DOCSLIB.ORG

Signaling Molecules§ Erin E

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Signaling Molecules§ Erin E Veterinary Immunology and Immunopathology 112 (2006) 302–308 www.elsevier.com/locate/vetimm Short communication Cloning and radiation hybrid mapping of bovine toll-like receptor-4 (TLR-4) signaling molecules§ Erin E. Connor a, Elizabeth A. Cates a,b, John L. Williams c, Douglas D. Bannerman a,* a Bovine Functional Genomics Laboratory, U.S. Department of Agriculture, Agricultural Research Service, Beltsville, MD 20705, USA b University of Maryland, College Park, MD 20742, USA c Roslin Institute (Edinburgh), Roslin, Midlothian, Scotland, UK Received 17 January 2006; accepted 7 March 2006 Abstract Toll-like receptor (TLR)-4 is a transmembrane receptor for lipopolysaccharide, a highly pro-inflammatory component of the outer membrane of Gram-negative bacteria. To date, molecules of the TLR-4 signaling pathway have not been well characterized in cattle. The goal of this study was to clone and sequence the full-length coding regions of bovine genes involved in TLR-4 signaling including CASP8, IRAK1, LY96 (MD-2), TICAM2, TIRAP, TOLLIP and TRAF 6 and to position these genes, as well as MyD88 and TICAM1, on the bovine genome using radiation hybrid mapping. Results of this work indicate differences with a previously published bovine sequence for LY96 and a predicted sequence in the GenBank database for TIRAP based on the most recent assembly of the bovine genome. In addition, discrepancies between actual and predicted chromosomal map positions based on the Btau_2.0 genome assembly release were identified, although map positions were consistent with predicted locations based on the current bovine-human comparative map. Alignment of the bovine amino acid sequences with human and murine sequences showed a broad range in conservation, from 52 to 93%. Overall, this work should assist in the assembly and annotation of the bovine genome sequence, the identification of variations in genes critically involved in host innate immunity, and facilitate the study of TLR-4 signaling pathways in cattle. # 2006 Elsevier B.V. All rights reserved. Keywords: Apoptosis; Mastitis; Endotoxin; Inflammation § The nucleotide sequence data reported in this paper were submitted to GenBank and assigned accession numbers DQ319070–DQ319076. * Corresponding author at: Bovine Functional Genomics Laboratory, USDA-Agricultural Research Service, BARC-East, Bldg. 1040, Room #2, Beltsville, MD 20705-2350, USA. Tel.: +1 301 504 5066; fax: +1 301 504 5306. E-mail address: [email protected] (D.D. Bannerman). 0165-2427/$ – see front matter # 2006 Elsevier B.V. All rights reserved. doi:10.1016/j.vetimm.2006.03.003 E.E. Connor et al. / Veterinary Immunology and Immunopathology 112 (2006) 302–308 303 1. Introduction have been implicated in mediating TLR-4-induced apoptosis (Bannerman and Goldblum, 2003; Dauphi- Gram-negative bacteria are responsible for several nee and Karsan, 2006). TICAM-2, which in concert economically important diseases in cattle, including with TICAM-1 promotes TLR-4-elicited activation of enteric colibacillosis, coliform septicemia, brucello- the IRF-3 transcription factor that regulates IFN-b sis, metritis, pneumonia, salmonellosis, campylobac- production (Vogel et al., 2003; Takeda and Akira, teriosis, and mastitis (Cullor, 1992). It is estimated that 2005), has recently been implicated in mediating almost 40% of the clinical cases of mastitis are caused TLR-4-induced pro-apoptotic signaling (Kaiser and by Gram-negative bacteria (Erskine et al., 1991; Ziv, Offermann, 2005). There is evidence to suggest that 1992). Many of the cows with these infections develop the ability of these various TLR-4 signaling molecules septic shock, an exaggerated inflammatory response to induce apoptosis is through FADD-mediated elicited largely by a highly pro-inflammatory compo- activation of caspase-8 (Bannerman and Goldblum, nent of the Gram-negative bacterial envelope known as endotoxin or bacterial lipopolysaccharide (LPS). LPS induces inflammation, in part, through its binding and activation of toll-like receptor (TLR)-4 (Chow et al., 1999), which leads to the downstream activation of the transcription factor NF-kB and corresponding pro-inflammatory cytokine production (Baldwin, 1996). Following LPS recognition by TLR-4 anditsassociatedproteinsMD-2andCD-14,theadapter protein myeloid differentiation factor 88 (MyD88) is recruited to the cytoplasmic domain of TLR-4 through homotypic binding of respective toll receptor-inter- leukin-1 receptor (TIR) domains contained within each protein (Medzhitov et al., 1998). Human MyD88 contains a highly conserved death domain (DD) that facilitates its interaction with another DD-containing signaling molecule, IL-1 receptor-associated kinase (IRAK). In the absence of MyD88, TIR domain- containing adapter protein (TIRAP) (also known as MAL) has been shown to function in a redundant role to MyD88 (Horng et al., 2001). Following recruitment to Fig.1. SchematicofhumanTLR-4signalingmoleculesreportedto MyD88, IRAK-1 undergoes rapid autophosphorylation be involved in the induction of cellular pro-inflammatory and pro- and dissociation from the signaling complex. Phos- apoptotic responses. Following LPS binding to the tri-partite recognition complex composed of TLR-4, MD-2 (LY96), and phorylated IRAK subsequently interacts with TNF CD14, various signaling molecules are recruited to the intracellular receptor-associated factor-6 (TRAF-6), initiating the domain of TLR-4 leading to the activation of a series of signal activation of a kinase cascade involving IkB kinase transduction pathways. TIRAP, MyD88, and IRAK-1 have been (IKK) (Swantek et al., 2000). Activation of this cascade proposed to function upstream of TRAF-6, the latter of which can culminates in the phosphorylation and degradation of activate IKK resulting in NF-kB nuclear translocation and the upregulation of pro-inflammatory cytokines. TICAM-1 and the NF-kB inhibitor, IkB, enabling NF-kB to translo- TICAM-2 have been shown to function upstream of TRAF-6 cate to the nucleus and promote pro-inflammatory gene and RIP, the latter of which also promotes NF-kB activation. expression. Adding to the level of complexity is the Further signaling roles have been demonstrated for TICAM-1 finding that another molecule, TOLLIP, is involved in and TICAM-2 in the activation of the transcription factor IRF-3, negatively regulating TLR-4-induced NF-kB activation which promotes the expression of IFN-b.Finally,boththeTIRAP/ MyD88/IRAK-1/TRAF-6 and TICAM-2/TICAM-1/RIP-1 path- (Zhang and Ghosh, 2002). ways have been implicated in caspase-8 mediated apoptosis. In addition to their involvement in NF-kB (Circled proteins indicate those whose bovine gene orthologs were activation, MyD88, TIRAP, IRAK-1, and TRAF-6 sequenced and/or mapped in the present report.). 304 E.E. Connor et al. / Veterinary Immunology and Immunopathology 112 (2006) 302–308 2003; Kaiser and Offermann, 2005; Dauphinee and Table 1 Karsan, 2006). A schematic of select TLR-4 Summary of primer sequences used for cloning bovine toll-like receptor signaling molecules intracellular signaling molecules involved in NF-kB 0 0 and IRF-3 activation (Vogel et al., 2003; Takeda and Locus Primer sequences (5 ! 3 ) Amplicon size (bp) Akira, 2005), as well as apoptosis, is shown (Fig. 1). CASP8 gatgttgccaggactgtgtg 1681 Molecules involved in intracellular TLR-4 signal- gcattttaactattgttcagttgcat IRAK-1a tgtgccgcttctacaaagtg 1149 ing have not been well characterized in cattle and agctgaaggtgtcggtgtct information is lacking regarding their roles in mastitis gagttccaacgtccttctgg 1197 and other diseases of cattle caused by Gram-negative ccatgagaacttccgaccat bacteria. Therefore, the goal of this study was to clone LY96 catttttaaagttttggagagattga 603 and sequence the full-length coding regions of bovine tggcagacctagcaaacaaa TICAM2 tcctcttctgactcggatcttt 854 genes involved in TLR-4 signaling, including inter- gggctccacaggtttctgta leukin-1 receptor-associated kinase 1 (IRAK1), MD-2 TIRAP ccctcccttctcccacttta 825 protein (LY96), toll-like receptor adaptor molecule 2 gggccctctaactccatttc (TICAM2), toll-interleukin 1 receptor domain contain- TOLLIP gtctggtcgcgtctctgtc 1034 ing adaptor protein (TIRAP), toll interacting protein ctgcaagaaccaaaaccaca TRAF6 gagcagttgatgatcacgttact 1819 (TOLLIP), TNF receptor-associated factor 6 (TRAF6), cccaaggattatggctcaa and caspase 8 (CASP8), to facilitate study of these a molecules in cattle. In addition, the chromosomal Two primer pairs were used to obtain overlapping segments of the IRAK-1 transcript; the remaining 112 bp at the 50 end were locations of these seven genes, as well as myeloid obtained by 50 rapid amplification of cDNA ends (RACE). differentiation primary response gene 88 (MyD88), and toll-like receptor adaptor molecule 1 (TICAM1) kit (Stratagene) according to kit instructions. To obtain were determined by radiation hybrid mapping. the complete 50 end of the IRAK-1 transcript, 50 rapid amplification of cDNA ends (RACE) was performed using the SMART RACE cDNA amplification kit 2. Materials and methods (Clontech, Palo Alto, CA), 1 mg of total RNA isolated from bovine pulmonary artery endothelial cells, and 2.1. Cloning and sequencing gene-specific primer 50-CGGTTGATCCACGGCCA- CAG-30, according to manufacturer’s instructions. For the cloning and sequencing of each gene target, Reaction products for each gene were separated by total RNAwas obtained using the RNeasy kit (Qiagen, agarose gel electrophoresis and the products of the Valencia, CA) from primary cultures of aortic and expected size were extracted using the
Load more

Recommended publications
  • Nonredundant Roles of TIRAP and Myd88 in Airway Response to Endotoxin, Independent of TRIF, IL-1 and IL-18 Pathways
    Laboratory Investigation (2006) 86, 1126–1135 & 2006 USCAP, Inc All rights reserved 0023-6837/06 $30.00 www.laboratoryinvestigation.org Nonredundant roles of TIRAP and MyD88 in airway response to endotoxin, independent of TRIF, IL-1 and IL-18 pathways Dieudonne´e Togbe1, Gorse Aurore1, Nicolas Noulin1,2, Vale´rie FJ Quesniaux1, Silvia Schnyder-Candrian1, Bruno Schnyder1, Virginie Vasseur1, Shizuo Akira3, Kasper Hoebe4, Bruce Beutler4, Bernhard Ryffel1,* and Isabelle Couillin1,* 1Molecular Immunology and Embryology, CNRS UMR6218, Transgenose Institute, Orleans, France; 2R&D Department, Key-Obs, Orleans, France; 3Department of Host Defense, Research Institute for Microbial Diseases, Osaka University, Suita, Osaka, Japan and 4Department of Immunology, Scripps Research Institute, La Jolla, CA, USA Inhaled endotoxins induce an acute inflammatory response in the airways mediated through Toll-like receptor 4 (TLR4) and myeloid differentiation factor 88 (MyD88). However, the relative roles of the TLR4 adaptor proteins TIRAP and TRIF and of the MyD88-dependent IL-1 and IL-18 receptor pathways in this response are unclear. Here, we demonstrate that endotoxin-induced acute bronchoconstriction, vascular damage resulting in protein leak, Th1 cytokine and chemokine secretion and neutrophil recruitment in the airways are abrogated in mice deficient for either TIRAP or MyD88, but not in TRIF deficient mice. The contribution of other TLR-independent, MyD88-dependent signaling pathways was investigated in IL-1R1, IL-18R and caspase-1 (ICE)-deficient mice, which displayed normal airway responses to endotoxin. In conclusion, the TLR4-mediated, bronchoconstric- tion and acute inflammatory lung pathology to inhaled endotoxin critically depend on the expression of both adaptor proteins, TIRAP and MyD88, suggesting cooperative roles, while TRIF, IL-1R1, IL-18R signaling pathways are dispensable.
    [Show full text]
  • Dissecting Negative Regulation of Toll-Like Receptor Signaling
    Review Dissecting negative regulation of Toll-like receptor signaling 1,2 1,2 1,2 Takeshi Kondo , Taro Kawai and Shizuo Akira 1 Laboratory of Host Defense, WPI Immunology Frontier Research Center, Osaka University, 3-1 Yamada-oka, Suita, Osaka 565-0871, Japan 2 Research Institute for Microbial Diseases, Osaka University, 3-1 Yamada-oka, Suita, Osaka 565-0871, Japan Toll-like receptors (TLRs) sense invading microbial pathogens. MyD88 is recruited to all TLRs except for pathogens and play crucial roles in the activation of TLR3 and associates with IL-1R-associated kinases (IRAKs) innate and adaptive immunity. However, excessive and TNFR-associated factor 6 (TRAF6), resulting in activa- TLR activation can disrupt immune homeostasis, and tion of canonical inhibitor of kappa light polypeptide gene may be responsible for the development of autoimmune enhancer in B-cells, kinases (IKKs) (IKKa and IKKb) and and inflammatory diseases. As such, the molecules and nuclear factor (NF)-kBs (Figure 1). In contrast, TRIF is pathways that negatively control TLR signaling have recruited to TLR3 and TLR4, leading to activation of been intensively investigated. Here, we discuss recent NF-kB as well as noncanonical IKKs (TRAF-family- insights into the negative regulation of TLR signaling, member-associated NF-kB activator (TANK) binding kinase with focus on three major mechanisms: (i) dissociation 1 (TBK1) and IKKi) and interferon (IFN) regulatory factor of adaptor complexes; (ii) degradation of signal proteins; (IRF)3 via TRAF proteins (Figure 2). TIRAP functions as a and (iii) transcriptional regulation. We also highlight sorting adapter that recruits MyD88 to TLR2 and TLR4, how pathogens negatively target TLR signaling as a whereas TRAM functions as a bridge adapter between TLR4 strategy to evade the host immune response.
    [Show full text]
  • RT² Profiler PCR Array (96-Well Format and 384-Well [4 X 96] Format)
    RT² Profiler PCR Array (96-Well Format and 384-Well [4 x 96] Format) Human Toll-Like Receptor Signaling Pathway Cat. no. 330231 PAHS-018ZA For pathway expression analysis Format For use with the following real-time cyclers RT² Profiler PCR Array, Applied Biosystems® models 5700, 7000, 7300, 7500, Format A 7700, 7900HT, ViiA™ 7 (96-well block); Bio-Rad® models iCycler®, iQ™5, MyiQ™, MyiQ2; Bio-Rad/MJ Research Chromo4™; Eppendorf® Mastercycler® ep realplex models 2, 2s, 4, 4s; Stratagene® models Mx3005P®, Mx3000P®; Takara TP-800 RT² Profiler PCR Array, Applied Biosystems models 7500 (Fast block), 7900HT (Fast Format C block), StepOnePlus™, ViiA 7 (Fast block) RT² Profiler PCR Array, Bio-Rad CFX96™; Bio-Rad/MJ Research models DNA Format D Engine Opticon®, DNA Engine Opticon 2; Stratagene Mx4000® RT² Profiler PCR Array, Applied Biosystems models 7900HT (384-well block), ViiA 7 Format E (384-well block); Bio-Rad CFX384™ RT² Profiler PCR Array, Roche® LightCycler® 480 (96-well block) Format F RT² Profiler PCR Array, Roche LightCycler 480 (384-well block) Format G RT² Profiler PCR Array, Fluidigm® BioMark™ Format H Sample & Assay Technologies Description The Human Toll-Like Receptor (TLR) Signaling Pathway RT² Profiler PCR Array profiles the expression of 84 genes central to TLR-mediated signal transduction and innate immunity. The TLR family of pattern recognition receptors (PRRs) detects a wide range of bacteria, viruses, fungi and parasites via pathogen-associated molecular patterns (PAMPs). Each receptor binds to specific ligands, initiates a tailored innate immune response to the specific class of pathogen, and activates the adaptive immune response.
    [Show full text]
  • TLR Signaling Pathways
    Seminars in Immunology 16 (2004) 3–9 TLR signaling pathways Kiyoshi Takeda, Shizuo Akira∗ Department of Host Defense, Research Institute for Microbial Diseases, Osaka University, and ERATO, Japan Science and Technology Corporation, 3-1 Yamada-oka, Suita, Osaka 565-0871, Japan Abstract Toll-like receptors (TLRs) have been established to play an essential role in the activation of innate immunity by recognizing spe- cific patterns of microbial components. TLR signaling pathways arise from intracytoplasmic TIR domains, which are conserved among all TLRs. Recent accumulating evidence has demonstrated that TIR domain-containing adaptors, such as MyD88, TIRAP, and TRIF, modulate TLR signaling pathways. MyD88 is essential for the induction of inflammatory cytokines triggered by all TLRs. TIRAP is specifically involved in the MyD88-dependent pathway via TLR2 and TLR4, whereas TRIF is implicated in the TLR3- and TLR4-mediated MyD88-independent pathway. Thus, TIR domain-containing adaptors provide specificity of TLR signaling. © 2003 Elsevier Ltd. All rights reserved. Keywords: TLR; Innate immunity; Signal transduction; TIR domain 1. Introduction 2. Toll-like receptors Toll receptor was originally identified in Drosophila as an A mammalian homologue of Drosophila Toll receptor essential receptor for the establishment of the dorso-ventral (now termed TLR4) was shown to induce the expression pattern in developing embryos [1]. In 1996, Hoffmann and of genes involved in inflammatory responses [3]. In addi- colleagues demonstrated that Toll-mutant flies were highly tion, a mutation in the Tlr4 gene was identified in mouse susceptible to fungal infection [2]. This study made us strains that were hyporesponsive to lipopolysaccharide [4]. aware that the immune system, particularly the innate im- Since then, Toll receptors in mammals have been a major mune system, has a skilful means of detecting invasion by focus in the immunology field.
    [Show full text]
  • TLR4 Signalling
    RESEA r CH HIGHLIGHTS INNATE IMMUNITY TLR4 signalling Toll-like receptor 4 (TLR4) is unique plasma membrane. Now, a study from sufficient to allow TRAM to localize among TLRs in its ability to activate Ruslan Medzhitov’s laboratory shows specifically to endosomes. These 20 two distinct signalling pathways that the two signalling pathways amino acids constitute a bipartite — one pathway is activated by the are induced sequentially and that localization domain — consisting of adaptors TIRAP (Toll/interleukin-1- the TRAM–TRIF pathway is only a myristoylation motif (the first 7 receptor (TIR)-domain-containing operational from early endosomes amino acids) and a polybasic domain adaptor protein) and MyD88, following endocytosis of TLR4. — that is commonly found in other which leads to the induction of The authors found it puzzling proteins that shuttle between the pro‑inflammatory cytokines, and that TLR4 is the only known TLR plasma membrane and endosomes. the second pathway is activated by capable of inducing the production Mutational analysis showed that the the adaptors TRIF (TIR-domain- of type I interferons from the plasma myristoylation motif is necessary containing adaptor protein inducing membrane so they decided to take for endosomal localization but interferon‑β) and TRAM (TRIF- a closer look at TLR4 signalling. both parts of the bipartite motif related adaptor molecule), which First, they assessed the subcellular are required for plasma-membrane leads to the induction of type I inter- localization of tagged TLR4 and found targeting. A TRAM transgene of ferons. Until now, it had been believed that it localized to both the plasma which the protein product resided that these two signalling pathways membrane and endosomal vesicles.
    [Show full text]
  • TLR4 Signaling Pathway Modulators As Potential Therapeutics in Inflammation and Sepsis
    vaccines Review TLR4 Signaling Pathway Modulators as Potential Therapeutics in Inflammation and Sepsis Nikolay N. Kuzmich 1,2,*, Konstantin V. Sivak 1, Vladimir N. Chubarev 3, Yury B. Porozov 2,4, Tatiana N. Savateeva-Lyubimova 1 and Francesco Peri 5,* ID 1 Department of Drug Safety, Research Institute of Influenza, WHO National Influenza Centre of Russia, 15/17 Professor Popov St, Saint-Petersburg 197376, Russia; [email protected] (K.V.S.); [email protected] (T.N.S.-L.) 2 Laboratory of Bioinformatics, Institute of Pharmacy and Translational medicine, I.M. Sechenov First Moscow State Medical University, 8-2 Trubetskaya St., Moscow 119991, Russia; [email protected] 3 Department of Pharmacology, Institute of Pharmacy and Translational medicine, I.M. Sechenov First Moscow State Medical University, 8-2 Trubetskaya St., Moscow 119991, Russia; [email protected] 4 Laboratory of Bioinformatics, ITMO University, 49 Kronverkskiy Pr., Saint Petersburg 197101, Russia 5 Department of Biotechnology and Biosciences, University of Milano-Bicocca, Piazza della Scienza 2, Milano 20126, Italy * Correspondence: [email protected] (N.N.K.); Tel.: +7-921-3491-750 (N.N.K.); [email protected] (F.P.); Tel.: +39-026-448-3453 (F.P.); Fax: +7-812-499-15-15 (N.N.K.) Academic Editor: Paola Massari Received: 5 September 2017; Accepted: 1 October 2017; Published: 4 October 2017 Abstract: Toll-Like Receptor 4 (TLR4) signal pathway plays an important role in initiating the innate immune response and its activation by bacterial endotoxin is responsible for chronic and acute inflammatory disorders that are becoming more and more frequent in developed countries.
    [Show full text]
  • Solution Structure of the TLR Adaptor MAL/TIRAP Reveals an Intact BB
    Solution structure of the TLR adaptor MAL/TIRAP PNAS PLUS reveals an intact BB loop and supports MAL Cys91 glutathionylation for signaling Mark M. Hughesa,1, Peter Lavrencicb,c,d,1, Rebecca C. Colla,c, Thomas Veb,c,e, Dylan G. Ryana, Niamh C. Williamsa, Deepthi Menona,f, Ashley Mansellg, Philip G. Boardf, Mehdi Moblid,2, Bostjan Kobeb,c,2, and Luke A. J. O’Neilla,2 aSchool of Biochemistry and Immunology, Trinity Biomedical Sciences Institute, Trinity College Dublin, Dublin 2, Ireland; bSchool of Chemistry and Molecular Biosciences, Australian Infectious Diseases Research Centre, The University of Queensland, Brisbane, QLD 4072, Australia; cInstitute for Molecular Bioscience, The University of Queensland, Brisbane QLD 4072, Australia; dCentre for Advanced Imaging, The University of Queensland, Brisbane QLD 4072, Australia; eInstitute for Glycomics, Griffith University, Southport, QLD 4222, Australia; fJohn Curtin School of Medical Research, Australian National University, Canberra, ACT 2601, Australia; and gCentre for Innate Immunity and Infectious Diseases, Hudson Institute of Medical Research, Monash University, Melbourne, VIC, 3168, Australia Edited by Jonathan C. Kagan, Children’s Hospital Boston, Boston, MA, and accepted by Editorial Board Member Ruslan Medzhitov June 28, 2017 (received for review February 2, 2017) MyD88 adaptor-like (MAL) is a critical protein in innate immunity, proline-containing motif (15–17). Furthermore, these crystal involved in signaling by several Toll-like receptors (TLRs), key structures contain two disulfide bonds involving residues C89– pattern recognition receptors (PRRs). Crystal structures of MAL C134 and C142–C174, respectively. The presence of disulfides is revealed a nontypical Toll/interleukin-1 receptor (TIR)-domain fold unusual for a cytosolic protein and poses an intriguing possibility of stabilized by two disulfide bridges.
    [Show full text]
  • Receptor 5/Toll-Like Receptor 4 Complexes Involves Signaling Via
    Induction of Macrophage Nitric Oxide Production by Gram-Negative Flagellin Involves Signaling Via Heteromeric Toll-Like Receptor 5/Toll-Like Receptor 4 Complexes This information is current as of September 25, 2021. Steven B. Mizel, Anna N. Honko, Marlena A. Moors, Pameeka S. Smith and A. Phillip West J Immunol 2003; 170:6217-6223; ; doi: 10.4049/jimmunol.170.12.6217 http://www.jimmunol.org/content/170/12/6217 Downloaded from References This article cites 50 articles, 26 of which you can access for free at: http://www.jimmunol.org/content/170/12/6217.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 25, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2003 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Induction of Macrophage Nitric Oxide Production by Gram-Negative Flagellin Involves Signaling Via Heteromeric Toll-Like Receptor 5/Toll-Like Receptor 4 Complexes1 Steven B.
    [Show full text]
  • Distinct IRAK4 Expression in Normal and B-CLL Lymphocytes
    ytology & f C H i o s l t a o n l o r Antosz et al., J Cytol Histol 2014, 5:3 g u y o J Journal of Cytology & Histology DOI: 10.4172/2157-7099.1000228 ISSN: 2157-7099 Research Article Article OpenOpen Access Access Distinct IRAK4 Expression in Normal and B-CLL Lymphocytes Halina Antosz*1, Joanna Sajewicz1, Barbara Marzec-Kotarska1, Dorota Choroszynska1, Iwona Hus2, Malgorzata Jargiello-Baszak3 and Jacek Baszak3 1Department of Clinical Genetics, Medical University of Lublin, Lublin, Poland 2Department of Clinical Immunology, Medical University of Lublin, Lublin, Poland 3Department of Cardiology, Medical University of Lublin, Lublin, Poland Abstract Toll-like receptors (TLR) signaling plays an important role in the B cell biology. It induces the maturation, proliferation and antibody production in response to pathogen recognition. Interleukin-1 Receptor-associated Kinase-4 (IRAK-4) is TLR downstream molecule which is of strategic importance in starting a cascade of NF-kappaB (Nuclear factor-kappaB) and MAPK (Mitogen-activated protein kinase) intracellular signaling pathways. The aim of the study was to identify the differences in IRAK-4 expression in normal and chronic lymphocytic leukemia (CLL) lymphocytes. We have also studied the IRAK-4 expression alteration upon TLR2/4 ligand stimulation in leukemic and normal B cells. We carried out Real-Time PCR and Western blot analysis of IRAK4 mRNA (RQ) and protein expression. The study were performed on the isolated CD19+ normal B lymphocytes and CLL cells (CD5+CD19+) before and 30 min after (Lipopolysaccharide) LPS and (Staphylococcus aureus strain Cowan I) SAC stimulation. IRAK-4 mRNA expression was significantly higher in normal CD19+ lymphocytes as compared to leukemic CD5+CD19+ subpopulation (RQ median 0.90 vs 0.54; p=0.012).
    [Show full text]
  • Inherited Human IRAK-1 Deficiency Selectively Impairs TLR Signaling in Fibroblasts
    Inherited human IRAK-1 deficiency selectively impairs TLR signaling in fibroblasts Erika Della Minaa,b, Alessandro Borghesic,d, Hao Zhoue,1, Salim Bougarnf,1, Sabri Boughorbelf,1, Laura Israela,b, Ilaria Melonig, Maya Chrabieha,b, Yun Linga,b, Yuval Itanh, Alessandra Renierig,i, Iolanda Mazzucchellid,j, Sabrina Bassok, Piero Pavonel, Raffaele Falsaperlal, Roberto Cicconem, Rosa Maria Cerboc, Mauro Stronatic,d, Capucine Picarda,b,n,o, Orsetta Zuffardim, Laurent Abela,b,h, Damien Chaussabelf,2, Nico Marrf,2, Xiaoxia Lie,2, Jean-Laurent Casanovaa,b,h,n,p,3,4, and Anne Puela,b,h,3,4 aLaboratory of Human Genetics of Infectious Diseases, Necker Branch, INSERM U1163, 75015 Paris, France; bImagine Institute, Paris Descartes University, 75015 Paris, France; cNeonatal Intensive Care Unit, Instituto di Ricovero e Cura a Carattere Scientifico (IRCCS) San Matteo Hospital Foundation, 27100 Pavia, Italy; dLaboratory of Neonatal Immunology, IRCCS San Matteo Hospital Foundation, 27100 Pavia, Italy; eDepartment of Immunology, Lerner Research Institute, Cleveland Clinic Foundation, Cleveland, OH 44106; fSidra Medical and Research Center, Doha, Qatar; gMedical Genetics, Department of Medical Biotechnologies, University of Siena, 53100 Siena, Italy; hSt. Giles Laboratory of Human Genetics of Infectious Diseases, Rockefeller Branch, The Rockefeller University, New York, NY 10065; iMedical Genetics, University Hospital of Siena, 53100 Siena, Italy; jDepartment of Internal Medicine and Therapeutics, University of Pavia, 27100 Pavia, Italy; kLaboratory of Transplant
    [Show full text]
  • Functional TLR5 Genetic Variants Affect Human Colorectal Cancer Survival
    Published OnlineFirst October 23, 2013; DOI: 10.1158/0008-5472.CAN-13-1746 Cancer Prevention and Epidemiology Research Functional TLR5 Genetic Variants Affect Human Colorectal Cancer Survival Sascha N. Klimosch1, Asta Forsti€ 4,9, Jana Eckert4, Jelena Knezevic5, Melanie Bevier4, Witigo von Schonfels€ 6, Nils Heits6, Jessica Walter6, Sebastian Hinz6, Jesus Lascorz4, Jochen Hampe7, Dominik Hartl2, Julia-Stefanie Frick3, Kari Hemminki4,9, Clemens Schafmayer6,8, and Alexander N.R. Weber1,5 Abstract Toll-like receptors (TLR) are overexpressed on many types of cancer cells, including colorectal cancer cells, but little is known about the functional relevance of these immune regulatory molecules in malignant settings. Here, we report frequent single-nucleotide polymorphisms (SNP) in the flagellin receptor TLR5 and the TLR downstream effector molecules MyD88 and TIRAP that are associated with altered survival in a large cohort of Caucasian patients with colorectal cancer (n ¼ 613). MYD88 rs4988453, a SNP that maps to a promoter region shared with the acetyl coenzyme-A acyl-transferase-1 (ACAA1), was associated with decreased survival of patients with colorectal cancer and altered transcriptional activity of the proximal genes. In the TLR5 gene, rs5744174/ F616L was associated with increased survival, whereas rs2072493/N592S was associated with decreased survival. Both rs2072493/N592S and rs5744174/F616L modulated TLR5 signaling in response to flagellin or to different commensal and pathogenic intestinal bacteria. Notably, we observed a reduction in flagellin-induced p38 phosphorylation, CD62L shedding, and elevated expression of interleukin (IL)-6 and IL-1b mRNA in human primary immune cells from TLR5 616LL homozygote carriers, as compared with 616FF carriers.
    [Show full text]
  • Hm1029bt-50Ug
    CERTIFICATE OF ANALYSIS – TECHNICAL DATA SHEET Product name TLR4/MD-2, Mouse, clone MTS510, biotinylated Catalog number HM1029BT-50UG Lot number - Expiry date - Volume 500 µl Amount 50 µg Formulation 0.2 µm filtered in PBS+0.1%BSA+0.02%NaN3 Concentration 100 µg/ml Host Species Rat IgG2a Conjugate Biotin Endotoxin N.A. Purification Protein G Storage 4°C Application notes IHC-F IHC-P IF FC FS IA IP W Reference # 4 1,3,5,8 2,3,6,7 2 Yes ● ● ● ● No N.D. ● ● ● ● N.D.= Not Determined; IHC = Immuno histochemistry; F = Frozen sections; P = Paraffin sections; IF = Immuno Fluorescence; FC = Flow Cytometry; FS = Functional Studies; IA = Immuno Assays; IP = Immuno Precipitation; W = Western blot FC: RAW264.7 cells (105) were stained with 4µg/ml mAb for 1h at 4°C (black- isotype control, red- irrelevant mAb, Blue- HM1029) Dilutions to be used depend on detection system applied. It is recommended that users test the reagent and determine their own optimal dilutions. The typical starting working dilution is 1:50. IHC-F: 6µm acetone fixed sections blocked with 0.3% hydrogen peroxidase in methanol and subsequently with normal serum. Sections were incubated for 2h at RT at 1/100 dilution of clone MTS510. FC: Cells were incubated with 0.1µg mAb for 30 minutes at 4°C. Postive control: RAW264.7 cells. FS: Cells were pre-incubated with 10µg/ml of antagonistic mAb MTS510. General Information Description The monoclonal antibody MTS510 reacts with the Toll-like receptor 4 (TLR4, CD284) that is associated with MD2. TLRs are expressed by various cells of the immune system, such as macrophages and dendritic cells.
    [Show full text]