, A.R. Lehmann, The SMC5-6 DNA repair gene in fertilized eggs by transient expression of Cre recombinase, Proc. Natl.

complex: Bridging of the SMC5-6 heads by the Kleisin, NSE4, and non-Kleisin Acad. Sci. USA 92 (1995) 160–164.

subunits, J. Biol. Chem. 281 (2006) 36952–36959. [32] K. Abe, H. Fuchs, A. Boersma, W. Hans, P. Yu, S. Kalaydjiev, M. Klaften, T. Adler, J.

[14] X. Duan, Y. Yang, Y.H. Chen, J. Arenz, G.K. Rangi, X. Zhao, H. Ye, Architecture of Calzada-Wack, I. Mossbrugger, B. Rathkolb, J. Rozman, C. Prehn, M. Maraslioglu,

the Smc5/6 complex of reveals a unique interaction Y. Kametani, S. Shimada, J. Adamski, D.H. Busch, I. Esposito, M. Klingenspor, E.

between the Nse5-6 subcomplex and the hinge regions of Smc5 and Smc6, J. Wolf, W. Wurst, V. Gailus-Durner, M. Katan, S. Marschall, D. Soewarto, S. Wag-

Biol. Chem. 284 (2009) 8507–8515. ner, M. Hrabeˇ de Angelis, A novel N-ethyl-N-nitrosourea-induced mutation

[15] A. Irmisch, E. Ampatzidou, K. Mizuno, M.J. O’Connell, J.M. Murray, Smc5/6 main- in phospholipase Cgamma2 causes inflammatory arthritis, metabolic defects,

tains stalled replication forks in a recombination-competent conformation, and male infertility in vitro in a murine model, Arthritis Rheum. 63 (2011)

EMBO J. 28 (2009) 144–155. 1301–1311.

[16] A.R. Lehmann, M. Walicka, D.J.F. Griffiths, J.M. Murray, F.Z. Watts, S. McCready, [33] J.F. Staropoli, L. Haliw, S. Biswas, L. Garrett, S.M. Holter, L. Becker, S. Skosyrski,

A.M. Carr, The rad18 gene of Schizosaccharomyces pombe defines a new sub- P. Da Silva-Buttkus, J. Calzada-Wack, F. Neff, B. Rathkolb, J. Rozman, A. Schrewe,

group of the SMC superfamily involved in DNA repair, Mol. Cell. Biol. 15 (1995) T. Adler, O. Puk, M. Sun, J. Favor, I. Racz, R. Bekeredjian, D.H. Busch, J. Graw, M.

7067–7080. Klingenspor, T. Klopstock, E. Wolf, W. Wurst, A. Zimmer, E. Lopez, H. Harati, E.

[17] E. Ampatzidou, A. Irmisch, J.M. O’Connell, J.M. Murray, Smc5/6 is required for Hill, D.S. Krause, J. Guide, E. Dragileva, E. Gale, V.C. Wheeler, R.M. Boustany, D.E.

repair at collapsed replication forks, Mol. Cell. Biol. 26 (2006) 9387–9401. Brown, S. Breton, K. Ruether, V. Gailus-Durner, H. Fuchs, M. Hrabeˇ de Angelis,

[18] G. De Piccoli, F. Cortes-Ledesma, G. Ira, J. Torres-Rosell, S. Uhle, S. Farmer, S.L. Cotman, Large-scale phenotyping of an accurate genetic mouse model of

J.Y. Hwang, F. Machin, A. Ceschia, A. McAleenan, V. Cordon-Preciado, A. JNCL identifies novel early pathology outside the central nervous system, PLoS

Clemente-Blanco, F. Vilella-Mitjana, P. Ullal, A. Jarmuz, B. Leitao, D. Bressan, ONE 7 (2012) e38310.

F. Dotiwala, A. Papusha, X. Zhao, K. Myung, J.E. Haber, A. Aguilera, L. Aragon, [34] H. Fuchs, V. Gailus-Durner, T. Adler, J.A. Aguilar-Pimentel, L. Becker, J. Calzada-

Smc5–Smc6 mediate DNA double-strand-break repair by promoting sister- Wack, P. Da Silva-Buttkus, F. Neff, A. Gotz, W. Hans, S.M. Holter, M. Horsch,

chromatid recombination, Nat. Cell Biol. 8 (2006) 1032–1034. G. Kastenmuller, E. Kemter, C. Lengger, H. Maier, M. Matloka, G. Moller, B.

[19] J. Torres-Rosell, I. Sunjevaric, G. De Piccoli, M. Sacher, N. Eckert-Boulet, R. Reid, Naton, C. Prehn, O. Puk, I. Racz, B. Rathkolb, W. Romisch-Margl, J. Rozman, R.

S. Jentsch, R. Rothstein, L. Aragon, M. Lisby, The Smc5–Smc6 complex and SUMO Wang-Sattler, A. Schrewe, C. Stoger, M. Tost, J. Adamski, B. Aigner, J. Beckers, H.

modification of Rad52 regulates recombinational repair at the ribosomal gene Behrendt, D.H. Busch, I. Esposito, J. Graw, T. Illig, B. Ivandic, M. Klingenspor, T.

, Nat. Cell Biol. 9 (2007) 923–931. Klopstock, E. Kremmer, M. Mempel, S. Neschen, M. Ollert, H. Schulz, K. Suhre, E.

[20] L. Strom, C. Karlsson, H.B. Lindroos, S. Wedahl, Y. Katou, K. Shirahige, C. Sjogren, Wolf, W. Wurst, A. Zimmer, M. Hrabeˇ de Angelis, Mouse phenotyping, Methods

Postreplicative formation of cohesion is required for repair and induced by a 53 (2011) 120–135.

single DNA break, Science 317 (2007) 242–245. [35] I. Schneider, W.S. Tirsch, T. Faus-Kessler, L. Becker, E. Kling, R.L. Busse, A. Ben-

[21] E.A. Outwin, A. Irmisch, J.M. Murray, M.J. O’Connell, Smc5–Smc6-dependent der, B. Feddersen, J. Tritschler, H. Fuchs, V. Gailus-Durner, K.H. Englmeier, M.

removal of cohesin from mitotic chromosomes, Mol. Cell. Biol. 29 (2009) Hrabe de Angelis, T. Klopstock, Systematic, standardized and comprehensive

4363–4375. neurological phenotyping of inbred mice strains in the German Mouse Clinic,

[22] P.R. Potts, M.H. Porteus, H. Yu, Human SMC5/6 complex promotes sister chro- J. Neurosci. Methods 157 (2006) 82–90.

matid homologous recombination by recruiting the SMC1/3 cohesin complex [36] W. Enard, S. Gehre, K. Hammerschmidt, S.M. Holter, T. Blass, M. Somel, M.K.

to double-strand breaks, EMBO J. 25 (2006) 3377–3388. Bruckner, C. Schreiweis, C. Winter, R. Sohr, L. Becker, V. Wiebe, B. Nickel, T. Giger,

[23] P.R. Potts, H. Yu, The SMC5/6 complex maintains telomere length in ALT cancer U. Muller, M. Groszer, T. Adler, A. Aguilar, I. Bolle, J. Calzada-Wack, C. Dalke, N.

cells through SUMOylation of telomere-binding proteins, Nat. Struct. Mol. Biol. Ehrhardt, J. Favor, H. Fuchs, V. Gailus-Durner, W. Hans, G. Holzlwimmer, A.

14 (2007) 581–590. Javaheri, S. Kalaydjiev, M. Kallnik, E. Kling, S. Kunder, I. Mossbrugger, B. Naton,

[24] S. Behlke-Steinert, L. Touat-Todeschini, D.A. Skoufias, R.L. Margolis, SMC5 and I. Racz, B. Rathkolb, J. Rozman, A. Schrewe, D.H. Busch, J. Graw, B. Ivandic, M.

MMS21 are required for chromosome cohesion and mitotic progression, Cell Klingenspor, T. Klopstock, M. Ollert, L. Quintanilla-Martinez, H. Schulz, E. Wolf,

Cycle 8 (2009) 2211–2218. W. Wurst, A. Zimmer, S.E. Fisher, R. Morgenstern, T. Arendt, M. Hrabeˇ de Angelis,

[25] M.I. Fousteri, A.R. Lehmann, A novel SMC protein complex in Schizosaccharo- J. Fischer, J. Schwarz, S. Paabo, A humanized version of Foxp2 affects cortico-

myces pombe contains the Rad18 DNA repair protein, EMBO J. 19 (2000) basal ganglia circuits in mice, Cell 137 (2009) 961–971.

1691–1702. [37] M. Horsch, S. Schadler, V. Gailus-Durner, H. Fuchs, H. Meyer, M. Hrabeˇ de Ange-

[26] K.P. Hopfner, A. Karcher, D.S. Shin, L. Craig, L.M. Arthur, J.P. Carney, J.A. Tainer, lis, J. Beckers, Systematic gene expression profiling of mouse model series

Structural biology of Rad50 ATPase: ATP-driven conformational control in DNA reveals coexpressed genes, Proteomics 8 (2008) 1248–1256.

double-strand break repair and the ABC-ATPase superfamily, Cell 101 (2000) [38] A.I. Saeed, V. Sharov, J. White, J. Li, W. Liang, N. Bhagabati, J. Braisted, M. Klapa, T.

789–800. Currier, M. Thiagarajan, A. Sturn, M. Snuffin, A. Rezantsev, D. Popov, A. Ryltsov,

[27] A.K. Stephan, M. Kliszczak, H. Dodson, C. Cooley, C.G. Morrison, Roles of ver- E. Kostukovich, I. Borisovsky, Z. Liu, A. Vinsavich, V. Trush, J. Quackenbush,

tebrate Smc5 in sister chromatid cohesion and homologous recombinational TM4: a free, open-source system for microarray data management and analysis,

repair, Mol. Cell. Biol. 31 (2011) 1369–1381. Biotechniques 34 (2003) 374–378.

[28] V. Gailus-Durner, H. Fuchs, T. Adler, A. Aguilar Pimentel, L. Becker, I. Bolle, J. [39] V.G. Tusher, R. Tibshirani, G. Chu, Significance analysis of microarrays applied

Calzada-Wack, C. Dalke, N. Ehrhardt, B. Ferwagner, W. Hans, S.M. Holter, G. to the ionizing radiation response, Proc. Natl. Acad. Sci. USA 98 (2001)

Holzlwimmer, M. Horsch, A. Javaheri, M. Kallnik, E. Kling, C. Lengger, C. Morth, 5116–5121.

I. Mossbrugger, B. Naton, C. Prehn, O. Puk, B. Rathkolb, J. Rozman, A. Schrewe, F. [40] S. Parrinello, E. Samper, A. Krtolica, J. Goldstein, S. Melov, J. Campisi, Oxygen

Thiele, J. Adamski, B. Aigner, H. Behrendt, D.H. Busch, J. Favor, J. Graw, G. Held- sensitivity severely limits the replicative lifespan of murine fibroblasts, Nat.

maier, B. Ivandic, H. Katus, M. Klingenspor, T. Klopstock, E. Kremmer, M. Ollert, Cell Biol. 5 (2003) 741–747.

L. Quintanilla-Martinez, H. Schulz, E. Wolf, W. Wurst, M. Hrabeˇ de Angelis, [41] G.N. Pitiyage, P. Slijepcevic, A. Gabrani, Y.G. Chianea, K.P. Lim, S.S. Prime,

Systemic first-line phenotyping, Methods Mol. Biol. 530 (2009) 463–509. W.M. Tilakaratne, F. Fortune, E.K. Parkinson, Senescent mesenchymal cells

[29] E.M. Taylor, J.S. Moghraby, J.H. Lees, B. Smit, P.B. Moens, A.R. Lehmann, accumulate in human fibrosis by a telomere-independent mechanism and

Characterisation of a novel human SMC heterodimer homologous to the ameliorate fibrosis through matrix metalloproteinases, J. Pathol. 223 (2011)

Schizosaccharomyces pombe Rad18/Spr18 complex, Mol. Biol. Cell 12 (2001) 604–617.

1583–1594.

Please cite this article in press as: L. Ju, et al., SMC6 is an essential gene in mice, but a hypomorphic mutant in the ATPase domain has a mild

phenotype with a range of subtle abnormalities, DNA Repair (2013), http://dx.doi.org/10.1016/j.dnarep.2013.02.006