Proc. Natl. Acad. Sci. USA Vol. 92, pp. 6813-6817, July 1995 Evolution Documentation of reticulate evolution in peonies (Paeonia) using internal transcribed spacer sequences of nuclear ribosomal DNA: Implications for biogeography and concerted evolution TAO SANG*, DANIEL J. CRAWFORD, AND TOD F. STUESSY Department of Plant Biology, Ohio State University, Columbus, OH 43210-1293 Communicated by Michael T. Clegg, University of California, Riverside, CA, April 17, 1995 ABSTRACT The internal transcribed spacers (ITS) of genus, comprising three sections and -35 diploid (2n = 10) nuclear ribosomal DNA of 33 species of genus Paeonui (Paeo- and tetraploid species of shrubs and perennial herbs, occurs niaceae) were sequenced. In section Paeonia, different pat- widely in disjunct areas of the northern temperate region terns of nucleotide additivity were detected in 14 diploid and (11-13). All the tetraploid species belong to herbaceous sec- tetraploid species at sites that are variable in the other 12 tion Paeonia. The majority of the tetraploids occurring in the species of the section, suggesting that reticulate evolution has Mediterranean region has been suggested as allopolyploids (9, occurred. Phylogenetic relationships of species that do not 10). The origins of the putative allotetraploids, however, show additivity, and thus ostensibly were not derived through remain unknown. The diploid species ofthis section have never hybridization, were reconstructed by parsimony analysis. The been considered to be of hybrid origin. taxa presumably derived through reticulate evolution were In the present study, ITS sequences were used to reconstruct then added to the phylogenetic tree according to additivity the phylogeny of Paeonia. t The sequence data indicate that from putative parents. The study provides an example of multiple hybridization events have led to speciation at both successfully using ITS sequences to reconstruct reticulate diploid and tetraploid levels in section Paeonia. The results evolution in plants and further demonstrates that the se- provide an example of using ITS sequences to detect relatively quence data could be highly informative and accurate for ancient reticulate evolution in plants. Reconstruction of re- detecting hybridization. Maintenance ofparental sequences in ticulate evolution in peonies yields significant insights into the species of hybrid origin is likely due to slowing of their distributional histories. The possible mechanisms respon- concerted evolution caused by the long generation time of sible for maintenance of complete or partial parental se- peonies. The partial and uneven homogenization of parental quences in the species of hybrid origin are discussed. sequences displayed in nine species of putative hybrid origin may have resulted from gradients of gene conversion. The MATERIALS AND METHODS documented hybridizations may have occurred since the Pleis- tocene glaciations. The species of hybrid origin and their Forty-five accessions of 33 Paeonia species, including all the putative parents are now distantly allopatric. Reconstruction well recognized ones in section Paeonia, were sequenced. For of reticulate evolution with sequence data, therefore, provides most species, fresh leaves used as sources of DNA were gene records for distributional histories of some of the pa- collected from natural populations in Bulgaria, China, Greece, rental species. and Spain. The remaining species were collected from The Royal Botanic Garden (Kew). Total DNA was isolated from Speciation via hybridization, particularly when combined with leaf tissues by the CTAB method (14) and purified in CsCl/ polyploidization, is an important evolutionary mechanism in ethidium bromide gradients. Double-stranded DNA of the plants (1). Reconstructing reticulate evolution, however, has complete ITS region was amplified by 30 cycles of symmetric been a remarkably challenging task. Although the application PCR using primers ITS-4 and ITS-5 of White et al. (15), but of molecular markers has greatly facilitated the detection of ITS-5 was modified to match sequences of the 18S gene in seed hybridization and the recognition of allopolyploids in many plants (ITS-5m, GGAAGGAGAAGTCGTAACAAGG). plant groups, difficulties remain, largely due to lack of under- The amplification products were purified by electrophoresis standing the complex dynamic of molecular evolution (2-5). through 1.0% agarose gel followed by use of Bioclean (United Despite very few applications of sequences of the internal States Biochemical) (16). Purified double-stranded DNAs transcribed spacers (ITS) of nuclear ribosomal DNA to studies were used for sequencing reactions employing Sequenase of allopolyploid taxa, strikingly contrasting results have been version 2.0 (United States Biochemical), deoxyadenosine 5'- reported. While in Krigia it was shown that both parental [a-[35S]thio]triphosphate, and two forward (ITS-3 and ITS- sequences of the ITS region have been maintained in an Sm) and two reverse (ITS-2 and ITS-4) primers (15, 16). The allopolyploid species (6), in cotton the sequences of allotet- sequencing reaction products were separated electrophoreti- raploids have been homogenized to that of either parental cally in 6% acrylamide gel with wedge spacers for 3 hr at 1500 diploid species due to concerted evolution (7). Further inves- V. After fixation, gels were dried and exposed to Kodak XAR tigations, therefore, are needed to understand evolution of the x-ray film for 24-48 hr. DNA sequences were aligned manually ITS region after hybridization and polyploidization. Such and read for both strains. understanding is particularly important because ITS sequences Variable nucleotide sites were analyzed by unweighted are becoming a widely used tool for phylogenetic reconstruc- Wagner parsimony using PAUP version 3.1.1 (17). The shortest tion in trees were searched by the branch-and-bound method, and plants (8). character changes were interpreted with ACCTRAN optimiza- The peonies (Paeonia) represent a group that appears to tion. Bootstrap have undergone extensive reticulate evolution (9-11). The analyses were carried out with 1000 replica- Abbreviation: ITS, internal transcribed spacer(s). The publication costs of this article were defrayed in part by page charge *To whom reprint requests should be addressed. payment. This article must therefore be hereby marked "advertisement" in tThe sequences reported in this paper have been deposited in the accordance with 18 U.S.C. §1734 solely to indicate this fact. GenBank data base (accession nos. U27670-U27697). 6813 Downloaded by guest on September 30, 2021 6814 Evolution: Sang et al. Proc. Natl. Acad. Sci. USA 92 (1995) tions using TBR branch swapping of the heuristicc search. (18).I- Additivity of Nucleotides and Reticulate Evolution. Five Section Oneapia ofPaeonia was chosen as the out,group for the Paeonia species-P. banatica, P. russi, P. emodi, P. sterniana, cladistic analysis of the genus for the following;reasons: (i) and P. peregrina-show perfect or almost perfect additivity at Paeonia is so isolated systematically that choice of a proper all sites that are variable between two or three other species or outgroup from outside of the genus is not feasit)le for polar- species groups (Figs. 1 and 2), suggesting strongly that these izing ITS variation within it; and (ii) evidence fr(om morphol- five species were derived through hybridization (6, 8). ogy, biogeography, ITS sequences, and chloropllast DNA di- P. banatica, a tetraploid, may have originated from hybrid- vergence suggests that the earliest evolutionary s,plit probably ization between Paeonia mairei and ARI-TEN (Paeonia ari- occurred between section Oneapia and the rest of the genus etina, Paeonia humilis, Paeonia officinalis, or Paeonia tenuifo- (refs. 19 and 20; and T.S., unpublished data). lia, or their common ancestor) because it combines different nucleotides at all sites that are variable between the putative parents (Fig. 2). At each of the additive sites- 4, 7, 8, 9, 12, 13, RESULTS 14, 15, 16, 17, 19, and 20 ofP. banatica-1 of the 2 nucleotides Variation in ITS Sequences and Phylogenetic Reconstruc- is a synapomorphy of ARI-TEN, which clearly indicates ARI- tion. ITS-1 of all species sequenced is 267 bp Ionig. There is a TEN to be a parent of P. banatica. At each of the remaining 1-bp and a 3-bp insertion/deletion in ITS-2 betuveen Paeonia additive sites 2 and 6, 1 of the nucleotides is a synapomorphy californica of section Oneapia and the rest of the species, and for P. mairei and JAP & OBO (Paeonia japonica or Paeonia thus ITS-2 is 220 bp for the former and 222 bp fFor the latter. obovata or their common ancestor), suggesting that either of Sequences of the 5.8S rRNA gene are identica1 for species them may be the other parent ofP. banatica. The possibility of sampled from the three sections and are 164 bp l ong. Percent- JAP & OBO being the parent can be ruled out because, at sites age G+C content ranges from 54.3% to 56.6% in ITS-1 and 7 and 8, their synapomorphies do not contribute to the from 57.2% to 59.5% in ITS-2, and it is 53.7% foir 5.8S rDNA. additivity. Likewise, P. russi, also a tetraploid, shows additivity The number of nucleotide sites showing fixecJ differences at all sites but site 12 that are variable between Paeonia among all species is 29 in ITS-1 and 20 in ITS-2. Nio nucleotide lactiflora and P. mairei and thus may have been derived through substitutions were found among different poptalations of a hybridization between these two species. species. Of 27 species and subspecies sequence-d in section The ITS sequence of the diploid P. emodi shows additivity Paeonia, 15 of them show nucleotide additivity alt the variable at sites that are variable between P. lactiflora and VEI & XIN sites within the section, suggesting that they ma.y have origi- (Paeonia veitchii or Paeonia xinjiangensis or their common nated via hybridization (Figs. 1 and 2; refs. 6 aniLd 8). Besides ancestor). At site 5, however, P. emodi combines G and T, but these clearly additive sites, very few ambiguouis ones were its putative parents, P.