DOCSLIB.ORG

Research Article Rapid PCR Detection of Mycoplasma Hominis, Ureaplasma Urealyticum,Andureaplasma Parvum

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Research Article Rapid PCR Detection of Mycoplasma Hominis, Ureaplasma Urealyticum,Andureaplasma Parvum Hindawi Publishing Corporation International Journal of Bacteriology Volume 2013, Article ID 168742, 7 pages http://dx.doi.org/10.1155/2013/168742 Research Article Rapid PCR Detection of Mycoplasma hominis, Ureaplasma urealyticum,andUreaplasma parvum Scott A. Cunningham,1 Jayawant N. Mandrekar,2 Jon E. Rosenblatt,1 and Robin Patel1,3 1 Division of Clinical Microbiology, Department of Laboratory Medicine and Pathology, Mayo Clinic, Rochester, MN 55905, USA 2 Division of Biomedical Statistics and Informatics, Department of Health Science Research, Mayo Clinic, Rochester, MN 55905, USA 3 Division of Infectious Diseases, Department of Medicine, Mayo Clinic, Rochester, MN 55905, USA Correspondence should be addressed to Robin Patel; [email protected] Received 5 November 2012; Accepted 30 January 2013 Academic Editor: Sam R. Telford Copyright © 2013 Scott A. Cunningham et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Objective. We compared laboratory developed real-time PCR assays for detection of Mycoplasma hominis and for detection and differentiation of Ureaplasma urealyticum and parvum to culture using genitourinary specimens submitted for M. hominis and Ureaplasma culture. Methods. 283 genitourinary specimens received in the clinical bacteriology laboratory for M. hominis and Ureaplasma species culture were evaluated. Nucleic acids were extracted using the Total Nucleic Acid Kit on the MagNA Pure 2.0. 5 L of the extracts were combined with 15 L of each of the two master mixes. Assays were performed on the LightCycler 480 II system. Culture was performed using routine methods. Results. M. hominis PCR detected 38/42 M. hominis culture-positive specimens, as well as 2 that were culture negative (sensitivity, 90.5%; specificity, 99.2%). Ureaplasma PCR detected 139/144 Urea- plasma culture-positive specimens, as well as 9 that were culture negative (sensitivity, 96.5%; specificity, 93.6%). Of the specimens that tested positive for Ureaplasma species, U. urealyticum alone was detected in 33, U. parvum alone in 109, and both in 6. Con- clusion. The described PCR assays are rapid alternatives to culture for detection of M. hominis and Ureaplasma species, and, unlike culture, the Ureaplasma assay easily distinguishes U. urealyticum from parvum. 1. Introduction microscopic colonies and takes two to five days. U. ure- alyticum was the only Ureaplasma species until 2002, when Mycoplasma hominis, Ureaplasma urealyticum,andUrea- U. parvum was described [4]. The two are not distinguished plasma parvum aresmall,fastidiousbacteriabelongingto based on culture characteristics alone. Real-time PCR detec- the Mollicutes class. They lack a cell wall (preventing stain- tion of these microorganisms from clinical samples circum- ing with Gram stain) and are not sensitively detected on vents technical issues related to culture and shortens turn- routine bacterial cultures. Optimal recovery requires spe- around time for detection and identification. cialized media and growth conditions. There are several human pathogens in the genera Mycoplasma and Ureaplasma Few real-time PCR assays and associated studies have which are responsible for a variety of clinical manifestations been described for M. hominis. Areal-timePCRassaytar- involving multiple body systems [1]. M. hominis causes geting M. hominis gap identified two positive cervical swabs septic arthritis and postpartum fever and has been associated fromwomenbeingevaluatedforinfertility[5]. 153 urogenital with pelvic inflammatory disease and bacterial vaginosis specimens were tested with a real-time PCR assay targeting [2]. Ureaplasma species can cause acute urethritis and have M. hominis yidC, of which 45 were PCR- and culture positive been associated with bacterial vaginosis, preterm birth, and and 10 PCR positive only [6]. Finally, extragenital M. hominis neonatal respiratory disease [1, 3]. infection was diagnosed in three patients using a real-time Although M. hominis and Ureaplasma species can be PCR assay targeting the M. hominis 16S ribosomal RNA gene cultured, this requires technical skill for interpretation of [7]. 2 International Journal of Bacteriology Table 1: Primers and probes. Mycoplasma hominis tuf (set number 793, TIB MolBio, Aldelphia, NJ; 10X concentration)a tuf 193F 5 AATTGATATGTTTAAAGATGATGAAAGAGA 3 Primers tuf 193R 5 TGTATCAACAGCATCCATTAATTCC 3 tuf 193flb 5 GACGTAAGAAGCCTTCTATCAGAATATGGT FITC 3 Probes tuf 193iLC610c 5 Red610 TGATGGTGACAATGCTCCTATTATTGCTGGTTC PO4 3 Ureaplasma species ureC (set number 684, TIB MolBio; 10X concentration)d ureC158F 5 CCTGCTTCGTTTAATGTATCTG 3 Primers ureC158R 5 GAAGATCCAATCTTTGAACAAATCGTA 3 ureC158R5 5 GAAGATCCAATCTTTGAACAAATTGCT 3 ureC158flb 5 AGCAACTGTTAATGCTAAGTCAATAGCGTTTCCTG FITC 3 Probes ureC158iLC610c 5 Red610 GCCCCTCAGTCTTCGTGAATCTTAAGACCACAAGC PO4 3 atuf target corresponds to 66720–66912 of GenBank accession number FP236530. bLabeled with fluorescein on 3 end. cLabeled with LC610 on 5 end and a phosphate on 3 end. dureC target corresponds to 527786–527943 of GenBank accession number CP001184. There has been more work on real-time PCR assays for five days. A color change (indicating an alkaline pH shift) in Ureaplasma species, although some have described assays the U9 broth prompted subculture of 100 LtoanA7agar ∘ buthavenotevaluatedclinicalspecimensorclinicalisolates plate. Plates were incubated anaerobically at 35 Cforupto [8]. A real-time PCR assay that detects and distinguishes U. 48hoursandexaminedwithaninvertedlightmicroscopefor urealyticum from parvum was described but used to assess small, circular to irregular colonies growing into the surface 87 vaginal swabs [9]. Tang et al. used a real-time PCR assay of the agar, with a surrounding red zone. Confirmation of that detects and distinguishes U. parvum and urealyticum to Ureaplasma species was indicated by golden-brown stained test 346 genitourinary swabs; 120 were positive for the former colonies with the addition of 0.167 M CO(NH2)2 and 0.04 M and21forthelatter,including5positiveforboth[10]. Finally, MnCl2 in water. Vancutsem et al. used a real-time PCR assay for detection and differentiation of U. urealyticum and parvum to evaluate 2.4. Sample Processing for PCR. Sampleswerevortexedand 300 lower genital tract specimens; 132 were culture positive, of which all plus an additional 19 were PCR-positive (19, U. 200 L transferred to a MagNA Pure sample cartridge (Roche urealyticum; 120, U. parvum; 12, Ureaplasma species) [11]. Applied Science, Indianapolis, IN). DNA extraction was Herein, we present one real-time PCR assay for the performed on the MagNA Pure LC 2.0 using the MagNA Pure LC Total Nucleic Acid Isolation Kit (Roche Applied Science) detection of M. hominis and another for the detection and differentiation of Ureaplasma species and report results of with a final elution volume of 100 L. these assays on 283 genitourinary specimens in comparison to culture. 2.5. Polymerase Chain Reaction Assay. Primers and probes (Table 1) were designed using the LightCycler Probe Design 2. Materials and Methods Software, version 2.0 (Roche Diagnostics, Indianapolis, IN, USA) and DNA Workbench, version 5.7.1 (CLC Bio, Cam- 2.1. Clinical Specimens. 283 genitourinary specimens (swabs, bridge, MA, USA). Positive control plasmids were con- urine) submitted to the Mayo Clinic Clinical Microbiology structed for the three target-specific genes (Table 1)using Laboratory in transport medium (e.g., UTM, M5) for M. the pCR 2.1 TOPO TA Cloning Kit (Invitrogen Corpora- hominis and Ureaplasma culture were evaluated. No clinical tion, Carlsbad, CA, USA). Sources for the inserted target data associated with these specimens was available. This study sequences were M. hominis ATCC 23114, U. urealyticum was approved by the Mayo Clinic Institutional Review Board. ATCC 27618, and U. parvum ATCC 27815D. Plasmids were purifiedusingtheHighPurePlasmidIsolationKit(Roche 2.2. Mycoplasma hominis Culture. Samples were placed into Applied Science). Sizes of the cloned inserts were confirmed ∘ arginine broth, incubated at 35 C, and monitored four times by EcoR1 digestion. Plasmid inserts were sequenced using daily for up to five days. Color change (indicating an alkaline M13 forward and reverse primers included in the cloning kit, to confirm proper insert orientation. Plasmids were diluted pH shift) in the arginine broth prompted subculture of 50 L ∘ to an A7 agar plate. Plates were incubated anaerobically at in Tris-EDTA buffer (pH 8.0) and stored at4 C. ∘ 35 C for up to five days and examined daily with an inverted The two assays were independently optimized onthe light microscope for “fried egg” morphology colonies. LightCycler 480 II platform employing LightCycler 480 Software version 1.5 (Roche Applied Science). 15 LofPCR 2.3. Ureaplasma Culture. SampleswereplacedintoU9broth, master mix, containing final concentrations of 1X Roche ∘ incubated at 35 C, and monitored four times daily for up to Genotyping Master (Taq DNA polymerase, PCR reaction International Journal of Bacteriology 3 buffer, deoxyribonucleoside triphosphate with dUTP substi- Melting peaks tuted for dTTP and 1 mM MgCl2), 1 mM (additional) MgCl2, 14.29 and1XofeachoftheLightCyclerprimer-probesets(Table1) were added to a 96-well LightCycler 480 plate. Extracted 11.29 nucleic acid (5 L)wasthenaddedtoeachwell.Thecycling ∘ 8.29 program was as follows: denaturation
Load more

Recommended publications
  • Comparative Genome Analysis of 19 Ureaplasma Urealyticum and Ureaplasma Parvum Strains
    Paralanov et al. BMC Microbiology 2012, 12:88 http://www.biomedcentral.com/1471-2180/12/88 RESEARCH ARTICLE Open Access Comparative genome analysis of 19 Ureaplasma urealyticum and Ureaplasma parvum strains Vanya Paralanov1, Jin Lu2, Lynn B Duffy2, Donna M Crabb2, Susmita Shrivastava1, Barbara A Methé1, Jason Inman1, Shibu Yooseph1, Li Xiao2, Gail H Cassell2, Ken B Waites2 and John I Glass1* Abstract Background: Ureaplasma urealyticum (UUR) and Ureaplasma parvum (UPA) are sexually transmitted bacteria among humans implicated in a variety of disease states including but not limited to: nongonococcal urethritis, infertility, adverse pregnancy outcomes, chorioamnionitis, and bronchopulmonary dysplasia in neonates. There are 10 distinct serotypes of UUR and 4 of UPA. Efforts to determine whether difference in pathogenic potential exists at the ureaplasma serovar level have been hampered by limitations of antibody-based typing methods, multiple cross-reactions and poor discriminating capacity in clinical samples containing two or more serovars. Results: We determined the genome sequences of the American Type Culture Collection (ATCC) type strains of all UUR and UPA serovars as well as four clinical isolates of UUR for which we were not able to determine serovar designation. UPA serovars had 0.75−0.78 Mbp genomes and UUR serovars were 0.84−0.95 Mbp. The original classification of ureaplasma isolates into distinct serovars was largely based on differences in the major ureaplasma surface antigen called the multiple banded antigen (MBA) and reactions of human and animal sera to the organisms. Whole genome analysis of the 14 serovars and the 4 clinical isolates showed the mba gene was part of a large superfamily, which is a phase variable gene system, and that some serovars have identical sets of mba genes.
    [Show full text]
  • Roles of Oral Bacteria in Cardiovascular Diseases—From
    J Pharmacol Sci 113, 000 – 000 (2010) Journal of Pharmacological Sciences ©2010 The Japanese Pharmacological Society Forum Minireview Roles of Oral Bacteria in Cardiovascular Diseases — From Molecular Mechanisms to Clinical Cases: Implication of Periodontal Diseases in Development of Systemic Diseases Hiroaki Inaba1 and Atsuo Amano1,* 1Department of Oral Frontier Biology, Graduate School of Dentistry, Osaka University, Suita 565-0871, Japan Received November 16, 2009; Accepted December 21, 2009 Abstract. Periodontal diseases, some of the most common infectious diseases seen in humans, are characterized by gingival inflammation, as well as loss of connective tissue and bone from around the roots of the teeth, which leads to eventual tooth exfoliation. In the past decade, the as- sociation of periodontal diseases with the development of systemic diseases has received increas- ing attention. Although a number of studies have presented evidence of close relationships between periodontal and systemic diseases, the majority of findings are limited to epidemiological studies, while the etiological details remain unclear. Nevertheless, a variety of recent hypothesis driven investigations have compiled various results showing that periodontal infection and subsequent direct oral-hematogenous spread of bacteria are implicated inPROOF the development of various systemic diseases. Herein, we present current understanding in regard to the relationship between periodon- tal and systemic diseases, including cardiovascular diseases, preterm delivery of low birth weight, diabetes mellitus, respiratory diseases, and osteoporosis. Keywords: periodontal disease, diabetes mellitus, cardiovascular disease, preterm delivery, Porphyromonas gingivalis, oral bacteria 1. Introduction detected in heart valve lesions and atheromatous plaque (5, 6), amniotic fluid of pregnant women with threatened Epidemiological and interventional studies of humans premature labor (11), and placentas from cases of preterm have revealed close associations between periodontal delivery (12, 13).
    [Show full text]
  • Fis-His-2020-Abstract-Supplement-Free-Paper.Pdf
    Abstract supplement (free paper abstracts) FIS/HIS International 2020 cannot be held responsible for errors or inconsistencies contained within the abstract supplement. Only major formatting alterations have been made and abstract content remains consistent with what was entered at time of submission by the author/s. How to search this document Laptop, PC or similar: ‘Ctrl’ + ‘F’ or ‘Edit’ then ‘Find’ Smart device: Open this PDF in either the 'iBooks' app (Apple) or 'My Files' app (Android). Both are built in apps and have a magnifying glass search icon. Contents A quick reference guide by topic, paper number and presentation type can be found at the end of the document or click here. (Click paper title to take you straight there) Free paper oral presentations 11: Investigations, actions and learning from an outbreak of SARS-CoV-2 infection among health care workers in the United Kingdom ........................................................................................................................ 13 12: Procalcitonin as an antibiotic stewardship tool in COVID-19 patients in the intensive care ...................... 14 20: Impact of antibiotic timing on mortality from Gram negative Bacteraemia in an English District General Hospital: the importance of getting it right every time .................................................................................... 15 35: Case report: A fall in the forest ................................................................................................................... 16 65: Not
    [Show full text]
  • CASEE-2017 Session1b -Eva-Tvrda
    A The 8th International CASEE Conference Warsaw University of Life Sciences – SGGW May 14 - 16, 2017 . Decreased sperm quality visible in routine semen analysis: . loss of sperm motility . morphological alterations . acrosome dysfunction . disruption of membrane integrity . oxidative stress . Most data connected to bacterial contamination of ejaculates: well-known causative agents of urogenital tract infections . Escherichia coli, Staphylococcus aureus, Ureaplasma urealyticum, Mycoplasma hominis, Chlamydia trachomatis . Ejaculates collected for reproductive technologies - certain contamination: . semen collection is not an entirely serile process . factors for semen contamination: artifical vaginas, environmental conditions, human factors . Current interest shifts to other bacteria, responsible for the colonization and contamination of the male urogenital tract, rather than infection . Gram-positive, catalase-negative, non-spore-forming, facultative anaerobic bacteria . Lactic acid bacteria (LAB) that produce bacteriocins . Origins: environmental, animal and human sources . E. faecalis: . most common in the gastrointestinal tract, and may be found in human and animal faeces . associated with clinical urinary tract infections, hepatobiliary sepsis, endocarditis, surgical wound infection, bacteraemia and neonatal sepsis . able to survive a range of adverse environments allowing multiple routes of cross- contamination . resistant to a broad range of antibiotics including ampicillin, ciprofloxacin and imipenem ANTIBIOTICS NATURALLY OCCURING
    [Show full text]
  • GBS 10 Strep11 Other 60 Vaginal Swabs! Real-Time LAMP!
    • Specificity studies were performed using a panel of 10 Group B Streptococcus agalactiae strains, 11 of the most commonly occurring Streptococcus genus strains and 60 other organisms commonly found in the human genital tract. • One hundred and twenty four (124) vaginal swabs sampled from pregnant women were tested with the real-time LAMP assay and compared to a real- time PCR assay (5). Neonatal infections are most commonly caused by Group B Streptococcus GBS 10 (Streptococcus agalactiae) (1). These infections can be classified as either early on-set • Of the 124 vaginal swabs, 85 tested positive for Group B Streptococcus and & or late-onset disease. Early onset infection (EOI) occurs during the first week of life 39 tested negative. with late onset infection (LOI) occurring between one week and three months. It is Strep11 thought that early onset disease develops in the foetus after aspiration of infected • Comparable results were achieved by both the real-time PCR and real –time amniotic fluid (2). Late onset infection is less well understood, and while passage LAMP assays. Results are listed in Table 4. Also shown in the table are through the birth canal is an obvious route of infection, it is also thought that community previously obtained microbiological culture data for the isolation and sources are involved (2). Other identification of GBS. 60 One approach used to identify potential for infection is a screening of pregnant women, where prophylaxis is offered to those identified as carriers (3). This approach is also • Figure 1: Breakdown of specificity panels investigated during the development of the Table 2: Results of GBS testing of vaginal swabs.
    [Show full text]
  • Prevalence of Ureaplasma Urealyticum, Mycoplasma Hominis and Chlamydia Trachomatis in Patients with Uncomplicated Recurrent Urin
    Nephrology and Renal Diseases Research Article ISSN: 2399-908X Prevalence of Ureaplasma urealyticum, Mycoplasma hominis and Chlamydia trachomatis in patients with uncomplicated recurrent urinary tract infections Jadranka Vlasic-Matas1*, Hrvoje Raos2, Marijana Vuckovic2, Stjepan Radic2 and Vesna Capkun3 1Polyclinic Nephrology Department, Split, Croatia 2School of Medicine, University of Split, Split, Croatia 3Department of Nuclear Medicine, Split University Hospital Center, Split, Croatia Abstract Aim: To assess the prevalence of Ureaplasma urealyticum, Mycoplasma hominis and Chlamydia trachomatis in patients with chronic urinary tract infections (UTIs) and its correlation with leukocyturia and symptoms. Methods: The study included 220 patients (130 women and 90 men) presenting with chronic voiding symptoms and sterile leukocyturia. Urine, urethral swabs and cervical swabs (for women patients) were taken to determine the presence of these pathogens. Patients were treated by tetracycline and followed up three and six months after initial therapy. Results: In 186 (85%) out of 220 patients, U. urealyticum was found, while C. trachomatis was present in 34 patients (15%). In majority of female patients (112 out of 130; 86%) U. urealyticum was found. In addition to ureaplasma, in eight patients M. hominis was found. C. trachomatis was identified in 18 female patients (14%). In 74 out of 90 (82%) male patients U. urealyticum was detected while in six of them M. hominis was also found. C. trachomatis was identified in 16 male patients (18%). U. urealyticum was significantly related to leukocyturia, as opposed to C. trachomatis (p<0,001). Women had more frequent symptomatology (p = 0,015) and higer leukocyturia (p<0.001). Conclusion: Leukocyturia is more common find in U.
    [Show full text]
  • Anterior Nares Acidovorax Ebreus 100% Acidovorax Sp
    Anterior Nares Acidovorax ebreus 100% Acidovorax sp. Acinetobacter johnsonii Acinetobacter lwoffii 10% Actinobacillus minor Actinomyces odontolyticus Actinomyces sp. 1% Actinomyces urogenitalis Aggregatibacter aphrophilus Alistipes putredinis 0.1% Anaerococcus hydrogenalis Anaerococcus lactolyticus 0.01% Anaerococcus prevotii Anaerococcus tetradius Anaerococcus vaginalis 0.001% Atopobium vaginae Bacteroides dorei Bacteroides intestinalis 0.0001% Bacteroides sp. Bacteroides stercoris Bacteroides vulgatus 0.00001% Campylobacter concisus Campylobacter gracilis Campylobacter hominis Campylobacter lari Campylobacter showae Candidate division Capnocytophaga gingivalis Capnocytophaga ochracea Capnocytophaga sputigena Cardiobacterium hominis Catonella morbi Citrobacter sp. Clostridium leptum Corynebacterium accolens Corynebacterium ammoniagenes Corynebacterium amycolatum Corynebacterium diphtheriae Corynebacterium efficiens Corynebacterium genitalium Corynebacterium glutamicum Corynebacterium jeikeium Corynebacterium kroppenstedtii Corynebacterium lipophiloflavum Corynebacterium matruchotii Corynebacterium pseudogenitalium Corynebacterium pseudotuberculosis Corynebacterium resistens Corynebacterium striatum Corynebacterium tuberculostearicum Corynebacterium urealyticum Delftia acidovorans Dialister invisus Eikenella corrodens Enhydrobacter aerosaccus Eubacterium rectale Finegoldia magna Fusobacterium nucleatum Fusobacterium periodonticum Fusobacterium sp. Gardnerella vaginalis Gemella haemolysans Granulicatella adiacens Granulicatella elegans Haemophilus
    [Show full text]
  • Reactive Arthritis Or Chronic Infectious Arthritis? J Sibilia, F-X Limbach
    580 REVIEW Ann Rheum Dis: first published as 10.1136/ard.61.7.580 on 1 July 2002. Downloaded from Reactive arthritis or chronic infectious arthritis? J Sibilia, F-X Limbach ............................................................................................................................. Ann Rheum Dis 2002;61:580–587 Microbes reach the synovial cavity either directly during hence active multiplication of the bacteria. bacteraemia or by transport within lymphoid cells or These findings thus suggest that microbes can survive in small numbers in the articular cavity monocytes. This may stimulate the immune system in certain forms of ReA (table 1). excessively, triggering arthritis. Some forms of ReA • The phenomenon has grown since 1995 with correspond to slow infectious arthritis due to the discovery of DNA of most other classical persistence of microbes and some to an infection arthritogenic agents in synovial samples from patients with ReA.18–21 One must nevertheless triggered arthritis linked to an extra-articular site of take a fairly critical point of view because infection. although the results are convincing for C .......................................................................... trachomatis, they are much less so for entero- bacteria. It is true that DNA of Yersinia, Shigella, or Campylobacter has been identified in some eactive arthritis (ReA) was first described in studies, but these are few and include very few 1916 during the first world war by Fiessinger patients.18 19 21 22 Thus, Ekman et al identified and Leroy in France and Reiter in Germany. R DNA of Salmonella in synovial samples,23 but It was, however, only in 1969 that a Scandinavian could not repeat their results. This might have team rationalised the concept of ReA by defining it as a transient non-purulent (reactive) arthritis been owing to technical artefacts, which lead appearing in the weeks following a digestive to false positives, or to a very small amount of infection.1 Actually, this notion of exclusively bacterial DNA in the synovium.
    [Show full text]
  • Are You Suprised ?
    DAMB 711 Microbiology Final Exam B 100 points December 16, 2009 Your name (Print Clearly): _____________________________________________ Exam # __________ Seat # ___________ CPA # ____________ I. Multiple Choice: Choose the ONE BEST answer. Mark the correct answer on Part 1 of the answer sheet. Use a #2 pencil. 1. Which of the following describes the infectious agent of a microorganism that causes atypical pneumoniae? A. fecal material from a patient harboring Salmonella typhi B. endospores of Clostridium botulinum C. Treponema pallidum in a chancre D. the reticulate body of Chlamydia trachomatis. E. the elementary body of Chlamydia pneumoniae 2. Many bacteria are intracellular parasites with specialized mechanisms for survival inside cells. One of the following is not a mechanism for survival in the cell. Which one? A. Shigella’s escape from the endosome. B. Mycobacterial prevention of phagosome and lysosome fusion. C. Salmonella’s transcription of an acid tolerance response gene. D. Aggregatibacter’s leukotoxin 3. Diabetic patients are predisposed to __________________ caused by___________________: A. athlete’s foot: Candida albicans B. typhus: Rickettsia typhi C. rhino-cerebral zygomycosis: Mucor species D. hypersensitivities: Aspergillus fumigatus E. lung infections: Coccidioides immitis 4. Chalmydia psittaci and Cryptococcus neoformans have the following in common: A. They are both molds. B. They are both yeasts. C. Their infectious agents are transmitted in avian feces. D. A, B and C are true E. B and C are true. 5. Members of the genus Mycoplasma are unique among bacteria because they: A. have a rudimentary life cycle. B. have a primary arthropod host that is both a vector and a reservoir.
    [Show full text]
  • Roles of the Vagina and the Vaginal Microbiota in Urinary Tract Infection: Evidence from Clinical Correlations and Experimental Models
    Washington University School of Medicine Digital Commons@Becker Open Access Publications 1-1-2020 Roles of the vagina and the vaginal microbiota in urinary tract infection: Evidence from clinical correlations and experimental models Amanda L Lewis Nicole M Gilbert Follow this and additional works at: https://digitalcommons.wustl.edu/open_access_pubs Urogenital infections and inflammations OPEN ACCESS Review Article Roles of the vagina and the vaginal microbiota in urinary tract infection: evidence from clinical correlations and experimental models Abstract Mounting evidence indicates that the vagina can harbor uropathogenic Amanda L. Lewis1,2,3 bacteria. Here, we consider three roles played by the vagina and its Nicole M. Gilbert2,3,4 bacterial inhabitants in urinary tract infection (UTI) and urinary health. First, the vagina can serve as a reservoir for Escherichia coli, the most common cause of UTI, and other recognized uropathogens. Second, 1 Molecular Microbiology, several vaginal bacterial species are frequently detected upon urine Washington University School culture but are underappreciated as uropathogens, and other vaginal of Medicine in Saint Louis, species are likely under-reported because of their fastidious nature. United States Third, some vaginal bacteria that are not widely viewed as uropathogens 2 Obstetrics and Gynecology, can transit briefly in the urinary tract, cause injury or immunomodulation, Washington University School and shift the balance of host-pathogen interactions to influence the of Medicine in Saint Louis, outcomes of uropathogenesis. This chapter describes the current liter- United States ature in these three areas and summarizes the impact of the vaginal 3 Center for Women's microbiota on susceptibility to UTI and other urologic conditions.
    [Show full text]
  • Detection and Characterisation of Ureaplasma Spp in Men with and Without Urogenital Symptoms
    Detection and characterisation of Ureaplasma spp in men with and without urogenital symptoms NONTUTHUKO EXCELLENT MANINGI Detection and characterisation of Ureaplasma spp in men with and without urogenital symptoms by NONTUTHUKO EXCELLENT MANINGI Submitted in partial fulfilment of the requirements for the degree Magister Scientiae Department of Medical Microbiology Faculty of Health Sciences University of Pretoria Pretoria South Africa January 2012 The things that will destroy us are: politics without principle, pleasure without conscience, wealth without work, knowledge without character, business without morality, science without humanity, and worship without sacrifice. M ahatma G andhi Declaration I, Nontuthuko Excellent Maningi, hereby declare that the work on which this dissertation is based, is original and that neither the whole work nor any part of it has been, is being, or is to be submitted for another degree at this or any other university or tertiary education institution or examination body. ................................................................. Signature of candidate ............................................................... Date ACKNOWLEDGEMENTS First, I want to thank the Almighty, who made all things possible for me. To my family, especially my mother and my late father who never gave up on me, I wouldn’t have done it without their support and encouragement. I want to thank my supervisor Dr Kock for all the assistance, guidance and encouragement she has given me throughout my MSc. A special thanks to my co-supervisor Prof AA Hoosen, he was not only a supervisor but also a father to me, he has inspired me from the first day I met him. I also want to thank the Department of Medical Microbiology, Dr Adam and the NHLS (Tshwane Academic Division) for the opportunity to perform this research and use of their facilities.
    [Show full text]
  • HIGHLIGHTS of PRESCRIBING INFORMATION These Highlights Do
    HIGHLIGHTS OF PRESCRIBING INFORMATION These highlights do not include all the information needed to use • See Full Prescribing Information for additional indication specific ® ® ACTICLATE and ACTICLATE CAP safely and effectively. See dosage information and important administration instructions for ® ® full prescribing information for ACTICLATE and ACTICLATE ACTICLATE and ACTICLATE CAP. (2.1, 2.4, 2.5) CAP. ---------------DOSAGE FORMS AND STRENGTHS----------­ • ® ACTICLATE Tablets: 75 mg and 150 mg (functionally scored) ACTICLATE (doxycycline hyclate) tablets, for oral use (3) ® ACTICLATE CAP (doxycycline hyclate) capsules, for oral use • ACTICLATE CAP Capsules: 75 mg (3) Initial U.S. Approval: 1967 ---------------------CONTRAINDICATIONS----------------------­ ACTICLATE and ACTICLATE CAP are contraindicated in persons ----------------------INDICATIONS AND USAGE----------------­ who have shown hypersensitivity to any of the tetracyclines. (4) ® ® ACTICLATE and ACTICLATE CAP are tetracycline class drugs -------------------WARNINGS AND PRECAUTIONS-----------­ indicated for: • The use of ACTICLATE and ACTICLATE CAP during tooth • Rickettsial infections (1.1) development (last half of pregnancy, infancy and childhood to the • Sexually transmitted infections (1.2) age of 8 years) may cause permanent discoloration of the teeth • Respiratory tract infections (1.3) (yellow-gray-brown) and enamel hypoplasia Advise the patient of • Specific bacterial infections (1.4) the potential risk to the fetus during pregnancy. (2.2, 5.1, 8.1, 8.4) • Ophthalmic infections (1.5) • The use of ACTICLATE and ACTICLATE CAP during the • Anthrax, including inhalational anthrax (post-exposure) (1.6) second and third-trimester of pregnancy, infancy and childhood • Alternative treatment for selected infections when penicillin is up to the age of 8 years may cause reversible inhibition of bone contraindicated (1.7) growth.
    [Show full text]