Hindawi Publishing Corporation International Journal of Bacteriology Volume 2013, Article ID 168742, 7 pages http://dx.doi.org/10.1155/2013/168742 Research Article Rapid PCR Detection of Mycoplasma hominis, Ureaplasma urealyticum,andUreaplasma parvum Scott A. Cunningham,1 Jayawant N. Mandrekar,2 Jon E. Rosenblatt,1 and Robin Patel1,3 1 Division of Clinical Microbiology, Department of Laboratory Medicine and Pathology, Mayo Clinic, Rochester, MN 55905, USA 2 Division of Biomedical Statistics and Informatics, Department of Health Science Research, Mayo Clinic, Rochester, MN 55905, USA 3 Division of Infectious Diseases, Department of Medicine, Mayo Clinic, Rochester, MN 55905, USA Correspondence should be addressed to Robin Patel; [email protected] Received 5 November 2012; Accepted 30 January 2013 Academic Editor: Sam R. Telford Copyright © 2013 Scott A. Cunningham et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Objective. We compared laboratory developed real-time PCR assays for detection of Mycoplasma hominis and for detection and differentiation of Ureaplasma urealyticum and parvum to culture using genitourinary specimens submitted for M. hominis and Ureaplasma culture. Methods. 283 genitourinary specimens received in the clinical bacteriology laboratory for M. hominis and Ureaplasma species culture were evaluated. Nucleic acids were extracted using the Total Nucleic Acid Kit on the MagNA Pure 2.0. 5 L of the extracts were combined with 15 L of each of the two master mixes. Assays were performed on the LightCycler 480 II system. Culture was performed using routine methods. Results. M. hominis PCR detected 38/42 M. hominis culture-positive specimens, as well as 2 that were culture negative (sensitivity, 90.5%; specificity, 99.2%). Ureaplasma PCR detected 139/144 Urea- plasma culture-positive specimens, as well as 9 that were culture negative (sensitivity, 96.5%; specificity, 93.6%). Of the specimens that tested positive for Ureaplasma species, U. urealyticum alone was detected in 33, U. parvum alone in 109, and both in 6. Con- clusion. The described PCR assays are rapid alternatives to culture for detection of M. hominis and Ureaplasma species, and, unlike culture, the Ureaplasma assay easily distinguishes U. urealyticum from parvum. 1. Introduction microscopic colonies and takes two to five days. U. ure- alyticum was the only Ureaplasma species until 2002, when Mycoplasma hominis, Ureaplasma urealyticum,andUrea- U. parvum was described [4]. The two are not distinguished plasma parvum aresmall,fastidiousbacteriabelongingto based on culture characteristics alone. Real-time PCR detec- the Mollicutes class. They lack a cell wall (preventing stain- tion of these microorganisms from clinical samples circum- ing with Gram stain) and are not sensitively detected on vents technical issues related to culture and shortens turn- routine bacterial cultures. Optimal recovery requires spe- around time for detection and identification. cialized media and growth conditions. There are several human pathogens in the genera Mycoplasma and Ureaplasma Few real-time PCR assays and associated studies have which are responsible for a variety of clinical manifestations been described for M. hominis. Areal-timePCRassaytar- involving multiple body systems [1]. M. hominis causes geting M. hominis gap identified two positive cervical swabs septic arthritis and postpartum fever and has been associated fromwomenbeingevaluatedforinfertility[5]. 153 urogenital with pelvic inflammatory disease and bacterial vaginosis specimens were tested with a real-time PCR assay targeting [2]. Ureaplasma species can cause acute urethritis and have M. hominis yidC, of which 45 were PCR- and culture positive been associated with bacterial vaginosis, preterm birth, and and 10 PCR positive only [6]. Finally, extragenital M. hominis neonatal respiratory disease [1, 3]. infection was diagnosed in three patients using a real-time Although M. hominis and Ureaplasma species can be PCR assay targeting the M. hominis 16S ribosomal RNA gene cultured, this requires technical skill for interpretation of [7]. 2 International Journal of Bacteriology Table 1: Primers and probes. Mycoplasma hominis tuf (set number 793, TIB MolBio, Aldelphia, NJ; 10X concentration)a tuf 193F 5 AATTGATATGTTTAAAGATGATGAAAGAGA 3 Primers tuf 193R 5 TGTATCAACAGCATCCATTAATTCC 3 tuf 193flb 5 GACGTAAGAAGCCTTCTATCAGAATATGGT FITC 3 Probes tuf 193iLC610c 5 Red610 TGATGGTGACAATGCTCCTATTATTGCTGGTTC PO4 3 Ureaplasma species ureC (set number 684, TIB MolBio; 10X concentration)d ureC158F 5 CCTGCTTCGTTTAATGTATCTG 3 Primers ureC158R 5 GAAGATCCAATCTTTGAACAAATCGTA 3 ureC158R5 5 GAAGATCCAATCTTTGAACAAATTGCT 3 ureC158flb 5 AGCAACTGTTAATGCTAAGTCAATAGCGTTTCCTG FITC 3 Probes ureC158iLC610c 5 Red610 GCCCCTCAGTCTTCGTGAATCTTAAGACCACAAGC PO4 3 atuf target corresponds to 66720–66912 of GenBank accession number FP236530. bLabeled with fluorescein on 3 end. cLabeled with LC610 on 5 end and a phosphate on 3 end. dureC target corresponds to 527786–527943 of GenBank accession number CP001184. There has been more work on real-time PCR assays for five days. A color change (indicating an alkaline pH shift) in Ureaplasma species, although some have described assays the U9 broth prompted subculture of 100 LtoanA7agar ∘ buthavenotevaluatedclinicalspecimensorclinicalisolates plate. Plates were incubated anaerobically at 35 Cforupto [8]. A real-time PCR assay that detects and distinguishes U. 48hoursandexaminedwithaninvertedlightmicroscopefor urealyticum from parvum was described but used to assess small, circular to irregular colonies growing into the surface 87 vaginal swabs [9]. Tang et al. used a real-time PCR assay of the agar, with a surrounding red zone. Confirmation of that detects and distinguishes U. parvum and urealyticum to Ureaplasma species was indicated by golden-brown stained test 346 genitourinary swabs; 120 were positive for the former colonies with the addition of 0.167 M CO(NH2)2 and 0.04 M and21forthelatter,including5positiveforboth[10]. Finally, MnCl2 in water. Vancutsem et al. used a real-time PCR assay for detection and differentiation of U. urealyticum and parvum to evaluate 2.4. Sample Processing for PCR. Sampleswerevortexedand 300 lower genital tract specimens; 132 were culture positive, of which all plus an additional 19 were PCR-positive (19, U. 200 L transferred to a MagNA Pure sample cartridge (Roche urealyticum; 120, U. parvum; 12, Ureaplasma species) [11]. Applied Science, Indianapolis, IN). DNA extraction was Herein, we present one real-time PCR assay for the performed on the MagNA Pure LC 2.0 using the MagNA Pure LC Total Nucleic Acid Isolation Kit (Roche Applied Science) detection of M. hominis and another for the detection and differentiation of Ureaplasma species and report results of with a final elution volume of 100 L. these assays on 283 genitourinary specimens in comparison to culture. 2.5. Polymerase Chain Reaction Assay. Primers and probes (Table 1) were designed using the LightCycler Probe Design 2. Materials and Methods Software, version 2.0 (Roche Diagnostics, Indianapolis, IN, USA) and DNA Workbench, version 5.7.1 (CLC Bio, Cam- 2.1. Clinical Specimens. 283 genitourinary specimens (swabs, bridge, MA, USA). Positive control plasmids were con- urine) submitted to the Mayo Clinic Clinical Microbiology structed for the three target-specific genes (Table 1)using Laboratory in transport medium (e.g., UTM, M5) for M. the pCR 2.1 TOPO TA Cloning Kit (Invitrogen Corpora- hominis and Ureaplasma culture were evaluated. No clinical tion, Carlsbad, CA, USA). Sources for the inserted target data associated with these specimens was available. This study sequences were M. hominis ATCC 23114, U. urealyticum was approved by the Mayo Clinic Institutional Review Board. ATCC 27618, and U. parvum ATCC 27815D. Plasmids were purifiedusingtheHighPurePlasmidIsolationKit(Roche 2.2. Mycoplasma hominis Culture. Samples were placed into Applied Science). Sizes of the cloned inserts were confirmed ∘ arginine broth, incubated at 35 C, and monitored four times by EcoR1 digestion. Plasmid inserts were sequenced using daily for up to five days. Color change (indicating an alkaline M13 forward and reverse primers included in the cloning kit, to confirm proper insert orientation. Plasmids were diluted pH shift) in the arginine broth prompted subculture of 50 L ∘ to an A7 agar plate. Plates were incubated anaerobically at in Tris-EDTA buffer (pH 8.0) and stored at4 C. ∘ 35 C for up to five days and examined daily with an inverted The two assays were independently optimized onthe light microscope for “fried egg” morphology colonies. LightCycler 480 II platform employing LightCycler 480 Software version 1.5 (Roche Applied Science). 15 LofPCR 2.3. Ureaplasma Culture. SampleswereplacedintoU9broth, master mix, containing final concentrations of 1X Roche ∘ incubated at 35 C, and monitored four times daily for up to Genotyping Master (Taq DNA polymerase, PCR reaction International Journal of Bacteriology 3 buffer, deoxyribonucleoside triphosphate with dUTP substi- Melting peaks tuted for dTTP and 1 mM MgCl2), 1 mM (additional) MgCl2, 14.29 and1XofeachoftheLightCyclerprimer-probesets(Table1) were added to a 96-well LightCycler 480 plate. Extracted 11.29 nucleic acid (5 L)wasthenaddedtoeachwell.Thecycling ∘ 8.29 program was as follows: denaturation