Signaling Molecules§ Erin E

Veterinary Immunology and Immunopathology 112 (2006) 302–308 www.elsevier.com/locate/vetimm Short communication Cloning and radiation hybrid mapping of bovine toll-like receptor-4 (TLR-4) signaling molecules§ Erin E. Connor a, Elizabeth A. Cates a,b, John L. Williams c, Douglas D. Bannerman a,*

a Bovine Functional Genomics Laboratory, U.S. Department of Agriculture, Agricultural Research Service, Beltsville, MD 20705, USA b University of Maryland, College Park, MD 20742, USA c Roslin Institute (Edinburgh), Roslin, Midlothian, Scotland, UK

Received 17 January 2006; accepted 7 March 2006

Abstract

Toll-like receptor (TLR)-4 is a transmembrane receptor for lipopolysaccharide, a highly pro-inflammatory component of the outer membrane of Gram-negative bacteria. To date, molecules of the TLR-4 signaling pathway have not been well characterized in cattle. The goal of this study was to clone and sequence the full-length coding regions of bovine genes involved in TLR-4 signaling including CASP8, IRAK1, LY96 (MD-2), TICAM2, TIRAP, TOLLIP and TRAF 6 and to position these genes, as well as MyD88 and TICAM1, on the bovine genome using radiation hybrid mapping. Results of this work indicate differences with a previously published bovine sequence for LY96 and a predicted sequence in the GenBank database for TIRAP based on the most recent assembly of the bovine genome. In addition, discrepancies between actual and predicted chromosomal map positions based on the Btau_2.0 genome assembly release were identified, although map positions were consistent with predicted locations based on the current bovine-human comparative map. Alignment of the bovine amino acid sequences with human and murine sequences showed a broad range in conservation, from 52 to 93%. Overall, this work should assist in the assembly and annotation of the bovine genome sequence, the identification of variations in genes critically involved in host innate immunity, and facilitate the study of TLR-4 signaling pathways in cattle. # 2006 Elsevier B.V. All rights reserved.

Keywords: Apoptosis; Mastitis; Endotoxin; Inﬂammation

§ The nucleotide sequence data reported in this paper were submitted to GenBank and assigned accession numbers DQ319070–DQ319076. * Corresponding author at: Bovine Functional Genomics Laboratory, USDA-Agricultural Research Service, BARC-East, Bldg. 1040, Room #2, Beltsville, MD 20705-2350, USA. Tel.: +1 301 504 5066; fax: +1 301 504 5306. E-mail address: [email protected] (D.D. Bannerman).

1. Introduction have been implicated in mediating TLR-4-induced apoptosis (Bannerman and Goldblum, 2003; Dauphi- Gram-negative bacteria are responsible for several nee and Karsan, 2006). TICAM-2, which in concert economically important diseases in cattle, including with TICAM-1 promotes TLR-4-elicited activation of enteric colibacillosis, coliform septicemia, brucello- the IRF-3 transcription factor that regulates IFN-b sis, metritis, pneumonia, salmonellosis, campylobac- production (Vogel et al., 2003; Takeda and Akira, teriosis, and mastitis (Cullor, 1992). It is estimated that 2005), has recently been implicated in mediating almost 40% of the clinical cases of mastitis are caused TLR-4-induced pro-apoptotic signaling (Kaiser and by Gram-negative bacteria (Erskine et al., 1991; Ziv, Offermann, 2005). There is evidence to suggest that 1992). Many of the cows with these infections develop the ability of these various TLR-4 signaling molecules septic shock, an exaggerated inflammatory response to induce apoptosis is through FADD-mediated elicited largely by a highly pro-inflammatory compo- activation of caspase-8 (Bannerman and Goldblum, nent of the Gram-negative bacterial envelope known as endotoxin or bacterial lipopolysaccharide (LPS). LPS induces inflammation, in part, through its binding and activation of toll-like receptor (TLR)-4 (Chow et al., 1999), which leads to the downstream activation of the transcription factor NF-kB and corresponding pro-inflammatory cytokine production (Baldwin, 1996). Following LPS recognition by TLR-4 anditsassociatedproteinsMD-2andCD-14,theadapter protein myeloid differentiation factor 88 (MyD88) is recruited to the cytoplasmic domain of TLR-4 through homotypic binding of respective toll receptor-interleukin-1 receptor (TIR) domains contained within each protein (Medzhitov et al., 1998). Human MyD88 contains a highly conserved death domain (DD) that facilitates its interaction with another DD-containing signaling molecule, IL-1 receptor-associated kinase (IRAK). In the absence of MyD88, TIR domain- containing adapter protein (TIRAP) (also known as MAL) has been shown to function in a redundant role to MyD88 (Horng et al., 2001). Following recruitment to Fig.1. SchematicofhumanTLR-4signalingmoleculesreportedto MyD88, IRAK-1 undergoes rapid autophosphorylation be involved in the induction of cellular pro-inflammatory and pro- and dissociation from the signaling complex. Phos- apoptotic responses. Following LPS binding to the tri-partite recognition complex composed of TLR-4, MD-2 (LY96), and phorylated IRAK subsequently interacts with TNF CD14, various signaling molecules are recruited to the intracellular receptor-associated factor-6 (TRAF-6), initiating the domain of TLR-4 leading to the activation of a series of signal activation of a kinase cascade involving IkB kinase transduction pathways. TIRAP, MyD88, and IRAK-1 have been (IKK) (Swantek et al., 2000). Activation of this cascade proposed to function upstream of TRAF-6, the latter of which can culminates in the phosphorylation and degradation of activate IKK resulting in NF-kB nuclear translocation and the upregulation of pro-inflammatory cytokines. TICAM-1 and the NF-kB inhibitor, IkB, enabling NF-kB to translo- TICAM-2 have been shown to function upstream of TRAF-6 cate to the nucleus and promote pro-inflammatory gene and RIP, the latter of which also promotes NF-kB activation. expression. Adding to the level of complexity is the Further signaling roles have been demonstrated for TICAM-1 finding that another molecule, TOLLIP, is involved in and TICAM-2 in the activation of the transcription factor IRF-3, negatively regulating TLR-4-induced NF-kB activation which promotes the expression of IFN-b.Finally,boththeTIRAP/ MyD88/IRAK-1/TRAF-6 and TICAM-2/TICAM-1/RIP-1 path- (Zhang and Ghosh, 2002). ways have been implicated in caspase-8 mediated apoptosis. In addition to their involvement in NF-kB (Circled proteins indicate those whose bovine gene orthologs were activation, MyD88, TIRAP, IRAK-1, and TRAF-6 sequenced and/or mapped in the present report.). 304 E.E. Connor et al. / Veterinary Immunology and Immunopathology 112 (2006) 302–308

2003; Kaiser and Offermann, 2005; Dauphinee and Table 1 Karsan, 2006). A schematic of select TLR-4 Summary of primer sequences used for cloning bovine toll-like receptor signaling molecules intracellular signaling molecules involved in NF-kB 0 0 and IRF-3 activation (Vogel et al., 2003; Takeda and Locus Primer sequences (5 ! 3 ) Amplicon size (bp) Akira, 2005), as well as apoptosis, is shown (Fig. 1). CASP8 gatgttgccaggactgtgtg 1681 Molecules involved in intracellular TLR-4 signal- gcattttaactattgttcagttgcat IRAK-1a tgtgccgcttctacaaagtg 1149 ing have not been well characterized in cattle and agctgaaggtgtcggtgtct information is lacking regarding their roles in mastitis gagttccaacgtccttctgg 1197 and other diseases of cattle caused by Gram-negative ccatgagaacttccgaccat bacteria. Therefore, the goal of this study was to clone LY96 catttttaaagttttggagagattga 603 and sequence the full-length coding regions of bovine tggcagacctagcaaacaaa TICAM2 tcctcttctgactcggatcttt 854 genes involved in TLR-4 signaling, including inter- gggctccacaggtttctgta leukin-1 receptor-associated kinase 1 (IRAK1), MD-2 TIRAP ccctcccttctcccacttta 825 protein (LY96), toll-like receptor adaptor molecule 2 gggccctctaactccatttc (TICAM2), toll-interleukin 1 receptor domain contain- TOLLIP gtctggtcgcgtctctgtc 1034 ing adaptor protein (TIRAP), toll interacting protein ctgcaagaaccaaaaccaca TRAF6 gagcagttgatgatcacgttact 1819 (TOLLIP), TNF receptor-associated factor 6 (TRAF6), cccaaggattatggctcaa and caspase 8 (CASP8), to facilitate study of these a molecules in cattle. In addition, the chromosomal Two primer pairs were used to obtain overlapping segments of the IRAK-1 transcript; the remaining 112 bp at the 50 end were locations of these seven genes, as well as myeloid obtained by 50 rapid amplification of cDNA ends (RACE). differentiation primary response gene 88 (MyD88), and toll-like receptor adaptor molecule 1 (TICAM1) kit (Stratagene) according to kit instructions. To obtain were determined by radiation hybrid mapping. the complete 50 end of the IRAK-1 transcript, 50 rapid amplification of cDNA ends (RACE) was performed using the SMART RACE cDNA amplification kit 2. Materials and methods (Clontech, Palo Alto, CA), 1 mg of total RNA isolated from bovine pulmonary artery endothelial cells, and 2.1. Cloning and sequencing gene-specific primer 50-CGGTTGATCCACGGCCA- CAG-30, according to manufacturer’s instructions. For the cloning and sequencing of each gene target, Reaction products for each gene were separated by total RNAwas obtained using the RNeasy kit (Qiagen, agarose gel electrophoresis and the products of the Valencia, CA) from primary cultures of aortic and expected size were extracted using the QIAquick Gel mammary endothelial cells isolated from separate Extraction kit (Qiagen). Purified DNA was cloned into Holstein cows. To clone TRAF6, TIRAP, CASP8 and the pCR2.1 vector using the TOPO TA Cloning kit TOLLIP, reverse transcription was performed using (Invitrogen, Carlsbad, CA). Multiple plasmid clones the iScript cDNA Synthesis kit (BioRad, Hercules, were isolated for each gene and endothelial cell line CA) in a 20-mL reaction volume. Polymerase chain using the Fastplasmid Mini kit (Eppendorf, Westbury, reactions using cDNAs from both endothelial cell NY) and sequenced in both directions using the sources as template were performed in a 25-mL CEQ8000 automated DNA sequencer and DTCS reaction volume using 2 mL of first strand cDNA and Quickstart chemistry (Beckman Coulter, Fullerton, 1 iQ Supermix (BioRad): 3 mM MgCl2; 0.8 mM CA). Sequences were submitted to the GenBank dNTPs; 0.625 U iTaq DNA polymerase and 0.4 mM database and assigned accession numbers presented in each primer described in Table 1. Thermocycling Table 2. conditions consisted of 95 8C for 3 min followed by 35 cycles of 95 8C for 30 s; 55 8C for 30 s; 72 8C for 2.2. Radiation hybrid mapping 1 min. For the amplification of LY96, IRAK-1 and TICAM2, single step RT-PCR was conducted on each For physical mapping of each gene target, PCR RNA source using the StrataScript One-Tube RT-PCR screening of DNA from 94 clone lines of a 3000-rad E.E. Connor et al. / Veterinary Immunology and Immunopathology 112 (2006) 302–308 305

Table 2 Summary of nucleotide and amino acid sequence similarities of bovine toll-like receptor-related genes to human and mouse sequences Locus GenBank accession no. Coding region (bp) % Nucleotide identitya % Amino acid identitya Human Mouse Human Mouse CASP8 DQ319070 1458 77 74 69 65 IRAK-1 DQ319075 2157 83 74 81 72 LY96 DQ319076 483 77 74 65 63 MyD88 NM_001014382b 891 86 79 86 77 TICAM1 NM_001030301b 2280 73 62 68 52 TICAM2 DQ319071 699 84 74 81 72 TIRAP DQ319072 699 78 76 81 72 TOLLIP DQ319073 822 88 84 92 93 TRAF6 DQ319074 1629 86 82 89 85 a Percentage calculated as the number of identical residues between the aligned open reading frame of bovine and the corresponding sequence of human or mouse. b Nucleotide sequences provided to GenBank by other investigators.

Table 3 Summary of RH mapping results for bovine toll-like receptor signaling molecules Locus Primer sequences (50 ! 30) Amplicon size (bp) BTA Marker/Gene 2-pt LOD Distance (cR) CASP8 ccttattggcaaacccaaaa 226 2 FLIP 7.783 0.312 gatataccaggccccattcc IRAK-1 ctgctctcgtccagctctct 435 X BM9208 6.684 0.577 ccatgagaacttccgaccat LY96 ctgtgaacacaacaatacaattctcc 1098 14 BM302 16.365 0.156 tctaattgaaatcagggtaatgtatga MyD88 ccccagcgatattgagtttg 368 22 CSSM006 17.478 0.110 tcacattccttgctttgcag TICAM1 ttcatcatcctgctgctcac 232 7 RM006 12.981 0.233 aggtgttggtcaccttcctg TICAM2 aggccagaagaggacacaga 379 10 BM3033 15.702 0.099 cgttgatggttcgtagagca TIRAP gctccagctcagaggtgtct 181 29 INRA211 14.835 0.131 ccctccaggtaggagaccag TOLLIP gcgtggactccttctacctg 799 29 NAP1L4 7.437 0.462 gtaccactcgtccacgacct TRAF6 tcctgtgcctcaatgtacca 379 15 TGLA75 15.948 0.071 gggttcgaatagttcgcttg

bovine hamster radiation hybrid (RH) panel (Res- or 58 8C for 30 s, 72 8C for 30 s–1 min and a final Gen Invitrogen) consisted of 25 ng DNA; 0.4 mMof extension of 72 8C for 5 min. Amplification products each gene-specific primer described in Table 3; from each cell line of the RH panel were evaluated by 200 mM dNTPs; 1 reaction buffer with MgCl2 agarose gel electrophoresis and concordancy data (Promega, Madison, WI, USA) and 0.5 U Taq were submitted to the Roslin RH database (http:// polymerase (Promega). The thermocycling profile databases.roslin.ac.uk.radhyb) for two-point analysis was 95 8C for 5 min; 10 cycles of 94 8C for 30 s, 65 or as previously described (Connor et al., 2004). Primers 68 8C(1 8C per cycle) for 30 s, 72 8C for 30 s– used for amplification of each gene target and 1 min; followed by 20–25 cycles of 94 8C for 30 s, 55 amplicon sizes are presented in Table 3. 306 E.E. Connor et al. / Veterinary Immunology and Immunopathology 112 (2006) 302–308

3. Results and discussion contribute to the extension of regions of conserved synteny on the bovine-human comparative maps, the For each gene locus, the GenBank accession integration of the bovine physical and sequence maps, number for the bovine nucleotide sequence and and the identification of causative genes underlying percentage nucleotide and amino acid sequence immune-related quantitative trait loci. identities with human and mouse are presented in The current study provides the first full-length Table 2. A search of PubMed, the NCBI Gene database sequences of bovine CASP8, IRAK1, TICAM2 and (http://www.ncbi.nlm.nih.gov/), the ARK database TIRAP and confirms recently released sequences for (http://texas.thearkdb.org/), and the INRA BOVmap TOLLIP (BT021785) and TRAF6 (NM_001034661). database (http://locus.jouy.inra.fr/) did not indicate A predicted sequence for bovine TIRAP based on the that any of the genes in the present work had current assembly of the bovine genome was available previously been positioned within the bovine genome (XM_609564), however, it lacked 16 amino acids in by radiation hybrid mapping. Recently, 10 bovine the amino terminus. In addition, cloning and sequen- TLR’s have been physically mapped (McGuire et al., cing of LY96 from two different endothelial cell types, 2006). The same 3000-rad bovine hamster RH each of which was isolated from different Holstein panel was used in both that and the present study, but cows, revealed a consensus sequence that shares only the genes mapped were different. Whereas that study 82% nucleotide identity and 71% amino acid identity mapped the genes encoding the receptors, we have with a provisional reference sequence in the GenBank mapped the genes encoding the intracellular proteins database for bovine LY96 (NM_174111). The provi- that enable TLR-4 signaling. The chromosomal sional reference sequence originated from a single assignments of these various bovine TLR-4 signaling clone from a normalized pooled tissue library and molecules are shown in Table 3. Bovine chromosomal shares 78% similarity with human LY96 assignments of CASP8, LY96, MyD88, TICAM1, (NM_015364). Our sequence (DQ319076) shows TIRAP, and TRAF6 were consistent with predicted 77% similarity with human LY96. In contrast to the locations based on the bovine-human comparative provisional reference sequence, our reported sequence map (Hayes et al., 2003) and the March 2005 Bos shares 99.9% identity with a predicted bovine LY96 taurus draft genome assembly (http://genome.ucs- sequence (XM_864835) on BTA14. c.edu/). In contrast, discrepancies were found in the Predicted functional domains within the bovine bovine chromosomal locations of TICAM2, TOLLIP, translated sequences of each gene were compared with and IRAK1 based on RH mapping conducted in the the published human protein sequences using Prosite present study and those predicted from the bovine (http://ca.expasy.org/prosite/) and found to be highly draft genome assembly and/or the comparative map of conserved, suggesting functional similarity of each of Hayes et al. Specifically, the predicted location for the proteins across the two species. For several of the TICAM2 based on the bovine draft genome assembly bovine genes, including CASP8, IRAK1, MyD88, and was tentatively BTA5, whereas the comparative map TIRAP, single amino acids in the translated proteins of by Hayes et al. indicated a location of either BTA10 or the respective human orthologs identified as critical BTA7. Mapping performed in the current study for enabling signaling activity and/or functioning were suggests that TICAM2 is located on BTA10. TOLLIP’s found to be conserved in cattle. For instance, the predicted position was on either BTA15 or BTA29 predicted amino acid sequence of bovine CASP8 according to the comparative map and on BTA29 revealed conservation of His323 and Cys366 residues, using the draft genome assembly. RH mapping in the which are required for proteolytic activity within the present report suggests that TOLLIP is indeed on caspase domain and its corresponding ability to induce BTA29. Finally, the draft bovine genome assembly apoptosis (Stennicke and Salvesen, 1999). Alignment assigned IRAK1 to BTA7. However, human IRAK1 is of the human and bovine predicted protein sequences known to be positioned on chromosome X. The of IRAK-1, MyD88, and TIRAP, identified the current study provides RH mapping evidence that conservation of the amino acids Thr66, F56, and bovine IRAK1 is located on chromosome X. Together, Pro136, respectively, each of which has been shown to the RH mapping assignments of these genes should be essential for proper functioning of the respective E.E. Connor et al. / Veterinary Immunology and Immunopathology 112 (2006) 302–308 307 proteins (Burns et al., 1998; Horng et al., 2001; Ross recommendation or endorsement by the U.S. Depart- et al., 2002). Whether amino acid sequence differ- ment of Agriculture. ences that exist in other regions affect functioning of bovine TLR-4 signaling molecules remains unknown. References TLR-4 has been demonstrated to play a critical role in host innate immunity. TLR-4 knockout mice or Baldwin Jr., A.S., 1996. The NF-kappa B and I kappa B proteins: new those with naturally occurring genetic mutations in discoveries and insights. Annu. Rev. Immunol. 14, 649–683. TLR-4 are hyporesponsive to LPS and highly Bannerman, D.D., Goldblum, S.E., 2003. Mechanisms of bacterial susceptible to infection (Poltorak et al., 1998; Hoshino lipopolysaccharide-induced endothelial apoptosis. Am. J. Phy- et al., 1999). Amino acid polymorphisms have also siol. Lung Cell. Mol. Physiol. 284, L899–L914. Burns, K., Martinon, F., Esslinger, C., Pahl, H., Schneider, P., been identified in humans and have been associated Bodmer, J.L., Di Marco, F., French, L., Tschopp, J., 1998. with diminished pulmonary responsiveness to inhaled MyD88, an adapter protein involved in interleukin-1 signaling. LPS and increased susceptibility to Gram-negative J. Biol. Chem. 273, 12203–12209. bacteremia and septic shock (Vogel et al., 2005). In Chow, J.C., Young, D.W., Golenbock, D.T., Christ, W.J., Gusovsky, addition, mutations have been identified in human F., 1999. Toll-like receptor-4 mediates lipopolysaccharide- induced signal transduction. J. Biol. Chem. 274, 10689–10692. TLR-4 signaling molecules, including IRAK-4 and Connor, E.E., Sonstegard, T.S., Ashwell, M.S., Bennett, G.L., other downstream effector proteins that promote NF- Williams, J.L., 2004. An expanded comparative map of bovine kB activation. Similarly, these mutations are asso- chromosome 27 targeting dairy form QTL regions. Anim. Genet. ciated with an impaired ability to respond to LPS and 35, 265–269. enhanced susceptibility to infection. Cullor, J.S., 1992. Shock attributable to bacteremia and endotox- emia in cattle: clinical and experimental findings. J. Am. Vet. The numerous diseases of cattle in which Gram- Med. Assoc. 200, 1894–1902. negative bacteria are the etiological cause confers a Dauphinee, S.M., Karsan, A., 2006. Lipopolysaccharide signaling in critical importance to understanding the role of TLR-4 endothelial cells. Lab. Invest. 86, 9–22. and its intracellular signaling molecules in mediating Erskine, R.J., Tyler, J.W., Riddell Jr., M.G., Wilson, R.C., 1991. bovine innate immunity. The recent finding that TLR-4 Theory, use, and realities of efficacy and food safety of anti- microbial treatment of acute coliform mastitis. J. Am. Vet. Med. expression is upregulated in cows with mastitis supports Assoc. 198, 980–984. a link between TLR-4 and the pathogenesis of an Goldammer, T., Zerbe, H., Molenaar, A., Schuberth, H.J., Brunner, infectious disease of cattle (Goldammer et al., 2004). R.M., Kata, S.R., Seyfert, H.M., 2004. Mastitis increases mam- The results of the present study should facilitate the mary mRNA abundance of beta-defensin 5, toll-like-receptor 2 identification of variation in bovine TLR-4 signaling (TLR2), and TLR4 but not TLR9 in cattle. Clin. Diagn. Lab. Immunol. 11, 174–185. genes (e.g., single nucleotide polymorphisms) that are Hayes, H., Elduque, C., Gautier, M., Schibler, L., Cribiu, E., Eggen, associated with increased disease susceptibility, and the A., 2003. Mapping of 195 genes in cattle and updated compara- development of reagents needed for more comprehen- tive map with man, mouse, rat and pig. Cytogenet. Genome Res. sive functional studies of TLR-4 signaling in cattle. 102, 16–24. Horng, T., Barton, G.M., Medzhitov, R., 2001. TIRAP: an adapter molecule in the toll signaling pathway. Nat. Immunol. 2, 835– 841. Acknowledgements Hoshino, K., Takeuchi, O., Kawai, T., Sanjo, H., Ogawa, T., Takeda, Y., Takeda, K., Akira, S., 1999. Cutting edge: toll-like receptor 4 The project was supported by the National (TLR4)-deficient mice are hyporesponsive to lipopolysacchar- Research Initiative of the United States Department ide: evidence for TLR4 as the Lps gene product. J. Immunol. 162, 3749–3752. of Agriculture Cooperative State Research, Education Kaiser, W.J., Offermann, M.K., 2005. Apoptosis induced by the toll- and Extension Service, grant number 2005-35204- like receptor adaptor TRIF is dependent on its receptor inter- 16028. RH mapping was supported by the European acting protein homotypic interaction motif. J. Immunol. 174, Commission (Project QLRI-CT-2002-02744). The 4942–4952. authors thank Marsha Campbell for laboratory McGuire, K., Jones, M., Werling, D., Williams, J.L., Glass, E.J., Jann, O., 2006. Radiation hybrid mapping of all 10 characterized assistance and support. Mention of trade names or bovine toll-like receptors. Anim. Genet. 37, 47–50. commercial products is solely for the purpose of Medzhitov, R., Preston-Hurlburt, P., Kopp, E., Stadlen, A., Chen, C., providing specific information and does not imply Ghosh, S., Janeway Jr., C.A., 1998. MyD88 is an adaptor protein 308 E.E. Connor et al. / Veterinary Immunology and Immunopathology 112 (2006) 302–308

in the hToll/IL-1 receptor family signaling pathways. Mol. Cell. Takeda, K., Akira, S., 2005. Toll-like receptors in innate immunity. 2, 253–258. Int. Immunol. 17, 1–14. Poltorak, A., He, X., Smirnova, I., Liu, M.Y., Huffel, C.V., Du, X., Vogel, S.N., Awomoyi, A.A., Rallabhandi, P., Medvedev, A.E., Birdwell, D., Alejos, E., Silva, M., Galanos, C., Freudenberg, 2005. Mutations in TLR4 signaling that lead to increased M., Ricciardi-Castagnoli, P., Layton, B., Beutler, B., 1998. susceptibility to infection in humans: an overview. J. Endotoxin Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: Res. 11, 333–339. mutations in Tlr4 gene. Science 282, 2085–2088. Vogel, S.N., Fitzgerald, K.A., Fenton, M.J., 2003. TLRs: differ- Ross, K., Yang, L., Dower, S., Volpe, F., Guesdon, F., 2002. ential adapter utilization by toll-like receptors mediates TLR- Identiﬁcation of threonine 66 as a functionally critical residue speciﬁc patterns of gene expression. Mol. Interv. 3, 466– of the interleukin-1 receptor-associated kinase. J. Biol. Chem. 477. 277, 37414–37421. Zhang, G., Ghosh, S., 2002. Negative regulation of toll-like receptor- Stennicke, H.R., Salvesen, G.S., 1999. Catalytic properties of the mediated signaling by Tollip. J. Biol. Chem. 277, 7059– caspases. Cell Death Differ. 6, 1054–1059. 7065. Swantek, J.L., Tsen, M.F., Cobb, M.H., Thomas, J.A., 2000. IL-1 Ziv, G., 1992. Treatment of peracute and acute mastitis. Vet. Clin. receptor-associated kinase modulates host responsiveness to North Am. Food Anim. Pract. 8, 1–15. endotoxin. J. Immunol. 164, 4301–4306.