The Role of Nuclear Factor-B in -Cell Survival and Function

David Liuwantara

A submission to the University of New South Wales in candidature for the degree of Doctor of Philosophy

Gene Therapy and Autoimmunity Research Program Department of Inflammation and Immunology Garvan Institute of Medical Research Darlinghurst, Sydney, Australia November 2007

Statement of Originality

‘I hereby declare that this submission is my own work and to the best of my knowledge it contains no materials previously published or written by another person, or substantial proportions of material which have been accepted for the award of any other degree or diploma at UNSW or any other educational institution, except where due acknowledgement is made in the thesis. Any contribution made to the research by others, with whom I have worked at UNSW or elsewhere, is explicitly acknowledged in the thesis. I also declare that the intellectual content of this thesis is the product of my own work, except to the extent that assistance from others in the project’s design and conception or in style, presentation and linguistic expression is acknowleged.’

Signed ……………………………………………………………

In Christ alone will I glory Though I could pride myself in battles won For I've been blessed beyond measure And by His strength alone I overcome Oh I could stop and count successes Like diamonds in my hands But those trophies could not equal To the grace by which I stand

In Christ alone will I glory For only by His grace I am redeemed And only His tender mercy Could reach beyond my weakness to my need And now I seek no greater honor Than just to know Him more And to count my gains But losses to the glory of my Lord

In Christ alone I place my trust And find my glory in the power of the cross In every victory let it be said of me My source of strength, my source of hope is Christ alone

In Christ Alone by: Don Koch and Shawn Craig Paragon Music Corp © 1990 BMG Music Pty. Ltd.

The fear of the LORD is the beginning of knowledge; fools despise wisdom and instruction. Proverbs 1: 7 (ESV)

For the word of the cross is folly to those who are perishing, but to us who are being saved it is the power of God. For it is written,

"I will destroy the wisdom of the wise, and the discernment of the discerning I will thwart."

Where is the one who is wise? Where is the scribe? Where is the debater of this age? Has not God made foolish the wisdom of the world? For since, in the wisdom of God, the world did not know God through wisdom, it pleased God through the folly of what we preach to save those who believe. For Jews demand signs and Greeks seek wisdom, but we preach Christ crucified, a stumbling block to Jews and folly to Gentiles, but to those who are called, both Jews and Greeks, Christ the power of God and the wisdom of God. For the foolishness of God is wiser than men, and the weakness of God is stronger than men. 1 Corinthian 1:18-25 (ESV)

i

Acknowledgement

The past four years have been the toughest in my life, but an incredible experience I would not have missed for the world. Along the way I’ve met and worked with some of the most incredible people, and unfortunately I cant mention all of you here (otherwise printing cost would be expensive for twice the volume of this thesis). Firstly, I would like to thank my primary supervisor Dr. Shane Grey, who has been to me a great mentor and friend. Your continued effort and encouragement has been the driving force in the completion of this project. I admire your knowledge in the field and passion for science. I am privileged to have the opportunity to work with you in the duration of this thesis. Over the past four years, you have taught me a great deal of knowledge and skills, from islet biology, diabetes immunology, western blotting, islet isolation, islet transplantation, beer drinking and hunting for good steak. I’ve enjoyed the time working with you and I look forward to future engagements that we may have. I would also like to thank a number of secondary supervisors that I’ve had over the past four years. To Prof. Charles Mackay, thank you for allowing me to join the department, and helping my transfer from the Bone Department. To Dr. Cecile King, thank you for your guidance and encouragement in my second PhD year. To Dr. Jenny Gunton, thank you for all the help and skills you have taught me over the past two years, I look forward also to any future collaboration that we may have. A special thanks to Stacey Walters, our honorary Lab Manager, for your patience and generosity in bestowing upon me your skills in islet isolation and transplantation. You have been a great friend and tutor. I know I promise to employ you someday but I doubt I could ever match the last offer you got. I think it is unfair to give Shane all the glory for my increased tolerance to alcohol, I don’t think I would ever had the skill to have a second round if not for your persistent encouragement. I hope that you continue to run into successful projects and I look forward to working with you again someday. Eliana Marino (The Princess), many thanks for your help, advice and most importantly friendship, throughout the course of this thesis. Andrew Yam, many thanks for your help with the bioinformatics, and a whole lot of primers. Thank you also for Civ III, Ricochet and especially the AirPort Extreme (you’re the first person who gave me a wireless experience). Thankyou also for inventing “Fatty Friday”, though it’s not the same without you. Fred and David Zhara, thank you for your help and friendship over the past years. To Bennett, Marry, Zoe, Tim, Trina and Sue Liu, thank you for welcoming me to ‘Chinatown’, Fatty Friday would not happen without your participation, but most importantly for all the help, advise and encouragements. To Bennet and Sue especially for welcoming me into their home in Boston. To Sue-Mei, Rebecca, Ken, Kim, Chris and Sue-Lyn, many thanks for your help and friendship over the past years, you guys have made lab 3 a livelier place to work. To Carrie, Hyun, Julie, Joanna, Heidi and Kendal, many thanks for your help and advise as well as friendship over the past years. To Carrie especially, thank you for welcoming me into your home in London; I had a great time there.

i

I would like to also thank Louis Tsai, Lewis Cox, Jess, Cindy, Helen, Santi, Gerard, Peta, Anita, Alex and all the friends on level 10. Thank you all for your encouragement and friendship, you have made level 10 an enjoyable place to work. To all the staff and students of Inflammation and Immunology department, many thanks for the great conversations we’ve had scientific or social… more social. I would like to also thank the BTF staff for your help in maintaining the animal facilities. To the IT staff past and present, especially George, Ryan and John, thank you all for your help. To all the friends from class 2000 UNSW, Mel, Shaz, Will, Leon, Danny, Sam, Iris, Quynh, thanks for the fun time we had over the past years. To the brothers and sisters in Christ at IPC: to Rev. Joni Stephen and Rev. Joe Mock, Hatta, Mariana, Darwin and Deb, thank you for your constant prayers and support; to James, Natalie, Kenneth, Jasmine, Victor, Adi, Hanvy, Muriani, Deviani, Ryan and Monnie, thank you for your prayers; and all the members of Pemuda thank you for your prayers and encouragements. To my fiancée Inggrid, thank you for your patience with me throughout the course of this thesis. Thank you for your encouragements and unconditional love over the past years. To my extended families in Sydney and beyond, thank you for your help throughout the different stages of my life, which altogether made it possible for me to complete this thesis. To mum and dad, thank you for sacrificing so much to get me here. A great lesson I learnt from you both over the past years is the unending love of a parent should give to their children. You have reflected to me the love Christ has taught us all to give. Thank you mum and dad, for everything.

ii

Abstract

In Type 1 diabetes, -cells is subjected to an autoimmune-mediated apoptotic and inflammatory attack. Whilst lymphocytes are the primary contributor of -cell death, exposure of -cells to stress signals such as cytokines, transform these cells into an inflammatory state activating transcripts for toxic agents. Demonstrating a significant role for -cells in participating in their own destruction through the elaboration of toxins and chemotactic molecules that could contribute to increased cellular infiltration. The Nuclear Factor-B (NF-B) is a transcription factor that provides for early immediate stress responses governing inflammation and cell survival. In islets, NF-B is thought to have an important role in -cell inflammation and apoptosis. Few studies however, have explored the role of NF-B in -cell protection. Indeed, we found that the expression NF-B is responsible for the islet-intrinsic immediate-early pro-inflammatory gene expression. Importantly however, we also found that in islets, NF-B is responsible for the expression and regulation of anti-apoptotic genes. We demonstrated for the first time that similar to other cells, the expression and regulation of the anti-inflammatory/ anti-apoptotic gene A20, in islets, is regulated by NF-B. Consequently, we found a somewhat paradoxical role for NF-B, where on the one hand it is responsible for -cell death, whilst on the other hand it is also responsible for -cell survival. In vivo however, we found that islet survival and function was severely impaired in the absence of NF-B activity. We observed that blockade of NF-B abrogate cytokine-induced A20 expression, and inhibited the activation of glucose-stimulated insulin secretion in vitro. In contrast, blockade of NF-B by over-expression of A20 resulted in an improved islet allograft survival with good metabolic control. Thus demonstrating the importance of NF-B-dependent anti-apoptotic genes for islet survival and function. The findings presented in this thesis demonstrate a fundamental bimodal role for NF-B in maintaining the balance of survival of -cells in the context of T1D. These data, uncovers a sophisticated molecular mechanism in the regulation of -cell death, survival, and metabolic function. Thus providing a better understanding of the role of NF-B in -cells in the context of T1D.

iii

Publications and Presentations Arising From This Thesis

Manuscripts

David Liuwantara, Mark Elliot, Mariya W Smith, Andrew O Yam, Stacey N Walters, Eliana Marino, Andy McShea, Shane T Grey, NF-B Regulates -cell death: a critical role for A20 in -cell protection, Diabetes, 2006, Sep;55(9): 2491-501.

Presentations

Evidence for a new role for NF-kappaB in islets: Maintenance of -cell function, Annual meeting of the Australian Diabetes Society, Christ Church, New Zealand 2007.

NF-B Regulates -cell death: a critical role for A20 in -cell protection, Annual meeting of the Australian Diabetes Society, Gold Coast, Qld, Australia 2006.

Identification of the BIRC Family Protein cIAP-2, As a Critical, Early-Immediate Response Gene in Pancreatic -cells, Annual meeting of the Australian Diabetes Society, Gold Coast, Qld, Australia 2006.

Signalling Pathways that Determine the Fate of Islets, The 16th St. Vincent & Mater Health Sydney, Research Symposium, Sydney, NSW, Australia 2006.

Signalling Pathways that Determine Islet’s Fate, Annual meeting of the Transplantation Society of Australia and New Zealand, Canberra, Australia 2006.

The Islet Anti-Apoptotic Response is Marked by the Expression of the NF-B Dependent Gene TNFAIP3/A20, Annual meeting of the Australian Diabetes Society, Perth, WA, Australia 2005.

The Role of A20 in Type 1 Diabetes, NSW Branch meeting of the Australian Society of Immunology, Wisemans Ferry, NSW, Australia 2004.

iv

Posters

NF-B blockade sensitises islet allograft to failure, 67th Scientific Sessions of the American Diabetes Association, Chicago, IL, USA 2007.

NF-B Regulates -cell death: a critical role for early immediate response genes in - cell protection, 67th Scientific Sessions of the American Diabetes Association, Chicago, IL, USA 2007.

Blockade of NF-B sensitise islet allograft to failure, Annual meeting of the Transplantation Society of Australia and New Zealand, Canberra, Australia 2007.

Signalling Pathways that Determine the Fate of Islets, Annual meeting of the Australian Diabetes Society, Gold Coast, 2006.

Islets Participate in their Own Destruction by Expressing Pro-inflammatory and Pro- apoptotic Genes in the Early Stages of an Inflammatory Insult, Balanced Only by the Expression of a Limited Set of Anti-apoptotic genes, 35th Annual Scientific Meeting of the Australasian Society for Immunology and 14th International HLA & Immunogenetics Workshop, Melbourne, 2005; Tissue Antigens, 66, 5, 343-622.

Marked Up-Regulation of NF-B Dependent Pro-Inflammatory and Pro-Apoptotic Genes in Stressed Islets, Boden Research Conference, Sydney, 2005.

The Islet Inflammatory Resonse is By the Up-Regulation of NF-B Dependent Anti- Apoptotic and Inflammatory Genes, The 15th St. Vincent & Matter Health Research Symposium, Sydney, 2005.

v

Table of Contents

Acknowledgement ...... i

Abstract ...... iii

Publications and Presentations Arising From This Thesis...... iv

Table of Contents ...... vi

List of Figures...... xii

List of Tables...... xv

List of Abbreviations...... xvi

Chapter 1 Introduction ...... 1

1.1 OVERVIEW...... 1

1.2 DISEASE COMPLICATIONS...... 3

1.3 IMMUNOBIOLOGY OF T1D ...... 7

1.3.1 The immune system ...... 7

1.3.2 Immune tolerance ...... 11

1.3.3 The disease ...... 12

1.3.4 T1D in human...... 13

1.3.5 Mouse models of T1D...... 14

1.3.5.1 The NOD mouse ...... 14

1.3.5.2 The BB rat ...... 18

1.3.6 Animal model as proof of principal...... 19

1.3.7 The Mechanism of disease ...... 20

1.3.7.1 Genetic factors of T1D...... 20

Genetic susceptibility loci: IDDM1: HLA...... 20

IDDM2: insulin gene ...... 23

IDDM3 to IDDM18 ...... 24

vi

1.3.7.2 Immunological factors of T1D: Who are the major players...... 26

T-cells ...... 26

B-cells ...... 27

Macrophages ...... 28

Dendritic Cells...... 29

1.3.7.3 Initiation of disease ...... 31

1.4 -CELL DEATH...... 33

1.4.1 Necrosis...... 33

1.4.2 Apoptosis...... 34

1.4.3 Fas signalling pathway...... 37

1.4.4 TNF and Apo3 signalling pathway...... 37

1.4.5 TRAIL/ Apo2 signalling pathway ...... 38

1.4.6 Mitochondrial signalling pathway ...... 40

1.4.7 Regulation of apoptosis...... 40

1.4.7.1 Regulation of cell surface activation of death pathway ...... 40

1.4.7.2 Regulation of mitochondrial death signalling pathway...... 41

1.5 NF-B AND INFLAMMATION...... 43

1.6 A20 AND CELLULAR SURVIVAL...... 51

1.7 EXPERIMENTAL OBJECTIVES...... 54

Chapter 2 Materials and Methods...... 55

2.1 BUFFERS AND SOLUTIONS...... 55

2.2 TISSUE CULTURE ...... 56

2.3 MAMMALIAN TRANSIENT TRANSFECTION...... 56

2.3.1 Plasmid Storage and amplification ...... 57

2.4 MICE ...... 57

vii

2.5 PRIMARY ISLETS...... 58

2.5.1 Human primary islets...... 58

2.5.2 Mouse primary islets...... 58

2.5.3 Islet transplantation...... 60

2.5.4 Glucose Stimulated Insulin Secretion...... 60

2.5.5 Glucose Tolerance Test...... 61

2.6 MOLECULAR TECHNIQUES...... 61

2.6.1 RNA isolation...... 61

2.6.2 mRNA reverse-transcription ...... 62

2.6.3 Microarray...... 62

2.6.4 Real-time quantitative PCR...... 64

2.6.5 Western Blotting...... 64

2.6.5.1 Commonly used buffers ...... 64

2.6.5.2 Protein isolation and storage...... 65

2.6.5.3 Protein quantitation...... 65

2.6.5.4 Western blotting...... 65

2.6.6 Immuno-precipitation...... 66

2.7 HISTOLOGY...... 67

2.7.1 Tissue preparation for Histology ...... 67

2.7.2 Hematoxilin-eosin staining...... 67

2.7.3 Immunohistochemistry...... 67

2.8 STATISTICS...... 69

Chapter 3 The Immediate-Early Gene Profile of Primary Mouse Islet...... 70

3.1 INTRODUCTION...... 70

3.2 RESULTS ...... 74

viii

3.2.1 Combimatrix™ Custom Array: The death-CHIP...... 74

3.2.2 Array Quality Control ...... 75

3.2.3 Islets immediate early gene response...... 77

3.2.4 Differential transcript induction between BALB/c and NOD islets...... 81

3.2.5 Differential transcript induction by IL-1 and TNF-...... 82

3.2.6 Microarray data validation by RTqPCR...... 85

3.2.7 A critical role for NF-B in the immediate early pro-inflammatory

response...... 86

3.2.8 The immediate-early gene response includes transcripts for anti-apoptotic

genes...... 88

3.2.9 Islets exhibit a specific immediate-early anti-apoptotic gene response...92

3.3 DISCUSSION ...... 94

Chapter 4 The Expression and Regulation of A20...... 99

4.1 INTRODUCTION...... 99

4.2 RESULTS ...... 102

4.2.1 -cells have an inducible anti-apoptotic response...... 102

4.2.2 Regulation of A20 in rodent islets...... 103

4.2.3 Regulation of A20 in human islets...... 104

4.2.4 A20 protein is highly regulated in -cells...... 106

4.2.5 -cell specific expression of A20 in islets...... 107

4.2.6 Cytokine-dependent regulation of A20 requires de novo gene

transcription...... 109

4.2.7 NF-B is both necessary and sufficient to initiate transcriptional

activation of the A20 promoter...... 111

ix

4.2.8 A20 transcription is regulated by multiple NF-B signalling pathways.

...... 112

4.2.9 Expression of A20 in stressed islets in vivo...... 115

4.2.10 A20 is sufficient to protect -cells from TNF--induced cell death.....116

4.3 DISCUSSION ...... 118

Chapter 5 NF-B in Islet Survival and Function ...... 122

5.1 INTRODUCTION...... 122

5.2 RESULTS ...... 125

5.2.1 Islet transplant model...... 125

5.2.2 Transduction by recombinant adenovirus...... 129

5.2.3 Inhibition of NF-B-dependent genes by IB over-expression...... 131

5.2.4 Blockade of NF-B by over-expression of IB does not prolong islet

allograft survival...... 134

5.2.5 Blockade of NF-B by PDTC pre-treatment does not prolong islet

allograft survival...... 136

5.2.6 A20 is a major NF-B target gene important in protecting islets from

inflammatory insult...... 138

5.2.7 Blockade of NF-B impairs islet isograft function...... 144

5.2.8 A role for NF-B the metabolic function of islets? ...... 147

5.3 DISCUSSION ...... 151

Chapter 6 General Discussion...... 155

6.1 NF-B AND THE ISLET’S IMMEDIATE-EARLY PRO-

INFLAMMATORY RESPONSES...... 157

6.2 NF-B AND THE ISLET’S IMMEDIATE-EARLY ANTI-APOPTOTIC

RESPONSES ...... 159

x

6.3 RECONCILING THE TWO FACTIONS: NF-B IN ISLET FUNCTION.....

...... 161

6.4 FUTURE DIRECTIONS ...... 165

6.5 CONCLUDING REMARKS ...... 167

References...... 168

APPENDIX 1...... 204

APPENDIX 2...... 235

First Author Publication Arising From this Thesis ...... 240

xi

List of Figures

Figure 1.1. Co-stimulatory Molecules...... 10

Figure 1.2. Photomicrograph of pancreatic biopsy specimens...... 16

Figure 1.3. GAD expression in pancreatic islet...... 16

Figure 1.4. Diagramatic representation of the TH-INS-IGF2 region on the human

chromosome 11p15 showing polymorphisms within the 4.1 kb region that

contains IDDM2...... 24

Figure 1.5. Pathways of -cell death...... 30

Figure 1.6. The apoptotic death pathway...... 36

Figure 1.7. Receptor mediated death pathway...... 39

Figure 1.8. The NF-B and IB protein family...... 46

Figure 1.9. The NF-B pathway relevant for -cells...... 50

Figure 3.1.Quality Control analysis of the “death-CHIP”...... 76

Figure 3.2. 1D Cluster analysis of global gene array...... 79

Figure 3.3. 1D Cluster analysis of the top 44 genes...... 80

Figure 3.4. Scatter plot analysis of average gene induction of the top 44 up-regulated

genes from all experiments...... 83

Figure 3.5. Average gene induction of the 44 up-regulated genes from all

experiments...... 84

Figure 3.6. RTqPCR confirmation of death-CHIP...... 85

Figure 3.7. Islet’s early-immediate pro-inflammatory gene response is NF-B

dependent...... 87

Figure 3.8. 1D Cluster analysis of anti-apoptotic genes...... 90

Figure 3.9. Islets have a limited set of anti-apoptotic genes...... 91

Figure 3.10. RTqPCR confirmation of anti-apoptotic gene induction...... 93

xii

Figure 4.1. -cells have an inducible anti-apoptotic response...... 103

Figure 4.2. A20 is an immediate early response gene in -cells...... 105

Figure 4.3. A20 protein expressed in primary mouse islets in vitro...... 106

Figure 4.4. A20 is expressed in insulin-producing -cells...... 108

Figure 4.5. A20 is regulated at the level of transcription by NF-B...... 110

Figure 4.6. NF-B is necessary and sufficient to drive de novo A20 expression...... 112

Figure 4.7 A20 expression is NF-B dependent in -cells...... 114

Figure 4.8. A20 is up-regulated in islets in vivo...... 115

Figure 4.9. A20 rescues -cells from FADD-induced cell death...... 117

Figure 5.1. Islet transplantation model...... 126

Figure 5.2. Blood glucose analysis of allogeneic transplant model...... 127

Figure 5.3. Histological analysis of islet graft at 2 or 5 days after transplantation. ..128

Figure 5.4. GFP expression in primary islets...... 130

Figure 5.5. IB over-expression in primary islets...... 132

Figure 5.6. Islets expressing the IB-super-repressor significantly inhibit IL-1

induced NF-B-dependent pro-inflammatory gene expression...... 133

Figure 5.7. Blockade of NF-B using IB-super-repressor sensitises islet allograft to

failure...... 135

Figure 5.8. Blockade of NF-B using PDTC sensitises islet allograft to failure...... 137

Figure 5.9. Blockade of NF-B using IB-super-repressor inhibit A20 expression.

...... 139

Figure 5.10. A20 can prolong islet allograft survival without sensitising to failure. 142

Figure 5.11. Hemotoxylin and Eosin Staining of islet allograft infected with rAd-A20

at POD 100...... 143

Figure 5.12. Functional analysis of PDTC treated islets in vivo...... 146

xiii

Figure 5.13. Functional analysis of PDTC-treated islets in vitro...... 148

Figure 5.14. A20 interaction with HIF-1 in -cell ...... 150

Figure 6.1. NF-B controls the survival balance in -cells...... 162

Figure 6.2. The three-way balance of NF-B...... 167

xiv

List of Tables

Table 1.1 Differences between NOD and human diabetes...... 17

Table 1.2. Non-MHC gene loci in human T1D...... 25

Table 1.3. Death Receptors and Ligands...... 35

Table 2.1. Buffers and Solutions...... 55

Table 2.2. Media for tissue culture...... 56

Table 2.3. List of Primers...... 63

Table 2.4. Buffers for Western Blot...... 64

Table 2.5. Antibodies for immunohistochemistry and Western Blotting...... 69

Table 3.1 Cytokine treatment...... 74

xv

List of Abbreviations

A AcD Actinomycin D Arg Arginine Asp Aspartic Acid ATP Adenine Tri-phosphate ADP Adenine Di-phosphate ARNT Aryl-hydrocarbon nuclear translocator

B BB Bio Breeder BCS Bovine Calf Serum BSA Bovine Serum Albumin BIRC Baculoviral-IAP-repeat containing protein

C CARD Caspase Recuritment Domain CD Cluster of Differentiation CTL Cyto-toxic T cells CTRL Control/ non-treated control/ non-infected control CVD Cardio Vascular Disease Chemokines Chemo-attractant cytokines cytC Cytochrome C cRNA Complementary RNA

D DC Dendritic cells DCCT Diabetes Control and Complication Trial DD Death Domain DED Death Effector Domain DEPCT diethylpyrocaronate treated DMEM Dubecco’s Minimum Eagle Media DNA Deoxyribonucleic Acid DISC Death Inducing Signalling Complex

E ELISA Enzyme linked immuno-sorbent assay

F FADD Fas Associated Death Domain FLICE FADD-like ICE

xvi

G g gravity GAD Glutamic acid decarboxylase GSIS Glucose Stimulated Insulin Secretion G6PI Glucose-6-Phosphoisomerase GK Gluco-kinase Glut-2 Glucose transporter-2 GFP Green Fluorescence Protein

H h hour HLA Human Leukocyte Antigen HEPES 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid

I IA-2 Islet cell Antigen-2 IAP Inhibitor of Apoptosis IAG Immediate-Early Gene ICA Islet cell Antigen ICE Interleukin-1 Converting Enzyme IEG Immediate Early Gene IHC Immuno-Histo-Chemistry IL Interleukin IFN Interferon iNOS inducible Nitric Oxide Synthase INS insulin gene IGF2 insulin-like growth factor II IR Insulin Receptor gene IB Inhibitor of B

L LB Luria-Bertani Medium LOD Logarithm of the odd

M μ micro m milli min minute M Molar MgCl2 magnesium chloride MEKK MEK kinase mRNA messenger RNA MHC Major Histocomplatibility Complex MOI Multiplicity of Infection

xvii

N NOD Non Obese Diabetic NO Nitric Oxide NF-B Nuclear Factor -B NIK NF-B inducible kinase

O OMM Outer Mitochondrial Membrane

P PAMP pathogen- associated molecular patterns PP pancreatic polypeptide cells. PDTC pyrrolidine dithiocarbamate POD Post-Operative Days PRR Pattern-recognition Receptors PGM Phospho-gluco-mutase

R rAd recombinant Adenovirus RIP Receptor Interacting Protein RNA Ribonucleic Acid

S sec seconds STZ Streptozotocin

T T1D Type 1 diabetes T2D Type 2 diabetes TNF- Tumour Necrosis Factor - TNF-R Tumour Necrosis Factor Receptor TRADD TNFR-associated death domain TRAF TNFR-associated factor TH Thyrosine hydroxylase gene Tm Melting Temperature

V VNTR variable number tandem repeats VDAC voltage dependent anion channel

xviii

Chapter 1 Introduction

1.1 OVERVIEW

Diabetes is a metabolic disorder of multiple aetiologies characterised by chronic hyperglycaemia with disturbances of carbohydrate, fat and protein metabolism resulting from defects in insulin secretion, insulin action, or both (WHO 1999). Diabetes is classified into major categories: type 1 diabetes (T1D) and type 2 diabetes (T2D). T1D is associated with an immune mediated destruction of the insulin producing -cells whereas T2D is a result of metabolic disorder associated with insulin resistance. The worldwide prevalence of diabetes in the year 2000 was approximately 171 million people and is projected to increase to approximately 366 million people by 2030

(Rathmann and Giani 2004; Wild, Roglic et al. 2004). Approximately 16 million people have T1D. An estimated of 140 thousand patients with T1D live in Australia (JDRF

2007).

In T1D, destruction of -cells within the islets of Langerhans involves a cohort of immune cells including T-cells, B-cells, macrophages and dendritic cells (DC)

(Benoist and Mathis 1997). Of these, T-cells have a central role in -cell destruction through activation of the apoptosis pathways (Roep 2003). T-cells mediate -cell apoptosis through a number of different mechanisms including: Fas/Fas-Ligand,

Perforin/ Granzyme and cytokine mediated apoptosis (Benoist and Mathis 1997;

Mathis, Vence et al. 2001). Induction of apoptosis through these signals, in turn activates complex intracellular apoptosis pathways, such as caspase activation and release of mitochodrial cytochrome C (cytC), which eventually results in -cell death

(Mathis, Vence et al. 2001).

1 Introduction

It is also recognised that -cells are not passive bystanders in the process of autoimmune destruction. Exposure of -cells to stress signals such as cytokines, transform these cells into an inflammatory state activating transcripts for toxic agents including inducible nitric oxide synthase (iNOS) (Corbett, Kwon et al. 1993; Cetkovic-

Cvrlje and Eizirik 1994; Corbett, Kwon et al. 1996; McDaniel, Kwon et al. 1996) and expression of inflammatory agents including cytokines and chemokines (Cardozo,

Kruhoffer et al. 2001; Luster 2002; Morimoto, Yoneyama et al. 2004; Reddy, Bai et al.

2006). iNOS expression impairs -cell function and induced mitochondrial dependent apoptosis (Corbett, Sweetland et al. 1993a; McDaniel, Kwon et al. 1996). Cytokine and chemokine expressions exacerbate immune infiltration (Frigerio, Junt et al. 2002;

Bouma, Coppens et al. 2005). These studies demonstrated a significant role for -cells in participating in their own destruction through elaboration of toxins and chemotactic molecules that could contribute to increased cellular infiltration.

Recent studies demonstrate that in response to death signals, a cell could mount protective and balancing pro-survival signals (Beg and Baltimore 1996; Van Antwerp,

Martin et al. 1996; Wang, Mayo et al. 1996; Bach, Hancock et al. 1997). This scenario is best observed in cancer cells such as B-cell lymphomas where evasion of immune mediated apoptosis was achieved through expression of the anti-apoptotic gene BcL-2

(Vaux, Cory et al. 1988; Nunez, Seto et al. 1989). Consequently it is the balance of the two opposing forces imposed on the cell i.e. death signals versus protective genes that will determine the fate of the cell (Bach, Hancock et al. 1997). At present, little is known about the role of anti apoptotic genes in islets. Understanding the molecular anti- apoptotic response of islets would be beneficial to obtain a greater knowledge of the disease as well as for the identification of potential therapeutic targets.

- 2 - Introduction

The Nuclear Factor-B (NF-B) is an inducible early immediate transcription factor responsible for the expression of numerous genes involved in cellular and physiological development, apoptosis, inflammatory as well as immune responses

(Verma, Stevenson et al. 1995). In islets, NF-B is thought to have an important role in

-cell inflammation and apoptosis (Cardozo, Heimberg et al. 2001; Heimberg,

Heremans et al. 2001). Nonetheless, others have demonstrated that NF-B is also responsible for expression of -cell protective genes (Chang, Kim et al. 2003). Thus, activation of NF-B from one pathway may result in -cell inflammation and death, whereas activation from a different pathway may result in the expression of protective genes and promotion of -cell survival. These seemingly conflicting data on the role of

NF-B in islets may be due to the diversity of NF-B activators and subsequent target genes.

This thesis investigates the different facets of NF-B functions and their effects on -cell survival and function. Due to the diverse effect of NF-B activation a variety and even opposing cellular outcomes are possible. We hypothesise that NF-B may hold the key to understanding the balance of survival of -cells in context of T1D. In addition, a greater understanding of NF-B in islet survival and function will also provide vital information in the development of therapeutic candidates for cure or treatment of T1D.

1.2 DISEASE COMPLICATIONS

Patients with T1D experience an immune mediated attack on the -cells within the islets of Langerhans. -cells function as the body’s insulin factory, and are necessary to maintain glucose homeostasis. When greater than 90% of -cells are

- 3 - Introduction destroyed (i.e. less than 10% of -cell mass remains), overt hyperglycaemia begins to manifest and eventually results in the loss of glycaemic control (Eisenbarth 1986). At this stage the patient will begin to present with clinical symptoms including polyuria, polydipsia and weight loss. Lack of insulin can even lead to ketoacidosis accompanied with nausea, vomiting and dehydration, all of which if untreated will lead to coma and death (Eisenbarth 1986).

In the early stages of T1D, there is often a period of temporary improved metabolic control and in some cases even insulin independence, known as the

“honeymoon period”. Insulin therapy can help to preserve -cell function in the long term, a phenomenon first described in 1989 in a clinical trial, which demonstrated that suppression of endogenous insulin by intensive insulin therapy improved -cell function in the subsequent year (Shah, Malone et al. 1989). Allowing -cells to rest can preserve residual -cell function for several months, as demonstrated in another clinical trial administering diazoxide to inhibit insulin secretion (Ortqvist, Bjork et al. 2004).

The long-term management of T1D is achieved through continuous administration of exogenous insulin to maintain good quality of metabolic control.

However, this treatment is unable to replicate the excellent metabolic control provided by the endogenous -cells. Thus daily management of T1D with insulin can still result in disease complications as a consequence of poor glucose homeostasis. Poor control of blood glucose homeostasis can cause changes in the microvasculature, which is the primary cause of some diabetic complications. These changes include: increased growth or apoptosis of vascular cells (Murata, Ohta et al. 2002; Romeo, Liu et al. 2002;

Pomero, Allione et al. 2003), thickening of the basement membrane (Bergstrand and

Bucht 1959) and finally loss of endothelial function (Tesfamariam and Cohen 1992;

Williams, Goldfine et al. 1998). Consequently, increasing the risk of severe

- 4 - Introduction complications including: nephropathy leading to renal failure, retinopathy often resulting in blindness and neuropathy leading to foot complications (eg: gangrene), which is a major cause of amputations.

Diabetic nephropathy usually develops after 5-15 years in patients with T1D

(Schwab, Dunn et al. 1992; Cooper 1998; Remuzzi, Benigni et al. 2006). The early stages of diabetes are often accompanied with glomerular hyperfiltration followed by loss of capillary surface area, thus reducing the filtration area (MCSG 1999). Eventually there will be sufficient alteration in the composition of the basement membrane that will result in an altered permeability, accumulation of glomerular extracellular matrix, and consequently occlusion, fibrosis and a decreased filtering capacity (MCSG 1999).

Patients with poor metabolic control are at higher risk of developing diabetic nephropathy, resulting in reduced lifespan, increased risk for cardio vascular diseases

(CVD) and developing end stage renal failure (DCCT 1993; DCCT 2000; DCCT 2003;

Remuzzi, Benigni et al. 2006).

Microvasculature changes in the retina are strongly associated with the development of diabetic retinopathy (Ferris, Davis et al. 1999; Cai and Boulton 2002).

Studies of animals and observation in human subjects, demonstrated that hyperglycaemia directly affects the microvasculature of the retina (Rand, Krolewski et al. 1985; Kern and Engerman 1996; Ferris, Davis et al. 1999; Feit-Leichman, Kinouchi et al. 2005). Structural changes include: thickening of the capillary basement membrane, increased vessel permeability, loss of retinal pericytes and formation of capillary microaneurysms (Ferris, Davis et al. 1999). Consequently these changes result in a decreased retinal blood flow, capillary occlusion, neovascularisation, haemorrhage, scar formation, and tractional retinal detachment (Cai and Boulton 2002). Increased risk of retinopathy is associated with longer duration of diabetes exposure, higher

- 5 - Introduction glycosylated hemoglobin level, and higher diastolic blood pressure (DCCT 1993;

Marshall, Garg et al. 1993; DCCT 2000).

Diabetic neuropathy (DN) is caused by a number of mechanisms including loss of blood supply to the nerve fascicules due to microvascular damage. The loss of blood supply to the fascicules results in a demyelination of the nerves and axonal degeneration

(Dyck, Karnes et al. 1986; Johnson, Doll et al. 1986; Dyck 1988). Perhaps the most severe implication of DN is the resulting loss of protective limb mechanical sensations, traumatic ulceration injuries and consequently amputations (Vinik and Mehrabyan

2004). There are also severe implications on the autonomous nervous system affecting the gastrointestinal, genitourinary and cardiovascular system (Vinik, Maser et al. 2003).

Individuals with DN have a lower quality of life, however intensive insulin treatment and a tight maintenance of blood glucose levels could delay the onset of DN (DCCT

1993; DCCT 2000).

The severity of the diabetic complications is the driving force behind the search for new treatments and curative strategies. These include, replacement strategies utilising isolated islets from cadaveric organ donors, pigs and /or stem cell derived - cells (Meier, Bhushan et al. 2006; Rood, Buhler et al. 2006; Witkowski, Zakai et al.

2006). Though this thesis does not directly explore these avenues, one anticipated outcome from our study might be the development of therapeutic candidates for treatment of T1D through islet transplantation.

- 6 - Introduction

1.3 IMMUNOBIOLOGY OF T1D

1.3.1 The immune system

As a preface for this section it is important to discuss the general development of the immune system and its function as a background to the immunobiology of T1D.

The immune system functions primarily in response to tissue injury and as a defence mechanism against pathogens. In fulfilling its function as the body’s primary defence mechanism the immune system has the capacity to release potent substances and/or activate death pathways to ensure the neutralisation of potential threats. In order to respond appropriately to pathogens without damaging the body, the immune system needs to be able to differentiate between self and non-self molecules. The two main arms in the immune system, the innate and the adaptive immune response, utilise independent mechanisms to recognise foreign entities.

The innate immune response is the first line of defence against foreign pathogens. Innate immune cells include macrophages, neutrophils, DCs, eosinophils, basophils, mast cells and natural killer (NK) cells. The innate response recognises foreign molecules through its expression of pattern-recognition receptors (PRRs), which recognise conserved molecular patterns from different microbial species called pathogen-associated molecular patterns (PAMPs) (Medzhitov and Janeway 2000).

Generally, the innate immune response destroys invading pathogens through the process of opsonisation, activation of the complement pathways, initiation of phagocytosis, release of pro-inflammatory mediators and induction of apoptosis (Akira, Takeda et al.

2001).

The adaptive immune response consists of the thymus derived T-cells and the bone marrow derived B-cells. Unlike the innate response, the adaptive immune response

- 7 - Introduction recognise pathogens through the re-arrangement of their receptor gene segments

(Tonegawa 1983; Chien, Gascoigne et al. 1984). This process of random recombination produces a highly diversified receptor repertoire; each individual lymphocyte carries only one specific receptor. The specificity of the adaptive response resulted in a more potent defensive mechanism than that of the innate immune response.

Whilst the innate immune response immediately attacks invading pathogens, the adaptive immune response requires some time to expand the one lymphocyte with receptors that specifically targets the invading pathogen. For this to occur, foreign peptides from the invading pathogen are required to be digested and processed into recognisable antigens (Ag). When a cell is infected by a foreign pathogen, components of the pathogens are processed by the cell and are displayed on the surface by the human leukocyte antigen (HLA) class I (Jardetzky, Lane et al. 1991). On the other hand the sentinel-like antigen-presenting cell (APC), such as dendritic cells (DC), engulf pathogens using phagocytosis and digest the pathogen into peptide Ag(s) and loaded onto the HLA class II (Unanue, Beller et al. 1984). It is important to note at this point that our understanding of the human HLA originates mostly from the mouse: major histocompatibility complex (MHC), thus studies referenced in this thesis to mouse models will refer to MHC complexes whereas studies performed on human subjects will refer to HLA complexes.

The HLA-bound Ag(s) are identified by a specific lymphocyte receptor, i.e. receptors on T-cells (TCR) and B-cells. When a TCR binds to an HLA-bound Ag on the

APC, a secondary co-stimulatory signal is needed to activate the T-cell (Lenschow,

Walunas et al. 1996; Chambers and Allison 1997). The cell’s co-stimulatory signal is the safety switch that allows T-cells to differentiate between self and non-self entities.

The best-characterised co-stimulatory molecules are the T-cell-bound CD28, which interacts with the APC-bound CD80 and CD86 (Wang and Chen 2004). Recent studies - 8 - Introduction demonstrate that there are numerous other co-stimulatory molecule interaction required to determine the fate of the T-cell, bearing the TCR specific HLA-bound Ag (eg: ICOS,

LFA-1, SLAM, 4-1BB, OX40) (Watts and DeBenedette 1999). In the presence of co- stimulatory molecules, T-cells will localise to the nearest draining lymph nodes to find the complementing Ag-specific B-cell. Once both Ag specific T- and B-cells have found each other, the process of clonal expansion begins, i.e. expansion of the adaptive immune subset specific only to the foreign antigen. Activation of the adaptive immune response often generates a potent response against the foreign entities sufficient to clear the infection. A summary of the co-stimulatory molecules required for T-cell activation and/or inhibition is illustrated in Figure 1.1.

- 9 - Introduction

Figure 1.1. Co-stimulatory Molecules

Co-stimulatory molecules promote T-cell proliferation, survival and effector differentiation. Importantly, binding of co-stimulatory molecules after MHC/ TCR interaction will ensure the avoidance of T-cell anergy. Co-inhibitory molecules inhibit T-cell proliferation and cytokine production, induces apoptosis and anergy as well as suppress effector cell differentiation. Adapted from (Li 2007).

- 10 - Introduction

1.3.2 Immune tolerance

The potency of the adaptive immune response is a result of the random re- arrangement of receptor gene segments, resulting in a diverse variety of potent lymphocyte receptors. This process however, also results in the amplification of lymphocytes recognising and targeting self-molecules for destruction. Despite this, it is a major feature of the immune system that B- and T-cells are physiologically tolerant to most if not all self-antigens. This physiological tolerance is a result of a highly complex lymphocyte development system called “central” and “peripheral” tolerance. During this process, lymphocytes bearing self-reactive receptors are either deleted, anergised or ignored. Central tolerance is the first selective process, which occurs in the primary lymphoid organs during the development of the lymphocytes. Further degrees of peripheral tolerance occur at later stages after the cell has been released into the lymphoid system.

During central tolerance, HLA molecules present antigen(s) to immature T-cells in the thymus. T-cells bearing T-cell receptor (TCR) that binds too strongly to self- antigen(s) are deleted (Werlen, Hausmann et al. 2003). Similarly, T-cells with poor binding to antigen(s) are also deleted (Nossal, Herold et al. 1992; Shehadeh, Gill et al.

1993). Thus only T-cells with intermediate binding abilities are allowed to exit the thymus, as naïve T-cells, and released into the lymphatic system. The process of negative selection is often leaky, due to the low concentration of some self-Ag in the thymus, leaving some self reactive T-cells to escape into the lymphatic circulation.

Self-reactive T-cells that escape central tolerance are anergised upon binding to the target self-molecule. This process is known as peripheral tolerance. In this case, when a TCR can strongly recognise a target cell, an appropriate co-stimulatory signal is necessary to activate the T-cell. In the absence of a co-stimulatory signal (when TCR is - 11 - Introduction bound to self molecule), the T-cell will be anergised (Nossal, Herold et al. 1992;

Shehadeh, Gill et al. 1993).

1.3.3 The disease

T1D is an autoimmune disease, whereby the immune system has lost tolerance towards the -cells and targets it for destruction (Wucherpfennig and Eisenbarth 2001).

Autoimmune diseases are defined as diseases caused by the pathogenic effect of autoantibodies or autoreactive T cells resulting in inflammation, functional alteration, or anatomical lesion (WHO 1999). To fulfil this definition T1D has to fit in the criteria defining autoimmune diseases (Adapted from (Rose and Bona 1993; Bach 1994)). They are:

1. The disease can be transferred through the patients’ antibodies or T cells.

2. The disease can be prevented or slowed through immunosuppressant regimens.

3. The disease is associated with manifestation of humoral or cell-mediated

autoimmunity against the target organ.

4. The disease can be experimentally induced by sensitisation against an auto-

antigen present in the target organ.

It is generally accepted that points 1 and 2 are compulsory criteria of autoimmune diseases, whereas points 3 and 4 are important but less critical. T1D fulfils the first three criteria of autoimmune disease, whereas point 4 was only partially fulfilled in animal models.

- 12 - Introduction

1.3.4 T1D in human

In humans, apparent transfer of disease may have occurred after pancreas transplantation between identical twins (Sibley, Sutherland et al. 1985) and after allogeneic bone marrow transplantation from diabetic donor (Lampeter, Homberg et al.

1993; Vialettes, Maraninchi et al. 1993). Conversely, administration of immunosuppressive regimens can delay -cell destruction, demonstrating the role of lymphocytes in disease progression (Feutren, Papoz et al. 1986; Bougneres, Carel et al.

1988; Bougneres, Landais et al. 1990; Burcelin, Eddouks et al. 1993). Suppression of T cell proliferation using anti-CD3 therapy was successful to improve glucose control and

-cell function in T1D patients for up to 2 years (Herold, Gitelman et al. 2005), supporting specifically the role of T cell in the pathogenesis of T1D. Furthermore, pancreas biopsy from T1D patients demonstrate the presence of infiltrating T cells juxtaposed at the site of -cell apoptosis (Yamagata, Nakajima et al. 1996; Imagawa,

Hanafusa et al. 2001) (Figure 1.2). Most patients diagnosed with T1D have autoantibodies to a number of -cell associated antigens including insulin (Palmer,

Asplin et al. 1983; Kuglin, Gries et al. 1988; Vardi, Ziegler et al. 1988; Keilacker,

Rjasanowski et al. 1995), glutamic acid decarboxylase GAD65/67 (Baekkeskov,

Aanstoot et al. 1990; Karlsen, Hagopian et al. 1992; Kaufman, Erlander et al. 1992;

Endl, Otto et al. 1997) and Islet cell Antigen-2 (IA-2)/ Phorgin – a tyrosine phosphatase-like molecule expressed by -cells (Passini, Larigan et al. 1995; Lan,

Wasserfall et al. 1996; Peakman, Stevens et al. 1999) (Figure 1.3). Together these data supported the notion that T1D is an autoimmune disease, whereby the immune system, especially the T lymphocytes lose their self-tolerance and target the -cells for destruction.

- 13 - Introduction

1.3.5 Mouse models of T1D

Due to the nature of the disease including the asymptomatic prediabetic period, the anatomical location of the pancreas and the lack of correlation between the peripheral blood and the immunological events in the islets, a large proportion of our knowledge about T1D has been derived from animal models (Roep, Atkinson et al.

2004). The Non-Obese Diabetic mouse (NOD) and the Bio-Breeding rat (BB) are the only two naturally occurring diabetes models, which closely resemble human T1D.

There are other inducible models of T1D through viral infection or toxin injection, detailed discussions of these models can be found in the following references: (Roep,

Atkinson et al. 2004; Rees and Alcolado 2005).

1.3.5.1 The NOD mouse

The NOD mouse was first developed by Susumu Makino in Japan (Makino,

Kunimoto et al. 1980). The phenotype of the NOD mouse resembles that of human T1D whereby hyperglycaemia and diabetes onset are both attributed to leukocyte infiltration of the pancreatic islets (insulitis), leading to leukocyte-mediated destruction of the - cells (Bendelac, Carnaud et al. 1987). Furthermore, similar to human diabetes, disease susceptibility is also related to multiple genetic (Todd, Aitman et al. 1991) and environmental factors (Oldstone 1990; Oldstone, Ahmed et al. 1990). Significant correlations between human and NOD diabetes include: the association of class II major histocompatibility complex (MHC) (Wicker, Appel et al. 1992), presence of autoantibodies (Yu, Robles et al. 2000) and the importance of T cells in disease progression (Wicker, Miller et al. 1986; Bendelac, Carnaud et al. 1987; Haskins and

McDuffie 1990; Shimizu, Kanagawa et al. 1993). There is however in this model a gender bias of disease prevalence towards the female mice (70-90% female vs 10-40%

- 14 - Introduction male) (Makino, Kunimoto et al. 1980; Delovitch and Singh 1997) and a higher disease incidence in genetically susceptible subjects (>80% NOD versus 5-30% Human) (Roep,

Atkinson et al. 2004). Unfortunately, numerous treatment that were successful in preventing or curing T1D in the NOD mice could not be translated into viable clinical outcomes for human (Atkinson and Leiter 1999; Roep, Atkinson et al. 2004; Shoda,

Young et al. 2005). Efficacy, timing, dosage and long-term outcome of these treatments were not thoroughly investigated in some studies (Shoda, Young et al. 2005).

Ultimately, the NOD model represents multiple copies of only a single individual disease, thus cannot be directly compared to the heterogenous human population (Roep,

Atkinson et al. 2004).

- 15 - Introduction

Figure 1.2. Photomicrograph of pancreatic biopsy specimens.

Ex vivo evidence of T-cell infiltrate in human islets: CD-31 T cells (green) are infiltrating into the islet (insulin containing -cells: red) in one patient (a) but not in another patient (b). Expression of MHC class I antigens increased in one patient (c), but did not increase in another patient (d.). Original magnification: x280 (a, b and d) and x200 (c). (Reproduced from (Imagawa, Hanafusa et al. 2001)).

Figure 1.3. GAD expression in pancreatic islet.

Immunohistochemistry of human islets expressing GAD 65 (a) and GAD 67 (b). (Reproduced from (Kaufman, Erlander et al. 1992)).

- 16 - Introduction

Table 1.1 Differences between NOD and human diabetes.

Reproduced from (Roep, Atkinson et al. 2004).

Similarities Human Mouse Genetic predisposition and polygenetic trait Yes Yes MHC-loci contribution Multiple Multiple Environmental influence Yes Yes Defective peripheral immune regulation Yes Yes Impaired dendritic-cell maturation and function Unconfirmed Yes Disease transmission with bone-marrow Yes Yes transplantation Autoantigens GAD65, IA2, GAD65, IA2, insulin, 38 kD insulin, 38 kD Initiating autoantigens Unknown Unknown Delayed onset with immunosuppression Yes Yes Islet autoimmunity linked to early gluten exposure Yes Yes Differences Endogenous retrovirus in -cells Unclear Yes* T-cell driven insulitis Mild Severe Humoral reactivity to -cells GAD65, IA2 Insulin and insulin Insulin gene One Two GAD65 expression by -cells Yes No Incidence 0.25-0.40% > 80% Incidence in genetically susceptible subjects 5-30% >80% Gender bias No Females Peri-insulitis No Yes Lymphocytic infiltrates to other tissues Minority of All mice patients Susceptibility of -cells to STZ or NO in vitro** Only at high Very concentration susceptible Maternal autoantibodies Potentially Diabetogenic reduced risk of T1D B cell required No Yes Successful intervention therapies Pending >195

- 17 - Introduction

1.3.5.2 The BB rat The BB rat was first developed in Ottawa, Canada in 1974 at the BioBreeding

Laboratories (Nakhooda, Like et al. 1977). The BB rat developed spontaneous hyperglycaemia at about 12 weeks of age and full diabetes by approximately 50-90 weeks (Guberski 1993). Destruction of the pancreatic -cells was lymphocyte dependent (Lohr, Markholst et al. 1989; Lally, Ratcliff et al. 2001), and protection was achieved using immunosuppressants (Laupacis, Stiller et al. 1983; Like, Dirodi et al.

1984; Jaworski, Honore et al. 1986). The morphology of insulitis was dominated by

Th1-type lymphocytes, which resembles human diabetes (Kolb, Worz-Pagenstert et al.

1996; Zipris 1996; Zipris, Greiner et al. 1996). Similar to the NOD mice and human diabetes, autoantibodies were detectable in diabetic prone animals (Mackay, Bone et al.

1996), and disease development was also associated with MHC associated and other susceptibility genes (Martin, Blankenhorn et al. 1999; Martin, Maxson et al. 1999).

Unlike the NOD mice, there was no gender bias in disease distribution (Guberski 1993) and viral infections could accelerate disease onset (Guberski, Thomas et al. 1991). The greatest caveat to the BB rat was their state of T cell lymphopenia, characterised by a severe loss of CD4+ and CD8+ T cells (Jackson, Rassi et al. 1981; Jackson, Kadison et al. 1983; Yale, Grose et al. 1985; Woda, Like et al. 1986) as well as a deficiency in

ART2+ T cells, which was associated with regulatory properties (Bortell, Kanaitsuka et al. 1999). Numerous trials of diabetes prevention treatments successful in the NOD mice, failed both in the BB rat and human trials, such as oral insulin (Mordes, Schirf et al. 1996), nicotinamide (Hermitte, Vialettes et al. 1989) and candidate autoantigens including GAD and BSA (Petersen, Mackay et al. 1997). Some preventative methods, which succeed in the BB rat however, also failed in humans; one example is the early prophylactic insulin treatment (Gotfredsen, Buschard et al. 1985).

- 18 - Introduction

1.3.6 Animal model as proof of principal

Animal models function as proof of principal demonstrating the autoimmune nature of T1D. T1D can be transferred from NOD mice or BB rats into non-diabetic recipients through transfer of splenocytes (Koevary, Rossini et al. 1983; Bendelac,

Carnaud et al. 1987; Haskins and McDuffie 1990; Christianson, Shultz et al. 1993;

Matsumoto, Yagi et al. 1993; Bergman and Haskins 1994) or T cell clones derived from the spleen or islets (Wicker, Miller et al. 1986; Bendelac, Carnaud et al. 1987; Haskins and McDuffie 1990; Shimizu, Kanagawa et al. 1993). Conversely, depletion of T cells through neonatal thymectomy (Like, Kislauskis et al. 1982; Ogawa, Maruyama et al.

1985), anti-lymphocyte serum (Like, Rossini et al. 1979; Boitard, Michie et al. 1985;

Wang, Pontesilli et al. 1991; Chatenoud, Thervet et al. 1994) and immunosuppression

(Laupacis, Stiller et al. 1983; Like, Dirodi et al. 1984; Jaworski, Honore et al. 1986;

Kiesel, Maruta et al. 1986; Mori, Suko et al. 1986; Bone, Walker et al. 1990; Baeder,

Sredy et al. 1992) resulted in prevention or protection from T1D. -cell associated auto- antibodies were also identified in the animal models; some examples are insulin

(Maruyama, Takei et al. 1988; Maruyama, Takei et al. 1989; Yu, Robles et al. 2000) and GAD (Tisch, Yang et al. 1993). Autoreactive T-cells specific for -cell associated autoantigens including insulin (Wegmann, Norbury-Glaser et al. 1994) proinsulin

(Chen, Bergerot et al. 2001) and GAD (Kaufman, Clare-Salzler et al. 1993; Tisch, Yang et al. 1993) have been identified in the NOD mice. Insulin B chain-specific CD4+ T cells could accelerate disease in young NOD mouse or adoptively transfer disease in

NOD-scid mice (Daniel, Gill et al. 1995). The fourth criterion of autoimmune disease was partially fulfilled in the animal models, whereby T1D was induced in normal rabbits by anti-insulin sensitisation (Kloppel, Altenahr et al. 1974). Overall, these data demonstrated that T1D is T cell mediated autoimmune disease directed against -cells

- 19 - Introduction or -cell specific auto-antigens. It is important to note however, that T1D in the animal models are skewed towards a T cell mediated disease far more than the human disease.

1.3.7 The Mechanism of disease

The pathogenesis of T1D involves interplay between genetic, immunological and environmental factors, which together results in disease susceptibility and initiation.

1.3.7.1 Genetic factors of T1D

T1D has long been associated as a hereditary disease, due to the high rate of familial transmission. Although 85% of newly diagnosed cases are sporadic (no first degree relative with T1D), first-degree relatives are at an increased risk of developing

T1D. The risk of T1D in the general population is 0.4%, which increases to 1.3-4% for offspring of a diabetic mother, 6-9% for offspring of a diabetic father (Warram,

Krolewski et al. 1984; Bleich, Polak et al. 1993; Harjutsalo, Reunanen et al. 2006) and

6-7% for siblings of affected individuals (Bach 1994). Disease concordance between monozygotic (identical) twins is between 21-70% (Rotter 1981; Lo, Tun et al. 1991), but the penetrance of genetic factors is less than 40% (Bach 1994). Studies both in human and animal models, demonstrated the presence of multiple pre-disposing genes associated with T1D.

Genetic susceptibility loci: IDDM1: HLA

Nerup et al. first discovered the association between HLA and T1D in 1974

(Nerup, Platz et al. 1974). It is now known that the MHC gene in mouse or HLA in human, on chromosome 6, is responsible for approximately 50% of the familial aggregation of T1D (Bonifacio, Hummel et al. 2004). The class II molecule on chromosome 6p21, specifically the HLA-DR4-DQ8 and HLA-DR3-DQ2, are the two

- 20 - Introduction haplotypes associated with the highest risk of diabetes (Caillat-Zucman, Garchon et al.

1992; Davies, Kawaguchi et al. 1994; Hermann, Bartsocas et al. 2004).

Transgenic mice expressing human DQ8 with -cell expression of co- stimulatory molecule B7-1 develop T1D, demonstrating that DQ8 directly predisposes to disease (Wen, Wong et al. 2000). NOD mice express only the diabetogenic MHC class II molecule I-Ag7. Crystal structure analysis of this molecule showed that the class II binding cleft had a large pocket and is able to bind with multiple peptides, including GAD (Corper, Stratmann et al. 2000). This may be relevant in humans, whereby people with DR3 and/or DR4 haplotype have an increased level of islet cell antibodies (ICA) (Caillat-Zucman, Garchon et al. 1992).

It was proposed that the diabetogenicity of the I-ANOD gene was associated with the absence of Aspartic Acid (Asp) at position 57 in the -chain variance (Acha-Orbea and McDevitt 1987) (which corresponds to the same position 57 in the human DQ - chain (Morel, Dorman et al. 1988)). Disease protection however was more prominent in homozygous Asp-57/ Asp-57 individuals as oppose to Asp-57/ non-Asp heterozygotes

(Ronningen, Iwe et al. 1989). Similarly, some mice were protected from diabetes despite the absence of Asp at position 57 (Lund, O'Reilly et al. 1990; Miyazaki, Uno et al. 1990). There were however, some homozygous individuals with Asp-57 who were diabetic, indicating that this phenomenon may only be valid to a certain group of diabetic individuals (Ronningen, Iwe et al. 1989). A different proposal for disease susceptibility was the presence of Arginine (Arg) at position 52 in the DQ chain and non-Asp DQ chain (Khalil, d'Auriol et al. 1990; Khalil, Deschamps et al. 1992). In this case, non-Arg residue in the DQ chain and Asp residue in the DQ chain were proposed to confer protection; although this was not the case in some subjects (Vicario,

Martinez-Laso et al. 1992). Other mechanisms have also been proposed that have

- 21 - Introduction varying degrees of correlation to the onset of T1D or disease protection (Deschamps,

Marcelli-Barge et al. 1988; Sheehy, Scharf et al. 1989; Ronningen, Spurkland et al.

1991; Degli-Esposti, Abraham et al. 1992). It is important however that in the case of a multifactorial disease, such as T1D, it seems improbable that disease susceptibility will be caused by just a handful of target genes. These evidences linked the HLA class II molecule to diabetes susceptibility, though the specific mechanisms have not yet been deciphered. The strongest evidence so far was the study by Wen et al., which directly relates DQ8 to disease onset (Wen, Chen et al. 2001).

It is also important to mention that the HLA-DQB1*0602 allele has the strongest association with disease protection, and usually found on the DR2 haplotype. This was demonstrated through a number of independent linkage studies (Baisch, Weeks et al.

1990; Pugliese, Brown et al. 2001). The protective mechanism of this allele has not yet been deciphered, but individuals carrying the HLA-DQB1*0602 allele rarely develop disease despite the presence of islet cell antigens (Pugliese, Gianani et al. 1995;

Gianani, Verge et al. 1996; Verge, Gianani et al. 1996). Again with the complexity of the multifactorial nature of T1D, the protective effect of this allele is not absolute. A few cases were found where this allele was present in T1D patients (Pugliese, Kawasaki et al. 1999).

- 22 - Introduction

IDDM2: insulin gene

The IDDM2 locus is located in the chromosome 11p15 region encompassing the tyrosine hydroxylase (TH), insulin (INS) and insulin-like growth factor II (IGF2)

(Davies, Kawaguchi et al. 1994). Recently, it was demonstrated that the highest susceptibility genes concentrated mainly in a 4.1 kb region encompassing the variable number of tandem repeats (VNTR) minisatellite and the INS gene (Bell, Selby et al.

1982; Bell, Horita et al. 1984; Lucassen, Julier et al. 1993) (Figure 1.4). A strong link has been established between disease susceptibility and the IDDM2 locus (Bain, Prins et al. 1992; Spielman, McGinnis et al. 1993), especially in the variation of the VNTR region (Bennett, Lucassen et al. 1995; Bennett, Wilson et al. 1996). Variation in the

VNTR region is grouped into three separate classes defined by their size: class I (26-63 repeats), class II (~80 repeats) and class III (~140-200 repeats). Homozygosity for Class

I allele was associated with high-risk of disease (Bennett, Lucassen et al. 1995) whereas

Class III allele conferred protection (Pugliese, Awdeh et al. 1994; Bennett, Wilson et al.

1996). The different classes of the VNTR region may be responsible in controlling islet self-antigen mRNA expression, including insulin, GAD, or IA-2, in the thymus for tolerance induction (Pugliese, Zeller et al. 1997). The protective class III VNTR was associated with high-level thymic expression of INS mRNA, which was inversely proportional to disease susceptibility (Pugliese, Zeller et al. 1997). In healthy subjects for instance, high levels of islet autoantigen mRNA were detected in the thymus

(Pugliese, Brown et al. 2001). Interestingly, in vivo studies demonstrated that class III

VNTR have a lower expression of INS transcription compared to class I VNTR in the pancreas (Bennett, Lucassen et al. 1995; Bennett, Wilson et al. 1996; Vafiadis, Bennett et al. 1997). It is nonetheless uncertain whether either thymic or peripheral expression of self-antigen is more important, since in vivo analysis demonstrated expression of islet

- 23 - Introduction self-antigen both in the thymus and periphery of healthy subjects (Pugliese, Zeller et al.

1997).

Figure 1.4. Diagramatic representation of the TH-INS-IGF2 region on the human chromosome 11p15 showing polymorphisms within the 4.1 kb region that contains IDDM2.

Open: introns, Closed: exons, hatched box: untranslated regions. Polymorphisms are designated by their position with respect to the first base of the initiating ATG (designated -1) following (Julier, Hyer et al. 1991). The VNTR (variable number tandem repeats) was positioned at -596 using the 5’ and 3’ boundaries described by (Bell, Selby et al. 1982), GenBank Acc J00265. (Reproduced from (Bennett, Lucassen et al. 1995)).

IDDM3 to IDDM18

There are in total 17 IDDM diabetes susceptibility loci summarised in Table 1.2;

IDDM13 and IDDM14 shared the same locus, thus IDDM14 is not used.

- 24 - Introduction

Table 1.2. Non-MHC gene loci in human T1D

Logarithm of the odd (LOD) score is the log-likelihood ratio of the data under the hypothesis that the proportion of the alleles shared has the observed value as compared with the hypothesis that there is no excess of allele sharing.

Locus Chromosome Markers Significance level (LOD) IDDM1 6p21 HLA (discussed above) IDDM2 11p15.5 INS (discussed above) 2.0 IDDM3 15q26 D15S107 (Field, Tobias et al. 1994) 2.0 IDDM4 11q13 FGF3 (Fibroblast Growth Factor 3) 3.6 (Davies, Kawaguchi et al. 1994; Hashimoto, Habita et al. 1994) IDDM5 6q25-q27 D6S476-D6S473 (Davies, Cucca et 3.6 al. 1996) IDDM6 18q21 D18S487 (Merriman, Eaves et al. 1998) IDDM7 2q31-q33 D2S152 (Esposito, Hill et al. 1998) IDDM8 6q25-q27 D6S264, D6S281 (Luo, Bui et al. 3.6 1995; Luo, Buzzetti et al. 1996) IDDM9 3q22-q25 D3S1303 (Davies, Kawaguchi et al. 2.0 1994) IDDM10 10p11-q11 D10S193 (Reed, Cucca et al. 1997; 2.0 Mein, Esposito et al. 1998) IDDM11 14q24.3q31 D14S67 (Field, Tobias et al. 1996) 3.6 IDDM12 2q33 CTLA4 (Nistico, Buzzetti et al. 3.6 1996) IDDM13 2q34 D2S164 (Morahan, Huang et al. 3.6 1996) IDDM15 6q21 D6S283 (Delepine, Pociot et al. 2.0 1997) IDDM16 14q32.32-32.33 D14S292-D14S293 IDDM17 10q25 D10S1750-D10S1773 (Concannon, Gogolin-Ewens et al. 1998; Verge, Vardi et al. 1998) IDDM18 5q33-q34 IL12B (Morahan, Huang et al. 2001) 3.6

- 25 - Introduction

1.3.7.2 Immunological factors of T1D: Who are the major players

Ultimately the major players of disease modulation in T1D are the immune cells responsible for islet infiltration and -cell destruction. The hallmark of disease onset in

T1D is the infiltration of mononuclear cells into the islets of Langerhans, an event described as insulitis (Gepts and Lecompte 1981). Studies in animal models described an initial peri-insulitis period where the mononuclear cells first assemble around the islets (Kay, Campbell et al. 1991; O'Reilly, Hutchings et al. 1991; Thivolet, Bendelac et al. 1991). Insulitis occurs shortly after the peri-insulitis period, where the mononuclear cells invade and destroy the -cells within the islets of Langerhans (Gepts and

Lecompte 1981; Jansen, Homo-Delarche et al. 1994). An initial non-destructive insulitis developed after weaning in all NOD mice. Antigen presenting cells (APC) such as macrophages and dendritic cells (DC) were the first to appear (Jansen, Homo-

Delarche et al. 1994), followed by both CD4+ and CD8+ T cells and B cells (Bottazzo,

Dean et al. 1985; Miyazaki, Hanafusa et al. 1985; Kay, Campbell et al. 1991; O'Reilly,

Hutchings et al. 1991; Hanninen, Jalkanen et al. 1992). The onset of insulitis was designated as checkpoint 1, when tolerance against -cell antigens is lost; checkpoint 2 is when the benign form of insulitis turned into an invasive and destructive immune attack (Andre, Gonzalez et al. 1996). The role of each of these immune components and their contribution to the initiation and destruction of -cells will be discussed in the following section.

T-cells

T cells are the most important immune cells in T1D (Tisch and McDevitt 1996;

Bach and Mathis 1997). Studies in the NOD mice have demonstrated that disease would not develop in absence of T-cells, whether due to genetic athymic or T lymphopenic

- 26 - Introduction mutations, thymectomy at birth, or pharmacological interference of T-cell functions. T- effector subsets with diabetogenic properties falls into two categories: the CD4+ helper

T cells and the CD8+ cytotoxic T cells; and both are important for optimal induction and progression of disease (Bendelac, Carnaud et al. 1987; Miller, Appel et al. 1988;

Katz, Benoist et al. 1993; Serreze, Leiter et al. 1994; Sumida, Furukawa et al. 1994;

Wicker, Leiter et al. 1994; Tisch and McDevitt 1996; Bach and Mathis 1997).

Both T-effector subsets have the ability to transfer disease when injected into non-diabetic recipient mice. CD8+ T-cells could directly recognise -cells through the peptide-bound cell surface MHC I molecule (Kay, Parker et al. 1996). CD4+ T-cells however, could not directly recognise -cell due to the absence of MHC II molecule. In this case CD4+ T-cells would obtain additional help from local APC(s) including DC, macrophages and even B-cells, and then indirectly induce -cell apoptosis without an

Ag-specific interaction between CD4+ T-cells and -cells (Mathis, Vence et al. 2001).

The perforin/ granzyme and Fas/ FasL mediated apoptosis are the two primary

T-cell dependent killing mechanisms in T1D. In addition, T-cells are also capable of inducing apoptosis through release of pro-apoptotic chemokines including IL-1, TNF-

and IFN- (Thomas and Kay 2000). Chemokine release into the insulitic environment could induce -cell damage through production of cytotoxic substrates by local macrophages or even by the -cell itself (Rabinovitch 1994). In most cases, iNOS expression resulting in the production of NO and related inflammatory mediators are the mechanism of cytokine-induced -cell damage (Eizirik, Flodstrom et al. 1996).

B-cells

Autoantibodies produced by B-cells mark the ongoing destruction of -cells in

T1D (Gottlieb and Eisenbarth 1998). There exists a high correlation between disease progression and the presence of auto-Ab including GAD (Baekkeskov, Aanstoot et al.

- 27 - Introduction

1990; Kaufman, Erlander et al. 1992), insulin (Palmer, Asplin et al. 1983), pro-insulin

(Kuglin, Gries et al. 1988) and IA-2 (Lan, Wasserfall et al. 1996). Despite the weight of

T-cell dependence in T1D, NOD mice without of B-cells were protected from disease

(Serreze, Chapman et al. 1996; Noorchashm, Noorchashm et al. 1997). Disease susceptibility was returned when NOD B-cells were reconstituted (Serreze, Fleming et al. 1998). However, when only antibodies were reconstituted into the B-cell deficient

NOD mice, disease protection was still sustained (Serreze, Chapman et al. 1996). These data indicated that the role of B-cells in T1D is more complex than just antibody production. Recent reports demonstrated a role for B-cell as antigen presenting cells

(APC) to T-cells during disease initiation (Silveira, Johnson et al. 2002; Silveira,

Dombrowsky et al. 2004). These data indicates that B-cells could not directly induce - cell apoptosis, but instead are necessary to help activate T-cells to induce disease as an

APC (Silveira, Johnson et al. 2002).

Macrophages

The presence of macrophages in the vicinity of the pancreatic islets is the hallmark of insulitis (Kay, Campbell et al. 1991; O'Reilly, Hutchings et al. 1991).

Macrophages participate in -cell destruction through release of cytokines including IL-

1 (Arnush, Heitmeier et al. 1998), TNF- (Dahlen, Dawe et al. 1998; Green, Eynon et al. 1998) and IFN- (Zumsteg, Frigerio et al. 2000). Exposure of islets to pro- inflammatory cytokines could induce severe inflammation, leading to loss of function and apoptosis. The primary mechanism of macrophage-induced -cell damage is through the expression of cytokine-induced iNOS and production of NO (Heitmeier,

Scarim et al. 1997). Interestingly, NO is not produced only by Macrophages, but also - cells in response to the cytokines. In islets, NO could activate the mitochondrial- dependent apoptotic program, or loss of glucose stimulated insulin secretion (GSIS)

- 28 - Introduction

(Corbett, Wang et al. 1992). Either of these pathways is detrimental toward islet function and survival.

Dendritic Cells

Dendritic cells (DCs) are the primary APCs for many normal immune functions.

In T1D, DCs may have a role in picking up -cell associated autoantibodies and presenting them at the local lymph nodes. Immature DC recruitment may have occurred in the pancreas due to inefficient macrophage function in cleaning up cellular debris from -cell apoptosis after cellular modelling (discussed below) (Rovere, Vallinoto et al. 1998; Rovere, Sabbadini et al. 1999). The relative importance between B-cells and

DCs as APC to T-cells, have not yet been thoroughly investigated, but each of these cells have an important role in the initiation and progression of T1D.

- 29 - Introduction

T-cells, via MHC I on I T-cells, via MHC + -cells release to death tly by APCs including DC and DC including tly by APCs tion (Fas/ FasL and TNF/ TNFR), (ii) release ofrelease (ii) TNFR), FasL and TNF/ (Fas/ tion cluding Fas/ FasL and perforin granzyme. cluding Fas/ -cell antigen presented indirec -cell antigen (red dots) is directly presented to CD8 presented directly is dots) (red antigen -cell ) recognise + or CD8 or + -cell killing through cell-to-cell contact, in contact, cell-to-cell killing through -cell -cell death, whereby death, -cell -cell killing through (i) receptor-mediated death activa (i) through -cell killing -cell death. death. -cell -cell surface.T-cell activation induces B. The “activation-linked” mechanism T-cells (CD4 T-cells mechanism B. The “activation-linked” the the in release of toxic mediators, and (iv) activation of (iv) and toxic mediators, of in release resulting of macrophages activation (iii) by T-cells, cytokines macrophages. induces T-cell activation mediators. A. The ‘recognition-linked’ mechanism of mechanism ‘recognition-linked’ A. The Figure 1.5. PathwaysFigure of 1.5.

- 30 - Introduction

1.3.7.3 Initiation of disease

Naïve T-cells could potentially encounter auto-antigen against -cells at either the draining lymph nodes (pancreatic lymph nodes; PLNs) or at a distant site (possibly due to molecular mimic of -cell antigen introduced by infection or diet). Studies in transgenic models have demonstrated that it is likely for naïve diabetogenic T-cells to encounter -cell auto-antigens and are activated at the PLNs or at the mesenteric lymph node, which is a distal draining site for the pancreas (Green, Eynon et al. 1998;

Hoglund, Mintern et al. 1999).

Initially, naïve lymphocytes have no access to the tissue, but rather circulate in the blood and lymphoid organs. At some point, -cell auto-antigens are taken up by

APCs, possibly DCs, inducing maturation and draining to the local lymph node (in this case PLNs). In the PLNs, -cell auto-antigens are presented to potentially diabetogenic

TCR and induce auto-reactive T-cell proliferation and activation. Activated T-cells now acquire the ability to migrate into the tissue, causing -cell destruction. This sequence of events was derived from studies on transgenic or standard NOD mouse models

(Hoglund, Mintern et al. 1999).

This concept raises the question where was -cell antigen first encountered?

Interestingly, -cell apoptosis was observed early in the NOD mouse prior to insulitis

(Trudeau, Dutz et al. 2000). This process was thought to be associated to the structural remodelling of the pancreas in the early post-natal period (Scaglia, Cahill et al. 1997), commonly found in other parts of the body including the nervous system (Oppenheim

1991), kidney (Coles, Burne et al. 1993), heart (Kajstura, Mansukhani et al. 1995), male germ cells (Wang, Nakane et al. 1998) and adrenal cortex (Spencer, Mesiano et al.

1999). In the case of the diabetic-prone NOD mouse, it is possible that clearance of apoptotic debris might be associated with the initiation of autoimmunity. Rovere et al.

- 31 - Introduction described that inefficient clearing of apoptotic debris by macrophages, could result in the recruitment of other phagocytes including immature DC (Rovere, Vallinoto et al.

1998; Rovere, Sabbadini et al. 1999). Analysis of the neonatal phase of -cell death in the pre-insulitic period demonstrated an elevated level of apoptosis in the NOD mice in contrast to BALB/c control (Trudeau, Dutz et al. 2000). This may be indicative of a defect in the clearance rate of macrophages in the NOD mouse (Trudeau, Dutz et al.

2000). Acquisition of excess apoptotic debris by immature DC could result in DC maturation and release of pro-inflammatory cytokines as well as presentation of auto- antigen to T cells at the local lymph nodes (Rovere, Vallinoto et al. 1998; Rovere,

Sabbadini et al. 1999).

- 32 - Introduction

1.4 -CELL DEATH

The process of cell death is mediated by necrosis and/or apoptosis. Apoptosis is a regulated event, involving several components but is primarily driven by activation of a series of zymogens called caspases (Vaux and Korsmeyer 1999). Necrosis, in contrast, is considered to be an unregulated form of cell death, which does not require caspases and has almost no energy requirements (Vaux and Korsmeyer 1999). In T1D, both necrosis and apoptosis have been shown to have a role in the pathogenesis of -cell death, however their contributions are still poorly defined (Mandrup-Poulsen 1996;

Rabinovitch 1998).

1.4.1 Necrosis

Necrosis is an inflammatory process characterised by loss of membrane integrity and leakage of cellular content into the extracellular space. In vitro studies of isolated - cells demonstrated that they are susceptible to necrosis in the presence of oxidising radicals, which may be caused by a low activity in radical scavenging enzymes

(Malaisse, Malaisse-Lagae et al. 1982). Cytokines such as IL-1 have been demonstrated to induce high expression of iNOS in islets, both in -cells (Corbett,

Wang et al. 1992; Corbett, Kwon et al. 1993; Corbett, Sweetland et al. 1993a; Kwon,

Corbett et al. 1995; McDaniel, Kwon et al. 1996). In vitro, high concentration of NO could induce necrosis in both rat and human islets (Ling, In't Veld et al. 1993).

Interestingly, this process was exacerbated in presence of high glucose concentrations, suggesting that the onset of hyperglycemia can exacerbate beta cell death (Mandrup-

Poulsen 1996). Importantly, of the number of cytokines investigated to have caused - cell death, IL-1 was the only cytokine capable of inducing -cell necrosis (Steer,

- 33 - Introduction

Scarim et al. 2006). In the study by Steer et al. it was demonstrated conclusively that

IL-1 exposure induced -cell necrosis in an NO dependent and caspase independent manner (Steer, Scarim et al. 2006).

-Cell necrosis may be important in the initial release of -cell specific auto- antigens. That is, macrophage derived IL-1 could initiate -cell necrosis, causing the release of -cell specific auto-antigens into the extracellular environment, which subsequently could be taken-up by APC’s, potentially initiating the autoimmune process (Benoist and Mathis 1997).

1.4.2 Apoptosis

Apoptosis or programmed cell death is the most common mechanism of cell death. Apoptosis is important in cellular development (Vaux and Korsmeyer 1999), homeostasis (Raff 1996) and immunological regulation (Ekert and Vaux 1997).

Abnormal regulation of apoptosis can result in diseases such as cancer (Strasser, Harris et al. 1990; McDonnell and Korsmeyer 1991), autoimmunity (Strasser, Whittingham et al. 1991; Watanabe-Fukunaga, Brannan et al. 1992), and neuro degenerative disorders

(Barr and Tomei 1994; Thompson 1995). In T1D, apoptosis plays a role in -cell death.

In this section we will explore the mechanisms of apoptosis to better understand the molecular basis of -cell death.

Apoptosis can be initiated through two major pathways: the extrinsic pathway and the intrinsic pathway. The extrinsic pathway mediates cell death as a result of extracellular signals including cytokine, Fas/Fas-L, hormones, growth factors and toxins such as NO. On the other hand, the intrinsic pathway activates cell death in response to cellular injury or stress, such as heat, irradiation, nutrient deprivation, viral infection and hypoxia. Extracellular activators of apoptosis usually directly activate the death

- 34 - Introduction program through caspase activation whereas the intrinsic apoptotic pathway usually activates apoptosis through induction of mitochondrial damage. The two pathways however, are not mutually exclusive and cross reactivity often occurs.

Activation of the extrinsic apoptotic pathway begins by the binding of a death ligand to its transmembrane receptor (Figure 1.7). Cell surface death receptors are transmembrane proteins that belong to the family of TNF/ nerve growth factor (NGF) receptor superfamily. Table 1.3 summarises the mammalian death receptor and their consecutive ligands. Investigations into the TNF family ligands and receptors have demonstrated that TNF-family ligands are of a homo-trimeric nature, thus binding of a single ligand resulted in the trimerisation of the receptors (Smith, Farrah et al. 1994;

Gruss and Dower 1995; Nagata 1997).

Table 1.3. Death Receptors and Ligands

Adapted from (Ashkenazi and Dixit 1998).

Death Receptors Ligands Fas/APO-1/CD95 Fas/CD95 ligand (FasL) TNFR1 TNF and lymphotoxin- DR-3/APO-3/WSL-1/TRAMP Apo3-ligand DR4/TRAIL-R1 Apo2-ligand DR5/TRAIL-R2/TRICK2/ KILLER Apo2-ligand

- 35 - Introduction

Figure 1.6. The apoptotic death pathway.

Two primary mechanisms of apoptosis activations: the extrinsic pathway (activated by extracellular receptors), and the intrinsic pathway (activated by factors including UV irradiation, and controlled by Bcl-2 family members). There exist a cross-talk mechanism between the two death pathways, which potentially amplifies the intensity of the death program. At present, little is known regarding the Bim and Bmf, since their pathways are ill defined. The steps between perforin/ granzyme initiation of death pathways and subsequent activation of effector caspases are not fully understood. Reproduced from (Mathis, Vence et al. 2001).

- 36 - Introduction

1.4.3 Fas signalling pathway

FasL binding to Fas resulted in the clustering (trimerisation) of the receptor death domain (DD), which in turn recruits the binding of FADD (Fas-associated death domain) through its own DD (Boldin, Mett et al. 1995; Chinnaiyan, O'Rourke et al.

1995). FADD also has a “death effector domain” (DED), which binds to the zymogen form of caspase 8 (Boldin, Goncharov et al. 1996; Muzio, Chinnaiyan et al. 1996).

Upon FADD recruitment, caspase-8 was activated through self-cleavage (Muzio,

Stockwell et al. 1998). The death receptor/ adapter molecule/ death domain complex that recruits casapases for cleavage and activation is termed the death inducing signalling complex (DISC). Caspase-8 then activates downstream effector caspases, such as caspase-3 -6 and -7.

1.4.4 TNF and Apo3 signalling pathway

TNF binding to TNFR1 induces the trimerisation of the receptor DD, which recruits the binding of TRADD (TNFR-associated death domain) (Hsu, Xiong et al.

1995). TRADD functions as a platform to recruit a number of signalling molecules.

Recruitment of TRAF-2 (TNFR-associated factor 2) (Rothe, Pan et al. 1995; Hsu, Shu et al. 1996) and RIP (Receptor interacting Protein) (Hsu, Huang et al. 1996; Ting,

Pimentel-Muinos et al. 1996) activates the NF-B and/or JNK/AP-1 process, whereas

FADD activates the apoptotic pathway as above described (Chinnaiyan, Tepper et al.

1996; Hsu, Shu et al. 1996; Varfolomeev, Boldin et al. 1996). DR3 shows close sequence similarity to TNFR1 (Chinnaiyan, O'Rourke et al. 1996; Kitson, Raven et al.

1996; Marsters, Sheridan et al. 1996; Bodmer, Burns et al. 1997; Screaton, Xu et al.

1997). Similarly Apo3L (the ligand of DR3) closely resembles TNF (Marsters, Sheridan

- 37 - Introduction et al. 1998). Activation of the Apo3L/DR3 closely resembles TNF/TNFR1 pathway, but the distribution of the ligands and receptors throughout the body differs significantly.

TNF expression occurs mainly in activated macrophages and lymphocytes (Tartaglia and Goeddel 1992), whereas Apo3L is expressed constitutively across many tissues

(Chicheportiche, Bourdon et al. 1997; Marsters, Sheridan et al. 1998). Conversely,

TNFR1 is expressed ubiquitously (Tartaglia and Goeddel 1992), whereas DR3 expressions are present mainly in spleen, thymus and peripheral blood and are induced in activated T-cells (Chinnaiyan, O'Rourke et al. 1996; Kitson, Raven et al. 1996;

Marsters, Sheridan et al. 1996; Bodmer, Burns et al. 1997; Screaton, Xu et al. 1997).

1.4.5 TRAIL/ Apo2 signalling pathway

TRAIL and Apo2L are the two TNF family members that show the most similarity to CD95L/ Fas (Wiley, Schooley et al. 1995; Pitti, Marsters et al. 1996).

Activation of apoptosis by TRAIL/ Apo2 is a caspase dependent death pathway

(Marsters, Pitti et al. 1996; Mariani and Krammer 1998). This particular apoptotic pathway however, is independent of the adapter molecule FADD. At the present time little is known regarding the adapter, which bridges the intracellular DD of the DR4/

DR5 receptors and the activation of downstream caspases (Yeh, Pompa et al. 1998;

Zhang, Cado et al. 1998). More recent data suggests that FADD is recruited to the DD of DR4/5 to activate Caspase 10, which consequently activate downstream effector caspases (Budihardjo, Oliver et al. 1999; Mathis, Vence et al. 2001).

The receptor mediated death pathway is summarised in Figure 1.7.

- 38 - Introduction

death domain, DED: death effector domain, FADD: Fas Fas FADD: death effector domain, DED: death domain, 1999)). et al. et Figure 1.7. mediated Receptor pathway death DD: mediated death pathways”. known “receptor Illustration of associated death domain, TRADD: TNFR associated death domain. (Reproduced and modified, from (Ashkenazi and Dixit (Ashkenazi from (Reproduced and modified, death domain. death domain, TRADD: associated TNFR associated Oliver 1998; Budihardjo,

- 39 - Introduction

1.4.6 Mitochondrial signalling pathway

Activation of the intrinsic apoptotic pathway results in release of cytochrome c

(CytC) from the mitochondria (Yang, Liu et al. 1997; Scaffidi, Fulda et al. 1998). CytC works together with Apaf-1 and procaspase-9 to activate a caspase dependent apoptotic pathway (Li, Nijhawan et al. 1997). Apaf-1 is a 130-kDa protein with an 85-amino acid domain, which functions similarly to the caspase recruitment domain (CARD)

(Hofmann, Bucher et al. 1997). Interestingly, of all the CARD-carrying caspases

(caspase-1, -2 and -9), Apaf-1 only activates caspase-9 (Hu, Snipas et al. 1998).

Activation of caspase dependent apoptosis through the intrinsic pathway requires a highly controlled multi-step biochemical pathway. Apaf-1 first binds to ATP/dATP and hydrolyses it to ADP and dADP respectively. In absence of CytC this hydrolytic process does not result in any functional consequences. When CytC is present however, the binding and hydrolysis of ATP/dATP results in the formation of a multimeric Apaf-

1/CytC complex, which is functional to recruit and activate pro-caspase-9 (Zou, Li et al.

1999). Activation of caspase-9 subsequently activates downstream effector caspase-3, -

6 and -7.

1.4.7 Regulation of apoptosis

1.4.7.1 Regulation of cell surface activation of death pathway

There are three different mechanisms, which control the regulation of cell surface death receptor mediated apoptosis. The first inhibits procaspase recruitment to the DISC (death inducing signalling complex) to avoid cleavage and activation. There are several endogenous inhibitors of death receptor induced apoptosis (Cryns and Yuan

1998), but the most studied of these are the proteins that belong to the family of

- 40 - Introduction

“FADD-like ICE inhibitory proteins” (FLIP). There are two alternative splicing forms of FLIP, i.e. FLIP-long and FLIP-short, both contain two death effector domains (DED)

(Hu, Vincenz et al. 1997; Thome, Schneider et al. 1997). The DED present on FLIP competitively binds to the DED of FADD, procaspase-8 and -10, therefore inhibiting procaspase processing at the DISC (Goltsev, Kovalenko et al. 1997; Irmler, Thome et al. 1997).

Secondly, inhibition of TRAIL/ Apo2 induced apoptosis is facilitated by expression of cell surface decoy receptors, closely resembling DR4 and DR5 (Golstein

1997). These receptors however, lack a cytoplasmic domain (DcR1) or have a truncated death domain (DcR2) (Marsters, Sheridan et al. 1997). The decoy receptors regulate apoptosis by sequestering TRAIL ligand away from the death receptors DR4 and DR5.

Finally, death receptor induced apoptosis can be regulated at the level of the proteolytic activation of initiator procaspases, such as procaspase-8 or -10. There are a number of different molecules that have been identified to have the ability to inhibit activation of initiator procaspases including CrmA (Ray, Black et al. 1992; Komiyama,

Ray et al. 1994), silencer of death domains “SODD” (Jiang, Woronicz et al. 1999) and

A20 (Daniel, Arvelo et al. 2004).

1.4.7.2 Regulation of mitochondrial death signalling pathway

The primary regulator of mitochondrial-initiated death pathway is in the containment of CytC in the mitochondrial inter-membrane space, separating it from the death co-activators Apaf1 and procaspase-9. The Bcl-2 family genes are the known regulators of CytC release into the cytosol. Over-expression of the anti-apoptotic members of Bcl-2 family (e.g. Bcl-2 or Bcl-xL) inhibit CytC release in response to a variety of apoptotic stimuli (Kluck, Bossy-Wetzel et al. 1997; Vander Heiden, Chandel et al. 1997; Yang, Liu et al. 1997; Scaffidi, Fulda et al. 1998). In contrast, pro-apoptotic

- 41 - Introduction members of Bcl-2 family genes such as Bax (Jurgensmeier, Xie et al. 1998; Rosse,

Olivier et al. 1998) and Bid (Kuwana, Smith et al. 1998; Li, Zhu et al. 1998; Luo,

Budihardjo et al. 1998; Gross, Yin et al. 1999) promote CytC release from the mitochondria. Bcl-2 regulation of CytC release and cellular commitment to apoptosis is a complex process, which till this date not fully understood.

The Bcl-2 superfamily consists of more than 20 members, organised according to their Bcl-2 homology domains (BH1-4) in the -helical regions, according to their function in the apoptotic process (Cory and Adams 2002). The anti-apoptotic members

(e.g. Bcl-xL, Bcl-w, or Bcl-2) are located in the outer mitochondrial membrane (OMM).

They inhibit apoptosis by preventing the opening of the voltage dependent anion channel (VDAC) in association with pro-apoptotic Bcl-2 members. They could also inhibit the assembly of supramolecular openings formed by pro-apoptotic Bcl-2 members (Mayer and Oberbauer 2003). The pro-apoptotic members on the other hand reside primarily in the cytoplasm and can insert to the OMM on demand. The pro- apoptotic members of Bcl-2 are categorised into two groups, members exhibiting BH1-

3 (such as Bax and Bak) and BH-3 only domain group (such as Bad or Bik) (Cory and

Adams 2002). Each member of the Bcl-2 family can form homo-, oligo- and hetero- dimers by binding to their BH domains. The formation of these multimeric molecules have a significant impact on their function. For instance, Bax monomers are poor apoptotic inducers, while Bid and Bim monomers are sufficient to induce pore formation by activation of the VDAC (Cory and Adams 2002). On the other hand, Bid oligomerisation of Bax or Bak can form large pores through the OMM resulting in CytC release (Korsmeyer, Wei et al. 2000). By maintaining the integrity of the OMM, anti- apoptotic Bcl-2 family genes inhibit the release of CytC into the cytosol and inhibit apoptosis. The specific mechanisms on Bcl-2 regulation of mitochondrial death

- 42 - Introduction signalling pathway are reviewed in the following publications (Korsmeyer, Wei et al.

2000; Cory and Adams 2002; Mayer and Oberbauer 2003).

1.5 NF-B AND INFLAMMATION

NF-B is a transcription factor, which has a central role in controlling the expression of inflammatory, survival and immune response genes (Karin and Lin 2002).

NF-B was first discovered as a lymphoid specific protein that binds to the decameric oligonucleotide GGGACTTCC, present in the intronic enhancer element of the B-cell- immunoglobulin -light-chain gene (Sen and Baltimore 1986). It was later found that

NF-B was ubiquitously expressed in all cells and plays an important role in co- ordinating immune responses (Ghosh, May et al. 1998). NF-B is a family of transcription factors consisting of five members including: REL-A (P65), NF-B1 (p50; p105), NF-B2 (p52;p100), c-REL and REL-B (Verma, Stevenson et al. 1995; Ghosh,

May et al. 1998). Each member has a conserved 300-amino acid in the amino-terminal region known as the Rel homology domain (RHD), containing dimerisation, nuclear- localisation signal (NLS) and DNA-binding-domains (Ghosh, May et al. 1998) (Figure

1.8 top panel). REL-A, REL-B and c-REL all have transactivation domains in the carboxy-terminus to activate NF-B. In contrast, NF-B1 and NF-B2 are synthesised as large precursor forms p105 and p100, and require proteolytic processing to produce their respective p52 and p50 NF-B subunit (Silverman and Maniatis 2001). Most members can form both homo- and hetero-dimers in vitro except for REL-B, which forms dimers only with p50 or p52 (Bours, Burd et al. 1992; Ryseck, Bull et al. 1992;

Dobrzanski, Ryseck et al. 1993; Dobrzanski, Ryseck et al. 1994). Most dimeric forms of the NF-B component produce the transcriptionally active form of the molecule ie: p50/p65, p50/c-rel, p65/p65 and p65/c-rel; but p50 and p52 homodimers are

- 43 - Introduction transcriptionally repressive (Kang, Tran et al. 1992; Plaksin, Baeuerle et al. 1993;

Brown, Linhoff et al. 1994; Hansen, Baeuerle et al. 1994; Hansen, Guerrini et al. 1994).

In its active form NF-B transmits a nuclear localisation signal, which facilitates its translocation into the nucleus and binds to target DNA sequences. The diverse effects of an active NF-B signal make it necessary for tight control of its activation. NF-B therefore usually resides in the cytoplasm bound to its natural inhibitor IB.

The most common forms of NF-B inhibitors are IB, IB, IB and BCL3

(Li, Gregg et al. 2005) (Figure 1.8 lower panel). IB contains an ankyrin repeat region, which binds to NF-B and masks the NLS to retain NF-B in the cytoplasm (Verma,

Stevenson et al. 1995). IB is the best-characterised IB protein, it is composed of three regions: an N-terminal region: regulating signal-dependent degradation, an ankyrin repeat domain, and a C-terminal PEST region regulating basal degradation

(Davis, Ghosh et al. 1991; Haskill, Beg et al. 1991). In response to NF-B activating stimuli, such as cytokines, IB is phosphorylated at two sites near the N-terminus at

Ser-32 and Ser-36 (DiDonato, Mercurio et al. 1996; DiDonato, Hayakawa et al. 1997;

Lee, Hagler et al. 1997; Lee, Peters et al. 1998), which then made IB a target for ubiquitination at Lys-21 and Lys-22, resulting in proteosomal degradation (Palombella,

Rando et al. 1994; Traenckner, Wilk et al. 1994; Chen, Hagler et al. 1995; Scherer,

Brockman et al. 1995; Rodriguez, Wright et al. 1996; Roff, Thompson et al. 1996).

Degradation of IB reveals the NLS, allowing NF-B to translocate into the nucleus.

Simultaneously, the IB-bound PKAc (catalytic subunit of the Protein Kinase A) is activated, allowing the phosphorylation of P65 by PKA (at position Ser-276), which enhances the transcriptional activity of P65 (Zhong, SuYang et al. 1997; Zhong, Voll et al. 1998).

- 44 - Introduction

Tight control of NF-B is evident whereby IB is itself a major NF-B target gene. Indeed nuclear localisation of NF-B up regulates IB expression to immediately translocate NF-B back to the cytoplasm (Verma, Stevenson et al. 1995).

This tight regulation of the auto-inhibitory-feedback-loop may be necessary to limit the expression of potentially dangerous NF-B target genes and for efficient secondary activation of NF-B (by other cytokines, or a secondary bacterial or viral infections).

Recent studies demonstrate continuous cycling between cytoplasmic and nuclear localisation of NF-B. In the inactive state, expulsion of IB-bound protein from the nucleus is more efficient than that of the importation process, giving an overall net cytoplasmic localisation (Johnson, Van Antwerp et al. 1999; Huang, Kudo et al. 2000;

Huang and Miyamoto 2001; Malek, Chen et al. 2001; Birbach, Gold et al. 2002).

Consequently, activation of NF-B is a result of a net nuclear localisation due to a more efficient nuclear translocation process. Evidence of this continuous cycling process was found only in IB-bound and not in IB-bound NF-B. The incomplete masking of the NLS by the IB-ankyrin repeat sequence may be responsible for this phenomenon, resulting in a leaky P50 NLS signal (Huxford, Huang et al. 1998; Jacobs and Harrison

1998). Interestingly, IB may be the only member of the IB family capable of efficiently exporting nuclear-NF-B back to the cytoplasm (Huang and Miyamoto

2001). At this stage, the physiological purpose of the continuous, but asymmetric shuttling of IB-bound NF-B has yet been deciphered. It is however another interesting phenomenon in the behaviour of NF-B.

- 45 - Introduction

Figure 1.8. The NF-B and IB protein family.

Top panel: there are seven members of the NF-B proteins; all share the Rel homology domain (RHD). Only three NF-B proteins contain transactivation domains (TAD) located in the c-termini. All NF-B proteins contain a nuclear localisation sequence for nuclear translocation. A glycine rich (GR) region is present in the p105 and p100 proteins, which signal their limited proteasomal processing to generate the p50 and p52 proteins respectively. Lower panel: IB proteins are characterised by the presence of variable number of ankyrin repeats. Duplicated from (Tergaonkar 2006).

- 46 - Introduction

Activation of NF-B is associated with a number of different stimuli, ranging from cytokines, TCR activation and free radicals (Li and Verma 2002). Each of these activators could activate either the NF-B1 (canonical) or NF-B2 (non-canonical) pathways. Each NF-B pathway involves distinct molecular entities, and has different

NF-B activation profiles. Generally, stimuli such as cytokines and LPS activate the canonical NF-B pathway, via degradation of IB proteins within minutes of stimulation (Karin and Ben-Neriah 2000). On the other hand stimuli such as hypoxia or

UV irradiation will induce activation of the non-canonical pathway of NF-B, which is slower and weaker in contrast to the canonical pathway (Karin and Ben-Neriah 2000).

IL-1 or LPS (lipo-poly-saccharide) activate NF-B through the TLR4 (Toll like receptor protein-4). In fact this process involves three surface receptors: TLR4, CD14 and MD-2, which together activates an intracellular signalling cascade through the TLR cytoplasmic Toll/IL-1 receptor (TIR-) homology domain. Activation of TLR4 results in the binding of MYD88 (myeloid differentiation primary response gene 88). MYD88, subsequently bind to IRAK (IL-1 receptor-associated kinase) (Silverman and Maniatis

2001) and then TNF-receptor-associated factor 6 (TRAF6) is phosphorylated then recruited to IRAK. Downstream of IRAK a protein complex consisting of: transforming-growth-factor--activated kinase 1 (TAK1), TAK1 binding protein 1

(TAB1) and TAB2 (Wang, Deng et al. 2001) relays the activation signal to the IKK complex.

TNF activates NF-B through the TNFR, by firstly inducing the trimerisation of the TNFR (Banner, D'Arcy et al. 1993). TNFR trimerisation in turn recruits the binding of TRADD (Hsu, Xiong et al. 1995), via the death domain (Tartaglia, Ayres et al. 1993;

Cleveland and Ihle 1995; Feinstein, Kimchi et al. 1995). TRADD is an adaptor molecule which recruits downstream transducers: FADD (Chinnaiyan, O'Rourke et al.

- 47 - Introduction

1995; Hsu, Shu et al. 1996), TNF receptor-associated factor 2 (TRAF2) (Rothe, Wong et al. 1994) and receptor-interacting protein (RIP) (Stanger, Leder et al. 1995; Hsu,

Huang et al. 1996). As earlier described, FADD engage the apoptotic proteases triggering cell death (Section 1.4); TRAF2 on the other hand engage the activation of

NF-B or Jun (Rothe, Sarma et al. 1995), through the recruitment of RIP (Kelliher,

Grimm et al. 1998) along with MEKK3 (Yang, Lin et al. 2001), which together activate the IKK complex.

Transduction of these signals converges on the formation of the inhibitor of NF-

B (IB) Kinase (IKK) complex. The IKK complex consists of several proteins, the main ones being the IKK, IKK and IKK or known as NEMO (Li and Verma 2002).

In the absence of at least two IKK proteins or NEMO, NF-B activation is completely blocked (Li, Estepa et al. 2000; Rudolph, Yeh et al. 2000). IKK1 and IKK2 complex could phosphorylate all known IB proteins, in vitro (Karin and Ben-Neriah 2000).

IKK1 is important in both IB dependent and IB independent activation of NF-B (Li,

Lu et al. 1999; Sizemore, Lerner et al. 2002). IKK2 is required for activation of the NF-

B non-canonical pathway, i.e. NIK dependent activation of P100 (Li, Van Antwerp et al. 1999; Senftleben, Cao et al. 2001; Xiao, Harhaj et al. 2001). Finally, NEMO is a non-catalytic component of the IKK complex and is important for IkB dependent activation of NF-B (Rudolph, Yeh et al. 2000).

A summary of the NF-B pathway relevant for this thesis is summarised in

Figure 1.9.

In T1D, NF-B is associated primarily as a regulator of islet inflammation and death. In other fields however, NF-B has been demonstrated to have anti-apoptotic and survival functions (Beg and Baltimore 1996; Van Antwerp, Martin et al. 1996; Wang,

Mayo et al. 1996). The significance of NF-B dependent anti-apoptotic genes was seen

- 48 - Introduction especially in cancer cells’ evasion of immune mediated apoptosis (Wang, Mayo et al.

1996). In T1D however, NF-B has been associated with regulation of pro- inflammatory genes (Cardozo, Kruhoffer et al. 2001). NF-B was demonstrated to be responsible in regulating chemokine, cytokine and free-radical expression in islets

(Cardozo, Heimberg et al. 2001). Interestingly, deletion of single NF-B-dependent chemokine or chemokine-receptors could prolong islet graft survival in vivo or suppress the onset of diabetes in the NOD mouse (Wang, Han et al. 2005). These data indicate a somewhat paradoxical role for NF-B, where on the one hand it is responsible for islet death, but on the other hand it is also responsible for islet survival. Deciphering the role of NF-B in islets with respect to T1D, will improve our understanding of the pathogenesis of T1D, and moreover provide valuable information to develop treatment for the disease.

- 49 - Introduction

Figure 1.9. The NF-B pathway relevant for -cells.

IL-1 and TNF- are typical inducers of NF-B in -cells, which activates NF-B via the NF-B-1 pathway. The NF-B-2 pathway can also be activated via the recruitment of NIK. Free radicals are also relevant inducers of NF-B, via the activation of PKD. The signalling components toward activation of NF-B merged at the formation of the IKK complex, which targets the inhibitors of NF-B (IB) for degradation, allowing NF-B to translocate into the nucleus to activate down-stream target genes.

- 50 - Introduction

1.6 A20 AND CELLULAR SURVIVAL

A20 is an 80 kDa zinc finger protein, originally identified as a TNF-inducible gene in human umbilical vein EC (HUVEC) (Opipari, Boguski et al. 1990). It is now recognised that A20 is an early immediate response gene expressed by a variety of cell types including smooth muscle cells, hepatocytes and hemopoietic cells, in response to inflammatory stimuli (e.g: IL-1, CD40 and LPS) (Laherty, Hu et al. 1992; Sarma, Lin et al. 1995; Grey, Arvelo et al. 1999). Structurally, A20 is distinguished by an unusual carboxy-terminal domain containing 7 c2/c2 zinc finger motifs, which incorporates a novel ubiquitin ligase domain essential for its function (Wertz, O'Rourke et al. 2004).

Despite the presence of zinc fingers, current evidence suggests that A20 neither binds

DNA nor is itself a transcription factor, unlike other members of this broad family of proteins. Rather, A20 is an NF-B dependent gene (Krikos, Laherty et al. 1992) and is a part of a negative regulatory loop critical for modulation of cell activation during inflammation (Laherty, Perkins et al. 1993; Bach, Hancock et al. 1997).

A20 exerts a potent anti-inflammatory function via inhibition of NF-B

(Cooper, Stroka et al. 1996; Ferran, Stroka et al. 1998). A20 achieves this by ubiquitinating kinases essential for NF-B activation, thus targeting them for proteosomal degradation (Wertz, O'Rourke et al. 2004). A20 has been shown to interact with proximal adaptor proteins involved in TNF-R signalling and NF-B activation such as TRAF1, TRAF2, ABIN (a novel A20 partner that interferes with RIP or TRAF2 transactivation) and the IB kinase IKK- (Song, Rothe et al. 1996; Heyninck, De

Valck et al. 1999; Zhang, Kovalenko et al. 2000). Intriguingly, the ability of A20 to block NF-B activation can have multiple consequences, depending upon the role of

NF-B activation in each cell type. For instance, in endothelial cells, NF-B activation

- 51 - Introduction results in the induction of a robust pro-inflammatory response which if unchecked results in cell death. In this case over expression of A20 inhibits the inflammatory response and is protective (Ferran, Stroka et al. 1998; Daniel, Patel et al. 2006).

Interestingly, over expression of A20 in HeLa cells treated with free radicals sensitises them to cell death (Storz, Doppler et al. 2005). This results from A20 blocking the induction of protective, NF-B-dependent anti-oxidant enzymes such as MnSOD.

Therefore, though many studies indicate that A20 performs an anti-inflammatory and hence protective function, the exact function exerted by A20 will vary according to the nature of each cell type and possibly the conditions under which it is activated. These data make it more imperative that the exact role of A20 in different cell types under varying conditions be analysed in detail.

Aside from its anti-inflammatory function, A20 also serves an anti-apoptotic function (Ferran, Stroka et al. 1998; Daniel, Patel et al. 2006). The anti-apoptotic mechanism of A20 is not yet fully understood, but may involve inhibition of key proximal signalling events, as was previously shown that A20 inhibits activation of initiator caspases (i.e. caspase 2 & 8) following death receptor ligation (Daniel, Arvelo et al. 2004). Recent studies on cardiac xeno-transplantation (Hancock, Buelow et al.

1998) and toxic lethal hepatitis model demonstrate an anti-inflammatory and anti- apoptotic function for A20 in vivo (Arvelo, Cooper et al. 2002). Grafts expressing A20 lack evidence of inflammation, thrombosis, apoptotic cell death and absence of transplant-associated vasculopathy (Hancock, Buelow et al. 1998). Interestingly, in a rat model of kidney transplantation, high A20 expression in the vessel wall correlates with surviving grafts and absence of transplant associated vasculopathy (Kunter, Floege et al.

2003). The potent anti-apoptotic and anti-inflammatory function of A20 was confirmed with the demonstration that A20 KO mice are born cachectic and die within 3 weeks of birth as a result of unfettered liver inflammation (Lee, Boone et al. 2000). - 52 - Introduction

Our group has previously demonstrated that over expression of A20 in vitro could protect islets from IL-1 dependent apoptosis, through inhibition of NF-B dependent iNOS expression (Grey, Arvelo et al. 1999). We have also demonstrated that

A20 over-expression in islets in vivo could promote the survival and function of suboptimal islet isograft (Grey, Longo et al. 2003). These data demonstrated that A20 might have potential therapeutic properties for cure of T1D, through protection of islet grafts from inflammation. More importantly, these data demonstrate a protective role for NF-B, through regulation of anti-apoptotic, anti-inflammatory gene such as A20.

- 53 - Introduction

1.7 EXPERIMENTAL OBJECTIVES

The role of NF-B in -cell survival and inflammation has been controversial.

We therefore wanted to investigate the role of NF-B in the regulation and expression of islet protection and survival genes. To achieve this, we focused the investigations of this thesis into three specific aims:

1. To understand the role of NF-B in the activation of immediate-early pro-

inflammatory gene response in islets.

2. To investigate the islet’s immediate-early anti-apoptotic gene response, and its

relationship to NF-B.

3. To investigate the role of NF-B in islets in vivo.

The outcome of our study will not only broaden our understanding of the role of

NF-B in the disease pathogenesis of T1D, but we anticipate that it will also illuminate potential candidates for the development of therapeutics to treat T1D.

- 54 -

Chapter 2 Materials and Methods

2.1 BUFFERS AND SOLUTIONS

Table 2.1. Buffers and Solutions. Buffers/ Components Manufacturers Solutions PBS (10x) 3.6% Disodiumhydrogen orthophosphate Merck (NA2HPO4) 0.2% Potassium Chloride (KCl) Merck 0.24% Potassium dihydrogen orthophosphate Merck (KH2PO4) 8% Sodium Chloride (NACl) Ajax Finechem ELISA wash/ 1 x PBS WB wash 0.1% Tween 20 Pharmacia Bio FACS buffer 1 x PBS 0.5% Bovine Serum Albumn (BSA) Gibco 0.05 mM NaN3 Amersham Scott’s 81 mM (2%) Magnesium Sulphate (MgSO4) Merck n Blueing sol 24 mM (0.2%) NaHCO2 Sigma Acid Ethanol 100% Ethanol Ajax Finechem For ELISA 0.1% 1N H2SO4 Merck Acid Ethanol 70% Ethanol For H&E 1% concentrated HCl Merck STZ buffer 0.1 M citrate buffer (pH 4.5) PBS/Triton 1 x PBS 0.3% Triton X-100 Sigma LID cell lysis 10 mM Tris-HCl buffer 1% Triton-X-100 Sigma 0.5% NP40 Sigma 150 mM NaCl Sigma 10 mM Na orthophosphate Sigma 10 mM Na pyrophosphate Sigma 10 mM NaF Sigma 1 mM EDTA Sigma 1 mM EGTA Sigma 10 mM Na orthovanadate Sigma 1 Complete, EDTA-free; protease inhibitor Roche cocktail tablet, per 50 mL Sample 2% SDS buffer 0.0625 M Tris-HCl pH 6.8 Non- 25% glycerol Lomb Scientific reducing 0.5% bromophenol blue Sigma 75% dH2O Reducing 0.5 mL 2-mercaptoethanol Sigma

55 Materials and Methods

2.2 TISSUE CULTURE

Table 2.2. Media for tissue culture. Media Components Manufacturer Human islet CMRL Gibco media 10% BSA Gibco 2mM Glutamine Gibco 45 U/mL penicillin G Gibco 45 μM/mL streptomycin Gibco 5mM HEPES Gibco Mouse islet DMEM (16 mM glucose) Gibco media 2mM Glutamine Gibco 45 U/mL penicillin G Gibco 45 μM/mL streptomycin Gibco 5mM HEPES Gibco 10% heat inactivated Bovine Calf Serum (BCS) Hyclone Cell Culture DMEM (16 mM glucose) Gibco media 2mM Glutamine Gibco 45 U/mL penicillin G Gibco 45 μM/mL streptomycin Gibco 10% heat inactivated BCS HyClone Min-6 line 0.286 mM 2-mercaptoethanol Sigma Islet isolation M199 Gibco media 4.16 mM NaHCO3 Sigma 10% heat inactivated BCS Hyclone Adjust pH to 7.2 Ajax Finechem, Taren Point, NSW, AU| Amersham Pharmacia Biotech, Uppsala, SE, Sweden| Gibco Invitrogen, Mount Waverly, VIC, AU| Sigma Aldrich, Sydney, NSW, AU| Merck & Co. Inc., Whitehouse Station, NJ, USA| Roche Applied Science, Indianapolis, IN, USA| HyClone, South Logan, UT, USA

2.3 MAMMALIAN TRANSIENT TRANSFECTION

The A20 reporter constructs were a kind gift of Dr R. Dikstein (The Weizmann

Institute of Science, Israel) (Ainbinder, Revach et al. 2002), the expression plasmids encoding FADD, TRAF2, TRAF6, NIK and P65 were a kind gift from the Beth Israel

Harvard Medical School (Boston, MA), and were described in (Anrather, Csizmadia et al. 1997; Daniel, Arvelo et al. 2004; Storz, Doppler et al. 2005). The PKD expression construct was a kind gift of Dr. P. Storz (The Mayo Clinic College of Medicine, USA)

(Storz and Toker 2003).

- 56 - Materials and Methods

Transfection of -TC-3 cells, luciferase and -gal activity was performed as described (Grey, Arvelo et al. 1999). Briefly, -TC3 cells were plated at a density of

1.5x106 cells/ well into 6-well tissue culture plates (NUNC) and transfected 24 h later using the Lipofectamine-2000 reagent (Gibco) with 1 μg total DNA. -TC3 were transfected with 0.1 μg of -gal reporter (driven by the CMV promoter), to correct for transfection efficiency; the desired mass of target plasmid(s) (0.2-0.6 μg) containing the gene of interest; and made-up to 1 μg by adding pcDNA3 empty vector (Invitrogen).

Analysis of mammalian transfection result was performed using the Galacto-

Star™ System (Applied Biosystems, Bedford, MA, USA), for analysis of -gal activity; or the Luciferase assay system (Promega, Sydney, NSW, AU) for analysis of Luciferase activity. Luminosity assays were performed on the Microplate scintillation counter,

(Packard, Canberra, AU).

2.3.1 Plasmid Storage and amplification

For storage and amplification, plasmid samples were transformed into

“chemically competent: Top-10” e.coli (Invitrogen), following manufacturer’s instruction. Plasmid extraction was performed using a DNA purification kit, “GenElute

HP” Plasmid Maxiprep kit (Sigma), according to the manufacturer’s instruction. For long-term storage, 500 μL of transduced plasmid broth was diluted in glycerol to ~25% glycerol solution and stored in -70°C.

2.4 MICE

BALB/c and C57/B6 mice were purchased from The Animal Resource Centre

(Perth, WA). NOD mice were purchased from The Walter and Eliza Hall Institute

(Melbourne, Vic). All procedures performed complied with the requirements Australian

- 57 - Materials and Methods

Code of Practice for the Care and Use of animals for Scientific Purposes under the supervision of the Garvan/St Vincent’s Animal Ethics Committee.

2.5 PRIMARY ISLETS

2.5.1 Human primary islets

Human primary islets were a gift from Prof. Phillip O’Connel of the Westmead hospital. Islet culture were performed as follows: islets were plated on a 24 wells tissue culture plate (NUNC, DK, Roskilde, Denmark) at a density of 150-200 islets per well, suspended in 1 ml of human islet media. After overnight culture human islets were treated with 200 U/ml of either the Th1 cytokines: IL-1, TNF- or IFN-; or the Th2 cytokines IL-4, IL-13 or IL-15 (R&D Systems, MN, USA), for the indicated time points.

2.5.2 Mouse primary islets

To isolate primary mouse islets, the pancreas was distended with 3 mL of

0.25mg/ mL Liberase-Enzyme Blend-RI (Roche, Indianapolis, IN) in serum-free M199 media, using a 30G needle. A maximum of three pancreata were placed into one 50 mL tube on ice for processing. The tissue was digested in a 37°C water bath for 18 min.

Afterward, tubes were placed on ice and 30 ml of islet isolation media with 10% serum was added immediately to stop the digestion process. Tubes were vortexed and shaken hard to dislodge the acinar tissue from the islets; then centrifuged at 130 g (4°C) for 2 min and the supernatant were discarded. This process was repeated twice. Pellet were then re-suspended in 20 mL islet isolation media, and passed through a 425 micron sieve (US standard sieve series, A.S.T.E. E-11 specifications dual MFG, Co. Chicago,

Il, USA), the empty tube was filled with 30 mL of media and again was passed through the strainer, this procedure removed undigested pancreatic tissue, and other large

- 58 - Materials and Methods particles. The solution was spun down at 290 g (4°C) for 2 min, and the supernatant was discarded. The tube was dried using tissue paper, while being careful not to disturb the pellet. 10 mL of Ficoll-Plaque Plus (Amersham) was added to the pellet; then mixed using the vortex; an additional 10 mL of Ficoll was added to rinse the sides of the 50 mL tube. Next, 10 mL of serum-free islet isolation media was carefully overlayed on top of the Ficoll. The sample was spun down at exactly 1612 g for 22 min, without rotor acceleration or deceleration. At the end of this process, intact islets will float in the interface between Ficoll and serum-free media. However, the entire volume of the supernatant was collected into a new 50 mL tube to ensure maximum islet recovery, without disturbing the pellet. Collected supernatant was diluted into 100 mL of islet isolation media (with serum) and centrifuged at 290 g (4°C) for 2 min. The supernatant was then discarded and the isolated islets were pooled into one 50 mL tube, suspended in 25 mL of media. The tube was then rested on ice for 4 min, and 15 mL of media were carefully discarded from the top of the 25 mL liquid, this process was repeated 4 times.

This was to ensure that islet debris was removed prior to subsequent procedures.

Following isolation islets were counted and were plated in to a 12 wells tissue culture plate (NUNC) with 1 ml of islet culture media, at a density of 150 – 200 islets per well. After overnight culture, islets were stimulated with either 200 U/ml of IL-1 or TNF- (R&D Systems), for the indicated time points. Islets were then prepared for

RNA isolation for Microarray or RTqPCR.

In some cases islets were transduced either with recombinant adenovirus to over-express GFP or IB or A20; or were pre-treated with the pharmacological NF-B inhibitor, pyrrolidine dithiocarbamate (PDTC, Sigma). The recombinant-Adenovirus

(rAd) vector expressing A20 (rAd-A20) was a gift from Dr. V. Dixit (Dept. Molecular

- 59 - Materials and Methods

Oncology, Genentech, Inc., South San Francisco, CA); the control vector expressing rAd-GFP was a kind gift from the Beth Israel Harvard Medical School.

For viral transduction, islets were re-suspended into 1 ml serum free, antibiotic free DMEM with HEPES and infected with adenovirus for 1 hr at 37°C. Subsequent to the 1 hr incubation period 1 ml of DMEM with serum was added to the culture to terminate the transduction process. Islets were either collected for transplantation or incubated overnight for in vitro analysis. GFP-transduced islets were observed under a

Zeiss inverted fluorescence microscope (Carl Zeiss Inc., Jena, Germany) and images were captured using the Zeiss AxioCam HR camera (Zeiss).

For PDTC treatment, islets were cultured into 1 ml of islet culture medium with either 10, 50 or 100 μM PDTC at 37°C for 2 hr. Islets were then washed with PBS and prepared for either transplantation or in vitro analysis.

2.5.3 Islet transplantation

Recipient mice were injected with 20 mg/ Kg streptozotocin (STZ) (Sigma) to induce diabetes, five days prior to the day of operation. Mice were deemed diabetic if their blood glucose level was 18 mM for two consecutive days.

Islets were transplanted into STZ-induced C57BL/6 diabetic mice from either

BALB/c mice (allogeneic model: three-donor mice per recipient) or C57BL/6 mice

(syngeneic model: one-donor mice per-recipient). Islets were transplanted into the kidney capsule of the recipient mouse and graft function was determined by monitoring the animal’s blood glucose level starting from 24 hr post transplantation.

2.5.4 Glucose Stimulated Insulin Secretion

Isolated islets were incubated at 37°C with or without 50 μM PDTC pre- treatment in islet culture media with 5 mM glucose, overnight. Islets were then handpicked and placed into 1.5 mL tubes (with 3 holes on the lid; ~10 islets per tube; - 60 - Materials and Methods with 500 μL of 1mM glucose media). Islets were rested in 1mM glucose for 60 min in

37°C shaking water bath, then media was discarded and a fresh 500 μL of 1mM glucose was added. Islets were incubated in 37°C shaking water bath for 15 min, then 10 μL of supernatant was collected into a 490 μL PBS (glucose-free DMEM, Invitrogen) with

0.1% BSA (Invitrogen). The rest of the supernatant were carefully discarded and replaced with 5 mM glucose solution for 15 min in 37°C shaking water bath, again 10

μL of supernatant was collected into a 490 μL media as above described and stored at -

20°C for later use. For total insulin collection, the islets were re-suspended in 500 μL acid-EtOH and mixed by aspiration and expulsion motions using the pipette.

Supernatant was removed into a clean 1.5 mL tube and stored at -20°C for later use.

GSIS analysis was performed using the Rat insulin Elisa kit (Crystal Chemical

Inc., IL, USA) as per manufacturer’s instruction. Normalisation was performed by dividing the “insulin release” value by the “total insulin” value.

2.5.5 Glucose Tolerance Test

At 10-15 days after transplantation, glucose tolerance test (GTT) was performed on the syngeneic graft recipient patients. Each mouse was given a glucose bolus (20 mg/

Kg) and the blood glucose level was monitored between 5-120 min after glucose administration.

2.6 MOLECULAR TECHNIQUES

2.6.1 RNA isolation

RNA isolation was performed using the Qiagen RNeasy Plus, (Qiagen,

Germantown, MD, USA), following the manufacturer’s instruction. Cell

Homogenisation was performed using the QIAshredder (Qiagen) as per manufacturer’s instruction. Isolated RNA was eluted into 50 μL of DEPC H2O. RNA quality was - 61 - Materials and Methods evaluated using an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA,

USA) and NanoDrop ND1000 spectrophotometer (NanoDrop Technologies,

Wilmington, DE, USA).

2.6.2 mRNA reverse-transcription

Reverse transcription procedure was performed using the SuperScript™III reverse transcriptase kit (Invitrogen) following the manufacturer’s instruction for

Oligo(DT)20 protocol.

2.6.3 Microarray

Mouse islets were isolated from BALB/c or NOD mouse donors, and cultured in islet culture media. Messenger-RNA was extracted and subjected to Microarray analysis using a custom micro-array containing probe sets for 890 inflammatory genes. Prior to hybridisation, total RNA was amplified and labelled using the MessageAmp II aRNA

Amplification Kit (Ambion, Austin, TX, USA). Amplified RNA quality was evaluated using an Agilent 2100 Bioanalyzer (Agilent Technologies). Samples were hybridised on a custom-designed “CustomArray-12K-Microarray” platform (CombiMatrix, WA,

USA). All data were first normalised and background corrected, then log (base 20 transformed. For each experiment, islets were isolated from 10 mice and pooled. Each experiment was performed on three (NOD) or four (BALB/c) independent islet preparations. All samples were run on duplicate arrays; 42 arrays were run in total. The mean coefficients of variation (CVs) based on replicate features on the microarrays were 20%.

- 62 - Materials and Methods

Table 2.3. List of Primers Target Sequence Melting Temp. (Tm) A20 (human) F: AAAGCCCTCATCGACAGAAA 50 R: CAGTTGCCAGCGGAATTTA 49 A20 (mouse) F: TGGTTCCAATTTTGCTCCTT 63.22 R: CGTTGATCAGGTGAGTCGTG 64.01 GAPDH F: CACATCAAGAAGGTGGTG 57.32 (human) R: TGTCATACCAGGAAATGA 54.34 Cyclophilin F: TGGACCAAACACAAACGGTTCC 65.08 (mouse) R: ACATTGCGAGCAGATGGGGTAG 69.17 Ccl2 (m) F: GGTCCCTGTCATGCTTCTGG 66.96 R: CCTGCTGCTGGTGATCCTCT 66.85 Cxcl2 (m) F: TCCAGAGCTTGAGTGTGACG 64.36 R: TTCAGGGTCAAGGCAAACTT 63.47 Cxcl10 (m) F: GACGGGCCAGTGAGAATGAG 67.08 R: GTGTGTGCGTGGCTTCACTC 67.12 Cxcl1 (m) F: GCTGGGATTCACCTCAAGAA 64.09 R: AGGTGCCATCAGAGCACTCT 64.04 TNF- (m) F: CATCTTCTCAAAATTCGAGTGACAA 65.10 R: TGGGAGTAGACAAGGTACAACCC 65.00 IL-6 (m) F: CTGCAAGAGACTTCCATCCAGTT 65.56 R: GAAGTAGGGAAGGCCGTGG 65.70 BIRC3 (human) F: TCTGCAAGAAGCTGAAGCTGTG 66.90 R: TCCGCAATTGTTCTTCCACTG 67.12 BIRC3 (mouse) F: CACTGCAGCAACCTCATTCAGA 67.59 R: TGCAATGTCATCTGTGGGAAGA 67.73 BIRC4 (m) F: ATCCAAACATCCGGGAGCA 67.66 R: AGGCGCCTTAGCTGCTCTTC 66.94 BIRC6 (m) F: AGGAAAGGGTTCAGCGTTGC 67.47 R: CTGTGACCTGCCCATCATCTG 68.00 BIRC1a F: GCTTTGAAGCCATGCCCTTT 67.25 R: TCTCCAGTGGGAACGAGCAG 67.86 BIRC1b F: AAATTGCCAAGGGAGCAACC 67.03 R: GGCAGGTTGTCCAGGACTTG 66.94 BIRC1e F: GATCCTGCCAAGCCTTCCAT 67.41 R: GGTGTTCGAGGCAGCTCTCA 68.02 BIRC1f F: GGTGACGACCCAATGGAAGA 67.19 R: TCCATGGCTTCTGGAAGTGC 67.54 BIRC5 F: GGGCCTCCTAGCAGGATCTTGAG 67.98 R: GTCCACGTCACAATAGAGCAAAGC 67.71 BIRC2 F: TGGCTTGAGATGTTGGGAACC 68.24 R: CATGAACAAACTCCTGACCCTTCA 68.08

- 63 - Materials and Methods

2.6.4 Real-time quantitative PCR

Real time PCR was performed on the RG3000 Real Time PCR System

(Rotorgene), using SYBR green chemistry (JumpStart, Sigma Castle Hill, Australia; or

FastStart, Roche, Basel, Switzerland). Following reaction, fold change was calculated following the 2CT.

2.6.5 Western Blotting

2.6.5.1 Commonly used buffers

Table 2.4. Buffers for Western Blot. Name Composition Manufacturer 4x Running Gel Buffer 27.23 g Tris 1.5 M Tris-Hcl, pH 8.8 Adjust pH to 8.8 with HCl Ajax Chemicals H2O initial volume 80 mL Baxter Health Care Make up to 150 mL Baxter 4x Stacking Gel Buffer 6 g of Tris MERC 0.5 M Tris-HCl, pH 6.8 Adjust pH to 6.8 with HCl Ajax Chemicals H2O initial volume 60 mL Baxter Make up to 100 mL Baxter Blot Buffer 5.82 g Tris MERC 48 mM Tris, 39 mM 2.93 g glycine MERC Glycine, pH 6.8 3.75 mL 10% SDS 200 mL Methanol Ajax Chemicals H2O initial volume 500 mL Baxter Make up to 1 L Baxter 10x Electrode running 30.3 g Tris MERC Buffer, pH 8.3 144 g glycine MERC 10 g SDS H2O initial volume 750 mL Baxter Make up to 1 L Baxter SDS-PAGE gel Polyacrylamide Solution BioRad Deionised H2O Millipore filtered H2O 4x Running/ Stacking As described above buffer 10% SDS 10% APS (mg/ mL) Sigma TEMED BioRad APS: Ammonium persulfate; TEMED: N,N,N',N'-Tetramethylethylenediamine; SDS: Sodium dodecyl sulfate. MERC Pty. Ltd. Kilsyth, Victoria, AU.; Baxter Health Care Pty. Ltd. Toongabbie, NSW, AU.

- 64 - Materials and Methods

2.6.5.2 Protein isolation and storage

Cells were lysed using the LID buffer (~600 μL for 7•106 Min6 cells or 50 μL for 100 islets) in a 1.5 mL tube, and vortexed for 5-10 min at 4°C (in the cold room).

Samples were centrifuged at 16,000 g for 2 min at 4°C and the supernatant were transferred to a new 1.5 mL tube and stored at -20°C for later use. Pellet was washed with 100-500 μL of LID buffer, and centrifuged at 16,000 g for 2 min at 4°C.

Supernatants were carefully removed and discarded; dry pellet was stored at -20°C for later use.

2.6.5.3 Protein quantitation Samples were quantitated using the DC protein assay (BioRad) following the manufacturer’s instruction. Approximately 10-15 μg of protein was used per reaction.

2.6.5.4 Western blotting Protein samples were mixed with reducing sample buffer in a 1.5 mL tubes, with holes on the lid. Samples were boiled at 95 °C for 10 min. Samples were separated using 10 or 12% SDS-PAGE gel at 80V (constant current) for 2-3 h, until the lower band of the running buffer was at the bottom of the gel. 6 μL of Kaleidoscope prestained standards were run alongside (BioRad). Samples were then transferred on to a transfer membrane (Immobilon Transfer Membranes, Millipore Corp. Bedford, MA,

USA). Membranes were blocked with 5% skim milk powder (BioRad) in TBS-Tween

(0.01%) for 1 h at RT. Membranes were blotted with primary antibody (Table 2.5) diluted in 5% skim milk in TBS-Tween (0.01%) at 4°C overnight on an orbital shaker.

Membranes were washed for 10 minutes in TBS-Tween (0.01%) with agitation

(repeated 3 times). Samples were then incubated with the specific secondary antibody diluted in 5% skim milk powder in TBS-Tween (0.01%) with agitation for 1 h at RT.

Secondary antibody was washed 3 times with TBS-Tween (0.01%) at 10 min intervals

- 65 - Materials and Methods at RT, with agitation. Membranes were then developed in ECL (Santa Cruz

Biotechnology, Western Blotting Luminol Reagent, CA, USA) and developed using the

Chemi-luminescent sensitive CCD camera (ChemiDoc, BioRad).

2.6.6 Immuno-precipitation

Immuno-precipitation was performed using the ImmunoPure Immobilized protein A/G beads (Pierce, Rockford, USA). To begin with, 40 μL of protein beads were aliquoted into a 1.5 mL tube and washed with 600 μL of LID buffer and centrifuged at 16000 g for 30 sec. Supernatant was carefully removed, leaving only ~1-

2 mm of liquid.

Between 100-500 μg of sample was added into the protein beads and the total volume of the mixture was topped with LID buffer to at least 500 μL. Approximately 3-

10 μL of primary antibody (depending on antibody concentration) was added into the sample tube and incubated overnight on a rotating wheel at 4°C.

The next day, samples were centrifuged at 16000 g for 60 sec and the supernatant were carefully removed and discarded. Samples were then washed three times with ~500 μL of LID buffer, each time vortexed, centrifuged at 16000 g for 30 sec and the supernatant were discarded after each centrifugation. 50 μL of reducing sample buffer were then added after the last wash and well mixed with the protein beads. The sample were heated to 65°C for 5 min and then centrifuged at 16000 g for 1 min. The supernatant were carefully removed into a new 1.5 mL tube and the pellets were discarded. Each sample were separated on a 10% SDS-PAGE gel at 75 V

(constant voltage) until the gel front hit the lower part of the gel.

Subsequent procedures were performed as described in the Western Blotting section.

- 66 - Materials and Methods

2.7 HISTOLOGY

2.7.1 Tissue preparation for Histology

Islet-transplanted kidneys were collected at transplantation endpoints from recipient mice. Tissues were frozen in Tissue-Tek OCT compound immediately after isolation (Pro SciTech, QLD, AU). Sections (8 μM) were cut using a Cryostat (Leica,

Wetzlar, Germany). OCT-embedded frozen tissue sections were best used for staining on the same day that they were cut. Should this not be possible, sections were stored in aluminium foil at -80°C. In this case, it was necessary to warm the tissue sections to room temperature (RT) prior to any work to avoid condensation on the tissue.

2.7.2 Hematoxilin-eosin staining

Slides were stained with haematoxylin-eosin (H&E) for histologic examination.

Sectioned tissues were fixed with Acetone (Ajax Finechem) for 10 min and allowed to dry before staining. Tissues were re-hydrated by a 5 sec 70% EtOH bath, followed by

10 sec dH2O. Tissues were stained with haematoxylin (Lomb Scientific, Taren Pt.,

NSW, AU) for 4 min, washed in water (twice), differentiated in Acid-EtOH for 0.2 sec and was immediately washed in water. Tissues were then emersed in Scots blueing solution for 10 sec and then washed in water. Next, the tissues were stained with eosin-

Y (with EtOH) (Sigma) for 4 min, then dehydrated by bathing in 70% EtOH for 10 sec

(twice), 90% EtOH for 10 sec, 100% EtOH for 10 sec and finally, Xylene (Ajax

Finechem) for 10 min. Slides were allowed to dry before coverslips were mounted using

Eukitt mounting Solution (Calibrated Instruments Inc., Hawthorne, NY, USA.)

2.7.3 Immunohistochemistry

Liquid blocker pen (Daido Sangyo Co. Ltd., Tokyo, Japan) was used to draw a wax barrier around the tissue sections. Frozen tissue sections were fixed with 2%

- 67 - Materials and Methods

Formaldehyde/ PBS solution for 15 min in RT and washed in PBS for 5 min (3 times).

Specimens were blocked using Serum Free protein block solution (Dako Cytomation,

Sydney, NSW, AU) for 60 min in room temperature. Primary antibody diluted in PBS/

Triton was placed on the slides and incubated overnight at 4°C in a humidified chamber. Primary antibodies used are indicated in Table 2.5. The next day, specimens were washed in PBS for 5 min in RT (3 times). HRP-conjugated secondary antibody

(Table 2.5) was added diluted in PBS/ triton and incubated for 60 min at RT in humidified chamber. Next, specimens were washed in PBS for 5 min in RT (3 times).

Chromogenic substrate reagent diaminobenzidine (DAB, Zymed Laboratories, San

Francisco, CA, USA) was used to develop HRP activity. Once colour had developed, slides were rinsed in dH2O (remove all excess DAB substrates). Specimens were counterstained using 100 μL Haematoxilin (Zymed Lab.) per section for 2 min and then washed in running tap water (until all excess haematoxilin were washed away). Slides were then washed in PBS until a blue tone developed, and then washed in dH2O. Slides were de-hydrated by bathing in Acetone (company) for 5 min at RT and allowed to dry.

Once slides were dry, coverslips were mounted with Eukitt mounting solution

(Calibrated Instruments Inc.) All immunohistochemistry slides were observed under a

Leica light microscope and images were captured using a Leica DC200 camera (Leica).

- 68 - Materials and Methods

Table 2.5. Antibodies for immunohistochemistry and Western Blotting. Specificity Label Dilution Manufacturer IB (rabbit None 1:100 (IHC) Cell Signalling Technology Inc., polyclonal) 1:1000 (WB) Denver, MA, USA Insulin (rabbit None 1:100 (IHC) Cell Signalling Technology Inc. polyclonal) 1:1000 (WB) Donkey-anti- HRP 1:1000 (IHC) Pierce Biotechnology, Rockford, IL-1, Rabbit-IgG 1:5000 (WB) USA A20 (rabbit None 1:10 (IP) Prepared by Dr. Shane T. Grey at Beth polyclonal) 1:500 (IP/WB) Israel, Harvard Medical School. HIF-1 (goat None 1:100 (IP) Santa Cruz Biotechnology polyclonal IgG) 1:1000 (WB) Rabbit-anti-Goat- HRP 1:5000 (WB) Pierce Biotechnology IgG

2.8 STATISTICS

Data were analysed using “Microsoft Excel” and “StatView 4.5”. The student t- test was used to assess differences between non-parametric data groups. Log rank anaylsis of Kaplan-Meier survival curves was used to compare islet graft rejection.

Results were considered significant if p < 0.05.

- 69 -

Chapter 3 The Immediate-Early Gene Profile of Primary Mouse Islet.

3.1 INTRODUCTION

A major aim of this study is to understand the role of NF-B in the activation of immediate-early gene response in islets. In T1D, the pancreatic islet -cells are subject to an autoimmune insult resulting in -cell inflammation and death (Gepts 1965; Gepts and Lecompte 1981). Phenotypically, this is characterised by an accumulation of mononuclear cell infiltrate (Kay, Campbell et al. 1991; O'Reilly, Hutchings et al. 1991).

T1D is characterised by two distinct phases: insulitis, when a mixed population of leukocytes invades the islets; and diabetes, when a large proportion of the -cells are destroyed resulting in hyperglycaemia. During insulitis, the pancreatic infiltrates can contribute to tissue destruction through the release of inflammatory cytokines, including

IL-1, TNF- and IFN- (Dahlen, Dawe et al. 1998; Green, Eynon et al. 1998; Jun,

Santamaria et al. 1999; Jun, Yoon et al. 1999; Pakala, Chivetta et al. 1999; Thomas,

Irawaty et al. 2004). The importance of cytokines in -cell destruction and T1D has been demonstrated in a number of in vitro and in vivo studies. For instance, treatment of neutralising antibody to IL-1 or TNF- using pharmacological intervention or transgenic model, could delay or prevent disease onset in the NOD mouse model, to varying degree (Cailleau, Diu-Hercend et al. 1997; Hunger, Carnaud et al. 1997;

Thomas, Irawaty et al. 2004). In addition, IFN- KO NOD mice have a delayed onset of diabetes (Hultgren, Huang et al. 1996), and IFN- KO islets impairs diabetogenic T-cell homing (Savinov, Wong et al. 2001).

In vitro studies over the past decade demonstrated that prolonged exposure of islets to these pro-inflammatory cytokines contribute to the early perturbation of -cell

70 The Immediate-Early Gene Profile of Primary Mouse Islets function and apoptotic destruction. This could occur directly through cytokine induced mediated apoptosis, by activation of caspases (Chang, Kim et al. 2003), or indirectly through induction of deleterious pro-inflammatory genes, including inducible-Nitric

Oxide Synthase (iNOS) and Cox2, which impairs -cell function (Corbett, Kwon et al.

1993 Corbett, 1993 #142; Eizirik, Bjorklund et al. 1993; Eizirik and Mandrup-Poulsen

2001; Heitmeier, Kelly et al. 2004). In particular, the role of iNOS in the impairment of

-cell function has been well studied. Cytokine induced expression of iNOS resulted in the elaboration of Nitric Oxide (NO). NO could induce -cell dysfunction by impairing glucose sensing and insulin secretion mechanisms in -cells; whilst at the same time could also induce mitochondrial damage and eventually apoptosis (Corbett, Wang et al.

1992; Corbett, Sweetland et al. 1993a; McDaniel, Kwon et al. 1996). Importantly, the expression of these apoptotic mediators (i.e. iNOS and Cox2) were under the transcriptional regulation of NF-B (Kwon, Corbett et al. 1995; Cardozo, Heimberg et al. 2001; Darville and Eizirik 2001; Ortis, Cardozo et al. 2006). These data therefore, demonstrated the importance of -cell response to cytokine in participating in their own destruction, through activation of apoptosis and in particular the role of NF-B in this process, through gene such as iNOS.

Classically, these types of analysis have been performed using a candidate gene approach. The advent of microarray technology, which enables the ability to investigate global gene expression patterns, can provide a way to comprehensively understand dynamic changes that occur at the level of gene regulation in specific cell populations.

These approaches have begun to be used to study the effects of cytokines upon -cell biology (Cardozo, Kruhoffer et al. 2001; Eizirik and Mandrup-Poulsen 2001). To date, studies investigating the gene profile of cytokine-activated islets have focused primarily on the intermediate to late periods; i.e. from 6-24 h (Cardozo, Kruhoffer et al. 2001;

- 71 - The Immediate-Early Gene Profile of Primary Mouse Islets

Eizirik and Mandrup-Poulsen 2001). These studies provide great insight into the islet’s gene profile during inflammation. In particular, they demonstrated that inflammatory stimuli leads to the reduction of the expression of several genes related to -cell function and preservation of -cell mass, such as Glut2, insulin and glucokinase

(Cardozo, Kruhoffer et al. 2001). In addition, these studies also showed that -cells could produce a surprising array of cytokines, chemokines and other inflammatory mediators that would aid in immune cell recruitment and activation. In conclusion, these studies validated the concept emerging from single gene studies, that -cells are active participants in the inflammatory processes that lead to their demise.

In response to a pro-inflammatory milieu, many cell types mount a protective anti-apoptotic response. Indeed it was demonstrated that expression of MnSOD in human cervical carcinoma cell line ME-180S conferred resistance against TNF- mediated apoptosis, providing the first evidence for this concept (Wong, Elwell et al.

1989). It was later established that this anti-apoptotic phenotype was under the transcriptional regulation of NF-B (Beg and Baltimore 1996; Van Antwerp, Martin et al. 1996; Wang, Mayo et al. 1996). Perhaps paradoxically, NF-B appears to be in control of both pro- and anti-apoptotic responses. Given that NF-B is an immediate early transcription factor, this implies that these cell fate decisions are determined by the immediate-early gene (IEG) profile (Bach, Hancock et al. 1997). We propose that the same to be true for -cells. Thus we would predict that the set of genes within the

NF-B-dependent IEG profile would determine -cell fate; i.e. inflammation and cell death versus cellular survival.

For this reason, we examined the NF-B-dependent IEG response of -cells, due to its significance in determining cellular fate (Goto, Matsumoto et al. 1994; Zhang,

Zhu et al. 2003). This approach is an important difference to previous studies (Cardozo,

- 72 - The Immediate-Early Gene Profile of Primary Mouse Islets

Kruhoffer et al. 2001; Eizirik and Mandrup-Poulsen 2001), which focused on gene changes at later time points. Some of the observed changes would be secondary to - cell intrinsic elaboration of cytokines, thus masking the true IEG profile. To study the role of NF-B, in this context, we stimulated primary islets with known activators of

NF-B; namely the cytokines IL-1 and TNF-. We also chose these cytokines for their importance of diabetic pathogenesis (Cetkovic-Cvrlje and Eizirik 1994; Arnush,

Heitmeier et al. 1998; Dahlen, Dawe et al. 1998; Grey, Arvelo et al. 1999; Pakala,

Chivetta et al. 1999; Thomas, Irawaty et al. 2004).

Additionally, we questioned whether diabetic prone islets would have an altered gene expression profile that may be important for disease initiation and progression. For this reason we also carried out these investigations in islets from the non-obese diabetic

(NOD) mouse, a spontaneous animal model for T1D. Similar approaches studying immune cell functions in NOD versus non-autoimmune prone strains (e.g. BALB/c) has led to significant understanding of the aetiology of T1D (Wicker, Clark et al. 2005).

Our study on the IEG response of cytokine-activated islets revealed a marked increase in transcripts coding for inflammatory and pro-apoptotic genes. Intriguingly, we also found that particular inflammatory genes were more highly regulated in NOD versus BALB/c islets, indicating that NOD islets may be more sensitive to inflammatory stimuli. Finally, we also demonstrated that islets, expressed a distinct set of anti-apoptotic genes. Thus in islets, NF-B may control pro- and anti-apoptotic gene expression.

- 73 - The Immediate-Early Gene Profile of Primary Mouse Islets

3.2 RESULTS

3.2.1 Combimatrix™ Custom Array: The death-CHIP

For our study, we generated a custom microarray. We customised a total of 950 genes, with three different probes designed to target each individual gene, randomly placed throughout the chip. This custom array included probe sets targeting pro- apoptotic, inflammatory, cell cycle and survival genes. A full list of the genes included in the microarray can be found in the Appendix 1. Since the overall purpose of this microarray analysis was to determine the islet’s immediate-early stress response, with respect to apoptosis, our list of custom array genes was dubbed the “death-CHIP”.

For the experiment islets were isolated from either BALB/c or NOD mice and then separated into three groups, which were either left untreated or stimulated with the cytokines IL-1 (200 U/mL) or TNF- (200 U/mL) for 1 h (Table 3.1). Each group contained 200 freshly isolated islets. RNA was then isolated from the islets and cRNA preparation was performed for micro-array analysis or cDNA preparation for RTqPCR analysis. In order to assure the validity of the microarray analysis, each experiment was independently repeated at least three times. A total of 27 individual samples were collected for microarray analysis.

Table 3.1 Cytokine treatment. BALB/c NOD Control (n = 6) Control (n = 3) Cytokine stimulation: 1h at IL-1 (n = 6) IL-1 (n = 3) 200 U/mL in all cases. TNF- (n= 6) TNF- (n = 3)

In this chapter, islet isolation, cytokine stimulation, RNA preparation and real time PCR analysis were performed at the Garvan Institute, Sydney; microarray

- 74 - The Immediate-Early Gene Profile of Primary Mouse Islets experiments including custom chip preparation and cRNA preparation and some data analyses were performed in collaboration with Andy McShea from Combimatrix™,

Mukilteo, Wa USA. Data analysis for the microarray result (Appendix 1) was performed with the assistance of a Bioinformatics student: Louis Tsai (BE. Bsc. Garvan

Institute, UNSW). Data analysis of the BIRC family genes was performed in collaboration with a medical-honours student: Andrew Yam (Bc. Hons. Garvan

Institute, UNSW; BMed. USyd). All subsequent data analysis was performed independently at the Garvan Institute, Sydney.

3.2.2 Array Quality Control

We began our analysis by confirming the repeatability of the result from each individual microarray chip. We performed cluster analyses comparing different samples of the same treatment (eg: BALB/c IL-1 exp-1 vs BALB/c IL-1 exp-2) or comparing two arrays running the same sample (eg: BALB/c IL-1 exp-1 chip-A vs. BALB/c IL-

1 exp-1 chip-B). In this way we performed 27 pairs of replicate arrays, and found very high correlation coefficients between replicate arrays (average 0.98) (Figure 3.1 A).

Figure 3.1 B is a representative dot plot analysis demonstrating the high correlation coefficient between two chips running the same samples, thus demonstrating the high reproducibility of our microarray analysis. We also found high correlation coefficient of base-line gene expression (untreated samples) between animals of the same strain in the different experiments (Figure 3.1 C). Similar results were found for all 27 samples, supporting the consistency and reliability of our experimental approach.

- 75 - The Immediate-Early Gene Profile of Primary Mouse Islets n the control n the 0 series of 2 of 0 series (intensities) is 0.98. 0.98. is (intensities) 2 roarrays, indicating high repeatability of microarray results. 1 results. of microarray repeatability high indicating roarrays, (intensities)]. After normalisation, the pair-wise correlation coefficient between replicate arrays (from 27 pairs pairs 27 (from arrays replicate between coefficient correlation pair-wise the normalisation, After (intensities)]. 2 Figure 3.1.Quality Control analysis of the “death-CHIP” “death-CHIP” of the analysis Figure Control 3.1.Quality C. Representative scatter plot analysis between 2 un-treated animals, indicating minimal variability in islet gene expression i expression gene islet in variability minimal indicating animals, 2 un-treated between plot analysis scatter Representative C. animals. different from samples untreated between comparisons pair-wise of 6 series animals. replicate microarrays(1 series per correlation sample); the mean coefficient log of of replicate arrays) is 0.98.of is replicate arrays) mic 2 replicate between plot analysis scatter Representative B. [log Coefficient A. Correlation - 76 - The Immediate-Early Gene Profile of Primary Mouse Islets

3.2.3 Islets immediate early gene response.

Our microarray data demonstrated that cytokine-activated islets have a distinct and repeatable pattern of gene expression (Figure 3.2). Overall, we found that 44 out of the 950 gene-transcript probes on the chip were significantly up regulated. Genes were considered to be significantly induced when the average induction was > 2-fold in all experiments. The identity and log2 intensities for the induced genes are presented in a 1-

D cluster analysis in Figure 3.3.

The induced transcripts were representative of a number of diverse gene families that in general are associated with inflammatory processes. Of these 44 up-regulated genes, 47% were transcription factors and other signalling components, 30% were chemokines and cytokines, 9% were anti-apoptotic and NF-B-inhibitor elements, 7% were adhesion molecules, and 7% were from other miscellaneous families. Ranking the genes in term of magnitude of expression, revealed that chemokines were the most highly expressed gene transcripts overall (Figure 3.4 A & B). This was true regardless whether the stimulus was either IL-1 or TNF-. The most highly expressed chemokine overall was Cxcl1 (induced ~15.7-fold), followed by Ccl2 (~11.9), Cxcl2 (~10.3-fold) and Cxcl10 (~4.5-fold). Indeed chemokines were amongst the top-ten (averaged IL-1 and TNF- induction) most highly induced genes overall (p < 0.05 in all cases).

Transcripts of cytokine expression were also amongst the 44 most highly up regulated genes in the islets’ immediate-early pro-inflammatory response. Our micro-array detected an increase in transcript expression of Il6 and Tnf in the islets isolated from either the BALB/c or the NOD mice. In the IL-1 induced islets, Il6 expression increased by ~5-fold in the BALB/c islets and ~15-fold in the NOD islets. Whereas in the TNF- induced islets, Il6 expression was increased by ~4.7-fold in the BALB/c

- 77 - The Immediate-Early Gene Profile of Primary Mouse Islets islets and ~3.6-fold in the NOD islets (p < 0.05 in all cases). The gene transcript for Tnf was significantly induced, but to a much lesser intensity than that of Il6. In the IL-1 induced islet, Tnf expression increased by ~4.7-fold (p < 0.05) in the BALB/c islets and

~3.6-fold (p < 0.05) in the NOD islets; whereas in the TNF- induced islets, Tnf expression was increased by ~1.2-fold (p > 0.05) in both BALB/c and NOD islets.

Transcripts for adhesion molecules were also significantly up regulated in islets in response to both IL-1 and TNF-. Icam1 expression was increased ~8-fold in response to IL-1 and ~5-fold in response to TNF- in both BALB/c and NOD islets (p < 0.005 in all cases). Vcam1 expression was increased ~2.5-fold in the BALB/c islets and ~5.6- fold in the NOD islets in response to IL-1, and ~2.5-fold in both BALB/c and NOD islets in response to TNF-.

- 78 - The Immediate-Early Gene Profile of Primary Mouse Islets

Figure 3.2. 1D Cluster analysis of global gene array.

Hierarchical cluster analysis of all 950 genes. Each column represents change in gene expression (log2) from an individual array experiment. Red = up-regulation, green = down-regulation. (Heat map generated with help from Louis Tsai BE. Garvan Institute).

- 79 - The Immediate-Early Gene Profile of Primary Mouse Islets

Figure 3.3. 1D Cluster analysis of the top 44 genes.

Hierarchical cluster analysis of the top 44 genes. Each column represents change in gene expression (log2) from an individual array experiment. Red = up-regulation, green = down-regulation.

- 80 - The Immediate-Early Gene Profile of Primary Mouse Islets

3.2.4 Differential transcript induction between BALB/c and NOD islets.

In most cases our data demonstrated that in response to the two inflammatory cytokines, islets from BALB/c mouse responded to a similar manner to islets from NOD mice (on average 38/44 [~86%] genes in IL-1 induced cohort and 43/44 [~98%] in

TNF- induced cohort). However analysis of scatter plots comparing the fold change of gene expression for IL-1-treated BALB/c versus NOD or TNF--treated islets, revealed that the magnitude of induction was different for select genes between NOD and BALB/c islets (Figure 3.4 A & B). The chemokine Ccl2 was more highly induced in the NOD versus BALB/c islets for both IL-1 and TNF-. The transcript expression was increased ~20-fold versus ~10.7-fold for IL-1 (p < 0.05) and ~8.3-fold versus

~5.3-fold for TNF- (p < 0.05) for NOD and BALB/c islets respectively (Figure 3.6).

Some transcripts were more highly induced in the NOD islets in response to IL-1, a pattern that was not repeated with TNF- treatment. Transcripts for Ccl7, Cxcl10,

Cxcl2 and Il6 were more highly induced in NOD versus BALB/c islets. The average induction by IL-1-stimulated NOD islets across all experiments were ~6.2-fold, ~15- fold, ~21-fold and ~14.8-fold for Ccl7, Cxcl10, Cxcl2 and Il6 respectively (p < 0.05). In contrast the average induction by IL-1-stimulated BALB/c islets across all experiments were ~2.6-fold, ~4.5-fold, ~15-fold, ~3.6-fold respectively (p < 0.05). We found that NOD islets show a specific transcript profile in response to cytokines that differs to that of BALB/c islets. Our data suggests that NOD islets may have a greater sensitivity towards releasing pro-inflammatory chemokines in respond to an inflammatory insult.

- 81 - The Immediate-Early Gene Profile of Primary Mouse Islets

3.2.5 Differential transcript induction by IL-1 and TNF-.

We found that there were a significant number of differences in the magnitude of expression of the induced IEG transcripts in response to IL-1 and TNF- (Figure

3.4). Overall, IL-1 induced a larger cohort of genes (44 versus 29 for IL-1 versus

TNF- respectively), with a significant number induced to a higher intensity than that observed for TNF- (Figure 3.5). In the BALB/c cohort, ~16% (7/44) of gene transcripts were induced to a much greater intensity in response to IL-1 as compared to

TNF-. Moreover, in the NOD cohort, ~30% (14/44) of gene transcripts were induced to a greater intensity in response to IL-1 as compared to TNF-. Specifically, the transcripts for Cxcl1, Ccl2, Cxcl2 and Icam1 were induced to a greater magnitude by

IL-1 versus TNF-. Their average induction by IL-1 were ~31.3-fold and ~22.9-fold;

~10.7-fold and ~20-fold; ~15.0-fold and ~21.5-fold; ~7.9-fold and ~8.7-fold for

BALB/c and NOD islets respectively (p < 0.05) (Figure 3.5). In contrast, the average induction of these genes by TNF- were ~4.7-fold and ~3.8-fold; ~5.4-fold and ~8.4- fold; ~2.0-fold and ~2.9-fold; ~5.0-fold and ~5.0-fold for BALB/c and NOD islets respectively (p < 0.05) (Figure 3.5). Therefore islets exhibit a selective sensitivity in their responses to particular Th1 cytokines, resulting in a markedly increased pro- inflammatory profile in response to IL-1.

- 82 - The Immediate-Early Gene Profile of Primary Mouse Islets

Figure 3.4. Scatter plot analysis of average gene induction of the top 44 up- regulated genes from all experiments.

Average gene transcript (fold change) for the top 44 most up regulated genes were correlated using scatter plot analysis.

- 83 - The Immediate-Early Gene Profile of Primary Mouse Islets

Figure 3.5. Average gene induction of the 44 up-regulated genes from all experiments.

Average transcript induction of top 44-genes.

- 84 - The Immediate-Early Gene Profile of Primary Mouse Islets

3.2.6 Microarray data validation by RTqPCR.

To provide independent validation of our microarray results, we repeated the experimental protocol, treating isolated islets with IL-1 for 1 h, and harvested RNA to analyse gene expression by RTqPCR. For this analysis, we chose the four most highly expressed genes overall, being Cxcl1, Ccl2, Cxcl2 and Tnfaip3/A20 (Section 3.2.9), as well as Tnf, Il6 and Cxcl10. As demonstrated in Figure 3.6 the chemokines: Cxcl2,

Ccl2, Cxcl1 and Cxcl10 as well as the cytokines Tnf and Il6 were significantly up regulated in response to the cytokine IL-1. In all cases, we found that these independently conducted experiments, where gene expression was analysed by

RTqPCR, confirmed the microarray data.

Figure 3.6. RTqPCR confirmation of death-CHIP.

RTqPCR confirmation of pro-inflammatory cytokines & chemokines expression in primary islets in vitro, in response to 200 U/ mL IL-1 for 1 h. Data represents mean ± SD from three independent experiments.

- 85 - The Immediate-Early Gene Profile of Primary Mouse Islets

3.2.7 A critical role for NF-B in the immediate early pro-inflammatory

response.

One of the questions of this thesis is to determine the role of NF-B in -cell biology. For this reason we have been examining the IEG response of islets following activation by IL-1 and TNF-, cytokines known to activate NF-B (Cnop, Welsh et al.

2005). However, IL-1 and TNF- can activate other signalling pathways, including

JNK1, p38 and MAPK2 pathways (Ammendrup, Maillard et al. 2000; Papa, Bubici et al.

2006). Therefore, we wanted to determine to what extent the induction of the transcripts we observed in islets, was due to activation of NF-B, versus these other pathways.

To test whether NF-B is involved in the regulation of the islet’s IEG response, we blocked NF-B activity by using the chemical inhibitor PDTC (Kwon, Corbett et al.

1995). For the experiments, islets were treated with IL-1 (200 U/mL) for 1 h, with or without PDTC pre-treatment (10, 50 & 100 μM). As we expected from our microarray data, we found that transcripts for Cxcl1, Ccl2, Cxcl2, Cxcl10, Tnf and Il6 were highly induced by IL-1 treatment (Figure 3.7). In contrast, we found that PDTC pre-treatment dose-dependently inhibited transcript expression. Indeed, at a concentration of 100 M

PDTC, the cytokine-induced expression of chemokines and cytokines were reduced by

90 % (p < 0.005) (Figure 3.7). These data demonstrated that NF-B has a significant role in regulating islets’ immediate-early pro-inflammatory response.

1 JNK: Jun N-terminal Kinase 2 Mitogen-activated Protein Kinase

- 86 - The Immediate-Early Gene Profile of Primary Mouse Islets

Figure 3.7. Islet’s early-immediate pro-inflammatory gene response is NF-B dependent.

Chemokine and cytokine mRNA expression in primary islets stimulated with IL-1 (200 U/ mL) for 1h with (10-100 M) or without PDTC pre-treatment. Data represents mean ± SD from three independent experiments. All differences are significant (P 0.05). CTRL = non-treated.

- 87 - The Immediate-Early Gene Profile of Primary Mouse Islets

3.2.8 The immediate-early gene response includes transcripts for anti-

apoptotic genes.

Emerging evidence suggests that NF-B can regulate both pro- and anti- apoptotic responses. This implies that these cell fate decisions are determined by the

IEG response (Bach, Hancock et al. 1997). We wanted to determine whether this paradigm was true for -cells. To achieve this, anti-apoptotic genes from all known and putative anti-apoptotic gene families were included on the death-CHIP (APPENDIX 2).

In this way, we could determine whether inflammatory and anti-apoptotic responses were co-ordinately regulated by NF-B. Indeed we found that as well as up regulating pro-inflammatory genes (Section 3.2.3), the IEG response included transcripts for anti- apoptotic genes. However, in contrast to the broad number of induced inflammatory transcripts (Figure 3.3), examination of the anti-apoptotic gene expression profile following cytokine stimulation indicated that islets have a relatively sparse immediate early anti-apoptotic gene response (Figure 3.8). Establishing a two-fold cut off for statistical significance, only two anti-apoptotic genes were determined to be up regulated, namely, TNFAIP3/A20 and BIRC3/c-IAP-2, of which A20 was consistently the most highly regulated anti-apoptotic gene (Figure 3.9 A & B). It is interesting to note, that A20 was the fourth most highly expressed gene overall, whereas Birc3 was in the top-ten most expressed genes, ranked ninth (Figure 3.5).

Interestingly, in contrast to the inflammatory genes described in Section 3.2.3, there was no difference in the magnitude of anti-apoptotic gene expression in NOD versus BALB/c islets for either cytokine treatment (Figure 3.9 A). However, we did observe a difference in the magnitude of gene expression in both genes with regard to

IL-1 versus TNF- stimulation. For example, A20 was induced ~13.8-fold versus

- 88 - The Immediate-Early Gene Profile of Primary Mouse Islets

~5.6-fold in NOD islets, by IL-1 and TNF- respectively (p < 0.05). A similar trend was seen for Birc3, which was induced ~5.3-fold versus ~3.4-fold in NOD islets, by IL-

1 and TNF- respectively (p < 0.05) (Figure 3.9 A). Thus these data demonstrates that the islets’ immediate-early gene response includes transcripts for anti-apoptotic genes.

- 89 - The Immediate-Early Gene Profile of Primary Mouse Islets

Figure 3.8. 1D Cluster analysis of anti-apoptotic genes.

63 anti-apoptotic genes included in “Death Chip”; three probes per genes; probe with the highest expression level was selected. Red= up-regulation; Green = down regulation.

- 90 - The Immediate-Early Gene Profile of Primary Mouse Islets

ratios) mean ± SD from from SD ± mean ratios) 2 lumn representslumn an individualOnly A20 and BIRC3 array. s. Data represents average(log fold change < 0.001). p

at least three independent experiments. three at least independent experiments. B. Fold gene expression changes in for each co A20 and BIRC3, ( significant were Figure 3.9. Islets have a limited set of anti-apoptotic genes. of anti-apoptotic set limited have a Figure 3.9. Islets anti-apoptotic gene highly expressed 10 most A. Top

- 91 - The Immediate-Early Gene Profile of Primary Mouse Islets

3.2.9 Islets exhibit a specific immediate-early anti-apoptotic gene response.

To confirm the findings of the death-CHIP we performed a series of independent experiments in which islets were treated with IL-1 or TNF- and the expression of the anti-apoptotic genes TNFAIP3/A20 and BIRC3/c-IAP-2 were analysed by RTqPCR. In this analysis we examined the expression of BIRC family members, enabling us to confirm both induced and non-induced transcripts from the microarray. We found that

A20 mRNA was highly induced by both IL-1 and TNF- (Figure 3.10). Moreover, we found that A20 was more highly induced by IL-1 versus TNF- confirming the microarray data (Figure 3.10 A). In this way, A20 clusters with the subset of transcripts that were more highly regulated by IL-1 versus TNF- (Figure 3.4 C). In Chapter 4, we will examine the expression and regulation of A20 in more detail, but in brief, we demonstrate that A20 expression is regulated by NF-B.

We found that BIRC3 was also induced in response to either IL-1 or TNF-, but in contrast to A20, did not show differential regulation with respect to its magnitude of induction by these cytokines. There are eight genes in the Birc family and we found that of these, only Birc3 was specifically regulated by these cytokines (Figure 3.10 B).

These RTqPCR data confirm the selective regulation of the Birc family genes indicated by our microarray.

- 92 - The Immediate-Early Gene Profile of Primary Mouse Islets . in vitro in primary islets gene expression in gene expression RTqPCR confirmation of anti-apoptotic confirmation anti-apoptotic RTqPCR of

Figure 3.10. RTqPCR confirmation of anti-apoptotic gene induction. induction. gene anti-apoptotic of confirmation RTqPCR 3.10. Figure or more independent experiments. (* p < 0.05) experiments. (* Data representsindependent mean more ± SD from or three

- 93 - The Immediate-Early Gene Profile of Primary Mouse Islets

3.3 DISCUSSION

In response to a pro-inflammatory stimuli, the IEG response of many cell types includes protective anti-apoptotic genes, which are dependent upon NF-B for their induction (Beg and Baltimore 1996; Van Antwerp, Martin et al. 1996; Wang, Mayo et al. 1996). To test if this was true for -cells, we examined their IEG profile following cytokine stimulation and determined the role of NF-B in the induction of genes regulating inflammation and cell death versus cellular survival. We show for the first time, a global map of the immediate-early pro-inflammatory gene profile of cytokine- activated islets. We demonstrate that islets were capable of rapidly taking up a decisive pro-inflammatory phenotype. In addition, we also found that islets had a specific immediate-early anti-apoptotic response. Emerging evidence suggests that NF-B can regulate both pro- and anti-apoptotic responses. Our data demonstrates that the islets’

IEG includes transcripts for both pro-inflammatory and anti-apoptotic genes.

In this present study, we found that cytokine stimulation induced a total of 44 genes as part of the IEG response of islets. Of these > 80% are involved with inflammation. We found that chemokines were amongst the most highly expressed transcripts in the IEG profile. Islet-intrinsic chemokine expression can play a significant role during insulitis and in the context of islet graft rejection (Frigerio, Junt et al. 2002;

Piemonti, Leone et al. 2002). We found that in cytokine-activated islets the chemokine

Ccl2 and 7 were a part of IEG-profile. The chemokine CCR2 is a receptor for Ccl2, 7 and 13, which are potent chemo-attractants for macrophages, immature DC, NK cells and activated T-cells (Luster 2002). Interestingly, inhibition of one or more of these chemokine receptors, in transgenic knockout animals or islet transplantation model resulted in either protection or delayed disease onset and prolonged islet graft survival

- 94 - The Immediate-Early Gene Profile of Primary Mouse Islets

(Abdi, Smith et al. 2002; Piemonti, Leone et al. 2002; Lee, Wang et al. 2003; Abdi,

Means et al. 2004; Morimoto, Yoneyama et al. 2004; Schroppel, Zhang et al. 2004).

We also found that cytokines and adhesion molecules were also amongst the most highly expressed transcripts in the IEG profile. In response to IL-1 or TNF-, islets could induce the expression of IL-6 and TNF-. Previous studies demonstrated

IL-6 induction in vitro in response to IFN- and TNF- (Campbell, Cutri et al. 1989) and in vivo in the insulitic lesion (Pilstrom, Bjork et al. 1995). IL-6 may synergise the deleterious effect of pro-inflammatory cytokines (such as IL-1) to inhibit islet function

(Sandler, Bendtzen et al. 1990). The role of TNF- in -cell inflammation and destruction has been well established (Dahlen, Dawe et al. 1998; Pakala, Chivetta et al.

1999). TNF- is important for the activation of T-cells in diabetes (Green and Flavell

1999), but also of interest for our study, TNF- is also able to directly activate the caspase pathway to induce -cell apoptosis (Karin and Lin 2002; Chang, Kim et al.

2003). Whilst the expression of these cytokines may have primarily originated from resident macrophages present in the pancreas (Kolb, Burkart et al. 1990; Arnush,

Scarim et al. 1998), ductal cells and islet vascular endothelial cells have also been demonstrated to express pro-inflammatory cytokines (Matsuda, Omori et al. 2005). It is interesting to note that islets can elaborate pro-inflammatory cytokines, which indicates that -cells have the potential to further exacerbate T-cell activation and perhaps trigger their own apoptotic destruction.

We also found that in response to IL-1 or TNF-, islets could induce the expression of Icam1 and Vcam1. The expression of adhesion molecules by cytokine- activated islets may accommodate homing of cellular infiltrate into the site of inflammation. Our study supported previous work demonstrating the expression of

- 95 - The Immediate-Early Gene Profile of Primary Mouse Islets adhesion molecules in NOD islets; but only after infiltration by mononuclear cells

(Martin, Hibino et al. 1996).

Pioneering studies demonstrated that the cytokines IL-1 with IFN-, could drive islet apoptosis through an NF-B-dependent iNOS expression and subsequent elaboration of NO (Corbett, Kwon et al. 1993; Corbett, Sweetland et al. 1993a; Corbett,

Sweetland et al. 1993b; Kwon, Corbett et al. 1995; Eizirik, Flodstrom et al. 1996;

Kwon, Corbett et al. 1998). These investigations provided the first evidence that -cells could participate in their own destruction. Our data suggests that in the early stages of an inflammatory insult (such as that from cytokines) -cells would commit rapidly to a pro-inflammatory gene profile, potentially contributing to the further activation and recruitment of immune cells. These data together with previous reports, supports the notion that -cells can be active players in the aetiology of T1D, through expression of these pro-inflammatory IEG-response (McDaniel, Kwon et al. 1996; Cardozo,

Kruhoffer et al. 2001).

We found in our array, that IL-1 could significantly induce a greater number of gene expression and to a greater intensity than TNF-. Whilst one may argue that this could be associated with the islet’s response to differential cytokine dosage, our experiments were designed to use excess cytokine concentrations so as to induce maximal gene expression. At the concentration used in this study both cytokines could independently induce IB degradation in islets in vitro. Interestingly, other studies have also demonstrated that distinct patterns of gene expression can occur following

NF-B activation by different cytokines. These distinct patterns may relate to signaling pathway-specific mechanisms that resulted in alternate activation of IKK or IB proteins (Thompson, Phillips et al. 1995; Werner, Barken et al. 2005). Although the

- 96 - The Immediate-Early Gene Profile of Primary Mouse Islets regulation of NF-B-dependent genes in -cells has not been explored in detail, our study raises the possibility of similar regulatory mechanisms in -cells.

Our array data demonstrates that islets from NOD mice have a significantly greater intensity of expression for a select set of transcripts as compared to islets from

BALB/c mice. Intriguingly, these transcripts encoded chemokines and the cytokine IL-

6. These results hint at the possibility that -cell-intrinsic responses, may play a role in

T1D pathogenesis. However, none of the transcripts that were more highly expressed in

NOD islets mapped to any of the known Idd loci, suggesting that their differential expression patterns are unlikely to be related to the genetics of T1D. Though in support of our studies, other groups have demonstrated the release of several different chemokines, at different stages of islet maturation, in NOD mice in vivo (Bouma,

Coppens et al. 2005). Interestingly, this study, like ours, displayed a startling contrast between chemokine expression in NOD islets and BALB/c islets (Bouma, Coppens et al. 2005). In future, to further investigate this phenomenon, the difference between IEG- expression profiles in the NOD islets versus BALB/c islets should be confirmed using

RTqPCR as well as laser capture microdissection technology.

Significantly, our data demonstrated that the IEG response of islets includes transcripts for anti apoptotic genes. However, of the 44-IEG transcripts, only two encoded anti-apoptotic genes, of which A20 was the highest induced with Birc3 being the second. A20 is a zinc-finger protein, first cloned from cytokine-activated endothelial cells, and later shown to have a dual anti-apoptotic and anti-inflammatory function

(Opipari, Boguski et al. 1990; Opipari, Hu et al. 1992; Ferran, Stroka et al. 1998; Lee,

Boone et al. 2000). This dual anti-apoptotic and anti-inflammatory function is preserved in -cells (Grey, Arvelo et al. 1999; Grey, Longo et al. 2003). BIRC3 is a member of the Baculovirus inhibitors of apoptosis (IAPs) family. Birc family proteins were

- 97 - The Immediate-Early Gene Profile of Primary Mouse Islets originally cloned from insect cells and shown to prevent cell death. Subsequently, Uren et al. isolated cDNAs encoding 3 human IAP homologs, and to date 8 family members are recognised including splice variants (Uren, Pakusch et al. 1996; Salvesen and

Duckett 2002). Other studies have demonstrated an anti-apoptotic role for BIRC genes in islets, especially XIAP (x-linked inhibitor of apoptosis) (Emamaullee, Liston et al.

2005; Emamaullee, Rajotte et al. 2005; Emamaullee and Shapiro 2006).

This present study is the first to demonstrate that A20 and BIRC3 are components of the IEG in islets. Thus, in response to cytokines, the IEG response of islets includes not only pro-inflammatory transcripts but also protective anti-apoptotic genes, which are dependent upon NF-B for their induction (Beg and Baltimore 1996;

Van Antwerp, Martin et al. 1996; Wang, Mayo et al. 1996). The co-ordinate regulation of pro-inflammatory and anti-apoptotic genes, suggests that NF-B plays a complex role in regulating cytokine responses in -cells. Indeed our data raises the possibility that rather than being detrimental to -cell survival and function, NF-B may play a pro-survival role in -cell biology. This concept will be explored further in chapters 4 and 5.

- 98 -

Chapter 4 The Expression and Regulation of A20

4.1 INTRODUCTION

One major aim of this thesis is to investigate the islet’s immediate-early anti- apoptotic gene response, and its relationship to NF-B. In Chapter 3 we demonstrated that NF-B is responsible for the activation of an immediate-early gene (IEG) response, characterised by the up-regulation of pro-inflammatory and -cell toxic genes, by the cytokines TNF- and IL-1. Our results are consistent with other studies demonstrating the pro-inflammatory and pro-apoptotic role of NF-B in -cells (Giannoukakis, Rudert et al. 2000; Eizirik and Mandrup-Poulsen 2001; Heimberg, Heremans et al. 2001;

Lamhamedi-Cherradi, Zheng et al. 2003; Eldor, Yeffet et al. 2006; Kim, Millet et al.

2007).

We also demonstrated, that these same cytokines induced the expression of anti- apoptotic genes. In contrast to the broad profile of pro-inflammatory genes expressed, there was a restricted immediate early anti-apoptotic gene response, with A20 being the most highly expressed anti-apoptotic gene. In other cell types A20 has complementary bimodal functions, as an anti-inflammatory gene through inhibition of NF-B and an anti-apoptotic gene through inhibition of caspase activation (Daniel, Arvelo et al. 2004;

Wertz, O'Rourke et al. 2004). Interestingly, A20 is also an NF-B dependent gene, thus functions primarily as a downstream feedback mechanism to control NF-B activation

(Krikos, Laherty et al. 1992). This raises the paradox that in -cells NF-B is responsible for the regulation of both pro-inflammatory and pro-apoptotic as well as anti-apoptotic and anti-inflammatory genes.

99 The Expression and Regulation of A20

This paradox raises important questions given the significance of apoptosis in the context of -cell biology. Apoptosis or programmed cell death is a genetically controlled mechanism by which cells commit suicide (Vaux, Haecker et al. 1994; Green

1998). Apoptosis is the physiological process for cell deletion in normal, reorganising or involuting tissue and is required for shaping of the endocrine pancreas (Scaglia,

Smith et al. 1995; Scaglia, Cahill et al. 1997). Aside from its role in normal cell biology, -cell apoptosis has been implicated in the pathophysiology of T1D both at its initiation phase and as the final effector mechanism (Mathis, Vence et al. 2001; Cnop,

Welsh et al. 2005). Evidence from the NOD mouse (Delovitch and Singh 1997) indicates that auto-reactive cytolytic T-lymphocytes (Tisch and McDevitt 1996), as well as soluble mediators including pro-inflammatory cytokines and free radicals, contribute to increased -cell apoptotic destruction during the pathogenesis of T1D (Chapter 3 and

(Corbett, Kwon et al. 1996; Cnop, Welsh et al. 2005)).

Transplantation of islets is considered to be one potential approach that could restore normal metabolic control for the cure of T1D. However, islet transplants face multiple obstacles, including cellular rejection akin to the mechanisms involved in autoimmune destruction of -cells, but also primary non-function, a phenomena related to lack of nutrients, hypoxia, and non-specific inflammatory mediators (Weir and

Bonner-Weir 1997; Lechler, Garden et al. 2003; Ricordi and Strom 2004). Importantly, islet transplants are subject to allogeneic rejection, due to the HLA mismatch between the donor tissue and the recipient’s immune system (Ricordi and Strom 2004).

Apoptosis begins within hours of transplantation, and peaks at about days 2-3 then diminishes until ~days 14 (allowing the graft to stabilise) (Davalli, Scaglia et al. 1996;

Moritz, Meier et al. 2002). Nonetheless, islet grafts remain susceptible to subsequent immunological attack (Rabinovitch and Suarez-Pinzon 1998).

- 100 - The Expression and Regulation of A20

Apoptosis is an important mechanism of -cell death, during the pathogenesis of

T1D as well as islet graft rejection. NF-B is considered to be a major player in this process (Cetkovic-Cvrlje and Eizirik 1994; Kwon, Corbett et al. 1995; Kwon, Corbett et al. 1998; Cardozo, Heimberg et al. 2001; Cardozo, Kruhoffer et al. 2001; Heimberg,

Heremans et al. 2001; Eldor, Yeffet et al. 2006) and therefore presents as a potential therapeutic target for the protection of islets (Heimberg, Heremans et al. 2001). Our microarray results from Chapter 3 raised the paradoxical possibility that NF-B also regulates -cell protective responses. This Chapter will explore the role of NF-B in regulating anti-apoptotic genes in more detail.

- 101 -

4.2 RESULTS

4.2.1 -cells have an inducible anti-apoptotic response.

Despite the importance of cell death in pathological -cell loss, little is known about the genetic control of apoptosis in these cells. Cell death is a highly regulated event, controlled in a pro-inflammatory setting by an inducible set of anti-apoptotic genes rapidly up-regulated in response to this same inflammatory stress and/or injury

(Beg and Baltimore 1996; Van Antwerp, Martin et al. 1996; Wang, Mayo et al. 1996;

Bach, Hancock et al. 1997). We were particularly interested to determine whether - cells and perhaps whole islets could also generate a rapid and inducible anti-apoptotic response after exposure to inflammatory cytokines as has been described for other cell types (Beg and Baltimore 1996; Van Antwerp, Martin et al. 1996; Wang, Mayo et al.

1996). We tested this concept by stimulating -insulinoma cells (-TC3) with TNF- in the presence or absence of the general transcription inhibitor, actinomycin-D. Blockade of de novo gene transcription in combination with TNF- stimulation sensitised -TC3 to cell death, whereas either treatment alone had minimal effect upon cell survival

(Figure 4.1). Cell survival decreased from 100% in control cells to 53% when cells were treated with 1000 U/mL TNF- and actinomycin-D (p < 0.001). These data demonstrate that blockade of de novo gene transcription sensitises -cells to TNF-- induced cell death, consistent with the notion that TNF- triggers a pro-apoptotic death cascade which can be blocked by gene induction (Beg and Baltimore 1996; Van

Antwerp, Martin et al. 1996; Wang, Mayo et al. 1996). This data demonstrates that - cells do have a cytokine-dependent regulated anti-apoptotic response as has been demonstrated for other cell types.

102 The Expression and Regulation of A20

Figure 4.1. -cells have an inducible anti-apoptotic response.

Survival of -TC3 treated with increasing concentrations of TNF-, with (black) or without (white) Actinomycin-D. Data represents percentage survival, mean ± SD from four independent experiments, performed in duplicate. Data with 500U and 1000U are significant (** p < 0.005).

4.2.2 Regulation of A20 in rodent islets.

As A20 was the most highly regulated early immediate anti-apoptotic gene in islets (demonstrated in Chapter 3), we focused on its regulation in more detail. Primary islets isolated from BALB/c or NOD mice were stimulated with the cytokines IL-1 or

TNF- for 1-8 hr, and steady state mRNA expression was analysed by PCR. As shown in Figure 4.2 A, A20 expression was up regulated by ~23-fold (p < 0.005) and ~16-fold

(p < 0.001) in BALB/c and NOD islets respectively within 1 hr post IL-1 stimulation.

Kinetic analysis of A20 expression revealed that though the expression declined thereafter it was still maintained at significantly increased levels at 4 and 8 h. Thus, A20 is a cytokine-inducible immediate early response gene in islets, consistent with its regulation in other cell types (Opipari, Boguski et al. 1990). In comparison to IL-1,

- 103 - The Expression and Regulation of A20

TNF- was a less effective inducer of A20 expression, stimulating only a ~4-fold increase in A20 mRNA expression at 1 hr for islets isolated from either BALB/c or

NOD mice (p < 0.05). This may relate to differential activation of NF-B pathways by

IL-1 versus TNF- respectively, which can then lead to distinct patterns of gene expression (Werner, Barken et al. 2005). The poor induction of A20 by TNF- is interesting, given the fact that TNF- is one of the earliest -cell-toxic cytokines detected in the islet infiltrate during the development of T1D in NOD mice (Dahlen,

Dawe et al. 1998). However, Figure 4.2 B shows that there was no difference in A20 expression between the male and female NOD mice, demonstrating that the lower disease incidence in the male NOD mice is not associated with A20 expression.

4.2.3 Regulation of A20 in human islets.

We next examined A20 regulation in primary human islets. As shown in Figure

4.2 C, A20 mRNA expression was rapidly induced following IL-1 stimulation, reaching a maximal ~25-fold induction at 1 hr post stimulation and decreasing thereafter. Again IL-1 was a more potent inducer of A20 expression than TNF-. In contrast to IL-1 and TNF-, other Th1-type cytokines such as IFN- and IL-15, and the Th2-type cytokines IL-4 and IL-13 did not induce A20 expression in human islets

(Figure 4.2 D). Together, these data demonstrate that A20 is an immediate early response gene in both human and rodent islets and that A20 is preferentially regulated by the Th1-type cytokines, IL-1 and TNF-.

- 104 - The Expression and Regulation of A20

Figure 4.2. A20 is an immediate early response gene in -cells.

Real time PCR analysis of human or rodent islets in response to cytokine stimulation. Data are presented as fold change versus untreated control. A. A20 expression in BALB/c (white) or NOD (black) islets treated with IL-1 or TNF-. Data represents mean ± SD from three independent experiments. B. A20 expression in Male (white) or female (black) NOD islets, stimulated, with IL-1 or TNF- for 1hr. Data represents mean ± SD form three independent experiments. C. A20 expression in primary Human islets treated with IL-1 (white) or TNF- (black). Data represents mean ± SD from four independent experiments. All differences are significant (p < 0.05). D. A20 expression in primary Human islet treated with IFN-, IL-4, IL-15 or IL-13. Data represents mean ± SD from two independent experiments. All differences are NOT significant (p > 0.05). - 105 - The Expression and Regulation of A20

4.2.4 A20 protein is highly regulated in -cells.

To investigate the regulation of A20 protein in -cells we stimulated the insulinoma cell line, Min6 with IL-1. A20 protein was immuno-precipitated at the periods between 15 min and 16 h. Consistent with the RNA expression A20 protein is highly induced after 2 h and its expression returned to basal level approximately 8 h after cytokine stimulation (Figure 4.3).

Figure 4.3. A20 protein expressed in primary mouse islets in vitro.

Primary islets were stimulated with IL-1 for increasing time points as indicated. Cytoplasmic protein extract were immuno-precipitated with A20 Ab and separated on polyacrylamide gel for detection with A20 Ab using western blot. Representative blot of three independent experiments.

- 106 - The Expression and Regulation of A20

4.2.5 -cell specific expression of A20 in islets.

Islets of Langerhans are a heterogeneous tissue comprising not only insulin secreting -cells, but additional hormone secreting cells including -, - and endothelial cells. -cells from freshly isolated islets are autofluorescent due to intracellular flavin adenine dinucleotide levels and can be FACS-purified on this basis (Pipeleers, in't Veld et al. 1985). To determine the cellular source of A20 expression in intact primary islets, we next examined A20 expression in FACS-purified primary -cells and non--cells

(Figure 4.4 A). We found that inducible A20 expression was restricted to insulin- positive -cells (~3-fold induction p < 0.05) as A20 expression was not induced by IL-

1 in glucagon-positive cells (Figure 4.4 B). The lower intensity of A20 expression in

-cells alone was a result of the time required between islet stimulation, cellular dispersion and cell separation, at the end of which took approximately 4-5 h after the initial cytokine stimulation. We also examined inducible A20 expression in the insulinoma cell line, Min6. Stimulation of Min6 cells with IL-1 or TNF- resulted in a rapid and marked induction of A20, with a kinetic similar to that seen for primary human and rodent islets (Figure 4.4 C). Thus these data demonstrate -cell specific regulation of A20 expression within pancreatic islets.

- 107 - The Expression and Regulation of A20 A20 A20 C. (white) cells. cells. (white) Lo (insulin negative, glucagon (insulin negative, glucagon Lo for 1h, dispersed into single cells and cells into single dispersed 1h, for < 0.05) but not in FL-1 not in but 0.05) < P (black) cells (* cells (black) Hi in FL-1 in -cells. -cells. (insulin positive, glucagon negative) and FL-1 glucagon negative) and (insulin positive, (black) stimulation. Data represents mean ± SD from four independent independent four from SD ± mean represents Data stimulation. (black) Hi p < 0.05). -cells. Primary islets were stimulated with IL-1 with stimulated were islets Primary -cells. or TNF-  or A20 expression was induced by IL-1 induced by was A20 expression A20 expression in FACS-sorted primary FACS-sorted primary in A20 expression expression in Min6 cells following IL-1 following cells in Min6 expression ( experiments. were significant All differences positive) cells. B. cells. positive) FACS-sorted based on autofluorescence into FL-1 on autofluorescence FACS-sorted based A. Figure 4.4. A20 is expressed in insulin-producing in insulin-producing expressed is A20 4.4. Figure

- 108 - The Expression and Regulation of A20

4.2.6 Cytokine-dependent regulation of A20 requires de novo gene

transcription.

We next began to address the mechanism(s) by which A20 was regulated in islets. Primary mouse islets (BALB/c) were pre-treated with actinomycin-D (5 μM, 1 h) to block de novo gene transcription and then stimulated with IL-1 for 1 h. Analysis of

A20 steady state mRNA revealed that induction of A20 was completely abolished

(>90%, p < 0.001) by actinomycin-D treatment indicating that in islets, cytokine- dependent induction of A20 is regulated at the level of de novo gene transcription

(Figure 4.1 A). To confirm that A20 was regulated at the level of transcription, -TC3 cells were transfected with an A20 promoter sequence upstream of a luciferase reporter and stimulated with IL-1 or TNF-. As shown in Figure 4.5 C, IL-1 and TNF- induced a ~4-fold (p < 0.001) and ~2-fold (p < 0.01) increase in luciferase activity respectively. Together these data demonstrate that A20 is regulated at the level of gene transcription in -cells, and prevention of A20 expression by inhibition of gene transcription correlated with sensitisation to TNF--induced apoptosis.

- 109 - The Expression and Regulation of A20

Figure 4.5. A20 is regulated at the level of transcription by NF-B.

A. A20 expression in BALB/c islets treated with IL-1 for 1hr with or without Actinomycin D. Data represents mean ± SD of two independent experiments. B. A20 promoter sequence indicating deleted NF-B binding sites used for reporter studies.

C. Induction of the native (white) or NF-B (black) A20 reporter in -TC3 by IL-1 or TNF-. Data represents mean ± SD from a representative experiment of three independent experiments conducted. All differences are significant (*p < 0.05, ** p < 0.001)

- 110 - The Expression and Regulation of A20

4.2.7 NF-B is both necessary and sufficient to initiate transcriptional

activation of the A20 promoter.

A20 has been previously described to be an NF-B-target gene, and contains two NF-B binding sequences in its promoter region (Krikos, Laherty et al. 1992). To determine whether or not the induction of A20 transcription in -cells is NF-B dependent, we transfected -TC3 cells with an A20 promoter construct in which the two

NF-B binding sites were deleted (NF-B) (Figure 4.5 B), and examined its activation in response to either IL-1 or TNF-. As shown in Figure 4.5 C, compared to the wild type promoter, both the cytokine-dependent and constitutive A20 promoter activity was completely abrogated (p < 0.001) in the NF-B deleted reporter.

We next utilised an alternative approach to confirm the importance of NF-B in the regulation of de novo transcription activity of the A20 promoter construct. We achieved this by over expressing the p65/RelA subunit of NF-B (Karin and Lin 2002) in -TC3 cells and examined whether this would result in induction of the A20 promoter. As shown in Figure 4.6 A, forced-expression of p65/RelA resulted in a marked dose-dependent activation of the A20 promoter, showing a ~19-fold increase (p

< 0.001) at the highest concentration tested. Importantly, forced-expression of p65/RelA also resulted in a 5-fold induction (p < 0.005) in endogenous A20 mRNA levels, indicating that NF-B was sufficient to drive the endogenous A20 promoter

(Figure 4.6 B). Finally, inhibition of NF-B activity using the chemical inhibitor, PDTC

(Kwon, Corbett et al. 1995), abolished IL-1-stimulated A20 mRNA (>90%, p < 0.01) expression in islets (Figure 4.6 C). Together these data demonstrate that NF-B is both necessary and sufficient to initiate transcriptional activation of the A20 promoter and drive expression of A20 mRNA. These data are consistent with our finding that A20 is

- 111 - The Expression and Regulation of A20 regulated by the NF-B-activating cytokines IL-1 and TNF-, but not cytokines such as IFN-, IL-4, IL-13 and IL-15, which do not activate NF-B.

Figure 4.6. NF-B is necessary and sufficient to drive de novo A20 expression.

A. Induction of endogenous A20 mRNA in -TC3 by P65/RelA. Data represents mean ± SD from a representative experiment of three independent experiments conducted.

B. Induction of the A20 reporter in -TC3 by p65/RelA. Data represents mean ± SD from a representative experiment of three independent experiments conducted. C. A20 expression in BALB/c islets treated with IL-1 for 1hr with or without PDTC. Data represents mean ± SD of three independent experiments. All differences are significant (*p < 0.05, ** p < 0.01, *** p < 0.001).

4.2.8 A20 transcription is regulated by multiple NF-B signalling

pathways.

NF-B constitutes a family of transcription factors that together act as major integrators of the cellular inflammatory response (May and Ghosh 1998; Karin and Lin

2002). Activation of discrete NF-B pathways through the Toll-like receptors (TLR),

Tumor Necrosis Factor receptors (TNF-R), or via free radicals results in the induction of a distinct sets of genes (Karin and Lin 2002; Storz and Toker 2003; Werner, Barken et al. 2005). To determine which NF-B pathways regulate A20 expression in -cells, - 112 - The Expression and Regulation of A20

we utilised a transient transfection approach, co-transfecting -TC3 cells with the A20- reporter and specific kinases or adapter proteins, known to activate distinct NF-B signalling pathways. The TNF-receptor-associated factor 6 (TRAF6) is an adaptor protein required for NFB signalling through the TLR family, whereas TRAF2 mediates NF-B signalling through the TNF-R family. As shown in Figure 4.7 A & B, forced-expression of either TRAF6 or TRAF2 dose-dependently activated the A20 promoter with an ~9-fold (p < 0.001) and ~6.5-fold (p < 0.001) increase in reporter activity at the highest concentrations used respectively. Thus we demonstrate that A20 is a downstream target gene of the canonical NF-B pathway, activated via ligation of

TLR and TNF-R family receptors. These data are consistent with our experiments demonstrating increased A20 expression in IL-1 (TLR-activating) and TNF- (TNF-

R-activating) stimulated -cells.

We next addressed whether A20 would be regulated in response to the non- canonical and free radical-dependent pathways. The NF-B-inducing Kinase (NIK), is critical for mediating signalling through the non-canonical TNF-R pathway (Karin and

Lin 2002), whereas free radicals activate NF-B through a PKD-dependent signalling pathway (Storz and Toker 2003). To determine whether A20 is a target gene of these pathways, we co-transfected -TC3 cells with the A20-promoter and either NIK or PKD

(Figure 4.7 C & D). Forced-expression of NIK resulted in a ~3.6-fold (p < 0.005) activation of the A20 promoter, whereas PKD induced a more modest ~2.6-fold (p <

0.001) induction of reporter activity. These data demonstrate that A20 transcription can be induced by TNF-R that activate the non-canonical pathway and by free radicals.

Together our data identifies A20 as a major NF-B target gene regulated by diverse NF-

B signalling pathways.

- 113 - The Expression and Regulation of A20

Figure 4.7 A20 expression is NF-B dependent in -cells.

Induction of the A20 reporter in -TC3 by (a.), TRAF 6, (b.) TRAF 2, (c.), NIK, and, (d.) PKD. Data represents mean ± SD from one representative experiment of four to six independent experiments conducted. All differences are significant (*p < 0.05, ** p < 0.001).

- 114 - The Expression and Regulation of A20

4.2.9 Expression of A20 in stressed islets in vivo.

Transplanted islets are exposed to a hyperglycaemic environment, non-specific inflammatory reactions (i.e. including cytokines and free radicals), immune-mediated rejection as well as stresses relating to hypoxia and lack of adequate nutrients (Lechler,

Garden et al. 2003; Ricordi and Strom 2004). Many of these factors are able to induce

NF-B. Having identified A20 as a major NF-B-regulated gene in -cells, we hypothesised that A20 expression should be heavily regulated in islets in vivo following exposure to inflammatory stress. To assess this directly, we examined A20 expression levels in islets following transplantation into either diabetic syngeneic or diabetic allogeneic hosts. As shown in Figure 4.8, at post operative day (POD) 5 post transplantation, there was a significant ~3-fold (p < 0.05) and ~4-fold (p < 0.05) increase in A20 steady state mRNA expression in islets transplanted into either syngeneic or allogeneic recipients respectively. These data demonstrate that transplanted islets also have a regulated anti-apoptotic stress response, and that A20 is one component of this stress-response in vivo.

Figure 4.8. A20 is up-regulated in islets in vivo.

Islet A20 expression at POD5. Data represents mean ± SD from three independent experiments. All differences are significant (*p < 0.05).

- 115 - The Expression and Regulation of A20

4.2.10 A20 is sufficient to protect -cells from TNF--induced cell death.

We demonstrated that blocking de novo gene transcription sensitises -cells to apoptosis and prevents A20 up regulation, indicating that loss of A20 expression may be partly responsible for the sensitisation to TNF--induced apoptosis. To determine the importance of A20 in regulating -cell apoptosis, we next asked whether A20 expression was sufficient to protect -cells from TNF--induced apoptosis.

Activation of the TNF receptor by its cognate ligand results in the recruitment of

Fas-associated-death-domain (FADD), which subsequently recruits and activates pro- caspase 8/FLICE triggering apoptosis (Green 1998; Karin and Lin 2002). For this experiment, -TC3, cells were transiently co-transfected with a FADD expression vector to induce apoptosis, in the presence or absence of an A20 expression plasmid. Controls cells were transfected with a vector expressing a FADD dominant negative inhibitor

(FADD-DN) or the empty vector pcDNA3. All groups were transiently co-transfected with a CMV-driven -gal reporter, which was used to determine the percentage of viable cells for each group (Daniel, Arvelo et al. 2004). As shown in Figure 4.9, forced- expression of FADD resulted in the rapid destruction of -TC3 cells as evidenced by the decrease in -gal reporter activity (~60%, p < 0.005) as compared to baseline levels observed in control groups (e.g. pcDNA3 or FADD-DN). On the other hand, expression of FADD-DN had little effect upon cell viability (p > 0.05). In contrast, A20 expressing cells were completely protected from the pro-apoptotic effect of FADD (p < 0.05).

These data demonstrate for the first time that A20 is sufficient to protect -cells from

TNF--induced apoptosis, thus loss of A20 expression by transcriptional blockade sensitises -cells to apoptotic cell death.

- 116 - The Expression and Regulation of A20

Figure 4.9. A20 rescues -cells from FADD-induced cell death.

Cell survival in -TC3 expressing pcDNA3, FADD-DN, FADD or FADD plus A20. Data represents mean percentage survival ± SD from four independent experiments. Difference between FADD and FADD plus A20 are significant (**p < 0.005).

- 117 - The Expression and Regulation of A20

4.3 DISCUSSION

Apoptotic -cell death is an important pathologic mechanism of -cell loss in

T1D and islet graft rejection (Mathis, Vence et al. 2001; Cnop, Welsh et al. 2005).

Apoptosis is a highly regulated process, such that the decision to undergo apoptosis is dependent upon the balance between anti-apoptotic and pro-apoptotic signals (Bach,

Hancock et al. 1997). In an inflammatory setting, cells are required to express a new or inducible set of anti-apoptotic genes as a mechanism to counteract the physiological stresses that otherwise leads to cellular damage and apoptosis (Bach,

Hancock et al. 1997; Karin and Lin 2002). Blockade of this regulated anti-apoptotic response sensitises many cell types to apoptotic death, underscoring the physiological relevance of this signalling network in cell biology (Beg and Baltimore 1996; Van

Antwerp, Martin et al. 1996; Wang, Mayo et al. 1996).

In these experiments we demonstrated that this paradigm is true for -cells, as

-cells were sensitised to TNF--induced death by inhibition of de novo gene transcription. Our microarray-based approach revealed that TNFAIP3/A20 is one potential candidate gene providing a molecular basis for this protective response. A20 is a zinc-finger containing immediate early response gene with a potent anti-apoptotic and anti-inflammatory function (Opipari, Boguski et al. 1990; Ferran, Stroka et al.

1998; Lee, Boone et al. 2000). This essential anti-apoptotic and anti-inflammatory function of A20 is preserved in islets (Grey, Arvelo et al. 1999; Grey, Longo et al.

2003). Once expressed, A20 binds to, and targets TNF receptor-interacting-protein

(RIP) for proteosomal degradation, thereby preventing TNF--induced NF-B activation (Wertz, O'Rourke et al. 2004). The anti-apoptotic mechanism of A20 is less well understood, but may also involve inhibition of key proximal signalling events, as

- 118 - The Expression and Regulation of A20

A20 inhibits activation of initiator caspases following death receptor ligation (Daniel,

Arvelo et al. 2004), consistent with our data demonstrating that A20 protects -cells from FADD-induced apoptosis.

The transcription factor NF-B regulates multiple pro-inflammatory genes that can contribute to islet destruction. NF-B can promote T-cell-mediated killing and the generation of -cell toxins through the induction of molecules such as Fas (Darville and Eizirik 2001; Heimberg, Heremans et al. 2001), iNOS (Kwon, Corbett et al.

1998; Heimberg, Heremans et al. 2001) and Cox-2 (Sorli, Zhang et al. 1998). In addition, the promoters of other pro-inflammatory genes induced in -cells, including chemokines (i.e. MCP-1) and adhesion molecules (i.e. ICAM-1) also possess binding elements for NF-B (May and Ghosh 1998). In Chapter 3, we demonstrated that many of these pro-inflammatory genes are components of the IEGs, regulated by NF-

B. The importance of NF-B in -cell inflammatory responses is further underscored by the fact that blockade of NF-B in in vitro models, by means of a

IB super-repressor, or via A20 over expression, prevents IL-1 and IFN--induced

-cell dysfunction and death (Kwon, Corbett et al. 1998; Grey, Arvelo et al. 1999;

Giannoukakis, Rudert et al. 2000; Heimberg, Heremans et al. 2001). Collectively these data implicate NF-B as a major player in cytokine-dependent -cell dysfunction, and indicate that targeting NF-B may have therapeutic utility as a means to improve islet function in the face of inflammatory insults.

However, aside from its important pro-inflammatory role, NF-B is a major regulator of cellular apoptosis through its ability to control the expression of multiple anti-apoptotic genes including the c-IAP’s, caspase-8-c-FLIP, Bfl-1/A1 (Karin and

Lin 2002) and A20 (Krikos, Laherty et al. 1992; Ferran, Stroka et al. 1998). In cells that lack the NF-B family member p65/RelA, exposure to TNF- will induce

- 119 - The Expression and Regulation of A20 apoptosis (Beg and Baltimore 1996). Furthermore, blockade of NF-B activation, by non-specifically inhibiting transcription with AcD (Wong, Elwell et al. 1989), or specifically via the use of the IB super-repressor (Van Antwerp, Martin et al. 1996;

Wang, Mayo et al. 1996), also sensitises cells to TNF--mediated apoptosis.

Importantly blockade of NF-B in -cells by means of a IB super-repressor

(Chang, Kim et al. 2003), or via AcD as we demonstrate here, also sensitises to TNF-

-dependent apoptotic death. We propose that this sensitisation was due to blockade of NF-B activation, and at least in part, the subsequent loss of A20 expression.

Consistent with this, prevention of A20 induction in vitro sensitises endothelial cells to TNF-dependent apoptosis (Ferran, Stroka et al. 1998). Thus in -cells, as has been demonstrated for other cell types, NF-B-activation governs both pro-inflammatory responses and protection from apoptosis (Karin and Lin 2002). Therefore targeting

NF-B activation in an in vivo setting where multiple factors are at play may sensitise

-cells to apoptosis (Chang, Kim et al. 2003).

In conclusion, in Chapter 3 we demonstrate that primary islets up-regulated a relatively small set of anti-apoptotic genes in response to inflammatory stress, of which TNFAIP3/A20 was the most highly regulated. Here in Chapter 4, we demonstrate that A20 is regulated at the level of gene transcription in pancreatic - cells, under the control of the transcription factor NF-B; thus tightly linking islet pro-inflammatory gene responses with protection from apoptosis. Together, with previous work performed by our group demonstrating an anti-inflammatory and anti- apoptotic function for A20 in islets (Grey, Arvelo et al. 1999; Grey, Longo et al.

2003), these present data indicate that A20 is a critical component of the islets regulated response to inflammatory stress and injury. Thus pathologic loss of A20 expression may render -cells susceptible to apoptotic death, conversely, enhancing

- 120 - The Expression and Regulation of A20

A20 expression in -cells may improve their survival in the face of inflammatory and autoimmune insults. Importantly, our data indicates that blockade of NF-B, as a means to prevent islet inflammatory responses in vivo, may have the unwanted side effect of sensitising -cells to apoptosis by preventing the up-regulation of anti- apoptotic genes such as A20 (Beg and Baltimore 1996; Van Antwerp, Martin et al.

1996; Ferran, Stroka et al. 1998). Thus the effect of blocking NF-B in islets in vivo in the context of an inflammatory setting remains to be resolved. This question will be addressed in Chapter 5.

- 121 -

Chapter 5 NF-B in Islet Survival and Function

5.1 INTRODUCTION.

Emerging evidence indicates that -cells subjected to immune attack such as during islet transplantation, participate in their own destruction (Abdi, Smith et al.

2002; Frigerio, Junt et al. 2002; Abdi, Means et al. 2003; Abdi, Means et al. 2004;

Morimoto, Yoneyama et al. 2004; Schroppel, Zhang et al. 2004; Reddy, Bai et al.

2006). Cytokine activation of the transcription factor NF-B has a vital role in this process. In pioneering studies by Corbet et al. it was demonstrated that cytokine activation of NF-B would lead to the induction of iNOS in -cells and result in the release of NO (Corbett, Wang et al. 1992). NO was shown to exhibit two major toxic effects upon -cells, by inhibiting GSIS, leading to -cell dysfunction, and inducing - cell apoptosis. These data provided the first evidence that -cells could participate in their own destruction in an inflammatory milieu. Further studies have demonstrated that after transplantation, islets can aid the recruitment and activation of invading lymphocytes through the elaboration of cytokines and chemokines (e.g. CXCL10,

CCL2) (Cardozo, Heimberg et al. 2001; Frigerio, Junt et al. 2002). Moreover, cytokine- activated -cells can facilitate their own T cell-mediated killing through the expression of death-receptors like Fas/CD95 (Chervonsky, Wang et al. 1997). Additionally, the induction of -cell-toxic molecules such as COX-2 (Heitmeier, Kelly et al. 2004) and

ATF3 (Hartman, Lu et al. 2004) by -cells themselves further exacerbates their apoptotic death. In Chapter 3 we demonstrated that the expression of many of these - cell toxic genes are NF-B dependent. Significantly we also demonstrated that they are immediate-early response genes. Indicating that in the first stages in the development of

122 NF-B in Islet Survival and Function

T1D, -cells present a pro-inflammatory profile, enhancing the immune attack and setting the scene for their later destruction.

These studies would support the concept that blockade of NF-B may be a useful therapeutic target to prevent islet-inflammatory responses, such as following islet transplantation to prolong islet graft survival. For instance, blockade of NF-B with the

IB super-repressor (Cardozo, Heimberg et al. 2001; Heimberg, Heremans et al.

2001), IL-1 receptor antagonist (Giannoukakis, Rudert et al. 1999) or by A20 over- expression (Grey, Arvelo et al. 1999) prevents cytokine-mediated pro-inflammatory gene induction and apoptosis in primary islets in vitro. Importantly, mice harbouring a

-cell-specific deletion of NF-B are protected from multiple-low-dose streptozocin induced diabetes (Eldor, Yeffet et al. 2006). Thus blockade of NF-B can protect islets from cytokine-mediated destruction.

In contrast to its well-established pro-apoptotic role, NF-B is also critical for the expression of cell survival genes. In ground breaking studies it was demonstrated that blockade of NF-B, would sensitise tumour cell lines to TNF-mediate apoptosis

(Beg and Baltimore 1996; Van Antwerp, Martin et al. 1996; Wang, Mayo et al. 1996).

The underlying mechanism for this phenomenon relates to the ability of TNF- to activate both NF-B and caspase-8 (Karin and Lin 2002). Blockade of NF-B would prevent the induction of anti-apoptotic genes that inhibit caspase activation, thus sensitise the cell to apoptosis (Ferran, Stroka et al. 1998). Important for this thesis,

Chang et al. showed that blockade of NF-B sensitises -cells to TNF- induced apoptosis (Chang, Kim et al. 2003). In Chapter 4, we clearly demonstrate that the expression of the most highly regulated cytokine inducible anti-apoptotic genes A20 is regulated by NF-B. Further, we demonstrate that A20 expression can inhibit TNF-

- 123 - NF-B in Islet Survival and Function mediated apoptosis in -cells. Thus blockade of NF-B sensitises -cells to TNF- mediated apoptosis, by preventing the induction of the anti-apoptotic gene A20.

Collectively these studies indicate a seemingly paradoxical role for NF-B in - cells. On the one hand NF-B is clearly responsible for the expression of pro- inflammatory -cell-toxic genes. However, NF-B is also responsible for the expression of -cell-protective anti-apoptotic genes. This paradox raises an important question for the field, because if NF-B is required for -cell survival in vivo in an inflammatory setting, administration of therapeutics to block NF-B may actually impair -cell survival. To help resolve this apparent paradox, we have examined the effect of blockade of NF-B upon islet survival and function in vivo in an islet allo-transplant model.

- 124 -

5.2 RESULTS

5.2.1 Islet transplant model

To test the role of NF-B in islet function in an inflammatory setting, we established an islet transplantation model. For our transplantation model, donor islets were obtained from BALB/c mice, which carried the MHC haplotype H-2d, and transplanted under the kidney capsule of C57BL/6 mice, which carried the MHC haplotype H-2b. This strain combination represents a full MHC mismatch at the class I and class II loci, and is recognised as one of the most vigorous allograft rejection models. As shown in Figure 5.1 we could routinely isolate good quality islets as demonstrated by their normal morphology (Figure 5.1 A) and uptake of Calcein AM

(green) demonstrating good viability (Figure 5.1 B).

For islet transplantation, 600 islets were isolated from three donor BALB/c mice and transplanted under the kidney capsule of one recipient C57BL/6 mouse (Figure 5.1

C & D), thus a ratio of three-donor pancreata to one recipient was used. Interestingly this model is similar to the clinical islet transplant experience where islets are isolated from two to four pancreata per transplant recipient (Shapiro, Lakey et al. 2000).

Recipient mice were administered 200 mg/Kg streptozotocin to induce diabetes.

As shown in Figure 5.2 this ratio of islet to recipient was sufficient to normalise blood glucose levels within 2-3 days post transplantation. Euglycaemia was maintained for approximately 2 weeks until after which time rejection was evident by the return of hyperglycaemia. The mean survival time of the grafts was 17.2 ± 3.2 days (n =6).

Immunologically-mediated rejection was evident by the appearance of a marked mononuclear cell infiltrate as early as post-operative days (POD) 2 and 5. In contrast no mononuclear cell infiltrate was evident in syngeneic islet graft (Figure 5.3).

125 NF-B in Islet Survival and Function

Figure 5.1. Islet transplantation model.

A. Light micrograph of primary mouse islets in culture, prior to transplantation. B. Fluorescence micrograph of islets stained with Calcein-AM; green indicates good viability. C. Streptozotocin-induced diabetic recipient mouse anaesthetised using isofluorine, prior to transplantation D. islet graft was transplanted into the kidney capsule of diabetic recipient mouse.

- 126 - NF-B in Islet Survival and Function

Figure 5.2. Blood glucose analysis of allogeneic transplant model.

Blood glucose analysis from C57BL/6 mice receiving islet grafts from 3 BALB/c donor mice. Blood glucose level (BGL) was monitored from post transplant days (POD) -1 until rejection (R). Mice achieved euglycaemia (N) immediately after tranplantation at POD 1 (MST= 17.2 ± 3.2 days, n =6). Tx: transplantation.

- 127 - NF-B in Islet Survival and Function

Figure 5.3. Histological analysis of islet graft at 2 or 5 days after transplantation.

Islet graft was transplanted under the kidney capsule and the recipient mice were sacrificed at POD 2 or POD 5. The kidney was cut along the lateral axis, across the transplanted graft, preserved in OCT and was cut at 8 μm sections. The samples were stained using the H&E protocol. Left panel: low power magnification. Right panel: high power magnification. (Tx: trasnplantation; POD: post operative days)

- 128 - NF-B in Islet Survival and Function

5.2.2 Transduction by recombinant adenovirus.

To test the role of NF-B blockade in our islet transplantation model we over- expressed the NF-B-super-repressor IB in islets (Chang, Kim et al. 2003). To achieve IB over-expression islets were incubated with recombinant-Adenovirus

(rAd) expressing IB. Control islets were infected with adenovirus expressing green fluorescent protein (GFP). As demonstrated in Figure 5.4, high expression of GFP could be achieved by infecting islets at a multiplicity of infection (MOI) of 5:1 or 50:1.

However, MOI of 50:1 were toxic to islets, so an MOI of 5:1 was used for all subsequent studies. At an MOI of 5:1, high expression of IB was achieved in islets as shown by western blot (Figure 5.5 A). Similarly in vivo, high expression of IB was detected in the islet allograft (Figure 5.5 B). Consistent with previous studies using adenoviral vectors, we found about 20-30% of islet cells in the graft expressed high level of the transgene IB (Grey, Longo et al. 2003).

- 129 - NF-B in Islet Survival and Function

at increasing at concentrations, viral in GFP transduced islets cultured in vitro cultured islets transduced GFP Figure 5.4. GFP expression in primary islets. in expression GFP Figure 5.4. Micrograph 1 h. for transduction rAd-GFP after overnight media culture islet in cultured were islets Primary green showing fluorescence from rAd- green fluorescence. any not showing islets contrast to control

- 130 - NF-B in Islet Survival and Function

5.2.3 Inhibition of NF-B-dependent genes by IB over-expression.

We first examined the inhibitory effect of IB over-expression on the induction of NF-B-dependent inflammatory genes in islets in vitro. To do this, islets were transduced with rAd-IB or the control vector rAd-GFP at an MOI of 5:1 for 24 h and then stimulated with the cytokine IL-1 (200 U/mL). Based on our studies in

Chapter 3, we examined the effect of IB over-expression on the following NF-B- dependent immediate-early genes: Cxcl1, Ccl2, Cxcl2, Cxcl10, IL-6 and TNF. As shown in Figure 5.6 over expression of IB resulted in a marked suppression (~70%) of NF-B-dependent gene induction. These data show that IB over-expression can inhibit NF-B gene expression.

- 131 - NF-B in Islet Survival and Function

Figure 5.5. IB over-expression in primary islets.

Primary islets were transduced with rAd-IB (1:5 MOI) prior to cell culture/ western blot (A) or transplantation into syngeneic recipient (B). A. Western blot analysis showing IB over-expression in primary islets in vitro at 24 h post transduction. B. Immuno-histochemistry analysis showing IB over-expression in islet isograft in vivo at POD 2. Brown staining indicated IB expression in islet.

- 132 - NF-B in Islet Survival and Function

Figure 5.6. Islets expressing the IB-super-repressor significantly inhibit IL-1 induced NF-B-dependent pro-inflammatory gene expression.

Chemokine and cytokine mRNA expression in primary islets, transfected with either rAd-GFP or rAd-IB and stimulated with IL-1 for 1h. Data represents mean ± SD from three independent experiments. All differences are significant (p < 0.05), except for IL-6 induction.

- 133 - NF-B in Islet Survival and Function

5.2.4 Blockade of NF-B by over-expression of IB does not prolong islet allograft survival.

To test the effect of NF-B upon islet function and survival in vivo in an islet transplantation setting, BALB/c islets were transduced with rAd-IB or rAd-GFP and transplanted into diabetic C57BL/6 recipients. Kaplan Meier survival analysis shows that control rAd-GFP expressing islets were rejected with a mean survival time of 14 ±

3.8 days (n = 15). The rejection time of the rAd-GFP expressing islets was not significantly different to the rejection of non-transduced islets (Figure 5.2). We found that islets over-expressing IB were rejected with a similar tempo to islets expressing

GFP (Figure 5.7 A). The mean survival time for the rAd-IB expressing grafts was

17.9 ± 6.2 days (n = 10). Thus, despite inhibiting pro-inflammatory gene expression

(Figure 5.6) blockade of NF-B did not improve islet allograft survival.

Interestingly, careful analysis of the blood glucose plots revealed that mice receiving IB-expressing islets struggled to restore euglycaemia (Figure 5.7 B). The failure of the IB-expressing grafts to restore blood glucose to normal levels was apparent as early as the first 5 days following transplantation. The median BGL(s) of mice receiving IB-expressing grafts was 13.3 mM, 12.2 mM and 8.8 mM at POD 1,

2 and 3 respectively, versus ~5 mM in mice receiving GFP-expressing grafts (p < 0.05, n  10 per group) (Figure 5.7 C). At POD 5, though the median BGL of the mice receiving IB-expressing grafts was not significantly different to control mice (i.e.

BGL = ~6.6 mM versus ~5.3 mM), 3 out of 10 mice were still hyperglycaemic (Figure

5.7 C). Thus IB-expressing grafts exhibited poor function in the early post-transplant period. This was despite the transplantation of an excessive number of islets that restored euglycaemia in 100% of non-transduced grafts within 24 h (Figure 5.2). In addition, all of the GFP-expressing grafts immediately restored blood glucose to normal

- 134 - NF-B in Islet Survival and Function levels and maintained euglycaemia till rejection (Figure 5.7 B & C). This indicated, that the failure of the IB-expressing islet grafts related to blockade of NF-B rather than to viral toxicity. These data would be consistent with the hypothesis that NF-B plays an important pro-survival role in -cells in an inflammatory setting in vivo.

Figure 5.7. Blockade of NF-B using IB-super-repressor sensitises islet allograft to failure.

A. Kaplan-Meier analysis showing islet allograft survival. Islets were transduced with either rAd-GFP (green line, MST 14 ± 3.8 days, n = 15) or rAd-IB (red line, MST 17.9 ± 6.2 days n = 10). B. Graphical illustration of blood glucose values over time from diabetic mice receiving allogeneic islets transduced with rAd-GFP (green line) or rAd-IB (red line). N = euglycaemia, Tx = Transplantation. C. Detailed blood glucose plot of individual mice receiving allogeneic islets transduced with rAd-GFP (green line) or rAd-IB (red line) for the first 5 post-operative days.

- 135 - NF-B in Islet Survival and Function

5.2.5 Blockade of NF-B by PDTC pre-treatment does not prolong islet allograft survival.

Because of the potential importance of our finding, we wanted to test this observation using a second independent approach. To achieve this we next examined the effect of blocking NF-B activity by using the pharmacological inhibitor PDTC. As shown in Chapter 3, PDTC is a powerful inhibitor of NF-B dependent gene expression. Indeed, at a concentration of 50 M PDTC, the cytokine-induced gene expression of chemokines and cytokines were reduced by > 90 % (p < 0.005) (Figure

3.7). By using PDTC to block NF-B, we would avoid potential islet toxicity due to the use of an adenoviral vector and secondly, because PDTC is membrane soluble, we would expect to inhibit NF-B in a greater percentage of islet cells. Indeed, with regard to blockade of NF-B-dependent genes in vitro we found PDTC to be slightly more effective than rAd-IB (i.e. >90% versus ~70% inhibition of NF-B respectively).

To assess the affect of NF-B blockade using PDTC, we pre-treated BALB/c islets with PDTC (10-100 μM) for 2 h and subsequently transplanted these islets into diabetic C57BL/6 recipients.

We found that mice receiving PDTC-treated islet grafts were unable to achieve euglycaemia in the early post-transplant period. For instance, the median BGL(s) of mice receiving 50 μM PDTC-treated grafts was 13.5 mM and 18.7 mM at POD 1 and 2 respectively, versus ~5 mM in mice receiving control grafts (p < 0.05, n  10 per group)

(Figure 5.8). Interestingly, we found the phenotype of the mice receiving the PDTC- treated grafts to be more severe than those receiving the IB-expressing grafts, with regards to hyperglycaemia. Indeed, most of the mice receiving PDTC-treated islets needed to be culled in the early post-transplant period due to ethical considerations. We believe that this is consistent with the PDTC-blocking NF-B in a greater percentage of

- 136 - NF-B in Islet Survival and Function islet cells. Thus the degree of NF-B blockade correlated with an increasingly impaired capacity of the transplanted islets to restore euglycemia in diabetic recipients. Our data shows that blockade of NF-B either by rAd-IB or by PDTC, does not prolong islet graft survival but results in an impairment of islet function in an inflammatory setting.

Figure 5.8. Blockade of NF-B using PDTC sensitises islet allograft to failure

Blood glucose values of mice receiving allogeneic islet transplants pre-treated with (red line, n = 13) or without (green line, n = 6) PDTC. Mice receiving PDTC-treated islets were sacrificed at POD 2-3 due to severe hyperglycaemia. All non-treated islets were rejected by ~ POD 15. Tx = transplantation.

- 137 - NF-B in Islet Survival and Function

5.2.6 A20 is a major NF-B target gene important in protecting islets from inflammatory insult.

Paradoxically, NF-B regulates the expression of pro-inflammatory genes as well as anti-apoptotic genes in -cells. To determine which of these functions is more important in vivo in an inflammatory setting, we examined the effect of NF-B- blockade upon islet graft survival following transplantation. We found that blanket blockade of NF-B did not improve the outcome of islet transplantation in vivo despite blunting the islets pro-inflammatory response. Rather blockade of NF-B markedly affected graft function, suggesting that NF-B was required for islet survival responses in vivo.

In Chapters 3 and 4, we identified A20 as the islets most highly expressed anti- apoptotic gene and moreover we demonstrated that NF-B is critical for the regulation and expression of A20. We questioned therefore whether the loss of islet survival in the

NF-B-blocked islet grafts related to the loss of A20 expression. To test this, we transduced primary islets with rAd-IB to block NF-B expression and examined IL-

1 stimulated A20 mRNA expression. As shown in Figure 5.9 A, A20 mRNA expression was reduced by ~60% in IB-expressing islets. We next examined the effect of NF-B blockade on A20 protein expression. In this experiment islets were treated with IL-1 for 4 h to allow sufficient time for optimal A20 protein expression

(Chapter 4). We found that over-expression of IB suppressed cytokine-induced A20 expression by ~50% as compared to A20 induction in GFP-expressing islets (Figure 5.9

B). Thus loss of A20 expression due to NF-B-blockade is associated with poor islet graft survival.

- 138 - NF-B in Islet Survival and Function

Figure 5.9. Blockade of NF-B using IB-super-repressor inhibit A20 expression.

Primary islets from BALB/c mice were transduced with either rAd-GFP or rAd-IB and were incubated with or without IL-1 for 1h (A) or 4 h (B). A. RNA was collected after cytokine stimulation and A20 mRNA expression was detected using RTqPCR. B. 10 μg of cytoplasmic protein extract were immuno-precipitated (IP) with A20 Ab and separated on polyacrylamide gel blotted (western blot: WB) with A20 Ab.

A20 has potent anti-apoptotic activity mediated by its ability to block the caspase pathway (Daniel, Arvelo et al. 2004; Daniel, Patel et al. 2006; Li, Wang et al.

2006). In addition, A20 has potent anti-inflammatory activity mediated by its ability to block NF-B activation (Wertz, O'Rourke et al. 2004). Emerging evidence supports the

- 139 - NF-B in Islet Survival and Function concept that the physiological function of A20 is to simultaneously block NF-B and prevent apoptosis, thus preventing uncontrolled inflammation (Ferran, Stroka et al.

1998; Lee, Boone et al. 2000). We hypothesise that blockade of NF-B in the islet grafts prevented the induction of A20, thus rendering the islet graft sensitive to cytokine-mediated apoptosis. Indeed we demonstrated in Chapter 3 that A20 could protect -cells from TNF- induced apoptosis.

To test the effect of A20 over-expression on islet graft survival, we transduced primary islets from BALB/c mice with rAd-A20 or rAd-GFP, at a MOI 5:1, and transplanted them into diabetic C57BL/6 recipient mice. We observed that A20 expressing islet allografts had normal metabolic function after transplantation. The median BGL of mice receiving A20-expressing islet grafts was 4.1 mM, 5.7 mM and

6.8 mM at POD 1, 5 and 10 respectively and was not different to the BGL of mice receiving control grafts (Figure 5.10 A). Therefore, in contrast to blockade of NF-B by

PDTC-treatment or IB over-expression, inhibition of NF-B by A20-expression

(Grey, Arvelo et al. 1999; Wertz, O'Rourke et al. 2004) did not impair islet survival in the early post-transplant period.

Kaplan Meier survival analysis demonstrated that A20 expression improved islet allograft survival (Figure 5.10 B). Indeed, in contrast to mice receiving non-infected or

GFP-expressing grafts, ~20% of the mice receiving A20-expressing islet grafts showed long-term allograft survival (i.e. >100 days, p < 0.0005). To confirm that the long-term euglycaemia was dependent upon the islet allograft, we conducted nephrectomies on surviving mice at 100 days. In all cases (5/5) euglycaemia was promptly lost (BGL > 16 mM) within 3-4 days following nephrectomy, indicating that the islet graft was functional. Histological analysis of the kidney graft site revealed the presence of intact islets under the kidney capsule and evidence of some mononuclear cell infiltration

- 140 - NF-B in Islet Survival and Function

(Figure 5.11). Interestingly, the mononuclear cell infiltration was less aggressive than that observed for rejecting control grafts (see Figure 5.3). We found that blockade of

NF-B using A20 improved islet allograft survival in a full mismatched transplant model. This data supports the notion that in islets subjected to an inflammatory insult, the survival function of NF-B is more important than its pro-inflammatory function.

- 141 - NF-B in Islet Survival and Function

Figure 5.10. A20 can prolong islet allograft survival without sensitising to failure.

A. Graphical illustration of blood glucose values over time from representative diabetic mice receiving allogeneic islets transduced with rAd-GFP (green line) or rAd-A20 (red line). N = Euglycaemia, Tx = Transplantation. B. Kaplan-Meier analysis showing islet allograft survival. Islets were either non- infected (NI) (black line, MST 15 ± 0.6 days, n = 8), or transduced with rAd-GFP (green line, MST 14 ± 4.5 days, n = 10) or rAd-A20 (~20% (5/23) survive > 100 days, p < 0.0005).

- 142 - NF-B in Islet Survival and Function

Figure 5.11. Hemotoxylin and Eosin Staining of islet allograft infected with rAd- A20 at POD 100.

Top panel: low power magnification of islet graft indicating good islet morphology and minimal lymphocyte infiltration. Minor accumulation of lymphocytes visible in the perimeter of the islet graft (arrow).

- 143 - NF-B in Islet Survival and Function

5.2.7 Blockade of NF-B impairs islet isograft function.

At this stage we questioned whether the loss of islet function in vivo following

NF-B blockade was entirely due to the loss of protective gene expression. A previous study has shown that blockade of NF-B impairs glucose stimulated insulin secretion

(GSIS) in islets (Norlin, Ahlgren et al. 2005). Interestingly, we found that NF-B- blocked islets have poor function in vivo in the early post-transplantation period

(Section 5.2.4 and 5.2.5). We next determined whether this related solely to the loss of

-cell survival in an inflammatory setting, or perhaps also involved the loss of metabolic function. To test this, we treated islets from C57BL/6 mice with PDTC (50

μM) and transplanted them into STZ-induced diabetic C57BL/6 recipient. In this syngeneic transplant model, we could test the effect of NF-B blockade on -cell function in the absence of inflammation. Moreover we transplanted the islets at a ratio of one donor per recipient, termed a marginal mass. By doing this, we were hoping to reveal subtle effects of NF-B blockade upon metabolic function. Syngeneic marginal mass transplant models have been used previously in other studies to determine the effects of different stresses and agents upon -cell function in vivo (Montana, Bonner-

Weir et al. 1993; Grey, Longo et al. 2003).

As we anticipated, in our marginal mass transplant model we found that control grafts could reduce but not normalise BGL (Figure 5.12 A). The mean BGL were 14.3 mM, 9.7 mM and 10.3 mM at POD 1, 4 and 9 respectively, as compared to mice receiving an optimal transplant mass, which immediately restored normal BGL even in an allograft model (Figure 5.2). Under these experimental conditions, the NF-B- blocked islet grafts, exhibited worse function than the control grafts (Figure 5.12 A).

The mean BGL of mice receiving PDTC-treated grafts were 20 mM, 23.2 mM and 25.4 mM at POD 1, 4 and 9 respectively and were not significantly different to the pre-

- 144 - NF-B in Islet Survival and Function transplant hyperglycaemic BGL. Thus the PDTC-treated grafts showed impaired metabolic function as compared to control marginal mass grafts (p < 0.05, n  4 per group).

To confirm that the failure of the marginal mass grafts were related to impaired

-cell function due to NF-B-blockade, glucose tolerance tests (GTT) were performed.

To do this, mice receiving PDTC-treated or control marginal mass grafts were administered a glucose bolus (2 g/Kg D-glucose) at POD 28 and blood glucose levels were monitored for the next 120 min (Figure 5.12 B). In mice receiving control grafts

BGL reached a maximal peak of 19.0 ± 4.1 mM at 20 min, which normalised to a basal

BGL of 9.0 ± 2.1 mM at 120 min. In contrast, mice receiving PDTC-treated grafts BGL reached a maximal peak of 31.0 ± 2.7 mM, which unlike controls did not normalise to basal BGL at 120 min, but remained at 23.9 ± 3.0 mM. This analysis demonstrated that mice receiving PDTC-treated syngeneic islets were glucose intolerant, indicating a severe impairment in the islet metabolic function.

- 145 - NF-B in Islet Survival and Function

Figure 5.12. Functional analysis of PDTC treated islets in vivo.

A: Pooled blood glucose values of mice transplanted with syngeneic islets pre-treated with (red line, n = 4) or without (black line, n = 5) 50 M PDTC. B: At the fourth week after transplantation, mice receiving control (black line) or PDTC-treated islets (red line) were infused (i.p.) with 2 g/Kg D-glucose and blood glucose values (GTT) were determined over the following 120 minutes. All differences are significant (p < 0.0001).

- 146 - NF-B in Islet Survival and Function

5.2.8 A role for NF-B the metabolic function of islets?

We found that blockade of NF-B impaired islet function in vivo, suggesting that NF-B signalling was required for glucose sensing and insulin secretion. A precedent for this concept has been demonstrated previously (Norlin, Ahlgren et al.

2005). To test whether attenuation of NF-B activity affected glucose stimulated insulin secretion (GSIS), we monitored the release of insulin in isolated islets 24 h after PDTC treatment. Treatment of control islets with 16.2 mM glucose resulted in ~15-fold increase in insulin release (Figure 5.13 A). In contrast, PDTC-treated islets exhibited a blunted GSIS response of only ~4-fold increase in insulin release, which significantly differs from non-treated islets (p < 0.05).

Because NF-B is a transcription factor, we hypothesised that blockade of NF-

B affected the expression of glucose sensing and insulin secretion related genes. To test this, islets were pre-treated with PDTC (50μM) for 2 h, washed in PBS and cultured overnight in islet culture media. Islets were harvested and the expression of important glucose sensing (i.e. Glut2), glycolytic genes (i.e. aldolase, glucokinase [GK], glucose-

6-phosphoisomerase [G6PI], phospho-gluco-mutase [PGM]) as well as aryl- hydrocarbon-nuclear translocator (ARNT) and insulin receptor (IR) were determined by

RTqPCR. Using gene expression levels in control islets as a baseline, we found that blockade of NF-B down-regulated the expression of G6PI (p < 0.005) and ARNT (p <

0.05) (Figure 5.13 B).

- 147 - NF-B in Islet Survival and Function

Figure 5.13. Functional analysis of PDTC-treated islets in vitro.

A. GSIS of islets 24 h after pre-treatment with (black) or without (white) 50 μM PDTC. Data representative of three independent experiments (* p < 0.05). B. RTqPCR analysis of islets treated with PDTC (black) or control non-treated islets (clear), for GK: Gluco-kinase; Glut 2: Glucose transporter-2; IR: Insulin Receptor; G6PI: Glucose-6-phosphoisomerase; PGM: Phospho-gluco-mutase, ARNT: Aryl- hydrocarbon Nuclear Translocator, Aldo: Aldolase. Data represents mean ± SD from three independent experiments (* p < 0.05, ** p < 0.005).

- 148 - NF-B in Islet Survival and Function

We were intrigued by our finding that NF-B blockade reduced the expression of ARNT and impaired -cell function. In contrast, A20 blocks NF-B activation without impairing -cell function. Recently, it has been demonstrated that ARNT is important in maintaining normal islet metabolic function and interestingly G6PI is an

ARNT regulated gene (Gunton, Kulkarni et al. 2005). For ARNT to function as a transcription factor it must bind to its partner HIF-1 (Zagorska and Dulak 2004) and both proteins are required to maintain normal islet metabolic function (personal communication Dr. J. Gunton, Garvan Institute, Sydney). HIF-1 protein is tightly regulated by degradation, controlled by ubiquitination and hydroxylation (Huang, Gu et al. 1998). Thus ARNT function is controlled through regulation of HIF-1. HIF-1 is stabilised by cytokine exposure (Jung, Isaacs et al. 2003), since we know that cytokines also induce NF-B activation and subsequently A20 expression (Chapter 4) we considered whether A20 was the means by which HIF-1 is stabilised after cytokine exposure. Indeed, A20 functions as a ubiquitinating and de-ubiquitinating enzyme

(Wertz, O'Rourke et al. 2004).

To test whether A20 could interact with HIF-1, we performed immuno- precipitation studies in the -cell line Min-6. As demonstrated in Figure 5.14 (top panel), we were able to detect HIF-1 in the cell lysate after precipitation with A20 antibody. In the reverse direction, we were able to detect A20 in the cell lysate after precipitation with HIF-1 antibody (Figure 5.14 lower panel). Thus we demonstrate that HIF-1 and A20 can interact suggesting a potential biological role for A20 in the regulation of HIF-1.

- 149 - NF-B in Islet Survival and Function

Figure 5.14. A20 interaction with HIF-1 in -cell

Top: Immuno-precipitate (IP) with A20 Ab; Immuno-blot (IB) with HIF-1 Ab. Bottom: Immuno-precipitate (IP) with HIF-1 Ab; Immuno-blot (IB) with A20 Ab. CTRL = non treated sample.

- 150 - NF-B in Islet Survival and Function

5.3 DISCUSSION

In Chapter 3 we demonstrated that NF-B is clearly responsible for the immediate-early expression of many pro-inflammatory -cell-toxic genes. This data supports the notion that NF-B could be a good therapeutic target to protect islets following transplantation (Cardozo, Heimberg et al. 2001; Heimberg, Heremans et al.

2001; Eldor, Yeffet et al. 2006). However, we also demonstrated in Chapter 4 that NF-

B is responsible for the expression of the -cell-protective, anti-apoptotic gene A20.

Collectively these studies indicate a seemingly paradoxical role for NF-B in -cells.

This paradox raises an important question for the field, because if NF-B is required for

-cell survival in vivo in an inflammatory setting, administration of therapeutics to block NF-B may actually impair -cell survival. To help resolve this apparent paradox, we have examined the effect of blockade of NF-B upon islet survival and function in vivo in an islet allo-transplant model.

To achieve this goal we used two independent but complementary approaches to block NF-B in -cells in an inflammatory setting in vivo. In the first experiment we used the NF-B super-repressor IB, while in the second we used the pharmacological inhibitor PDTC. In both cases we validated the ability of these approaches to inhibit

NF-B by showing their efficacy in suppressing IL-1-stimulated gene expression.

Despite blocking inflammatory gene expression, these treatments did not prolong islet allograft survival as the grafts were rejected with a tempo similar to control islet grafts.

Thus, blockade of NF-B was not protective against inflammation.

These results are in contrast to previous studies demonstrating a protective role for blockade of NF-B in islets. Indeed, blockade of NF-B can prevent -cell apoptosis induced by the cytokines IL-1 and IFN- (Kwon, Corbett et al. 1998;

- 151 - NF-B in Islet Survival and Function

Giannoukakis, Rudert et al. 2000; Heimberg, Heremans et al. 2001) and can protect from STZ-induced diabetes in vivo (Mabley, Hasko et al. 2002; Eldor, Yeffet et al.

2006). One of the reasons for this difference may relate to the experimental setting used to discern the role of NF-B in -cells. In the case of the above studies, all the killing pathways were dependent upon NF-B. For instance, -cells were treated with the NF-

B-activating cytokine IL-1, resulting in the induction of iNOS and the generation of

NO, which is toxic to -cells (Cetkovic-Cvrlje and Eizirik 1994; Kwon, Corbett et al.

1995; Kwon, Corbett et al. 1998). Thus it is expected that blockade of NF-B would be protective in this system. However in vivo, as in our transplant models, -cells may be subjected to additional inflammatory stimuli, including TNF- (Chang, Kim et al. 2003;

Kim, Millet et al. 2007). In this context, blockade of NF-B sensitises cells to apoptosis

(Beg and Baltimore 1996; Van Antwerp, Martin et al. 1996; Wang, Mayo et al. 1996), by allowing the unopposed triggering of the caspase pathway, mediated through the

FADD/ caspase-8 death pathway (Ashkenazi and Dixit 1998; Marsters, Sheridan et al.

1998; Karin and Lin 2002). This pathway has been shown to be important in -cells, as blockade of gene transcription through AcD treatment (Chapter 4 and (Liuwantara,

Elliot et al. 2006)), or through over-expression of IB (Chang, Kim et al. 2003) sensitised -cells to TNF--mediated apoptosis. Thus we would predict that blockade of

NF-B in vivo would sensitise -cells to apoptosis following transplantation or during the development of T1D. In a recent report, Kim et al. demonstrated that over expression of IB in -cells accelerated diabetes development in NOD mice, a result consistent with our hypothesis (Kim, Millet et al. 2007).

Our studies from Chapter 4 would suggest that blockade of NF-B sensitises - cells to apoptosis by impairing their ability to up-regulate A20. To test this, we over- expressed A20 in islet grafts and followed allograft survival. Over expression of A20,

- 152 - NF-B in Islet Survival and Function which blocks NF-B activation in islets (Grey, Arvelo et al. 1999) did not sensitise allografts to failure but rather enabled long term survival of a subset of A20-expressing grafts. Since A20 is regulated by NF-B, we propose that NF-B-blocked grafts are sensitised to failure due to the loss of A20 expression. In support of our hypothesis, we found that inhibition of NF-B resulted in the loss of A20 expression in islets.

We also considered whether the poor function exhibited by the NF-B-blocked grafts was related to a loss in their metabolic function, a hypothesis previously proposed

(Norlin, Ahlgren et al. 2005). To test this, we inhibited NF-B activity in a marginal mass transplant model in a syngenetic setting. We found that NF-B-blocked islet grafts were unable to restore BGL to the degree achieved by control islets. Moreover, NF-B- blocked islet grafts were unresponsive to glucose stimulation both in vivo and in vitro, indicating a significant impairment in -cell function. Because NF-B is a transcription factor, we examined whether its blockade would effect the expression of genes important for glucose sensing and insulin secretion. We found that blockade of NF-B correlated with decreased expression of G6PI. G6PI converts glucose-6-phosphate into fructose-6-phosphate; the third step down the glycolysis pathway. Our results are suggestive that NF-B may be required, either directly or indirectly, for the expression of G6PI during inflammation. Consequently, the loss of NF-B would result in the breakdown of the glycolysis pathway, which is necessary to induce downstream ATP production and subsequently insulin secretion. We acknowledge however, that G6PI is not a rate-limiting step of glycolysis, and other mechanisms may be involved, which linked NF-B to the regulation of the metabolic function of islets.

Of further interest, we also found that blockade of NF-B resulted in the loss of

ARNT expression. ARNT is a transcription factor that regulates the expression of numerous metabolic genes, including G6PI (Gunton, Kulkarni et al. 2005). ARNT itself

- 153 - NF-B in Islet Survival and Function is stabilised by its binding partner HIF-1 (Zagorska and Dulak 2004) and we showed that A20 interacted with HIF-1. HIF-1 is regulated by ubiquitination, and A20 is a ubiquitin ligase, presenting the possibility of an NF-B/ A20/ HIF-1/ ARNT regulatory axis. Though this is speculation at the moment, it is an interesting hypothesis, which we are exploring.

In conclusion, we have addressed the function of NF-B in islets in the setting of an inflammatory milieu in vivo. We did this to resolve the question as to whether the important role of NF-B is to regulate pro-inflammatory genes or survival genes in vivo.

In this context we demonstrated an essential role for NF-B in maintaining -cell survival, mediated through the regulation of the anti-apoptotic gene A20. In addition, we provide provocative evidence that NF-B may also be involved in the maintenance of -cell function. Thus NF-B has a vital role in inflammatory-activated islets such as following transplantation. In this setting, the survival and metabolic function of NF-B far outweigh its pro-inflammatory role.

- 154 -

Chapter 6 General Discussion

Although autoimmune T-cells are the primary contributor to -cell death in

T1D, -cells also contribute to their own destruction through elaboration of toxic reagents and expression of pro-inflammatory substances. In this thesis we are interested to investigate the cellular mechanisms, which associates -cells to their own destruction. The work by Corbett et al. pioneered the notion that islets were involved in their own destruction, through the expression of pro-inflammatory mediators (Corbett,

Wang et al. 1992; Corbett, Kwon et al. 1993; Corbett, Sweetland et al. 1993a; Corbett,

Sweetland et al. 1993b). The same group also later demonstrated that this islet intrinsic pro-inflammatory response was regulated by NF-B (Kwon, Corbett et al. 1995; Kwon,

Corbett et al. 1998). Consequently, NF-B became one of the major focuses in the study of T1D as a potential therapeutic target (Cardozo, Kruhoffer et al. 2001; Eizirik and Mandrup-Poulsen 2001; Heimberg, Heremans et al. 2001; Eldor, Yeffet et al.

2006). We believe that deciphering the pro-inflammatory cellular mechanism of -cell in response to an inflammatory insult will give us a greater understanding in the pathogenesis of -cell death in T1D.

The transcription factor NF-B is important in cellular development, inflammation and survival (Karin and Lin 2002). In T1D however, the exact role of NF-

B in -cell destruction and survival has not been fully understood. Whilst in general,

NF-B is considered as a pro-inflammatory mediator responsible for -cell dysfunction and death (Cardozo, Heimberg et al. 2001; Cardozo, Kruhoffer et al. 2001), blockade of

NF-B in islets sensitised them to TNF- mediated apoptosis (Chang, Kim et al. 2003).

Demonstrating that in islets NF-B is important for both inflammation and survival.

Over the past years, conflicting evidence have been published regarding the role of NF- 155 General Discussion

B in -cells in T1D with respect to inflammation and apoptosis. During the course of this thesis, studies were published supporting both sides of the argument. Indeed NF-B has been shown to be essential for apoptotic destruction of -cell (Eldor, Yeffet et al.

2006) as well as essential for survival responses (Kim, Millet et al. 2007).

The islet transplantation model allows us to investigate the role of NF-B in islet survival and function in an unbiased experimental environment. In this setting, islets were exposed to a combination of immunological and/ or inflammatory insults, without the bias of activating only a certain death pathway(s). In vitro we found that NF-B was responsible for a large proportion of the islet’s pro-inflammatory responses (Chapter 3).

Interestingly, NF-B was also responsible for the islet’s anti-apoptotic gene response

(Chapter 4). In this thesis we attempted to reconcile the pro-inflammatory role of NF-

B to its protective function, especially in the context of -cell inflammation. Our in vivo study demonstrated that the pro-survival function of NF-B is more important than its pro-inflammatory function in the context of islet transplantation (Chapter 5).

Moreover, we found that NF-B is required for maintenance of normal islet function in an inflammatory setting. We demonstrate for the first time that A20 is the islet’s most highly expressed immediate-early anti-apoptotic response gene. Our data supports the concept that NF-B is important for the -cell’s survival response, which is mediated through its regulation of A20. This chapter will summarise and discuss the major findings presented in this thesis and suggest directions for future studies.

- 156 - General Discussion

6.1 NF-B AND THE ISLET’S IMMEDIATE-EARLY PRO-

INFLAMMATORY RESPONSES

NF-B has been known to have a pro-inflammatory role in -cells. Previous studies have demonstrated that NF-B is responsible for expression of pro- inflammatory genes in cytokine-activated islets (Cardozo, Heimberg et al. 2001).

Likewise, NF-B is responsible for the elaboration of NO in cytokine-activated islets, resulting in islet dysfunction and death (Corbett, Wang et al. 1992; Corbett, Sweetland et al. 1993b). In this thesis, we wanted to re-visit the area of islet inflammation looking specifically in the immediate early time point. The immediate early gene (IEG) response has previously been demonstrated to have significant contribution to the fate of the cell in response to a pro-inflammatory or death mediating stimulus (Goto, Matsumoto et al.

1994; Zhang, Zhu et al. 2003). More importantly, examination of the IEG response, will allow us to differentiate between the islet’s intrinsic pro-inflammatory responses against the secondary gene response (expressed as a consequence of islet-intrinsic release of inflammatory mediators as part of the immediate-early response).

In our microarray, we found that in response to the NF-B-inducing cytokines

IL-1 or TNF-, islets express a large number of pro-inflammatory IEGs (Chapter 3).

Our data is in agreement with previous findings, which demonstrate that islets participate in their immune destruction through expression of pro-inflammatory cytokines and chemokines (Abdi, Means et al. 2003). We found a large number of pro- inflammatory chemokines, expressed in islets in the immediate-early time point.

Chemokines such as Ccl2, Cxcl2, Cxcl10 and Cxcl1 are potent chemo-attractant for T- cells, macrophages, DC and NK-cells; and all of them have previously been associated with either insulitis or islet graft rejection (Frigerio, Junt et al. 2002; Piemonti, Leone et

- 157 - General Discussion al. 2002; Abdi, Means et al. 2003; Kutlu, Darville et al. 2003). Looking at the islet’s pro-inflammatory IEG-profile, it should come as no surprise that -cell destruction or islet graft rejection is a rapid and devastating process. Our data suggests that in the presence of an inflammatory milieu, islets have no choice but to activate a pro- inflammatory gene profile (Chapter 3). Consequently, the expression of these genes would not only increase the incoming cellular infiltrate, but also result in the elaboration of toxic agents detrimental to -cell function and survival.

In this study, we confirm that NF-B was responsible for the expression of the islet’s pro-inflammatory IEG expression. We demonstrated that blockade of NF-B could effectively inhibit the expression of these pro-inflammatory genes in islets. This finding alludes to an important concept, whereby blockade of NF-B-dependent genes could delay or prevent diabetes onset or improve islet allograft survival. For example:

Antibody neutralisation of Cxcl10, could suppress the occurrence of diabetes in the

NOD mouse (Morimoto, Yoneyama et al. 2004); Transgenic mice lacking the chemokine receptor CCR2 or CCR5 have prolonged islet graft survival, due to decreased T-cell activation necessary for graft rejection (Abdi, Smith et al. 2002; Lee,

Wang et al. 2003; Abdi, Means et al. 2004; Schroppel, Zhang et al. 2004); and finally, transgenic mice lacking the chemokine receptor CCR7, have permanent islet graft survival in vivo (Wang, Han et al. 2005). These studies and others, warrant the concept that blockade of NF-B in islets could improve graft survival, since NF-B is the transcriptional regulator responsible for the expression of these genes in islets.

- 158 - General Discussion

6.2 NF-B AND THE ISLET’S IMMEDIATE-EARLY ANTI-

APOPTOTIC RESPONSES

As earlier mentioned in this thesis (Chapter 1 Section 1.4 Apoptosis), there are several checks and balances, which control the apoptotic program. Ultimately, the fate of the cell is decided by the balance between the pro- and anti-apoptotic genes expressed (Bach, Hancock et al. 1997). In the case of T1D, little is known on whether

-cells are able to mount an anti-apoptotic response to counter the massive immunological attack. Given the intensity of the autoimmune insult faced by the - cells, or the allogeneic assault upon the foreign islet, the contribution of an islet mounted protective response may be deemed insignificant. However, understanding the natural -cell anti-apoptotic response genes may provide useful insight in the development of potential gene therapy targets. More importantly, previous gene transduction studies, which over-express anti-apoptotic gene(s) in islets, failed to achieve their goal, due to interference with normal -cell function. For instance, over- expression of Bcl-2 or Bcl-xL, in islets, using a transgenic animal model, achieved some protection from immune mediated assault but has impaired islet function (Allison,

Thomas et al. 2000; Zhou, Pena et al. 2000). This example illustrates the importance of mapping out the anti-apoptotic gene response in islets, to help determine a possible gene therapy candidate.

We found in our microarray, that unlike other cell types, islets have a limited anti-apoptotic IEG response. Of the 67 anti-apoptotic genes present in our microarray only two were significantly up regulated in this early time point. This finding may indicate that -cells have a restricted set of inducible anti-apoptotic responses, possibly to avoid interference with its normal metabolic function. Of the two inducible anti- apoptotic IEGs, A20 was the highest expressed and BIRC3 was second (Chapter 4). Our

- 159 - General Discussion data demonstrates that other anti-apoptotic genes were present, but not induced in the immediate-early time point. Our data therefore does not contradict other studies demonstrating the expression of anti-apoptotic genes in cytokine-activated islets

(Cardozo, Heimberg et al. 2001; Cardozo, Kruhoffer et al. 2001), but rather highlights the importance of A20 and BIRC3 in the immediate-early time point.

A20 is a zinc finger protein, first discovered as a TNF- inducible gene

(Opipari, Boguski et al. 1990), and was later found to have protective function against

TNF- induced death (Opipari, Hu et al. 1992). Further studies indicated that A20 has both anti-apoptotic (Sarma, Lin et al. 1995; Tewari, Wolf et al. 1995) and anti- inflammatory functions (Cooper, Stroka et al. 1996). A20 regulates inflammation by regulating NF-B (Cooper, Stroka et al. 1996; De Valck, Heyninck et al. 1996), and its functional significance was demonstrated in the poor survival of total A20 KO mice

(Lee, Boone et al. 2000). A20 regulates NF-B activation through its unique ability of having both ubiquitin ligase and de-ubiquitination domains in the one molecule (Wertz,

O'Rourke et al. 2004). The exact mechanism behind A20’s anti-apoptotic function has not yet been deciphered, but current evidence demonstrates a likelihood of a direct inhibition of caspase 8 (Daniel, Arvelo et al. 2004). A previous study has demonstrated that the A20 promoter contains two NF-B binding sites important for its activation, however this data has not been translated into other cell types (Krikos, Laherty et al.

1992).

Interestingly, our study demonstrates that, in islets, A20 expression was under the regulation of NF-B (Chapter 4). To many people this would come as no surprise, since NF-B has previously been shown to have anti-apoptotic function in a number of independent studies (Beg and Baltimore 1996; Van Antwerp, Martin et al. 1996; Wang,

Mayo et al. 1996). Although as a caveat, these studies were performed primarily on

- 160 - General Discussion carcinoma cell lines and few have translated these studies into primary cell types. In

T1D however, NF-B has a reputation as the mediator of -cell inflammation and death

(Eizirik and Mandrup-Poulsen 2001). Nonetheless, Chang et al. demonstrated that blockade of NF-B sensitised islets to TNF- mediated apoptosis in vitro (Chang, Kim et al. 2003). This finding was published less than a year prior to the initiation of this thesis, indicating the lack of evidence present regarding the protective effect of NF-B in islets. We found that in absence of de novo gene transcription, -cells are also sensitised to death, an effect, which correlates with loss of A20 induction (Chapter 4).

Our data therefore, suggests that A20 is a NF-B target gene responsible in mediating the protection against TNF- induced apoptosis in the earlier publication (Chang, Kim et al. 2003). Supportive of this hypothesis we found that -cells over-expressing A20 were protected from FADD-induced apoptosis in vitro. This component of my thesis demonstrates a significant role for NF-B in mediating -cell protection, through expression of A20.

6.3 RECONCILING THE TWO FACTIONS: NF-B IN ISLET

FUNCTION

Our data clearly suggests that NF-B has a paradoxical role in islet function and survival. On the one hand, NF-B is responsible for activating a massive islet-intrinsic pro-inflammatory response (Chapter3). On the other hand however, NF-B is responsible for islet survival and function (Chapter 4). We hypothesise therefore that

NF-B is the pivoting point holding the balance between islet survival and death, in face of an inflammatory insult (Figure 6.1). To test which of the two NF-B functions is more important in islets in the inflammatory milieu; we conducted a series of tests in islets in a transplant setting. We questioned whether blockade of NF-B in islets would

- 161 - General Discussion block the expression of pro-inflammatory genes and promote islet survival or inhibit the induction of survival genes and sensitise the islet to death.

Figure 6.1. NF-B controls the survival balance in -cells.

We found that, although blockade of NF-B in islets in vitro resulted in the inhibition of pro-inflammatory gene expression; in vivo, islet allograft survival was not prolonged. Rather, our data indicates that blockade of NF-B in islets, in the inflammatory milieu, will block the protective function of NF-B and result in islet graft failure. Thus in the inflammatory setting, the protective function of NF-B is of greater importance than that of the pro-inflammatory effect. This finding however, is in contrast to other studies that promote NF-B as a death mediator of -cells in T1D

(Cardozo, Kruhoffer et al. 2001; Heimberg, Heremans et al. 2001; Eldor, Yeffet et al.

2006). In particular, the study by Eldor et al. demonstrated that blockade of NF-B in vivo protected islets from low dose streptozotocin (STZ) induced diabetes (Eldor, Yeffet et al. 2006). A major caveat to these studies however, is that only a specific death

- 162 - General Discussion pathway was explored, while ignoring other possible death mediators. IL-1 exposure in vitro (Cardozo, Kruhoffer et al. 2001; Heimberg, Heremans et al. 2001) or low-dose

STZ treatment in vivo (Eldor, Yeffet et al. 2006), mediates -cell death or islet destruction, specifically through an NF-B dependent death pathway (Corbett, Kwon et al. 1993; Kwon, Corbett et al. 1998; Mabley, Hasko et al. 2002). Thus promotion of - cell and/or islet survival was achieved through inhibition of NF-B, since islet death was induced solely through the NF-B pathway. Unfortunately in these studies, other important mediators of -cell death such as TNF-, which operates via activation of caspase-8, was not explored (Chapter 1 Section 1.4 Apoptosis).

In contrast to the above mentioned studies, Chang et al. demonstrated that blockade of NF-B sensitised islets to TNF induced death in vitro (Chang, Kim et al.

2003). Moreover, only recently, Kim et al. demonstrated that blockade of NF-B in vitro accelerates disease onset in NOD mice. Kim et al. demonstrated that blockade of

NF-B in the transgenic mice sensitised islets to TNF- induced death, though it was protective against an IL-1 induced death (Kim, Millet et al. 2007). It was not until recently therefore that a balanced study on the role of NF-B was conducted, investigating both its protective and destructive functions.

As we demonstrated earlier, A20 was the islets’ highest expressed anti-apoptotic gene, and was under the regulation of NF-B. We found in our study that over- expression of A20 could promote long-term islet graft survival in 20% of the recipient animals, without causing poor islet function in the early post transplant period.

Together, these data demonstrate that, islets have a potent anti-apoptotic response, quite comparable to the inflicting pro-inflammatory insult. More importantly, we demonstrate here that indeed NF-B is important in promoting islet survival, through its regulation of anti-apoptotic genes such as A20 (Chapter 4).

- 163 - General Discussion

Interestingly, we also found that blockade of NF-B in vivo in a syngeneic transplantation setting also sensitise islet grafts to poor metabolic function. In support of our finding: Norlin et al. demonstrated that NF-B is important in controlling islet’s metabolic function (Norlin, Ahlgren et al. 2005). This study was criticised by Eldor et al. since over-expression of IB in the Norlin study was linked to the Pdx1 promoter, which is expressed during pancreatic development (Eldor, Yeffet et al. 2006). To overcome this problem, Eldor et al. utilised an inducible over-expression of IB linked to the rat insulin promoter (RIP), which was activated only when the mice reached adulthood (Eldor, Yeffet et al. 2006). Using this technique, the mice over- expressing IB did not have hyperglycaemia and were glucose tolerant (Eldor, Yeffet et al. 2006). Similarly, Kim et al. did not find any islet-associated metabolic defect in the NF-B-blocked mice (Kim, Millet et al. 2007). Ours however is the first study to examine the role of NF-B in -cell function in the context of islet isolation with subsequent transplantation into hyperglycaemic recipient. In this context, we found that

NF-B has an important role in mediating the islet’s normal metabolic function. We found that loss of GSIS may be associated with the loss of glucose-6-phosphoisomerase

(G6PI) and Aryl-Hydrocarbon Nuclear Translocator (ARNT). Importantly, we found that A20 was able to associate with the transcription factor HIF-1 in islets in vitro.

Previous work by Gunton et al. demonstrated an important role for ARNT in the metabolic function of islets; and HIF-1 is an important binding partner of ARNT.

Interestingly, loss of GSIS and G6PI were also observed with phenotypic changes of the insulinoma cell line Min-6 after treatment with HIF-1 siRNA (Cheng, Stokes et al.

2007). We speculate that in the context of islet inflammation, NF-B may contribute to the regulation of the islet’s metabolic function, through its expression of A20, which in turn could contribute to the regulation of HIF-1. We emphasise that the interpretation

- 164 - General Discussion of this findings are speculative and further studies are required to further our understanding in this matter.

6.4 FUTURE DIRECTIONS

Throughout the course of this thesis a number of findings were made, which would be interesting to develop further. In the first instance, in contrast to BALB/c islets our microarray data demonstrated a trend in the NOD islets to have greater sensitivity towards expression of pro-inflammatory IEGs in response to the cytokines

IL-1 or TNF-. None of the transcripts that were more highly expressed in NOD islets mapped to any of the known Idd loci. However, this result does raise interesting questions as to the role of the islets response to inflammation in the pathogenesis of

T1D. In the immediate future, it would be necessary to confirm the result of the microarray by RTqPCR and secondly by examining protein expression in isolated islets.

Whether these differences we observed relate to promoter polymorphisms, alteration in cytokine signalling networks or other processes remains to be determined.

Secondly, we found that in IL-1 induction of pro-inflammatory genes, in islets, was of a much greater intensity than that of TNF-. We found that this phenomenon was also true for expression of A20 but not Birc3. Studies in other cell types have demonstrated that distinct patterns of gene expression can occur following NF-B activation by different cytokines, which may relate to signalling pathway-specific mechanisms that results in alternate activation of IKK or IB proteins (Thompson,

Phillips et al. 1995; Werner, Barken et al. 2005). Our study raises the possibility that similar NF-B regulatory mechanisms are true in -cells.

Importantly, this thesis demonstrated that A20 over-expression could prolong islet allograft survival in 20% of the recipient mice. Further investigation into this phenomenon will be performed in which A20-expressing islets will be transplanted into - 165 - General Discussion recipient mice deficient in one or more T-cell killing pathways (i.e. FasL-, perforin/ granzyme- or TNF-KO mice). In this way, we can decipher the efficacy of A20 against different pro-apoptotic pathways in vivo. Further study will also be conducted to utilise low-dose immuno-suppressive agents, in an attempt to improve the success rate of long term survival of A20-expressing islet graft. It would be an important step forward, if we could demonstrate that gene therapy with A20 could improve graft survival in combination with a clinically applicable immuno-suppressive agent.

Another interesting aspect of this work, which we will explore in the immediate future, is how A20 affected the incoming cellular infiltrate. We question whether over- expression of A20 would induce graft tolerance, thus inhibiting subsequent attack from the immune system; or does over-expression of A20 dampen the islet’s intrinsic death pathways, thus inhibiting death induction by external stimuli. We believe that our studies support the concept that A20 has the potential to be developed as a gene therapy candidate to inhibit islet allograft rejection.

Finally, the question on how NF-B could be important in regulating -cell metabolic function in the context of islet transplantation will also require future attention. We found that A20 could associate with HIF-1 in vitro, which we speculate may contribute to the role of NF-B in the regulation of islet’s metabolic function. We also found an interesting phenotypic similarity between -cell lacking HIF-1 and islet lacking NF-B, in which both result in the down regulation of G6PI. These data provide clues into the relationship between NF-B and islet metabolic function. Future studies in this are currently under way.

- 166 - General Discussion

Figure 6.2. The three-way balance of NF-B.

6.5 CONCLUDING REMARKS

Understanding the molecular mechanism of islet function and survival is an essential step toward finding a cure for T1D. This thesis introduced a new concept in the role of NF-B with regard to islet function and survival. As we demonstrated throughout this study, a complex relationship exists between NF-B and -cell survival.

This relationship could be illustrated as a three-way balance scale (Figure 6.2), where on one arm NF-B is responsible for “islet death”, on the other: “survival” and on the third arm: “metabolic function”. Consequently, blockade of NF-B rather than protecting islets from inflammatory attack resulted in -cell failure, demonstrating the importance of NF-B in controlling survival and metabolic function. A future challenge will be to determine whether more selective inhibition of NF-B can prevent inflammatory gene expression without compromising -cell viability.

- 167 -

References

Abdi, R., T. K. Means, T. Ito, R. N. Smith, N. Najafian, M. Jurewicz, V. Tchipachvili, I. Charo, H. Auchincloss, Jr., M. H. Sayegh and A. D. Luster (2004). "Differential role of CCR2 in islet and heart allograft rejection: tissue specificity of chemokine/chemokine receptor function in vivo." J Immunol 172(2): 767-75. Abdi, R., T. K. Means and A. D. Luster (2003). "Chemokines in islet allograft rejection." Diabetes Metab Res Rev 19(3): 186-90. Abdi, R., R. N. Smith, L. Makhlouf, N. Najafian, A. D. Luster, H. Auchincloss, Jr. and M. H. Sayegh (2002). "The role of CC chemokine receptor 5 (CCR5) in islet allograft rejection." Diabetes 51(8): 2489-95. Acha-Orbea, H. and H. O. McDevitt (1987). "The first external domain of the nonobese diabetic mouse class II I-A beta chain is unique." Proc Natl Acad Sci U S A 84(8): 2435-9. Ainbinder, E., M. Revach, O. Wolstein, S. Moshonov, N. Diamant and R. Dikstein (2002). "Mechanism of rapid transcriptional induction of tumor necrosis factor alpha- responsive genes by NF-kappaB." Mol Cell Biol 22(18): 6354-62. Akira, S., K. Takeda and T. Kaisho (2001). "Toll-like receptors: critical proteins linking innate and acquired immunity." Nat Immunol 2(8): 675-80. Allison, J., H. Thomas, D. Beck, J. L. Brady, A. M. Lew, A. Elefanty, H. Kosaka, T. W. Kay, D. C. Huang and A. Strasser (2000). "Transgenic overexpression of human Bcl-2 in islet beta cells inhibits apoptosis but does not prevent autoimmune destruction." Int Immunol 12(1): 9-17. Ammendrup, A., A. Maillard, K. Nielsen, N. Aabenhus Andersen, P. Serup, O. Dragsbaek Madsen, T. Mandrup-Poulsen and C. Bonny (2000). "The c-Jun amino- terminal kinase pathway is preferentially activated by interleukin-1 and controls apoptosis in differentiating pancreatic beta-cells." Diabetes 49(9): 1468-76. Andre, I., A. Gonzalez, B. Wang, J. Katz, C. Benoist and D. Mathis (1996). "Checkpoints in the progression of autoimmune disease: lessons from diabetes models." Proc Natl Acad Sci U S A 93(6): 2260-3. Anrather, J., V. Csizmadia, C. Brostjan, M. P. Soares, F. H. Bach and H. Winkler (1997). "Inhibition of bovine endothelial cell activation in vitro by regulated expression of a transdominant inhibitor of NF-kappa B." J Clin Invest 99(4): 763-72. Arnush, M., M. R. Heitmeier, A. L. Scarim, M. H. Marino, P. T. Manning and J. A. Corbett (1998). "IL-1 produced and released endogenously within human islets inhibits beta cell function." J Clin Invest 102(3): 516-26. Arnush, M., A. L. Scarim, M. R. Heitmeier, C. B. Kelly and J. A. Corbett (1998). "Potential role of resident islet macrophage activation in the initiation of autoimmune diabetes." J Immunol 160(6): 2684-91. Arvelo, M. B., J. T. Cooper, C. Longo, S. Daniel, S. T. Grey, J. Mahiou, E. Czismadia, G. Abu-Jawdeh and C. Ferran (2002). "A20 protects mice from D- galactosamine/lipopolysaccharide acute toxic lethal hepatitis." Hepatology 35(3): 535-43.

168 References

Ashkenazi, A. and V. M. Dixit (1998). "Death receptors: signaling and modulation." Science 281(5381): 1305-8. Atkinson, M. A. and E. H. Leiter (1999). "The NOD mouse model of type 1 diabetes: as good as it gets?" Nat Med 5(6): 601-4. Bach, F. H., W. W. Hancock and C. Ferran (1997). "Protective genes expressed in endothelial cells: a regulatory response to injury." Immunology Today 18(10): 483-6. Bach, J. F. (1994). "Insulin-dependent diabetes mellitus as an autoimmune disease." Endocr Rev 15(4): 516-42. Bach, J. F. and D. Mathis (1997). "The NOD mouse." Res Immunol 148(5): 285-6. Baeder, W. L., J. Sredy, S. N. Sehgal, J. Y. Chang and L. M. Adams (1992). "Rapamycin prevents the onset of insulin-dependent diabetes mellitus (IDDM) in NOD mice." Clin Exp Immunol 89(2): 174-8. Baekkeskov, S., H. J. Aanstoot, S. Christgau, A. Reetz, M. Solimena, M. Cascalho, F. Folli, H. Richter-Olesen and P. De Camilli (1990). "Identification of the 64K autoantigen in insulin-dependent diabetes as the GABA-synthesizing enzyme glutamic acid decarboxylase." Nature 347(6289): 151-6. Bain, S. C., J. B. Prins, C. M. Hearne, N. R. Rodrigues, B. R. Rowe, L. E. Pritchard, R. J. Ritchie, J. R. Hall, D. E. Undlien, K. S. Ronningen and et al. (1992). "Insulin gene region-encoded susceptibility to type 1 diabetes is not restricted to HLA-DR4- positive individuals." Nat Genet 2(3): 212-5. Baisch, J. M., T. Weeks, R. Giles, M. Hoover, P. Stastny and J. D. Capra (1990). "Analysis of HLA-DQ genotypes and susceptibility in insulin-dependent diabetes mellitus." N Engl J Med 322(26): 1836-41. Banner, D. W., A. D'Arcy, W. Janes, R. Gentz, H. J. Schoenfeld, C. Broger, H. Loetscher and W. Lesslauer (1993). "Crystal structure of the soluble human 55 kd TNF receptor-human TNF beta complex: implications for TNF receptor activation." Cell 73(3): 431-45. Barr, P. J. and L. D. Tomei (1994). "Apoptosis and its role in human disease." Biotechnology (N Y) 12(5): 487-93. Beg, A. A. and D. Baltimore (1996). "An essential role for NF-kappaB in preventing TNF-alpha-induced cell death." Science 274(5288): 782-4. Bell, G. I., S. Horita and J. H. Karam (1984). "A polymorphic locus near the human insulin gene is associated with insulin-dependent diabetes mellitus." Diabetes 33(2): 176-83. Bell, G. I., M. J. Selby and W. J. Rutter (1982). "The highly polymorphic region near the human insulin gene is composed of simple tandemly repeating sequences." Nature 295(5844): 31-5. Bendelac, A., C. Carnaud, C. Boitard and J. F. Bach (1987). "Syngeneic transfer of autoimmune diabetes from diabetic NOD mice to healthy neonates. Requirement for both L3T4+ and Lyt-2+ T cells." J Exp Med 166(4): 823-32. Bennett, S. T., A. M. Lucassen, S. C. Gough, E. E. Powell, D. E. Undlien, L. E. Pritchard, M. E. Merriman, Y. Kawaguchi, M. J. Dronsfield, F. Pociot and et al. (1995). "Susceptibility to human type 1 diabetes at IDDM2 is determined by tandem repeat variation at the insulin gene minisatellite locus." Nat Genet 9(3): 284-92. - 169 - References

Bennett, S. T., A. J. Wilson, F. Cucca, J. Nerup, F. Pociot, P. A. McKinney, A. H. Barnett, S. C. Bain and J. A. Todd (1996). "IDDM2-VNTR-encoded susceptibility to type 1 diabetes: dominant protection and parental transmission of alleles of the insulin gene-linked minisatellite locus." J Autoimmun 9(3): 415-21. Benoist, C. and D. Mathis (1997). "Cell death mediators in autoimmune diabetes--no shortage of suspects." Cell 89(1): 1-3. Bergman, B. and K. Haskins (1994). "Islet-specific T-cell clones from the NOD mouse respond to beta-granule antigen." Diabetes 43(2): 197-203. Bergstrand, A. and H. Bucht (1959). "The glomerular lesions of diabetes mellitus and their electron-microscope appearances." J Pathol Bacteriol 77(1): 231-42. Birbach, A., P. Gold, B. R. Binder, E. Hofer, R. de Martin and J. A. Schmid (2002). "Signaling molecules of the NF-kappa B pathway shuttle constitutively between cytoplasm and nucleus." J Biol Chem 277(13): 10842-51. Bleich, D., M. Polak, G. S. Eisenbarth and R. A. Jackson (1993). "Decreased risk of type I diabetes in offspring of mothers who acquire diabetes during adrenarchy." Diabetes 42(10): 1433-9. Bodmer, J. L., K. Burns, P. Schneider, K. Hofmann, V. Steiner, M. Thome, T. Bornand, M. Hahne, M. Schroter, K. Becker, A. Wilson, L. E. French, J. L. Browning, H. R. MacDonald and J. Tschopp (1997). "TRAMP, a novel apoptosis- mediating receptor with sequence homology to tumor necrosis factor receptor 1 and Fas(Apo-1/CD95)." Immunity 6(1): 79-88. Boitard, C., S. Michie, P. Serrurier, G. W. Butcher, A. P. Larkins and H. O. McDevitt (1985). "In vivo prevention of thyroid and pancreatic autoimmunity in the BB rat by antibody to class II major histocompatibility complex gene products." Proc Natl Acad Sci U S A 82(19): 6627-31. Boldin, M. P., T. M. Goncharov, Y. V. Goltsev and D. Wallach (1996). "Involvement of MACH, a novel MORT1/FADD-interacting protease, in Fas/APO-1- and TNF receptor-induced cell death." Cell 85(6): 803-15. Boldin, M. P., I. L. Mett, E. E. Varfolomeev, I. Chumakov, Y. Shemer-Avni, J. H. Camonis and D. Wallach (1995). "Self-association of the "death domains" of the p55 tumor necrosis factor (TNF) receptor and Fas/APO1 prompts signaling for TNF and Fas/APO1 effects." J Biol Chem 270(1): 387-91. Bone, A. J., R. Walker, A. M. Varey, A. Cooke and J. D. Baird (1990). "Effect of cyclosporin on pancreatic events and development of diabetes in BB/Edinburgh rats." Diabetes 39(4): 508-14. Bonifacio, E., M. Hummel, M. Walter, S. Schmid and A. G. Ziegler (2004). "IDDM1 and multiple family history of type 1 diabetes combine to identify neonates at high risk for type 1 diabetes." Diabetes Care 27(11): 2695-700. Bortell, R., T. Kanaitsuka, L. A. Stevens, J. Moss, J. P. Mordes, A. A. Rossini and D. L. Greiner (1999). "The RT6 (Art2) family of ADP-ribosyltransferases in rat and mouse." Mol Cell Biochem 193(1-2): 61-8. Bottazzo, G. F., B. M. Dean, J. M. McNally, E. H. MacKay, P. G. Swift and D. R. Gamble (1985). "In situ characterization of autoimmune phenomena and expression of HLA molecules in the pancreas in diabetic insulitis." N Engl J Med 313(6): 353-60.

- 170 - References

Bougneres, P. F., J. C. Carel, L. Castano, C. Boitard, J. P. Gardin, P. Landais, J. Hors, M. J. Mihatsch, M. Paillard, J. L. Chaussain and et al. (1988). "Factors associated with early remission of type I diabetes in children treated with cyclosporine." N Engl J Med 318(11): 663-70. Bougneres, P. F., P. Landais, C. Boisson, J. C. Carel, N. Frament, C. Boitard, J. L. Chaussain and J. F. Bach (1990). "Limited duration of remission of insulin dependency in children with recent overt type I diabetes treated with low-dose cyclosporin." Diabetes 39(10): 1264-72. Bouma, G., J. M. Coppens, S. Mourits, T. Nikolic, S. Sozzani, H. A. Drexhage and M. A. Versnel (2005). "Evidence for an enhanced adhesion of DC to fibronectin and a role of CCL19 and CCL21 in the accumulation of DC around the pre-diabetic islets in NOD mice." Eur J Immunol 35(8): 2386-96. Bours, V., P. R. Burd, K. Brown, J. Villalobos, S. Park, R. P. Ryseck, R. Bravo, K. Kelly and U. Siebenlist (1992). "A novel mitogen-inducible gene product related to p50/p105-NF-kappa B participates in transactivation through a kappa B site." Mol Cell Biol 12(2): 685-95. Brown, A. M., M. W. Linhoff, B. Stein, K. L. Wright, A. S. Baldwin, Jr., P. V. Basta and J. P. Ting (1994). "Function of NF-kappa B/Rel binding sites in the major histocompatibility complex class II invariant chain promoter is dependent on cell- specific binding of different NF-kappa B/Rel subunits." Mol Cell Biol 14(5): 2926- 35. Budihardjo, I., H. Oliver, M. Lutter, X. Luo and X. Wang (1999). "Biochemical pathways of caspase activation during apoptosis." Annu Rev Cell Dev Biol 15: 269- 90. Burcelin, R. G., M. Eddouks, M. Beylot, S. Normand, C. Boitard, G. Feutren, P. Landais, J. P. Riou, J. R. Girard, J. F. Bach and et al. (1993). "Hypersensitivity to insulin during remissions in cyclosporin-treated IDDM patients." Diabetes Care 16(6): 881-8. Cai, J. and M. Boulton (2002). "The pathogenesis of diabetic retinopathy: old concepts and new questions." Eye 16(3): 242-60. Caillat-Zucman, S., H. J. Garchon, J. Timsit, R. Assan, C. Boitard, I. Djilali-Saiah, P. Bougneres and J. F. Bach (1992). "Age-dependent HLA genetic heterogeneity of type 1 insulin-dependent diabetes mellitus." J Clin Invest 90(6): 2242-50. Cailleau, C., A. Diu-Hercend, E. Ruuth, R. Westwood and C. Carnaud (1997). "Treatment with neutralizing antibodies specific for IL-1beta prevents cyclophosphamide-induced diabetes in nonobese diabetic mice." Diabetes 46(6): 937- 40. Campbell, I. L., A. Cutri, A. Wilson and L. C. Harrison (1989). "Evidence for IL-6 production by and effects on the pancreatic beta-cell." J Immunol 143(4): 1188-91. Cardozo, A. K., H. Heimberg, Y. Heremans, R. Leeman, B. Kutlu, M. Kruhoffer, T. Orntoft and D. L. Eizirik (2001). "A comprehensive analysis of cytokine-induced and nuclear factor-kappa B-dependent genes in primary rat pancreatic beta-cells." J Biol Chem 276(52): 48879-86.

- 171 - References

Cardozo, A. K., M. Kruhoffer, R. Leeman, T. Orntoft and D. L. Eizirik (2001). "Identification of novel cytokine-induced genes in pancreatic beta-cells by high- density oligonucleotide arrays." Diabetes 50(5): 909-20. Cetkovic-Cvrlje, M. and D. L. Eizirik (1994). "TNF-alpha and IFN-gamma potentiate the deleterious effects of IL-1 beta on mouse pancreatic islets mainly via generation of nitric oxide." Cytokine 6(4): 399-406. Chambers, C. A. and J. P. Allison (1997). "Co-stimulation in T cell responses." Curr Opin Immunol 9(3): 396-404. Chang, I., S. Kim, J. Y. Kim, N. Cho, Y. H. Kim, H. S. Kim, M. K. Lee, K. W. Kim and M. S. Lee (2003). "Nuclear factor kappaB protects pancreatic beta-cells from tumor necrosis factor-alpha-mediated apoptosis." Diabetes 52(5): 1169-75. Chatenoud, L., E. Thervet, J. Primo and J. F. Bach (1994). "Anti-CD3 antibody induces long-term remission of overt autoimmunity in nonobese diabetic mice." Proc Natl Acad Sci U S A 91(1): 123-7. Chen, W., I. Bergerot, J. F. Elliott, L. C. Harrison, N. Abiru, G. S. Eisenbarth and T. L. Delovitch (2001). "Evidence that a peptide spanning the B-C junction of proinsulin is an early Autoantigen epitope in the pathogenesis of type 1 diabetes." J Immunol 167(9): 4926-35. Chen, Z., J. Hagler, V. J. Palombella, F. Melandri, D. Scherer, D. Ballard and T. Maniatis (1995). "Signal-induced site-specific phosphorylation targets I kappa B alpha to the ubiquitin-proteasome pathway." Genes Dev 9(13): 1586-97. Cheng, K., R. Stokes and J. E. Gunton (2007). Hypoxia-inducing factor-1alpha (HIF- 1alpha) is necessary for normal beta-cell function and insulin secretion Australian Diabetes Society (ADS) & Australian Diabetes Educators Association (ADEA) Annual Scientific Meeting in association with New Zealand Society for the Study of Diabetes (NZSSD). Christchurch, New Zealand, ASN Events Pty Ltd. Chervonsky, A. V., Y. Wang, F. S. Wong, I. Visintin, R. A. Flavell, C. A. Janeway, Jr. and L. A. Matis (1997). "The role of Fas in autoimmune diabetes." Cell 89(1): 17- 24. Chicheportiche, Y., P. R. Bourdon, H. Xu, Y. M. Hsu, H. Scott, C. Hession, I. Garcia and J. L. Browning (1997). "TWEAK, a new secreted ligand in the tumor necrosis factor family that weakly induces apoptosis." J Biol Chem 272(51): 32401-10. Chien, Y. H., N. R. Gascoigne, J. Kavaler, N. E. Lee and M. M. Davis (1984). "Somatic recombination in a murine T-cell receptor gene." Nature 309(5966): 322-6. Chinnaiyan, A. M., K. O'Rourke, M. Tewari and V. M. Dixit (1995). "FADD, a novel death domain-containing protein, interacts with the death domain of Fas and initiates apoptosis." Cell 81(4): 505-12. Chinnaiyan, A. M., K. O'Rourke, G. L. Yu, R. H. Lyons, M. Garg, D. R. Duan, L. Xing, R. Gentz, J. Ni and V. M. Dixit (1996). "Signal transduction by DR3, a death domain-containing receptor related to TNFR-1 and CD95." Science 274(5289): 990- 2. Chinnaiyan, A. M., C. G. Tepper, M. F. Seldin, K. O'Rourke, F. C. Kischkel, S. Hellbardt, P. H. Krammer, M. E. Peter and V. M. Dixit (1996). "FADD/MORT1 is a

- 172 - References common mediator of CD95 (Fas/APO-1) and tumor necrosis factor receptor-induced apoptosis." J Biol Chem 271(9): 4961-5. Christianson, S. W., L. D. Shultz and E. H. Leiter (1993). "Adoptive transfer of diabetes into immunodeficient NOD-scid/scid mice. Relative contributions of CD4+ and CD8+ T-cells from diabetic versus prediabetic NOD.NON-Thy-1a donors." Diabetes 42(1): 44-55. Cleveland, J. L. and J. N. Ihle (1995). "Contenders in FasL/TNF death signaling." Cell 81(4): 479-82. Cnop, M., N. Welsh, J. C. Jonas, A. Jorns, S. Lenzen and D. L. Eizirik (2005). "Mechanisms of pancreatic beta-cell death in type 1 and type 2 diabetes: many differences, few similarities." Diabetes 54 Suppl 2: S97-107. Coles, H. S., J. F. Burne and M. C. Raff (1993). "Large-scale normal cell death in the developing rat kidney and its reduction by epidermal growth factor." Development 118(3): 777-84. Concannon, P., K. J. Gogolin-Ewens, D. A. Hinds, B. Wapelhorst, V. A. Morrison, B. Stirling, M. Mitra, J. Farmer, S. R. Williams, N. J. Cox, G. I. Bell, N. Risch and R. S. Spielman (1998). "A second-generation screen of the human genome for susceptibility to insulin-dependent diabetes mellitus." Nat Genet 19(3): 292-6. Cooper, J. T., D. M. Stroka, C. Brostjan, A. Palmetshofer, F. H. Bach and C. Ferran (1996). "A20 blocks endothelial cell activation through a NF-kappaB-dependent mechanism." J Biol Chem 271(30): 18068-73. Cooper, M. E. (1998). "Pathogenesis, prevention, and treatment of diabetic nephropathy." Lancet 352(9123): 213-9. Corbett, J. A., G. Kwon, M. H. Marino, C. P. Rodi, P. M. Sullivan, J. Turk and M. L. McDaniel (1996). "Tyrosine kinase inhibitors prevent cytokine-induced expression of iNOS and COX-2 by human islets." American Journal of Physiology 270(6 Pt 1): C1581-7. Corbett, J. A., G. Kwon, J. Turk and M. L. McDaniel (1993). "IL-1 beta induces the coexpression of both nitric oxide synthase and cyclooxygenase by islets of Langerhans: activation of cyclooxygenase by nitric oxide." Biochemistry 32(50): 13767-70. Corbett, J. A., M. A. Sweetland, J. R. Lancaster, Jr. and M. L. McDaniel (1993a). "A 1-hour pulse with IL-1 beta induces formation of nitric oxide and inhibits insulin secretion by rat islets of Langerhans: evidence for a tyrosine kinase signaling mechanism." Faseb J 7(2): 369-74. Corbett, J. A., M. A. Sweetland, J. L. Wang, J. R. Lancaster, Jr. and M. L. McDaniel (1993b). "Nitric oxide mediates cytokine-induced inhibition of insulin secretion by human islets of Langerhans." Proc Natl Acad Sci U S A 90(5): 1731-5. Corbett, J. A., J. L. Wang, M. A. Sweetland, J. R. Lancaster, Jr. and M. L. McDaniel (1992). "Interleukin 1 beta induces the formation of nitric oxide by beta-cells purified from rodent islets of Langerhans. Evidence for the beta-cell as a source and site of action of nitric oxide." J Clin Invest 90(6): 2384-91.

- 173 - References

Corper, A. L., T. Stratmann, V. Apostolopoulos, C. A. Scott, K. C. Garcia, A. S. Kang, I. A. Wilson and L. Teyton (2000). "A structural framework for deciphering the link between I-Ag7 and autoimmune diabetes." Science 288(5465): 505-11. Cory, S. and J. M. Adams (2002). "The Bcl2 family: regulators of the cellular life-or- death switch." Nat Rev Cancer 2(9): 647-56. Cryns, V. and J. Yuan (1998). "Proteases to die for." Genes Dev 12(11): 1551-70. Dahlen, E., K. Dawe, L. Ohlsson and G. Hedlund (1998). "Dendritic cells and macrophages are the first and major producers of TNF-alpha in pancreatic islets in the nonobese diabetic mouse." J Immunol 160(7): 3585-93. Daniel, D., R. G. Gill, N. Schloot and D. Wegmann (1995). "Epitope specificity, cytokine production profile and diabetogenic activity of insulin-specific T cell clones isolated from NOD mice." Eur J Immunol 25(4): 1056-62. Daniel, S., M. B. Arvelo, V. I. Patel, C. R. Longo, G. Shrikhande, T. Shukri, J. Mahiou, D. W. Sun, C. Mottley, S. T. Grey and C. Ferran (2004). "A20 protects endothelial cells from TNF-, Fas-, and NK-mediated cell death by inhibiting caspase 8 activation." Blood 104(8): 2376-84. Daniel, S., V. I. Patel, G. V. Shrikhande, S. T. Scali, H. E. Ramsey, E. Csizmadia, N. Benhaga, M. D. Fisher, M. B. Arvelo and C. Ferran (2006). "The universal NF- kappaB inhibitor a20 protects from transplant vasculopathy by differentially affecting apoptosis in endothelial and smooth muscle cells." Transplant Proc 38(10): 3225-7. Darville, M. I. and D. L. Eizirik (2001). "Cytokine induction of Fas gene expression in insulin-producing cells requires the transcription factors NF-kappaB and C/EBP." Diabetes 50(8): 1741-8. Davalli, A. M., L. Scaglia, D. H. Zangen, J. Hollister, S. Bonner-Weir and G. C. Weir (1996). "Vulnerability of islets in the immediate posttransplantation period. Dynamic changes in structure and function." Diabetes 45(9): 1161-7. Davies, J. L., F. Cucca, J. V. Goy, Z. A. Atta, M. E. Merriman, A. Wilson, A. H. Barnett, S. C. Bain and J. A. Todd (1996). "Saturation multipoint linkage mapping of chromosome 6q in type 1 diabetes." Hum Mol Genet 5(7): 1071-4. Davies, J. L., Y. Kawaguchi, S. T. Bennett, J. B. Copeman, H. J. Cordell, L. E. Pritchard, P. W. Reed, S. C. Gough, S. C. Jenkins, S. M. Palmer and et al. (1994). "A genome-wide search for human type 1 diabetes susceptibility genes." Nature 371(6493): 130-6. Davis, N., S. Ghosh, D. L. Simmons, P. Tempst, H. C. Liou, D. Baltimore and H. R. Bose, Jr. (1991). "Rel-associated pp40: an inhibitor of the rel family of transcription factors." Science 253(5025): 1268-71. DCCT (1993). "The effect of intensive treatment of diabetes on the development and progression of long-term complications in insulin-dependent diabetes mellitus. The Diabetes Control and Complications Trial Research Group." N Engl J Med 329(14): 977-86. DCCT (2000). "Retinopathy and nephropathy in patients with type 1 diabetes four years after a trial of intensive therapy. The Diabetes Control and Complications Trial/Epidemiology of Diabetes Interventions and Complications Research Group." N Engl J Med 342(6): 381-9.

- 174 - References

DCCT (2003). "Sustained effect of intensive treatment of type 1 diabetes mellitus on development and progression of diabetic nephropathy: the Epidemiology of Diabetes Interventions and Complications (EDIC) study." Jama 290(16): 2159-67. De Valck, D., K. Heyninck, W. Van Criekinge, R. Contreras, R. Beyaert and W. Fiers (1996). "A20, an inhibitor of cell death, self-associates by its zinc finger domain." FEBS Lett 384(1): 61-4. Degli-Esposti, M. A., L. J. Abraham, V. McCann, T. Spies, F. T. Christiansen and R. L. Dawkins (1992). "Ancestral haplotypes reveal the role of the central MHC in the immunogenetics of IDDM." Immunogenetics 36(6): 345-56. Delepine, M., F. Pociot, C. Habita, L. Hashimoto, P. Froguel, J. Rotter, A. Cambon- Thomsen, I. Deschamps, S. Djoulah, J. Weissenbach, J. Nerup, M. Lathrop and C. Julier (1997). "Evidence of a non-MHC susceptibility locus in type I diabetes linked to HLA on chromosome 6." Am J Hum Genet 60(1): 174-87. Delovitch, T. L. and B. Singh (1997). "The nonobese diabetic mouse as a model of autoimmune diabetes: immune dysregulation gets the NOD." Immunity 7(6): 727-38. Deschamps, I., A. Marcelli-Barge, J. C. Poirier, O. Cohen-Haguenauer, H. Abderrahim, D. Cohen, H. Lestradet and J. Hors (1988). "Two distinct HLA-DR3 haplotypes are associated with age related heterogeneity in type 1 (insulin-dependent) diabetes." Diabetologia 31(12): 896-901. DiDonato, J., F. Mercurio, C. Rosette, J. Wu-Li, H. Suyang, S. Ghosh and M. Karin (1996). "Mapping of the inducible IkappaB phosphorylation sites that signal its ubiquitination and degradation." Mol Cell Biol 16(4): 1295-304. DiDonato, J. A., M. Hayakawa, D. M. Rothwarf, E. Zandi and M. Karin (1997). "A cytokine-responsive IkappaB kinase that activates the transcription factor NF- kappaB." Nature 388(6642): 548-54. Dobrzanski, P., R. P. Ryseck and R. Bravo (1993). "Both N- and C-terminal domains of RelB are required for full transactivation: role of the N-terminal leucine zipper-like motif." Mol Cell Biol 13(3): 1572-82. Dobrzanski, P., R. P. Ryseck and R. Bravo (1994). "Differential interactions of Rel- NF-kappa B complexes with I kappa B alpha determine pools of constitutive and inducible NF-kappa B activity." Embo J 13(19): 4608-16. Dyck, P. J. (1988). "Detection, characterization, and staging of polyneuropathy: assessed in diabetics." Muscle Nerve 11(1): 21-32. Dyck, P. J., J. L. Karnes, P. O'Brien, H. Okazaki, A. Lais and J. Engelstad (1986). "The spatial distribution of fiber loss in diabetic polyneuropathy suggests ischemia." Ann Neurol 19(5): 440-9. Eisenbarth, G. S. (1986). "Type I diabetes mellitus. A chronic autoimmune disease." N Engl J Med 314(21): 1360-8. Eizirik, D. L., A. Bjorklund and N. Welsh (1993). "Interleukin-1-induced expression of nitric oxide synthase in insulin-producing cells is preceded by c-fos induction and depends on gene transcription and protein synthesis." FEBS Lett 317(1-2): 62-6. Eizirik, D. L., M. Flodstrom, A. E. Karlsen and N. Welsh (1996). "The harmony of the spheres: inducible nitric oxide synthase and related genes in pancreatic beta cells." Diabetologia 39(8): 875-90.

- 175 - References

Eizirik, D. L. and T. Mandrup-Poulsen (2001). "A choice of death--the signal- transduction of immune-mediated beta-cell apoptosis." Diabetologia 44(12): 2115-33. Ekert, P. G. and D. L. Vaux (1997). "Apoptosis and the immune system." Br Med Bull 53(3): 591-603. Eldor, R., A. Yeffet, K. Baum, V. Doviner, D. Amar, Y. Ben-Neriah, G. Christofori, A. Peled, J. C. Carel, C. Boitard, T. Klein, P. Serup, D. L. Eizirik and D. Melloul (2006). "Conditional and specific NF-kappaB blockade protects pancreatic beta cells from diabetogenic agents." Proc Natl Acad Sci U S A 103(13): 5072-7. Emamaullee, J., P. Liston, R. G. Korneluk, A. M. Shapiro and J. F. Elliott (2005). "XIAP overexpression in islet beta-cells enhances engraftment and minimizes hypoxia-reperfusion injury." Am J Transplant 5(6): 1297-305. Emamaullee, J. A., R. V. Rajotte, P. Liston, R. G. Korneluk, J. R. Lakey, A. M. Shapiro and J. F. Elliott (2005). "XIAP overexpression in human islets prevents early posttransplant apoptosis and reduces the islet mass needed to treat diabetes." Diabetes 54(9): 2541-8. Emamaullee, J. A. and A. M. Shapiro (2006). "Interventional strategies to prevent beta-cell apoptosis in islet transplantation." Diabetes 55(7): 1907-14. Endl, J., H. Otto, G. Jung, B. Dreisbusch, F. Donie, P. Stahl, R. Elbracht, G. Schmitz, E. Meinl, M. Hummel, A. G. Ziegler, R. Wank and D. J. Schendel (1997). "Identification of naturally processed T cell epitopes from glutamic acid decarboxylase presented in the context of HLA-DR alleles by T lymphocytes of recent onset IDDM patients." J Clin Invest 99(10): 2405-15. Esposito, L., N. J. Hill, L. E. Pritchard, F. Cucca, C. Muxworthy, M. E. Merriman, A. Wilson, C. Julier, M. Delepine, J. Tuomilehto, E. Tuomilehto-Wolf, C. Ionesco- Tirgoviste, L. Nistico, R. Buzzetti, P. Pozzilli, M. Ferrari, E. Bosi, F. Pociot, J. Nerup, S. C. Bain and J. A. Todd (1998). "Genetic analysis of chromosome 2 in type 1 diabetes: analysis of putative loci IDDM7, IDDM12, and IDDM13 and candidate genes NRAMP1 and IA-2 and the interleukin-1 gene cluster. IMDIAB Group." Diabetes 47(11): 1797-9. Feinstein, E., A. Kimchi, D. Wallach, M. Boldin and E. Varfolomeev (1995). "The death domain: a module shared by proteins with diverse cellular functions." Trends Biochem Sci 20(9): 342-4. Feit-Leichman, R. A., R. Kinouchi, M. Takeda, Z. Fan, S. Mohr, T. S. Kern and D. F. Chen (2005). "Vascular damage in a mouse model of diabetic retinopathy: relation to neuronal and glial changes." Invest Ophthalmol Vis Sci 46(11): 4281-7. Ferran, C., D. M. Stroka, A. Z. Badrichani, J. T. Cooper, C. J. Wrighton, M. Soares, S. T. Grey and F. H. Bach (1998). "A20 inhibits NF-kappaB activation in endothelial cells without sensitizing to tumor necrosis factor-mediated apoptosis." Blood 91(7): 2249-58. Ferris, F. L., 3rd, M. D. Davis and L. M. Aiello (1999). "Treatment of diabetic retinopathy." N Engl J Med 341(9): 667-78. Feutren, G., L. Papoz, R. Assan, B. Vialettes, G. Karsenty, P. Vexiau, H. Du Rostu, M. Rodier, J. Sirmai, A. Lallemand and et al. (1986). "Cyclosporin increases the rate and length of remissions in insulin-dependent diabetes of recent onset. Results of a multicentre double-blind trial." Lancet 2(8499): 119-24.

- 176 - References

Field, L. L., R. Tobias and T. Magnus (1994). "A locus on chromosome 15q26 (IDDM3) produces susceptibility to insulin-dependent diabetes mellitus." Nat Genet 8(2): 189-94. Field, L. L., R. Tobias, G. Thomson and S. Plon (1996). "Susceptibility to insulin- dependent diabetes mellitus maps to a locus (IDDM11) on human chromosome 14q24.3-q31." Genomics 33(1): 1-8. Frigerio, S., T. Junt, B. Lu, C. Gerard, U. Zumsteg, G. A. Hollander and L. Piali (2002). "Beta cells are responsible for CXCR3-mediated T-cell infiltration in insulitis." Nat Med 8(12): 1414-20. Gepts, W. (1965). "Pathologic anatomy of the pancreas in juvenile diabetes mellitus." Diabetes 14(10): 619-33. Gepts, W. and P. M. Lecompte (1981). "The pancreatic islets in diabetes." Am J Med 70(1): 105-15. Ghosh, S., M. J. May and E. B. Kopp (1998). "NF-kappa B and Rel proteins: evolutionarily conserved mediators of immune responses." Annu Rev Immunol 16: 225-60. Gianani, R., C. F. Verge, R. I. Moromisato-Gianani, L. Yu, Y. J. Zhang, A. Pugliese and G. S. Eisenbarth (1996). "Limited loss of tolerance to islet autoantigens in ICA+ first degree relatives of patients with type I diabetes expressing the HLA dqb1*0602 allele." J Autoimmun 9(3): 423-5. Giannoukakis, N., W. A. Rudert, S. C. Ghivizzani, A. Gambotto, C. Ricordi, M. Trucco and P. D. Robbins (1999). "Adenoviral gene transfer of the interleukin-1 receptor antagonist protein to human islets prevents IL-1beta-induced beta-cell impairment and activation of islet cell apoptosis in vitro." Diabetes 48(9): 1730-6. Giannoukakis, N., W. A. Rudert, M. Trucco and P. D. Robbins (2000). "Protection of human islets from the effects of interleukin-1beta by adenoviral gene transfer of an Ikappa B repressor." J Biol Chem 275(47): 36509-13. Golstein, P. (1997). "Cell death: TRAIL and its receptors." Curr Biol 7(12): R750-3. Goltsev, Y. V., A. V. Kovalenko, E. Arnold, E. E. Varfolomeev, V. M. Brodianskii and D. Wallach (1997). "CASH, a novel caspase homologue with death effector domains." J Biol Chem 272(32): 19641-4. Gotfredsen, C. F., K. Buschard and E. K. Frandsen (1985). "Reduction of diabetes incidence of BB Wistar rats by early prophylactic insulin treatment of diabetes-prone animals." Diabetologia 28(12): 933-5. Goto, S., I. Matsumoto, N. Kamada, A. Bui, T. Saito, M. Findlay, Z. Pujic and P. Wilce (1994). "The induction of immediate early genes in postischemic and transplanted livers in rats. Its relation to organ survival." Transplantation 58(7): 840- 5. Gottlieb, P. A. and G. S. Eisenbarth (1998). "Diagnosis and treatment of pre-insulin dependent diabetes." Annu Rev Med 49: 391-405. Green, D. R. (1998). "Apoptotic pathways: the roads to ruin." Cell 94(6): 695-8. Green, E. A., E. E. Eynon and R. A. Flavell (1998). "Local expression of TNFalpha in neonatal NOD mice promotes diabetes by enhancing presentation of islet antigens." Immunity 9(5): 733-43. - 177 - References

Green, E. A. and R. A. Flavell (1999). "The initiation of autoimmune diabetes." Curr Opin Immunol 11(6): 663-9. Grey, S. T., M. B. Arvelo, W. Hasenkamp, F. H. Bach and C. Ferran (1999). "A20 inhibits cytokine-induced apoptosis and nuclear factor kappaB-dependent gene activation in islets." J Exp Med 190(8): 1135-46. Grey, S. T., C. Longo, T. Shukri, V. I. Patel, E. Csizmadia, S. Daniel, M. B. Arvelo, V. Tchipashvili and C. Ferran (2003). "Genetic engineering of a suboptimal islet graft with A20 preserves beta cell mass and function." J Immunol 170(12): 6250-6. Gross, A., X. M. Yin, K. Wang, M. C. Wei, J. Jockel, C. Milliman, H. Erdjument- Bromage, P. Tempst and S. J. Korsmeyer (1999). "Caspase cleaved BID targets mitochondria and is required for cytochrome c release, while BCL-XL prevents this release but not tumor necrosis factor-R1/Fas death." J Biol Chem 274(2): 1156-63. Gruss, H. J. and S. K. Dower (1995). "Tumor necrosis factor ligand superfamily: involvement in the pathology of malignant lymphomas." Blood 85(12): 3378-404. Guberski, D. L. (1993). "Diabetes-Prone and Diabetes-Resistant BB Rats: Animal Models of Spontaneous and Virally Induced Diabetes Mellitus, Lymphocytic Thyroiditis, and Collagen-Induced Arthritis." Ilar J 35(2): 29-37. Guberski, D. L., V. A. Thomas, W. R. Shek, A. A. Like, E. S. Handler, A. A. Rossini, J. E. Wallace and R. M. Welsh (1991). "Induction of type I diabetes by Kilham's rat virus in diabetes-resistant BB/Wor rats." Science 254(5034): 1010-3. Gunton, J. E., R. N. Kulkarni, S. Yim, T. Okada, W. J. Hawthorne, Y. H. Tseng, R. S. Roberson, C. Ricordi, P. J. O'Connell, F. J. Gonzalez and C. R. Kahn (2005). "Loss of ARNT/HIF1beta mediates altered gene expression and pancreatic-islet dysfunction in human type 2 diabetes." Cell 122(3): 337-49. Hancock, W. W., R. Buelow, M. H. Sayegh and L. A. Turka (1998). "Antibody- induced transplant arteriosclerosis is prevented by graft expression of anti-oxidant and anti-apoptotic genes." Nat Med 4(12): 1392-6. Hanninen, A., S. Jalkanen, M. Salmi, S. Toikkanen, G. Nikolakaros and O. Simell (1992). "Macrophages, T cell receptor usage, and endothelial cell activation in the pancreas at the onset of insulin-dependent diabetes mellitus." J Clin Invest 90(5): 1901-10. Hansen, S. K., P. A. Baeuerle and F. Blasi (1994). "Purification, reconstitution, and I kappa B association of the c-Rel-p65 (RelA) complex, a strong activator of transcription." Mol Cell Biol 14(4): 2593-603. Hansen, S. K., L. Guerrini and F. Blasi (1994). "Differential DNA sequence specificity and regulation of HIV-1 enhancer activity by cRel-RelA transcription factor." J Biol Chem 269(35): 22230-7. Harjutsalo, V., A. Reunanen and J. Tuomilehto (2006). "Differential transmission of type 1 diabetes from diabetic fathers and mothers to their offspring." Diabetes 55(5): 1517-24. Hartman, M. G., D. Lu, M.-L. Kim, G. J. Kociba, T. Shukri, J. Buteau, X. Wang, W. L. Frankel, D. Guttridge, M. Prentki, S. T. Grey, D. Ron and T. Hai (2004). "Role for Activating Transcription Factor 3 in Stress-Induced {beta}-Cell Apoptosis." Mol. Cell. Biol. 24(13): 5721-5732.

- 178 - References

Hashimoto, L., C. Habita, J. P. Beressi, M. Delepine, C. Besse, A. Cambon-Thomsen, I. Deschamps, J. I. Rotter, S. Djoulah, M. R. James and et al. (1994). "Genetic mapping of a susceptibility locus for insulin-dependent diabetes mellitus on chromosome 11q." Nature 371(6493): 161-4. Haskill, S., A. A. Beg, S. M. Tompkins, J. S. Morris, A. D. Yurochko, A. Sampson- Johannes, K. Mondal, P. Ralph and A. S. Baldwin, Jr. (1991). "Characterization of an immediate-early gene induced in adherent monocytes that encodes I kappa B-like activity." Cell 65(7): 1281-9. Haskins, K. and M. McDuffie (1990). "Acceleration of diabetes in young NOD mice with a CD4+ islet-specific T cell clone." Science 249(4975): 1433-6. Heimberg, H., Y. Heremans, C. Jobin, R. Leemans, A. K. Cardozo, M. Darville and D. L. Eizirik (2001). "Inhibition of cytokine-induced NF-kappaB activation by adenovirus-mediated expression of a NF-kappaB super-repressor prevents beta-cell apoptosis." Diabetes 50(10): 2219-24. Heitmeier, M. R., C. B. Kelly, N. J. Ensor, K. A. Gibson, K. G. Mullis, J. A. Corbett and T. J. Maziasz (2004). "Role of cyclooxygenase-2 in cytokine-induced beta-cell dysfunction and damage by isolated rat and human islets." J Biol Chem 279(51): 53145-51. Heitmeier, M. R., A. L. Scarim and J. A. Corbett (1997). "Interferon-gamma increases the sensitivity of islets of Langerhans for inducible nitric-oxide synthase expression induced by interleukin 1." Journal of Biological Chemistry 272(21): 13697-704. Hermann, R., C. S. Bartsocas, G. Soltesz, A. Vazeou, P. Paschou, E. Bozas, A. Malamitsi-Puchner, O. Simell, M. Knip and J. Ilonen (2004). "Genetic screening for individuals at high risk for type 1 diabetes in the general population using HLA Class II alleles as disease markers. A comparison between three European populations with variable rates of disease incidence." Diabetes Metab Res Rev 20(4): 322-9. Hermitte, L., B. Vialettes, N. Atlef, M. J. Payan, N. Doll, A. Scheimann and P. Vague (1989). "High dose nicotinamide fails to prevent diabetes in BB rats." Autoimmunity 5(1-2): 79-86. Herold, K. C., S. E. Gitelman, U. Masharani, W. Hagopian, B. Bisikirska, D. Donaldson, K. Rother, B. Diamond, D. M. Harlan and J. A. Bluestone (2005). "A single course of anti-CD3 monoclonal antibody hOKT3gamma1(Ala-Ala) results in improvement in C-peptide responses and clinical parameters for at least 2 years after onset of type 1 diabetes." Diabetes 54(6): 1763-9. Heyninck, K., D. De Valck, W. Vanden Berghe, W. Van Criekinge, R. Contreras, W. Fiers, G. Haegeman and R. Beyaert (1999). "The zinc finger protein A20 inhibits TNF-induced NF-kappaB-dependent gene expression by interfering with an RIP- or TRAF2-mediated transactivation signal and directly binds to a novel NF-kappaB- inhibiting protein ABIN." J Cell Biol 145(7): 1471-82. Hofmann, K., P. Bucher and J. Tschopp (1997). "The CARD domain: a new apoptotic signalling motif." Trends Biochem Sci 22(5): 155-6. Hoglund, P., J. Mintern, C. Waltzinger, W. Heath, C. Benoist and D. Mathis (1999). "Initiation of autoimmune diabetes by developmentally regulated presentation of islet cell antigens in the pancreatic lymph nodes." J Exp Med 189(2): 331-9.

- 179 - References

Hsu, H., J. Huang, H. B. Shu, V. Baichwal and D. V. Goeddel (1996). "TNF- dependent recruitment of the protein kinase RIP to the TNF receptor-1 signaling complex." Immunity 4(4): 387-96. Hsu, H., H. B. Shu, M. G. Pan and D. V. Goeddel (1996). "TRADD-TRAF2 and TRADD-FADD interactions define two distinct TNF receptor 1 signal transduction pathways." Cell 84(2): 299-308. Hsu, H., J. Xiong and D. V. Goeddel (1995). "The TNF receptor 1-associated protein TRADD signals cell death and NF-kappa B activation." Cell 81(4): 495-504. Hu, S., S. J. Snipas, C. Vincenz, G. Salvesen and V. M. Dixit (1998). "Caspase-14 is a novel developmentally regulated protease." J Biol Chem 273(45): 29648-53. Hu, S., C. Vincenz, J. Ni, R. Gentz and V. M. Dixit (1997). "I-FLICE, a novel inhibitor of tumor necrosis factor receptor-1- and CD-95-induced apoptosis." J Biol Chem 272(28): 17255-7. Huang, L. E., J. Gu, M. Schau and H. F. Bunn (1998). "Regulation of hypoxia- inducible factor 1alpha is mediated by an O2-dependent degradation domain via the ubiquitin-proteasome pathway." Proc Natl Acad Sci U S A 95(14): 7987-92. Huang, T. T., N. Kudo, M. Yoshida and S. Miyamoto (2000). "A nuclear export signal in the N-terminal regulatory domain of IkappaBalpha controls cytoplasmic localization of inactive NF-kappaB/IkappaBalpha complexes." Proc Natl Acad Sci U S A 97(3): 1014-9. Huang, T. T. and S. Miyamoto (2001). "Postrepression activation of NF-kappaB requires the amino-terminal nuclear export signal specific to IkappaBalpha." Mol Cell Biol 21(14): 4737-47. Hultgren, B., X. Huang, N. Dybdal and T. A. Stewart (1996). "Genetic absence of gamma-interferon delays but does not prevent diabetes in NOD mice." Diabetes 45(6): 812-7. Hunger, R. E., C. Carnaud, I. Garcia, P. Vassalli and C. Mueller (1997). "Prevention of autoimmune diabetes mellitus in NOD mice by transgenic expression of soluble tumor necrosis factor receptor p55." Eur J Immunol 27(1): 255-61. Huxford, T., D. B. Huang, S. Malek and G. Ghosh (1998). "The crystal structure of the IkappaBalpha/NF-kappaB complex reveals mechanisms of NF-kappaB inactivation." Cell 95(6): 759-70. Imagawa, A., T. Hanafusa, S. Tamura, M. Moriwaki, N. Itoh, K. Yamamoto, H. Iwahashi, K. Yamagata, M. Waguri, T. Nanmo, S. Uno, H. Nakajima, M. Namba, S. Kawata, J. I. Miyagawa and Y. Matsuzawa (2001). "Pancreatic biopsy as a procedure for detecting in situ autoimmune phenomena in type 1 diabetes: close correlation between serological markers and histological evidence of cellular autoimmunity." Diabetes 50(6): 1269-73. Irmler, M., M. Thome, M. Hahne, P. Schneider, K. Hofmann, V. Steiner, J. L. Bodmer, M. Schroter, K. Burns, C. Mattmann, D. Rimoldi, L. E. French and J. Tschopp (1997). "Inhibition of death receptor signals by cellular FLIP." Nature 388(6638): 190-5. Jackson, R., P. Kadison, J. Buse, N. Rassi, B. Jegasothy and G. S. Eisenbarth (1983). "Lymphocyte abnormalities in the BB rat." Metabolism 32(7 Suppl 1): 83-6.

- 180 - References

Jackson, R., N. Rassi, T. Crump, B. Haynes and G. S. Eisenbarth (1981). "The BB diabetic rat. Profound T-cell lymphocytopenia." Diabetes 30(10): 887-9. Jacobs, M. D. and S. C. Harrison (1998). "Structure of an IkappaBalpha/NF-kappaB complex." Cell 95(6): 749-58. Jansen, A., F. Homo-Delarche, H. Hooijkaas, P. J. Leenen, M. Dardenne and H. A. Drexhage (1994). "Immunohistochemical characterization of monocytes-macrophages and dendritic cells involved in the initiation of the insulitis and beta-cell destruction in NOD mice." Diabetes 43(5): 667-75. Jardetzky, T. S., W. S. Lane, R. A. Robinson, D. R. Madden and D. C. Wiley (1991). "Identification of self peptides bound to purified HLA-B27." Nature 353(6342): 326- 9. Jaworski, M. A., L. Honore, L. D. Jewell, J. G. Mehta, P. McGuire-Clark, J. J. Schouls and W. Y. Yap (1986). "Cyclosporin prophylaxis induces long-term prevention of diabetes, and inhibits lymphocytic infiltration in multiple target tissues in the high-risk BB rat." Diabetes Res 3(1): 1-6. JDRF. (2007, 19 July). "What is Diabetes?" Retrieved 02 October, 2007, from http://www.jdrf.org.au/publications/factsheets/what_is_diabetes.pdf. Jiang, Y., J. D. Woronicz, W. Liu and D. V. Goeddel (1999). "Prevention of constitutive TNF receptor 1 signaling by silencer of death domains." Science 283(5401): 543-6. Johnson, C., D. Van Antwerp and T. J. Hope (1999). "An N-terminal nuclear export signal is required for the nucleocytoplasmic shuttling of IkappaBalpha." Embo J 18(23): 6682-93. Johnson, P. C., S. C. Doll and D. W. Cromey (1986). "Pathogenesis of diabetic neuropathy." Ann Neurol 19(5): 450-7. Julier, C., R. N. Hyer, J. Davies, F. Merlin, P. Soularue, L. Briant, G. Cathelineau, I. Deschamps, J. I. Rotter, P. Froguel and et al. (1991). "Insulin-IGF2 region on chromosome 11p encodes a gene implicated in HLA-DR4-dependent diabetes susceptibility." Nature 354(6349): 155-9. Jun, H. S., P. Santamaria, H. W. Lim, M. L. Zhang and J. W. Yoon (1999). "Absolute requirement of macrophages for the development and activation of beta-cell cytotoxic CD8+ T-cells in T-cell receptor transgenic NOD mice." Diabetes 48(1): 34-42. Jun, H. S., C. S. Yoon, L. Zbytnuik, N. van Rooijen and J. W. Yoon (1999). "The role of macrophages in T cell-mediated autoimmune diabetes in nonobese diabetic mice." J Exp Med 189(2): 347-58. Jung, Y., J. S. Isaacs, S. Lee, J. Trepel, Z. G. Liu and L. Neckers (2003). "Hypoxia- inducible factor induction by tumour necrosis factor in normoxic cells requires receptor-interacting protein-dependent nuclear factor kappa B activation." Biochem J 370(Pt 3): 1011-7. Jurgensmeier, J. M., Z. Xie, Q. Deveraux, L. Ellerby, D. Bredesen and J. C. Reed (1998). "Bax directly induces release of cytochrome c from isolated mitochondria." Proc Natl Acad Sci U S A 95(9): 4997-5002. Kajstura, J., M. Mansukhani, W. Cheng, K. Reiss, S. Krajewski, J. C. Reed, F. Quaini, E. H. Sonnenblick and P. Anversa (1995). "Programmed cell death and

- 181 - References expression of the protooncogene bcl-2 in myocytes during postnatal maturation of the heart." Exp Cell Res 219(1): 110-21. Kang, S. M., A. C. Tran, M. Grilli and M. J. Lenardo (1992). "NF-kappa B subunit regulation in nontransformed CD4+ T lymphocytes." Science 256(5062): 1452-6. Karin, M. and Y. Ben-Neriah (2000). "Phosphorylation meets ubiquitination: the control of NF-[kappa]B activity." Annu Rev Immunol 18: 621-63. Karin, M. and A. Lin (2002). "NF-kappaB at the crossroads of life and death." Nat Immunol 3(3): 221-7. Karlsen, A. E., W. A. Hagopian, J. S. Petersen, E. Boel, T. Dyrberg, C. E. Grubin, B. K. Michelsen, O. D. Madsen and A. Lernmark (1992). "Recombinant glutamic acid decarboxylase (representing the single isoform expressed in human islets) detects IDDM-associated 64,000-M(r) autoantibodies." Diabetes 41(10): 1355-9. Katz, J., C. Benoist and D. Mathis (1993). "Major histocompatibility complex class I molecules are required for the development of insulitis in non-obese diabetic mice." Eur J Immunol 23(12): 3358-60. Kaufman, D. L., M. Clare-Salzler, J. Tian, T. Forsthuber, G. S. Ting, P. Robinson, M. A. Atkinson, E. E. Sercarz, A. J. Tobin and P. V. Lehmann (1993). "Spontaneous loss of T-cell tolerance to glutamic acid decarboxylase in murine insulin-dependent diabetes." Nature 366(6450): 69-72. Kaufman, D. L., M. G. Erlander, M. Clare-Salzler, M. A. Atkinson, N. K. Maclaren and A. J. Tobin (1992). "Autoimmunity to two forms of glutamate decarboxylase in insulin-dependent diabetes mellitus." J Clin Invest 89(1): 283-92. Kay, T. W., I. L. Campbell and L. C. Harrison (1991). "Characterization of pancreatic T lymphocytes associated with beta cell destruction in the non-obese diabetic (NOD) mouse." J Autoimmun 4(2): 263-76. Kay, T. W., J. L. Parker, L. A. Stephens, H. E. Thomas and J. Allison (1996). "RIP- beta 2-microglobulin transgene expression restores insulitis, but not diabetes, in beta 2-microglobulin null nonobese diabetic mice." J Immunol 157(8): 3688-93. Keilacker, H., I. Rjasanowski, W. Besch and K. D. Kohnert (1995). "Autoantibodies to insulin and to proinsulin in type 1 diabetic patients and in at-risk probands differentiate only little between both antigens." Horm Metab Res 27(2): 90-4. Kelliher, M. A., S. Grimm, Y. Ishida, F. Kuo, B. Z. Stanger and P. Leder (1998). "The death domain kinase RIP mediates the TNF-induced NF-kappaB signal." Immunity 8(3): 297-303. Kern, T. S. and R. L. Engerman (1996). "A mouse model of diabetic retinopathy." Arch Ophthalmol 114(8): 986-90. Khalil, I., L. d'Auriol, M. Gobet, L. Morin, V. Lepage, I. Deschamps, M. S. Park, L. Degos, F. Galibert and J. Hors (1990). "A combination of HLA-DQ beta Asp57- negative and HLA DQ alpha Arg52 confers susceptibility to insulin-dependent diabetes mellitus." J Clin Invest 85(4): 1315-9. Khalil, I., I. Deschamps, V. Lepage, R. al-Daccak, L. Degos and J. Hors (1992). "Dose effect of cis- and trans-encoded HLA-DQ alpha beta heterodimers in IDDM susceptibility." Diabetes 41(3): 378-84.

- 182 - References

Kiesel, U., K. Maruta, U. Treichel, U. Bicker and H. Kolb (1986). "Suppression of spontaneous insulin-dependent diabetes in BB rats by administration of ciamexone." J Immunopharmacol 8(3): 393-406. Kim, S., I. Millet, H. S. Kim, J. Y. Kim, M. S. Han, M. K. Lee, K. W. Kim, R. S. Sherwin, M. Karin and M. S. Lee (2007). "NF-{kappa}B prevents {beta} cell death and autoimmune diabetes in NOD mice." Proc Natl Acad Sci U S A. Kitson, J., T. Raven, Y. P. Jiang, D. V. Goeddel, K. M. Giles, K. T. Pun, C. J. Grinham, R. Brown and S. N. Farrow (1996). "A death-domain-containing receptor that mediates apoptosis." Nature 384(6607): 372-5. Kloppel, G., E. Altenahr, G. Freytag and F. K. Jansen (1974). "Immune insulitis and manifest diabetes mellitus. Studies on the course of immune insulitis and the induction of diabetes mellitus in rabbits immunized with insulin." Virchows Arch A Pathol Anat Histol 364(4): 333-46. Kluck, R. M., E. Bossy-Wetzel, D. R. Green and D. D. Newmeyer (1997). "The release of cytochrome c from mitochondria: a primary site for Bcl-2 regulation of apoptosis." Science 275(5303): 1132-6. Koevary, S., A. Rossini, W. Stoller, W. Chick and R. M. Williams (1983). "Passive transfer of diabetes in the BB/W rat." Science 220(4598): 727-8. Kolb, H., V. Burkart, B. Appels, H. Hanenberg, G. Kantwerk-Funke, U. Kiesel, J. Funda, U. Schraermeyer and V. Kolb-Bachofen (1990). "Essential contribution of macrophages to islet cell destruction in vivo and in vitro." J Autoimmun 3 Suppl 1: 117-20. Kolb, H., U. Worz-Pagenstert, R. Kleemann, H. Rothe, P. Rowsell and F. W. Scott (1996). "Cytokine gene expression in the BB rat pancreas: natural course and impact of bacterial vaccines." Diabetologia 39(12): 1448-54. Komiyama, T., C. A. Ray, D. J. Pickup, A. D. Howard, N. A. Thornberry, E. P. Peterson and G. Salvesen (1994). "Inhibition of interleukin-1 beta converting enzyme by the cowpox virus serpin CrmA. An example of cross-class inhibition." J Biol Chem 269(30): 19331-7. Korsmeyer, S. J., M. C. Wei, M. Saito, S. Weiler, K. J. Oh and P. H. Schlesinger (2000). "Pro-apoptotic cascade activates BID, which oligomerizes BAK or BAX into pores that result in the release of cytochrome c." Cell Death Differ 7(12): 1166-73. Krikos, A., C. D. Laherty and V. M. Dixit (1992). "Transcriptional activation of the tumor necrosis factor alpha-inducible zinc finger protein, A20, is mediated by kappa B elements." J Biol Chem 267(25): 17971-6. Kuglin, B., F. A. Gries and H. Kolb (1988). "Evidence of IgG autoantibodies against human proinsulin in patients with IDDM before insulin treatment." Diabetes 37(1): 130-2. Kunter, U., J. Floege, A. S. von Jurgensonn, T. Stojanovic, S. Merkel, H. J. Grone and C. Ferran (2003). "Expression of A20 in the vessel wall of rat-kidney allografts correlates with protection from transplant arteriosclerosis." Transplantation 75(1): 3- 9.

- 183 - References

Kutlu, B., M. I. Darville, A. K. Cardozo and D. L. Eizirik (2003). "Molecular regulation of monocyte chemoattractant protein-1 expression in pancreatic beta-cells." Diabetes 52(2): 348-55. Kuwana, T., J. J. Smith, M. Muzio, V. Dixit, D. D. Newmeyer and S. Kornbluth (1998). "Apoptosis induction by caspase-8 is amplified through the mitochondrial release of cytochrome c." J Biol Chem 273(26): 16589-94. Kwon, G., J. A. Corbett, S. Hauser, J. R. Hill, J. Turk and M. L. McDaniel (1998). "Evidence for involvement of the proteasome complex (26S) and NFkappaB in IL- 1beta-induced nitric oxide and prostaglandin production by rat islets and RINm5F cells." Diabetes 47(4): 583-91. Kwon, G., J. A. Corbett, C. P. Rodi, P. Sullivan and M. L. McDaniel (1995). "Interleukin-1 beta-induced nitric oxide synthase expression by rat pancreatic beta- cells: evidence for the involvement of nuclear factor kappa B in the signaling mechanism." Endocrinology 136(11): 4790-5. Laherty, C. D., H. M. Hu, A. W. Opipari, F. Wang and V. M. Dixit (1992). "The Epstein-Barr virus LMP1 gene product induces A20 zinc finger protein expression by activating nuclear factor kappa B." J Biol Chem 267(34): 24157-60. Laherty, C. D., N. D. Perkins and V. M. Dixit (1993). "Human T cell leukemia virus type I Tax and phorbol 12-myristate 13-acetate induce expression of the A20 zinc finger protein by distinct mechanisms involving nuclear factor kappa B." J Biol Chem 268(7): 5032-9. Lally, F. J., H. Ratcliff and A. J. Bone (2001). "Apoptosis and disease progression in the spontaneously diabetic BB/S rat." Diabetologia 44(3): 320-4. Lamhamedi-Cherradi, S. E., S. Zheng, B. A. Hilliard, L. Xu, J. Sun, S. Alsheadat, H. C. Liou and Y. H. Chen (2003). "Transcriptional regulation of type I diabetes by NF- kappa B." J Immunol 171(9): 4886-92. Lampeter, E. F., M. Homberg, K. Quabeck, U. W. Schaefer, P. Wernet, J. Bertrams, H. Grosse-Wilde, F. A. Gries and H. Kolb (1993). "Transfer of insulin-dependent diabetes between HLA-identical siblings by bone marrow transplantation." Lancet 341(8855): 1243-4. Lan, M. S., C. Wasserfall, N. K. Maclaren and A. L. Notkins (1996). "IA-2, a transmembrane protein of the protein tyrosine phosphatase family, is a major autoantigen in insulin-dependent diabetes mellitus." Proc Natl Acad Sci U S A 93(13): 6367-70. Laupacis, A., C. R. Stiller, C. Gardell, P. Keown, J. Dupre, A. C. Wallace and P. Thibert (1983). "Cyclosporin prevents diabetes in BB Wistar rats." Lancet 1(8314-5): 10-2. Lechler, R. I., O. A. Garden and L. A. Turka (2003). "The complementary roles of deletion and regulation in transplantation tolerance." Nat Rev Immunol 3(2): 147-58. Lee, E. G., D. L. Boone, S. Chai, S. L. Libby, M. Chien, J. P. Lodolce and A. Ma (2000). "Failure to regulate TNF-induced NF-kappaB and cell death responses in A20-deficient mice." Science 289(5488): 2350-4. Lee, F. S., J. Hagler, Z. J. Chen and T. Maniatis (1997). "Activation of the IkappaB alpha kinase complex by MEKK1, a kinase of the JNK pathway." Cell 88(2): 213-22.

- 184 - References

Lee, F. S., R. T. Peters, L. C. Dang and T. Maniatis (1998). "MEKK1 activates both IkappaB kinase alpha and IkappaB kinase beta." Proc Natl Acad Sci U S A 95(16): 9319-24. Lee, I., L. Wang, A. D. Wells, Q. Ye, R. Han, M. E. Dorf, W. A. Kuziel, B. J. Rollins, L. Chen and W. W. Hancock (2003). "Blocking the monocyte chemoattractant protein-1/CCR2 chemokine pathway induces permanent survival of islet allografts through a programmed death-1 ligand-1-dependent mechanism." J Immunol 171(12): 6929-35. Lenschow, D. J., T. L. Walunas and J. A. Bluestone (1996). "CD28/B7 system of T cell costimulation." Annu Rev Immunol 14: 233-58. Li, H., H. Zhu, C. J. Xu and J. Yuan (1998). "Cleavage of BID by caspase 8 mediates the mitochondrial damage in the Fas pathway of apoptosis." Cell 94(4): 491-501. Li, H. L., A. B. Wang, R. Zhang, Y. S. Wei, H. Z. Chen, Z. G. She, Y. Huang, D. P. Liu and C. C. Liang (2006). "A20 inhibits oxidized low-density lipoprotein-induced apoptosis through negative Fas/Fas ligand-dependent activation of caspase-8 and mitochondrial pathways in murine RAW264.7 macrophages." J Cell Physiol 208(2): 307-18. Li, P., J. L. Gregg, N. Wang, D. Zhou, P. O'Donnell, J. S. Blum and V. L. Crotzer (2005). "Compartmentalization of class II antigen presentation: contribution of cytoplasmic and endosomal processing." Immunol Rev 207: 206-17. Li, P., D. Nijhawan, I. Budihardjo, S. M. Srinivasula, M. Ahmad, E. S. Alnemri and X. Wang (1997). "Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex initiates an apoptotic protease cascade." Cell 91(4): 479-89. Li, Q., G. Estepa, S. Memet, A. Israel and I. M. Verma (2000). "Complete lack of NF- kappaB activity in IKK1 and IKK2 double-deficient mice: additional defect in neurulation." Genes Dev 14(14): 1729-33. Li, Q., Q. Lu, J. Y. Hwang, D. Buscher, K. F. Lee, J. C. Izpisua-Belmonte and I. M. Verma (1999). "IKK1-deficient mice exhibit abnormal development of skin and skeleton." Genes Dev 13(10): 1322-8. Li, Q., D. Van Antwerp, F. Mercurio, K. F. Lee and I. M. Verma (1999). "Severe liver degeneration in mice lacking the IkappaB kinase 2 gene." Science 284(5412): 321-5. Li, Q. and I. M. Verma (2002). "NF-kappaB regulation in the immune system." Nat Rev Immunol 2(10): 725-34. Li, X. (2007). The role of co-stimulation in allograft tolerance and immunity. 25th Annual Scientific Meeting of the Transplantation Society of Australia and New Zealand. Australian Academy of Science, Canberra, ACT, TSANZ. Like, A. A., V. Dirodi, S. Thomas, D. L. Guberski and A. A. Rossini (1984). "Prevention of diabetes mellitus in the BB/W rat with Cyclosporin-A." Am J Pathol 117(1): 92-7. Like, A. A., E. Kislauskis, R. R. Williams and A. A. Rossini (1982). "Neonatal thymectomy prevents spontaneous diabetes mellitus in the BB/W rat." Science 216(4546): 644-6.

- 185 - References

Like, A. A., A. A. Rossini, D. L. Guberski, M. C. Appel and R. M. Williams (1979). "Spontaneous diabetes mellitus: reversal and prevention in the BB/W rat with antiserum to rat lymphocytes." Science 206(4425): 1421-3. Ling, Z., P. A. In't Veld and D. G. Pipeleers (1993). "Interaction of interleukin-1 with islet beta-cells. Distinction between indirect, aspecific cytotoxicity and direct, specific functional suppression." Diabetes 42(1): 56-65. Liuwantara, D., M. Elliot, M. W. Smith, A. O. Yam, S. N. Walters, E. Marino, A. McShea and S. T. Grey (2006). "Nuclear factor-kappaB regulates beta-cell death: a critical role for A20 in beta-cell protection." Diabetes 55(9): 2491-501. Lo, S. S., R. Y. Tun, M. Hawa and R. D. Leslie (1991). "Studies of diabetic twins." Diabetes Metab Rev 7(4): 223-38. Lohr, M., H. Markholst, T. Dyrberg, G. Kloppel, M. Oberholzer and A. Lernmark (1989). "Insulitis and diabetes are preceded by a decrease in beta cell volume in diabetes-prone BB rats." Pancreas 4(1): 95-100. Lucassen, A. M., C. Julier, J. P. Beressi, C. Boitard, P. Froguel, M. Lathrop and J. I. Bell (1993). "Susceptibility to insulin dependent diabetes mellitus maps to a 4.1 kb segment of DNA spanning the insulin gene and associated VNTR." Nat Genet 4(3): 305-10. Lund, T., L. O'Reilly, P. Hutchings, O. Kanagawa, E. Simpson, R. Gravely, P. Chandler, J. Dyson, J. K. Picard, A. Edwards and et al. (1990). "Prevention of insulin- dependent diabetes mellitus in non-obese diabetic mice by transgenes encoding modified I-A beta-chain or normal I-E alpha-chain." Nature 345(6277): 727-9. Luo, D. F., M. M. Bui, A. Muir, N. K. Maclaren, G. Thomson and J. X. She (1995). "Affected-sib-pair mapping of a novel susceptibility gene to insulin-dependent diabetes mellitus (IDDM8) on chromosome 6q25-q27." Am J Hum Genet 57(4): 911- 9. Luo, D. F., R. Buzzetti, J. I. Rotter, N. K. Maclaren, L. J. Raffel, L. Nistico, C. Giovannini, P. Pozzilli, G. Thomson and J. X. She (1996). "Confirmation of three susceptibility genes to insulin-dependent diabetes mellitus: IDDM4, IDDM5 and IDDM8." Hum Mol Genet 5(5): 693-8. Luo, X., I. Budihardjo, H. Zou, C. Slaughter and X. Wang (1998). "Bid, a Bcl2 interacting protein, mediates cytochrome c release from mitochondria in response to activation of cell surface death receptors." Cell 94(4): 481-90. Luster, A. D. (2002). "The role of chemokines in linking innate and adaptive immunity." Curr Opin Immunol 14(1): 129-35. Mabley, J. G., G. Hasko, L. Liaudet, F. Soriano, G. J. Southan, A. L. Salzman and C. Szabo (2002). "NFkappaB1 (p50)-deficient mice are not susceptible to multiple low- dose streptozotocin-induced diabetes." J Endocrinol 173(3): 457-64. Mackay, I. R., A. Bone, T. Tuomi, R. Elliott, T. Mandel, C. Karopoulos and M. J. Rowley (1996). "Lack of autoimmune serological reactions in rodent models of insulin dependent diabetes mellitus." J Autoimmun 9(6): 705-11. Makino, S., K. Kunimoto, Y. Muraoka, Y. Mizushima, K. Katagiri and Y. Tochino (1980). "Breeding of a non-obese, diabetic strain of mice." Jikken Dobutsu 29(1): 1- 13.

- 186 - References

Malaisse, W. J., F. Malaisse-Lagae, A. Sener and D. G. Pipeleers (1982). "Determinants of the selective toxicity of alloxan to the pancreatic B cell." Proc Natl Acad Sci U S A 79(3): 927-30. Malek, S., Y. Chen, T. Huxford and G. Ghosh (2001). "IkappaBbeta, but not IkappaBalpha, functions as a classical cytoplasmic inhibitor of NF-kappaB dimers by masking both NF-kappaB nuclear localization sequences in resting cells." J Biol Chem 276(48): 45225-35. Mandrup-Poulsen, T. (1996). "The role of interleukin-1 in the pathogenesis of IDDM." Diabetologia 39(9): 1005-29. Mariani, S. M. and P. H. Krammer (1998). "Differential regulation of TRAIL and CD95 ligand in transformed cells of the T and B lymphocyte lineage." Eur J Immunol 28(3): 973-82. Marshall, G., S. K. Garg, W. E. Jackson, D. L. Holmes and H. P. Chase (1993). "Factors influencing the onset and progression of diabetic retinopathy in subjects with insulin-dependent diabetes mellitus." Ophthalmology 100(8): 1133-9. Marsters, S. A., R. M. Pitti, C. J. Donahue, S. Ruppert, K. D. Bauer and A. Ashkenazi (1996). "Activation of apoptosis by Apo-2 ligand is independent of FADD but blocked by CrmA." Curr Biol 6(6): 750-2. Marsters, S. A., J. P. Sheridan, C. J. Donahue, R. M. Pitti, C. L. Gray, A. D. Goddard, K. D. Bauer and A. Ashkenazi (1996). "Apo-3, a new member of the tumor necrosis factor receptor family, contains a death domain and activates apoptosis and NF-kappa B." Curr Biol 6(12): 1669-76. Marsters, S. A., J. P. Sheridan, R. M. Pitti, J. Brush, A. Goddard and A. Ashkenazi (1998). "Identification of a ligand for the death-domain-containing receptor Apo3." Curr Biol 8(9): 525-8. Marsters, S. A., J. P. Sheridan, R. M. Pitti, A. Huang, M. Skubatch, D. Baldwin, J. Yuan, A. Gurney, A. D. Goddard, P. Godowski and A. Ashkenazi (1997). "A novel receptor for Apo2L/TRAIL contains a truncated death domain." Curr Biol 7(12): 1003-6. Martin, A. M., E. P. Blankenhorn, M. N. Maxson, M. Zhao, J. Leif, J. P. Mordes and D. L. Greiner (1999). "Non-major histocompatibility complex-linked diabetes susceptibility loci on chromosomes 4 and 13 in a backcross of the DP-BB/Wor rat to the WF rat." Diabetes 48(1): 50-8. Martin, A. M., M. N. Maxson, J. Leif, J. P. Mordes, D. L. Greiner and E. P. Blankenhorn (1999). "Diabetes-prone and diabetes-resistant BB rats share a common major diabetes susceptibility locus, iddm4: additional evidence for a "universal autoimmunity locus" on rat chromosome 4." Diabetes 48(11): 2138-44. Martin, S., T. Hibino, A. Faust, R. Kleemann and H. Kolb (1996). "Differential expression of ICAM-1 and LFA-1 versus L-selectin and VCAM-1 in autoimmune insulitis of NOD mice and association with both Th1- and Th2-type infiltrates." Journal of Autoimmunity 9(5): 637-43. Maruyama, T., I. Takei, Y. Asaba, T. Yanagawa, T. Takahashi, H. Itoh, Y. Suzuki, K. Kataoka, T. Saruta and T. Ishii (1989). "Insulin autoantibodies in mouse models of insulin-dependent diabetes." Diabetes Res 11(2): 61-5.

- 187 - References

Maruyama, T., I. Takei, T. Yanagawa, T. Takahashi, Y. Asaba, K. Kataoka and T. Ishii (1988). "Insulin autoantibodies in non-obese diabetic (NOD) mice and streptozotocin-induced diabetic mice." Diabetes Res 7(2): 93-6. Mathis, D., L. Vence and C. Benoist (2001). "beta-Cell death during progression to diabetes." Nature 414(6865): 792-8. Matsuda, T., K. Omori, T. Vuong, M. Pascual, L. Valiente, K. Ferreri, I. Todorov, Y. Kuroda, C. V. Smith, F. Kandeel and Y. Mullen (2005). "Inhibition of p38 pathway suppresses human islet production of pro-inflammatory cytokines and improves islet graft function." Am J Transplant 5(3): 484-93. Matsumoto, M., H. Yagi, K. Kunimoto, J. Kawaguchi, S. Makino and M. Harada (1993). "Transfer of autoimmune diabetes from diabetic NOD mice to NOD athymic nude mice: the roles of T cell subsets in the pathogenesis." Cell Immunol 148(1): 189- 97. May, M. J. and S. Ghosh (1998). "Signal transduction through NF-kappa B." Immunol Today 19(2): 80-8. Mayer, B. and R. Oberbauer (2003). "Mitochondrial regulation of apoptosis." News Physiol Sci 18: 89-94. McDaniel, M. L., G. Kwon, J. R. Hill, C. A. Marshall and J. A. Corbett (1996). "Cytokines and nitric oxide in islet inflammation and diabetes." Proceedings of the Society for Experimental Biology & Medicine 211(1): 24-32. McDonnell, T. J. and S. J. Korsmeyer (1991). "Progression from lymphoid hyperplasia to high-grade malignant lymphoma in mice transgenic for the t(14; 18)." Nature 349(6306): 254-6. MCSG (1999). "The Microalbuminuria Collaborative Study Group. Predictors of the development of microalbuminuria in patients with Type 1 diabetes mellitus: a seven- year prospective study." Diabet Med 16(11): 918-25. Medzhitov, R. and C. Janeway, Jr. (2000). "Innate immune recognition: mechanisms and pathways." Immunol Rev 173: 89-97. Meier, J. J., A. Bhushan and P. C. Butler (2006). "The potential for stem cell therapy in diabetes." Pediatr Res 59(4 Pt 2): 65R-73R. Mein, C. A., L. Esposito, M. G. Dunn, G. C. Johnson, A. E. Timms, J. V. Goy, A. N. Smith, L. Sebag-Montefiore, M. E. Merriman, A. J. Wilson, L. E. Pritchard, F. Cucca, A. H. Barnett, S. C. Bain and J. A. Todd (1998). "A search for type 1 diabetes susceptibility genes in families from the United Kingdom." Nat Genet 19(3): 297-300. Merriman, T. R., I. A. Eaves, R. C. Twells, M. E. Merriman, P. A. Danoy, C. E. Muxworthy, K. M. Hunter, R. D. Cox, F. Cucca, P. A. McKinney, J. P. Shield, J. D. Baum, J. Tuomilehto, E. Tuomilehto-Wolf, C. Ionesco-Tirgoviste, G. Joner, E. Thorsby, D. E. Undlien, F. Pociot, J. Nerup, K. S. Ronningen, S. C. Bain and J. A. Todd (1998). "Transmission of haplotypes of microsatellite markers rather than single marker alleles in the mapping of a putative type 1 diabetes susceptibility gene (IDDM6)." Hum Mol Genet 7(3): 517-24. Miller, B. J., M. C. Appel, J. J. O'Neil and L. S. Wicker (1988). "Both the Lyt-2+ and L3T4+ T cell subsets are required for the transfer of diabetes in nonobese diabetic mice." J Immunol 140(1): 52-8.

- 188 - References

Miyazaki, A., T. Hanafusa, K. Yamada, J. Miyagawa, H. Fujino-Kurihara, H. Nakajima, K. Nonaka and S. Tarui (1985). "Predominance of T lymphocytes in pancreatic islets and spleen of pre-diabetic non-obese diabetic (NOD) mice: a longitudinal study." Clin Exp Immunol 60(3): 622-30. Miyazaki, T., M. Uno, M. Uehira, H. Kikutani, T. Kishimoto, M. Kimoto, H. Nishimoto, J. Miyazaki and K. Yamamura (1990). "Direct evidence for the contribution of the unique I-ANOD to the development of insulitis in non-obese diabetic mice." Nature 345(6277): 722-4. Montana, E., S. Bonner-Weir and G. C. Weir (1993). "Beta cell mass and growth after syngeneic islet cell transplantation in normal and streptozocin diabetic C57BL/6 mice." J Clin Invest 91(3): 780-7. Morahan, G., D. Huang, B. D. Tait, P. G. Colman and L. C. Harrison (1996). "Markers on distal chromosome 2q linked to insulin-dependent diabetes mellitus." Science 272(5269): 1811-3. Morahan, G., D. Huang, S. I. Ymer, M. R. Cancilla, K. Stephen, P. Dabadghao, G. Werther, B. D. Tait, L. C. Harrison and P. G. Colman (2001). "Linkage disequilibrium of a type 1 diabetes susceptibility locus with a regulatory IL12B allele." Nat Genet 27(2): 218-21. Mordes, J. P., B. Schirf, D. Roipko, D. L. Greiner, H. Weiner, P. Nelson and A. A. Rossini (1996). "Oral insulin does not prevent insulin-dependent diabetes mellitus in BB rats." Ann N Y Acad Sci 778: 418-21. Morel, P. A., J. S. Dorman, J. A. Todd, H. O. McDevitt and M. Trucco (1988). "Aspartic acid at position 57 of the HLA-DQ beta chain protects against type I diabetes: a family study." Proc Natl Acad Sci U S A 85(21): 8111-5. Mori, Y., M. Suko, H. Okudaira, I. Matsuba, A. Tsuruoka, A. Sasaki, H. Yokoyama, T. Tanase, T. Shida, M. Nishimura and et al. (1986). "Preventive effects of cyclosporin on diabetes in NOD mice." Diabetologia 29(4): 244-7. Morimoto, J., H. Yoneyama, A. Shimada, T. Shigihara, S. Yamada, Y. Oikawa, K. Matsushima, T. Saruta and S. Narumi (2004). "CXC chemokine ligand 10 neutralization suppresses the occurrence of diabetes in nonobese diabetic mice through enhanced beta cell proliferation without affecting insulitis." J Immunol 173(11): 7017-24. Moritz, W., F. Meier, D. M. Stroka, M. Giuliani, P. Kugelmeier, P. C. Nett, R. Lehmann, D. Candinas, M. Gassmann and M. Weber (2002). "Apoptosis in hypoxic human pancreatic islets correlates with HIF-1alpha expression." Faseb J 16(7): 745-7. Murata, M., N. Ohta, S. Fujisawa, J. Y. Tsai, S. Sato, Y. Akagi, Y. Takahashi, H. Neuenschwander and P. F. Kador (2002). "Selective pericyte degeneration in the retinal capillaries of galactose-fed dogs results from apoptosis linked to aldose reductase-catalyzed galactitol accumulation." J Diabetes Complications 16(5): 363- 70. Muzio, M., A. M. Chinnaiyan, F. C. Kischkel, K. O'Rourke, A. Shevchenko, J. Ni, C. Scaffidi, J. D. Bretz, M. Zhang, R. Gentz, M. Mann, P. H. Krammer, M. E. Peter and V. M. Dixit (1996). "FLICE, a novel FADD-homologous ICE/CED-3-like protease, is recruited to the CD95 (Fas/APO-1) death--inducing signaling complex." Cell 85(6): 817-27.

- 189 - References

Muzio, M., B. R. Stockwell, H. R. Stennicke, G. S. Salvesen and V. M. Dixit (1998). "An induced proximity model for caspase-8 activation." J Biol Chem 273(5): 2926- 30. Nagata, S. (1997). "Apoptosis by death factor." Cell 88(3): 355-65. Nakhooda, A. F., A. A. Like, C. I. Chappel, F. T. Murray and E. B. Marliss (1977). "The spontaneously diabetic Wistar rat. Metabolic and morphologic studies." Diabetes 26(2): 100-12. Nerup, J., P. Platz, O. O. Andersen, M. Christy, J. Lyngsoe, J. E. Poulsen, L. P. Ryder, L. S. Nielsen, M. Thomsen and A. Svejgaard (1974). "HL-A antigens and diabetes mellitus." Lancet 2(7885): 864-6. Nistico, L., R. Buzzetti, L. E. Pritchard, B. Van der Auwera, C. Giovannini, E. Bosi, M. T. Larrad, M. S. Rios, C. C. Chow, C. S. Cockram, K. Jacobs, C. Mijovic, S. C. Bain, A. H. Barnett, C. L. Vandewalle, F. Schuit, F. K. Gorus, R. Tosi, P. Pozzilli and J. A. Todd (1996). "The CTLA-4 gene region of chromosome 2q33 is linked to, and associated with, type 1 diabetes. Belgian Diabetes Registry." Hum Mol Genet 5(7): 1075-80. Noorchashm, H., N. Noorchashm, J. Kern, S. Y. Rostami, C. F. Barker and A. Naji (1997). "B-cells are required for the initiation of insulitis and sialitis in nonobese diabetic mice." Diabetes 46(6): 941-6. Norlin, S., U. Ahlgren and H. Edlund (2005). "Nuclear factor-{kappa}B activity in {beta}-cells is required for glucose-stimulated insulin secretion." Diabetes 54(1): 125- 32. Nossal, G. J., K. C. Herold and C. C. Goodnow (1992). "Autoimmune tolerance and type 1 (insulin-dependent) diabetes mellitus." Diabetologia 35 Suppl 2: S49-59. Nunez, G., M. Seto, S. Seremetis, D. Ferrero, F. Grignani, S. J. Korsmeyer and R. Dalla-Favera (1989). "Growth- and tumor-promoting effects of deregulated BCL2 in human B-lymphoblastoid cells." Proc Natl Acad Sci U S A 86(12): 4589-93. O'Reilly, L. A., P. R. Hutchings, P. R. Crocker, E. Simpson, T. Lund, D. Kioussis, F. Takei, J. Baird and A. Cooke (1991). "Characterization of pancreatic islet cell infiltrates in NOD mice: effect of cell transfer and transgene expression." Eur J Immunol 21(5): 1171-80. Ogawa, M., T. Maruyama, T. Hasegawa, T. Kanaya, F. Kobayashi, Y. Tochino and H. Uda (1985). "The inhibitory effect of neonatal thymectomy on the incidence of insulitis in non-obese diabetes (NOD) mice." Biomed. res. 6(2): 103-5. Oldstone, M. B. (1990). "Viruses as therapeutic agents. I. Treatment of nonobese insulin-dependent diabetes mice with virus prevents insulin-dependent diabetes mellitus while maintaining general immune competence." J Exp Med 171(6): 2077- 89. Oldstone, M. B., R. Ahmed and M. Salvato (1990). "Viruses as therapeutic agents. II. Viral reassortants map prevention of insulin-dependent diabetes mellitus to the small RNA of lymphocytic choriomeningitis virus." J Exp Med 171(6): 2091-100. Opipari, A. W., Jr., M. S. Boguski and V. M. Dixit (1990). "The A20 cDNA induced by tumor necrosis factor alpha encodes a novel type of zinc finger protein." J Biol Chem 265(25): 14705-8.

- 190 - References

Opipari, A. W., Jr., H. M. Hu, R. Yabkowitz and V. M. Dixit (1992). "The A20 zinc finger protein protects cells from tumor necrosis factor cytotoxicity." J Biol Chem 267(18): 12424-7. Oppenheim, R. W. (1991). "Cell death during development of the nervous system." Annu Rev Neurosci 14: 453-501. Ortis, F., A. K. Cardozo, D. Crispim, J. Storling, T. Mandrup-Poulsen and D. L. Eizirik (2006). "Cytokine-induced proapoptotic gene expression in insulin-producing cells is related to rapid, sustained, and nonoscillatory nuclear factor-kappaB activation." Mol Endocrinol 20(8): 1867-79. Ortqvist, E., E. Bjork, M. Wallensteen, J. Ludvigsson, J. Aman, C. Johansson, G. Forsander, F. Lindgren, L. Berglund, M. Bengtsson, C. Berne, B. Persson and F. A. Karlsson (2004). "Temporary preservation of beta-cell function by diazoxide treatment in childhood type 1 diabetes." Diabetes Care 27(9): 2191-7. Pakala, S. V., M. Chivetta, C. B. Kelly and J. D. Katz (1999). "In autoimmune diabetes the transition from benign to pernicious insulitis requires an islet cell response to tumor necrosis factor alpha." J Exp Med 189(7): 1053-62. Palmer, J. P., C. M. Asplin, P. Clemons, K. Lyen, O. Tatpati, P. K. Raghu and T. L. Paquette (1983). "Insulin antibodies in insulin-dependent diabetics before insulin treatment." Science 222(4630): 1337-9. Palombella, V. J., O. J. Rando, A. L. Goldberg and T. Maniatis (1994). "The ubiquitin-proteasome pathway is required for processing the NF-kappa B1 precursor protein and the activation of NF-kappa B." Cell 78(5): 773-85. Papa, S., C. Bubici, F. Zazzeroni, C. G. Pham, C. Kuntzen, J. R. Knabb, K. Dean and G. Franzoso (2006). "The NF-kappaB-mediated control of the JNK cascade in the antagonism of programmed cell death in health and disease." Cell Death Differ 13(5): 712-29. Passini, N., J. D. Larigan, S. Genovese, E. Appella, F. Sinigaglia and L. Rogge (1995). "The 37/40-kilodalton autoantigen in insulin-dependent diabetes mellitus is the putative tyrosine phosphatase IA-2." Proc Natl Acad Sci U S A 92(20): 9412-6. Peakman, M., E. J. Stevens, T. Lohmann, P. Narendran, J. Dromey, A. Alexander, A. J. Tomlinson, M. Trucco, J. C. Gorga and R. M. Chicz (1999). "Naturally processed and presented epitopes of the islet cell autoantigen IA-2 eluted from HLA-DR4." J Clin Invest 104(10): 1449-57. Petersen, J. S., P. Mackay, A. Plesner, A. Karlsen, C. Gotfredsen, S. Verland, B. Michelsen and T. Dyrberg (1997). "Treatment with GAD65 or BSA does not protect against diabetes in BB rats." Autoimmunity 25(3): 129-38. Piemonti, L., B. E. Leone, R. Nano, A. Saccani, P. Monti, P. Maffi, G. Bianchi, A. Sica, G. Peri, R. Melzi, L. Aldrighetti, A. Secchi, V. Di Carlo, P. Allavena and F. Bertuzzi (2002). "Human pancreatic islets produce and secrete MCP-1/CCL2: relevance in human islet transplantation." Diabetes 51(1): 55-65. Pilstrom, B., L. Bjork and J. Bohme (1995). "Demonstration of a TH1 cytokine profile in the late phase of NOD insulitis." Cytokine 7(8): 806-14.

- 191 - References

Pipeleers, D. G., P. A. in't Veld, M. Van de Winkel, E. Maes, F. C. Schuit and W. Gepts (1985). "A new in vitro model for the study of pancreatic A and B cells." Endocrinology 117(3): 806-16. Pitti, R. M., S. A. Marsters, S. Ruppert, C. J. Donahue, A. Moore and A. Ashkenazi (1996). "Induction of apoptosis by Apo-2 ligand, a new member of the tumor necrosis factor cytokine family." J Biol Chem 271(22): 12687-90. Plaksin, D., P. A. Baeuerle and L. Eisenbach (1993). "KBF1 (p50 NF-kappa B homodimer) acts as a repressor of H-2Kb gene expression in metastatic tumor cells." J Exp Med 177(6): 1651-62. Pomero, F., A. Allione, E. Beltramo, S. Buttiglieri, F. D'Alu, E. Ponte, A. Lacaria and M. Porta (2003). "Effects of protein kinase C inhibition and activation on proliferation and apoptosis of bovine retinal pericytes." Diabetologia 46(3): 416-9. Pugliese, A., Z. L. Awdeh, C. A. Alper, R. A. Jackson and G. S. Eisenbarth (1994). "The paternally inherited insulin gene B allele (1,428 FokI site) confers protection from insulin-dependent diabetes in families." J Autoimmun 7(5): 687-94. Pugliese, A., D. Brown, D. Garza, D. Murchison, M. Zeller, M. J. Redondo, J. Diez, G. S. Eisenbarth, D. D. Patel and C. Ricordi (2001). "Self-antigen-presenting cells expressing diabetes-associated autoantigens exist in both thymus and peripheral lymphoid organs." J Clin Invest 107(5): 555-64. Pugliese, A., R. Gianani, R. Moromisato, Z. L. Awdeh, C. A. Alper, H. A. Erlich, R. A. Jackson and G. S. Eisenbarth (1995). "HLA-DQB1*0602 is associated with dominant protection from diabetes even among islet cell antibody-positive first- degree relatives of patients with IDDM." Diabetes 44(6): 608-13. Pugliese, A., E. Kawasaki, M. Zeller, L. Yu, S. Babu, M. Solimena, C. T. Moraes, M. Pietropaolo, R. P. Friday, M. Trucco, C. Ricordi, M. Allen, J. A. Noble, H. A. Erlich and G. S. Eisenbarth (1999). "Sequence analysis of the diabetes-protective human leukocyte antigen-DQB1*0602 allele in unaffected, islet cell antibody-positive first degree relatives and in rare patients with type 1 diabetes." J Clin Endocrinol Metab 84(5): 1722-8. Pugliese, A., M. Zeller, A. Fernandez, Jr., L. J. Zalcberg, R. J. Bartlett, C. Ricordi, M. Pietropaolo, G. S. Eisenbarth, S. T. Bennett and D. D. Patel (1997). "The insulin gene is transcribed in the human thymus and transcription levels correlated with allelic variation at the INS VNTR-IDDM2 susceptibility locus for type 1 diabetes." Nat Genet 15(3): 293-7. Rabinovitch, A. (1994). "Immunoregulatory and cytokine imbalances in the pathogenesis of IDDM. Therapeutic intervention by immunostimulation?" Diabetes 43(5): 613-21. Rabinovitch, A. (1998). "An update on cytokines in the pathogenesis of insulin- dependent diabetes mellitus." Diabetes Metab Rev 14(2): 129-51. Rabinovitch, A. and W. L. Suarez-Pinzon (1998). "Cytokines and their roles in pancreatic islet beta-cell destruction and insulin-dependent diabetes mellitus." Biochem Pharmacol 55(8): 1139-49. Raff, M. C. (1996). "Size control: the regulation of cell numbers in animal development." Cell 86(2): 173-5.

- 192 - References

Rand, L. I., A. S. Krolewski, L. M. Aiello, J. H. Warram, R. S. Baker and T. Maki (1985). "Multiple factors in the prediction of risk of proliferative diabetic retinopathy." N Engl J Med 313(23): 1433-8. Rathmann, W. and G. Giani (2004). "Global prevalence of diabetes: estimates for the year 2000 and projections for 2030." Diabetes Care 27(10): 2568-9; author reply 2569. Ray, C. A., R. A. Black, S. R. Kronheim, T. A. Greenstreet, P. R. Sleath, G. S. Salvesen and D. J. Pickup (1992). "Viral inhibition of inflammation: cowpox virus encodes an inhibitor of the interleukin-1 beta converting enzyme." Cell 69(4): 597- 604. Reddy, S., Y. Bai, E. Robinson and J. Ross (2006). "Immunolocalization of monocyte chemoattractant protein-1 in islets of NOD mice during cyclophosphamide administration." Ann N Y Acad Sci 1079: 103-8. Reed, P., F. Cucca, S. Jenkins, M. Merriman, A. Wilson, P. McKinney, E. Bosi, G. Joner, K. Ronningen, E. Thorsby, D. Undlien, T. Merriman, A. Barnett, S. Bain and J. Todd (1997). "Evidence for a type 1 diabetes susceptibility locus (IDDM10) on human chromosome 10p11-q11." Hum Mol Genet 6(7): 1011-6. Rees, D. A. and J. C. Alcolado (2005). "Animal models of diabetes mellitus." Diabet Med 22(4): 359-70. Remuzzi, G., A. Benigni and A. Remuzzi (2006). "Mechanisms of progression and regression of renal lesions of chronic nephropathies and diabetes." J Clin Invest 116(2): 288-96. Ricordi, C. and T. B. Strom (2004). "Clinical islet transplantation: advances and immunological challenges." Nat Rev Immunol 4(4): 259-68. Rodriguez, M. S., J. Wright, J. Thompson, D. Thomas, F. Baleux, J. L. Virelizier, R. T. Hay and F. Arenzana-Seisdedos (1996). "Identification of lysine residues required for signal-induced ubiquitination and degradation of I kappa B-alpha in vivo." Oncogene 12(11): 2425-35. Roep, B. O. (2003). "The role of T-cells in the pathogenesis of Type 1 diabetes: from cause to cure." Diabetologia 46(3): 305-21. Roep, B. O., M. Atkinson and M. von Herrath (2004). "Satisfaction (not) guaranteed: re-evaluating the use of animal models of type 1 diabetes." Nat Rev Immunol 4(12): 989-97. Roff, M., J. Thompson, M. S. Rodriguez, J. M. Jacque, F. Baleux, F. Arenzana- Seisdedos and R. T. Hay (1996). "Role of IkappaBalpha ubiquitination in signal- induced activation of NFkappaB in vivo." J Biol Chem 271(13): 7844-50. Romeo, G., W. H. Liu, V. Asnaghi, T. S. Kern and M. Lorenzi (2002). "Activation of nuclear factor-kappaB induced by diabetes and high glucose regulates a proapoptotic program in retinal pericytes." Diabetes 51(7): 2241-8. Ronningen, K. S., T. Iwe, T. S. Halstensen, A. Spurkland and E. Thorsby (1989). "The amino acid at position 57 of the HLA-DQ beta chain and susceptibility to develop insulin-dependent diabetes mellitus." Hum Immunol 26(3): 215-25. Ronningen, K. S., A. Spurkland, T. Iwe, F. Vartdal and E. Thorsby (1991). "Distribution of HLA-DRB1, -DQA1 and -DQB1 alleles and DQA1-DQB1 genotypes

- 193 - References among Norwegian patients with insulin-dependent diabetes mellitus." Tissue Antigens 37(3): 105-11. Rood, P. P., L. H. Buhler, R. Bottino, M. Trucco and D. K. Cooper (2006). "Pig-to- nonhuman primate islet xenotransplantation: a review of current problems." Cell Transplant 15(2): 89-104. Rose, N. R. and C. Bona (1993). "Defining criteria for autoimmune diseases (Witebsky's postulates revisited)." Immunol Today 14(9): 426-30. Rosse, T., R. Olivier, L. Monney, M. Rager, S. Conus, I. Fellay, B. Jansen and C. Borner (1998). "Bcl-2 prolongs cell survival after Bax-induced release of cytochrome c." Nature 391(6666): 496-9. Rothe, M., M. G. Pan, W. J. Henzel, T. M. Ayres and D. V. Goeddel (1995). "The TNFR2-TRAF signaling complex contains two novel proteins related to baculoviral inhibitor of apoptosis proteins." Cell 83(7): 1243-52. Rothe, M., V. Sarma, V. M. Dixit and D. V. Goeddel (1995). "TRAF2-mediated activation of NF-kappa B by TNF receptor 2 and CD40." Science 269(5229): 1424-7. Rothe, M., S. C. Wong, W. J. Henzel and D. V. Goeddel (1994). "A novel family of putative signal transducers associated with the cytoplasmic domain of the 75 kDa tumor necrosis factor receptor." Cell 78(4): 681-92. Rotter, J. I. (1981). "The modes of inheritance of insulin-dependent diabetes mellitus or the genetics of IDDM, no longer a nightmare but still a headache." Am J Hum Genet 33(6): 835-51. Rovere, P., M. G. Sabbadini, C. Vallinoto, U. Fascio, V. S. Zimmermann, A. Bondanza, P. Ricciardi-Castagnoli and A. A. Manfredi (1999). "Delayed clearance of apoptotic lymphoma cells allows cross-presentation of intracellular antigens by mature dendritic cells." J Leukoc Biol 66(2): 345-9. Rovere, P., C. Vallinoto, A. Bondanza, M. C. Crosti, M. Rescigno, P. Ricciardi- Castagnoli, C. Rugarli and A. A. Manfredi (1998). "Bystander apoptosis triggers dendritic cell maturation and antigen-presenting function." J Immunol 161(9): 4467- 71. Rudolph, D., W. C. Yeh, A. Wakeham, B. Rudolph, D. Nallainathan, J. Potter, A. J. Elia and T. W. Mak (2000). "Severe liver degeneration and lack of NF-kappaB activation in NEMO/IKKgamma-deficient mice." Genes Dev 14(7): 854-62. Ryseck, R. P., P. Bull, M. Takamiya, V. Bours, U. Siebenlist, P. Dobrzanski and R. Bravo (1992). "RelB, a new Rel family transcription activator that can interact with p50-NF-kappa B." Mol Cell Biol 12(2): 674-84. Salvesen, G. S. and C. S. Duckett (2002). "IAP proteins: blocking the road to death's door." Nat Rev Mol Cell Biol 3(6): 401-10. Sandler, S., K. Bendtzen, D. L. Eizirik and M. Welsh (1990). "Interleukin-6 affects insulin secretion and glucose metabolism of rat pancreatic islets in vitro." Endocrinology 126(2): 1288-94. Sarma, V., Z. Lin, L. Clark, B. M. Rust, M. Tewari, R. J. Noelle and V. M. Dixit (1995). "Activation of the B-cell surface receptor CD40 induces A20, a novel zinc finger protein that inhibits apoptosis." J Biol Chem 270(21): 12343-6.

- 194 - References

Savinov, A. Y., F. S. Wong and A. V. Chervonsky (2001). "IFN-gamma affects homing of diabetogenic T cells." J Immunol 167(11): 6637-43. Scaffidi, C., S. Fulda, A. Srinivasan, C. Friesen, F. Li, K. J. Tomaselli, K. M. Debatin, P. H. Krammer and M. E. Peter (1998). "Two CD95 (APO-1/Fas) signaling pathways." Embo J 17(6): 1675-87. Scaglia, L., C. J. Cahill, D. T. Finegood and S. Bonner-Weir (1997). "Apoptosis participates in the remodeling of the endocrine pancreas in the neonatal rat." Endocrinology 138(4): 1736-41. Scaglia, L., F. E. Smith and S. Bonner-Weir (1995). "Apoptosis contributes to the involution of beta cell mass in the post partum rat pancreas." Endocrinology 136(12): 5461-8. Scherer, D. C., J. A. Brockman, Z. Chen, T. Maniatis and D. W. Ballard (1995). "Signal-induced degradation of I kappa B alpha requires site-specific ubiquitination." Proc Natl Acad Sci U S A 92(24): 11259-63. Schroppel, B., N. Zhang, P. Chen, W. Zang, D. Chen, K. L. Hudkins, W. A. Kuziel, R. Sung, J. S. Bromberg and B. Murphy (2004). "Differential expression of chemokines and chemokine receptors in murine islet allografts: the role of CCR2 and CCR5 signaling pathways." J Am Soc Nephrol 15(7): 1853-61. Schwab, S. J., F. L. Dunn and M. N. Feinglos (1992). "Screening for microalbuminuria. A comparison of single sample methods of collection and techniques of albumin analysis." Diabetes Care 15(11): 1581-4. Screaton, G. R., X. N. Xu, A. L. Olsen, A. E. Cowper, R. Tan, A. J. McMichael and J. I. Bell (1997). "LARD: a new lymphoid-specific death domain containing receptor regulated by alternative pre-mRNA splicing." Proc Natl Acad Sci U S A 94(9): 4615- 9. Sen, R. and D. Baltimore (1986). "Multiple nuclear factors interact with the immunoglobulin enhancer sequences." Cell 46(5): 705-16. Senftleben, U., Y. Cao, G. Xiao, F. R. Greten, G. Krahn, G. Bonizzi, Y. Chen, Y. Hu, A. Fong, S. C. Sun and M. Karin (2001). "Activation by IKKalpha of a second, evolutionary conserved, NF-kappa B signaling pathway." Science 293(5534): 1495-9. Serreze, D. V., H. D. Chapman, D. S. Varnum, M. S. Hanson, P. C. Reifsnyder, S. D. Richard, S. A. Fleming, E. H. Leiter and L. D. Shultz (1996). "B lymphocytes are essential for the initiation of T cell-mediated autoimmune diabetes: analysis of a new "speed congenic" stock of NOD.Ig mu null mice." J Exp Med 184(5): 2049-53. Serreze, D. V., S. A. Fleming, H. D. Chapman, S. D. Richard, E. H. Leiter and R. M. Tisch (1998). "B lymphocytes are critical antigen-presenting cells for the initiation of T cell-mediated autoimmune diabetes in nonobese diabetic mice." J Immunol 161(8): 3912-8. Serreze, D. V., E. H. Leiter, G. J. Christianson, D. Greiner and D. C. Roopenian (1994). "Major histocompatibility complex class I-deficient NOD-B2mnull mice are diabetes and insulitis resistant." Diabetes 43(3): 505-9. Shah, S. C., J. I. Malone and J. I. Malone (1989). "A randomized trial of intensive insulin therapy in newly diagnosed insulin-dependent diabetes mellitus." N Engl J Med 320(9): 550-4.

- 195 - References

Shapiro, A. M., J. R. Lakey, E. A. Ryan, G. S. Korbutt, E. Toth, G. L. Warnock, N. M. Kneteman and R. V. Rajotte (2000). "Islet transplantation in seven patients with type 1 diabetes mellitus using a glucocorticoid-free immunosuppressive regimen." N Engl J Med 343(4): 230-8. Sheehy, M. J., S. J. Scharf, J. R. Rowe, M. H. Neme de Gimenez, L. M. Meske, H. A. Erlich and B. S. Nepom (1989). "A diabetes-susceptible HLA haplotype is best defined by a combination of HLA-DR and -DQ alleles." J Clin Invest 83(3): 830-5. Shehadeh, N. N., R. G. Gill and K. J. Lafferty (1993). "Mechanism of self-tolerance to endocrine tissue." Springer Semin Immunopathol 14(3): 203-20. Shimizu, J., O. Kanagawa and E. R. Unanue (1993). "Presentation of beta-cell antigens to CD4+ and CD8+ T cells of non-obese diabetic mice." J Immunol 151(3): 1723-30. Shoda, L. K., D. L. Young, S. Ramanujan, C. C. Whiting, M. A. Atkinson, J. A. Bluestone, G. S. Eisenbarth, D. Mathis, A. A. Rossini, S. E. Campbell, R. Kahn and H. T. Kreuwel (2005). "A comprehensive review of interventions in the NOD mouse and implications for translation." Immunity 23(2): 115-26. Sibley, R. K., D. E. Sutherland, F. Goetz and A. F. Michael (1985). "Recurrent diabetes mellitus in the pancreas iso- and allograft. A light and electron microscopic and immunohistochemical analysis of four cases." Lab Invest 53(2): 132-44. Silveira, P. A., J. Dombrowsky, E. Johnson, H. D. Chapman, D. Nemazee and D. V. Serreze (2004). "B cell selection defects underlie the development of diabetogenic APCs in nonobese diabetic mice." J Immunol 172(8): 5086-94. Silveira, P. A., E. Johnson, H. D. Chapman, T. Bui, R. M. Tisch and D. V. Serreze (2002). "The preferential ability of B lymphocytes to act as diabetogenic APC in NOD mice depends on expression of self-antigen-specific immunoglobulin receptors." Eur J Immunol 32(12): 3657-66. Silverman, N. and T. Maniatis (2001). "NF-kappaB signaling pathways in mammalian and insect innate immunity." Genes Dev 15(18): 2321-42. Sizemore, N., N. Lerner, N. Dombrowski, H. Sakurai and G. R. Stark (2002). "Distinct roles of the Ikappa B kinase alpha and beta subunits in liberating nuclear factor kappa B (NF-kappa B) from Ikappa B and in phosphorylating the p65 subunit of NF-kappa B." J Biol Chem 277(6): 3863-9. Smith, C. A., T. Farrah and R. G. Goodwin (1994). "The TNF receptor superfamily of cellular and viral proteins: activation, costimulation, and death." Cell 76(6): 959-62. Song, H. Y., M. Rothe and D. V. Goeddel (1996). "The tumor necrosis factor- inducible zinc finger protein A20 interacts with TRAF1/TRAF2 and inhibits NF- kappaB activation." Proc Natl Acad Sci U S A 93(13): 6721-5. Sorli, C. H., H. J. Zhang, M. B. Armstrong, R. V. Rajotte, J. Maclouf and R. P. Robertson (1998). "Basal expression of cyclooxygenase-2 and nuclear factor- interleukin 6 are dominant and coordinately regulated by interleukin 1 in the pancreatic islet." Proc Natl Acad Sci U S A 95(4): 1788-93. Spencer, S. J., S. Mesiano, J. Y. Lee and R. B. Jaffe (1999). "Proliferation and apoptosis in the human adrenal cortex during the fetal and perinatal periods: implications for growth and remodeling." J Clin Endocrinol Metab 84(3): 1110-5.

- 196 - References

Spielman, R. S., R. E. McGinnis and W. J. Ewens (1993). "Transmission test for linkage disequilibrium: the insulin gene region and insulin-dependent diabetes mellitus (IDDM)." Am J Hum Genet 52(3): 506-16. Stanger, B. Z., P. Leder, T. H. Lee, E. Kim and B. Seed (1995). "RIP: a novel protein containing a death domain that interacts with Fas/APO-1 (CD95) in yeast and causes cell death." Cell 81(4): 513-23. Steer, S. A., A. L. Scarim, K. T. Chambers and J. A. Corbett (2006). "Interleukin-1 stimulates beta-cell necrosis and release of the immunological adjuvant HMGB1." PLoS Med 3(2): e17. Storz, P., H. Doppler, C. Ferran, S. T. Grey and A. Toker (2005). "Functional dichotomy of A20 in apoptotic and necrotic cell death." Biochem J 387(Pt 1): 47-55. Storz, P. and A. Toker (2003). "Protein kinase D mediates a stress-induced NF- kappaB activation and survival pathway." Embo J 22(1): 109-20. Strasser, A., A. W. Harris, M. L. Bath and S. Cory (1990). "Novel primitive lymphoid tumours induced in transgenic mice by cooperation between myc and bcl-2." Nature 348(6299): 331-3. Strasser, A., S. Whittingham, D. L. Vaux, M. L. Bath, J. M. Adams, S. Cory and A. W. Harris (1991). "Enforced BCL2 expression in B-lymphoid cells prolongs antibody responses and elicits autoimmune disease." Proc Natl Acad Sci U S A 88(19): 8661-5. Sumida, T., M. Furukawa, A. Sakamoto, T. Namekawa, T. Maeda, M. Zijlstra, I. Iwamoto, T. Koike, S. Yoshida, H. Tomioka and et al. (1994). "Prevention of insulitis and diabetes in beta 2-microglobulin-deficient non-obese diabetic mice." Int Immunol 6(9): 1445-9. Tartaglia, L. A., T. M. Ayres, G. H. Wong and D. V. Goeddel (1993). "A novel domain within the 55 kd TNF receptor signals cell death." Cell 74(5): 845-53. Tartaglia, L. A. and D. V. Goeddel (1992). "Two TNF receptors." Immunol Today 13(5): 151-3. Tergaonkar, V. (2006). "NFkappaB pathway: a good signaling paradigm and therapeutic target." Int J Biochem Cell Biol 38(10): 1647-53. Tesfamariam, B. and R. A. Cohen (1992). "Free radicals mediate endothelial cell dysfunction caused by elevated glucose." Am J Physiol 263(2 Pt 2): H321-6. Tewari, M., F. W. Wolf, M. F. Seldin, K. S. O'Shea, V. M. Dixit and L. A. Turka (1995). "Lymphoid expression and regulation of A20, an inhibitor of programmed cell death." J Immunol 154(4): 1699-706. Thivolet, C., A. Bendelac, P. Bedossa, J. F. Bach and C. Carnaud (1991). "CD8+ T cell homing to the pancreas in the nonobese diabetic mouse is CD4+ T cell- dependent." J Immunol 146(1): 85-8. Thomas, H. E., W. Irawaty, R. Darwiche, T. C. Brodnicki, P. Santamaria, J. Allison and T. W. Kay (2004). "IL-1 receptor deficiency slows progression to diabetes in the NOD mouse." Diabetes 53(1): 113-21. Thomas, H. E. and T. W. Kay (2000). "Beta cell destruction in the development of autoimmune diabetes in the non-obese diabetic (NOD) mouse." Diabetes Metab Res Rev 16(4): 251-61.

- 197 - References

Thome, M., P. Schneider, K. Hofmann, H. Fickenscher, E. Meinl, F. Neipel, C. Mattmann, K. Burns, J. L. Bodmer, M. Schroter, C. Scaffidi, P. H. Krammer, M. E. Peter and J. Tschopp (1997). "Viral FLICE-inhibitory proteins (FLIPs) prevent apoptosis induced by death receptors." Nature 386(6624): 517-21. Thompson, C. B. (1995). "Apoptosis in the pathogenesis and treatment of disease." Science 267(5203): 1456-62. Thompson, J. E., R. J. Phillips, H. Erdjument-Bromage, P. Tempst and S. Ghosh (1995). "I kappa B-beta regulates the persistent response in a biphasic activation of NF-kappa B." Cell 80(4): 573-82. Ting, A. T., F. X. Pimentel-Muinos and B. Seed (1996). "RIP mediates tumor necrosis factor receptor 1 activation of NF-kappaB but not Fas/APO-1-initiated apoptosis." Embo J 15(22): 6189-96. Tisch, R. and H. McDevitt (1996). "Insulin-dependent diabetes mellitus." Cell 85(3): 291-7. Tisch, R., X. D. Yang, S. M. Singer, R. S. Liblau, L. Fugger and H. O. McDevitt (1993). "Immune response to glutamic acid decarboxylase correlates with insulitis in non-obese diabetic mice." Nature 366(6450): 72-5. Todd, J. A., T. J. Aitman, R. J. Cornall, S. Ghosh, J. R. Hall, C. M. Hearne, A. M. Knight, J. M. Love, M. A. McAleer, J. B. Prins and et al. (1991). "Genetic analysis of autoimmune type 1 diabetes mellitus in mice." Nature 351(6327): 542-7. Tonegawa, S. (1983). "Somatic generation of antibody diversity." Nature 302(5909): 575-81. Traenckner, E. B., S. Wilk and P. A. Baeuerle (1994). "A proteasome inhibitor prevents activation of NF-kappa B and stabilizes a newly phosphorylated form of I kappa B-alpha that is still bound to NF-kappa B." Embo J 13(22): 5433-41. Trudeau, J. D., J. P. Dutz, E. Arany, D. J. Hill, W. E. Fieldus and D. T. Finegood (2000). "Neonatal beta-cell apoptosis: a trigger for autoimmune diabetes?" Diabetes 49(1): 1-7. Unanue, E. R., D. I. Beller, C. Y. Lu and P. M. Allen (1984). "Antigen presentation: comments on its regulation and mechanism." J Immunol 132(1): 1-5. Uren, A. G., M. Pakusch, C. J. Hawkins, K. L. Puls and D. L. Vaux (1996). "Cloning and expression of apoptosis inhibitory protein homologs that function to inhibit apoptosis and/or bind tumor necrosis factor receptor-associated factors." Proc Natl Acad Sci U S A 93(10): 4974-8. Vafiadis, P., S. T. Bennett, J. A. Todd, J. Nadeau, R. Grabs, C. G. Goodyer, S. Wickramasinghe, E. Colle and C. Polychronakos (1997). "Insulin expression in human thymus is modulated by INS VNTR alleles at the IDDM2 locus." Nat Genet 15(3): 289-92. Van Antwerp, D. J., S. J. Martin, T. Kafri, D. R. Green and I. M. Verma (1996). "Suppression of TNF-alpha-induced apoptosis by NF-kappaB." Science 274(5288): 787-9. Vander Heiden, M. G., N. S. Chandel, E. K. Williamson, P. T. Schumacker and C. B. Thompson (1997). "Bcl-xL regulates the membrane potential and volume homeostasis of mitochondria." Cell 91(5): 627-37.

- 198 - References

Vardi, P., A. G. Ziegler, J. H. Mathews, S. Dib, R. J. Keller, A. T. Ricker, J. I. Wolfsdorf, R. D. Herskowitz, A. Rabizadeh, G. S. Eisenbarth and et al. (1988). "Concentration of insulin autoantibodies at onset of type I diabetes. Inverse log-linear correlation with age." Diabetes Care 11(9): 736-9. Varfolomeev, E. E., M. P. Boldin, T. M. Goncharov and D. Wallach (1996). "A potential mechanism of "cross-talk" between the p55 tumor necrosis factor receptor and Fas/APO1: proteins binding to the death domains of the two receptors also bind to each other." J Exp Med 183(3): 1271-5. Vaux, D. L., S. Cory and J. M. Adams (1988). "Bcl-2 gene promotes haemopoietic cell survival and cooperates with c-myc to immortalize pre-B cells." Nature 335(6189): 440-2. Vaux, D. L., G. Haecker and A. Strasser (1994). "An evolutionary perspective on apoptosis." Cell 76(5): 777-9. Vaux, D. L. and S. J. Korsmeyer (1999). "Cell death in development." Cell 96(2): 245-54. Verge, C. F., R. Gianani, E. Kawasaki, L. Yu, M. Pietropaolo, R. A. Jackson, H. P. Chase and G. S. Eisenbarth (1996). "Prediction of type I diabetes in first-degree relatives using a combination of insulin, GAD, and ICA512bdc/IA-2 autoantibodies." Diabetes 45(7): 926-33. Verge, C. F., P. Vardi, S. Babu, F. Bao, H. A. Erlich, T. Bugawan, D. Tiosano, L. Yu, G. S. Eisenbarth and P. R. Fain (1998). "Evidence for oligogenic inheritance of type 1 diabetes in a large Bedouin Arab family." J Clin Invest 102(8): 1569-75. Verma, I. M., J. K. Stevenson, E. M. Schwarz, D. Van Antwerp and S. Miyamoto (1995). "Rel/NF-kappa B/I kappa B family: intimate tales of association and dissociation." Genes Dev 9(22): 2723-35. Vialettes, B., D. Maraninchi, M. P. San Marco, F. Birg, A. M. Stoppa, C. Mattei- Zevaco, C. Thivolet, L. Hermitte, P. Vague and P. Mercier (1993). "Autoimmune polyendocrine failure--type 1 (insulin-dependent) diabetes mellitus and hypothyroidism--after allogeneic bone marrow transplantation in a patient with lymphoblastic leukaemia." Diabetologia 36(6): 541-6. Vicario, J. L., J. Martinez-Laso, A. Corell, J. M. Martin-Villa, P. Morales, G. Lledo, O. G. Segurado, D. de Juan and A. Arnaiz-Villena (1992). "Comparison between HLA-DRB and DQ DNA sequences and classic serological markers as type 1 (insulin-dependent) diabetes mellitus predictive risk markers in the Spanish population." Diabetologia 35(5): 475-81. Vinik, A. I., R. E. Maser, B. D. Mitchell and R. Freeman (2003). "Diabetic autonomic neuropathy." Diabetes Care 26(5): 1553-79. Vinik, A. I. and A. Mehrabyan (2004). "Diabetic neuropathies." Med Clin North Am 88(4): 947-99, xi. Wang, C., L. Deng, M. Hong, G. R. Akkaraju, J. Inoue and Z. J. Chen (2001). "TAK1 is a ubiquitin-dependent kinase of MKK and IKK." Nature 412(6844): 346-51. Wang, C. Y., M. W. Mayo and A. S. Baldwin, Jr. (1996). "TNF- and cancer therapy- induced apoptosis: potentiation by inhibition of NF-kappaB." Science 274(5288): 784-7.

- 199 - References

Wang, L., R. Han, I. Lee, A. S. Hancock, G. Xiong, M. D. Gunn and W. W. Hancock (2005). "Permanent survival of fully MHC-mismatched islet allografts by targeting a single chemokine receptor pathway." J Immunol 175(10): 6311-8. Wang, R. A., P. K. Nakane and T. Koji (1998). "Autonomous cell death of mouse male germ cells during fetal and postnatal period." Biol Reprod 58(5): 1250-6. Wang, S. and L. Chen (2004). "T lymphocyte co-signaling pathways of the B7-CD28 family." Cell Mol Immunol 1(1): 37-42. Wang, Y., O. Pontesilli, R. G. Gill, F. G. La Rosa and K. J. Lafferty (1991). "The role of CD4+ and CD8+ T cells in the destruction of islet grafts by spontaneously diabetic mice." Proc Natl Acad Sci U S A 88(2): 527-31. Warram, J. H., A. S. Krolewski, M. S. Gottlieb and C. R. Kahn (1984). "Differences in risk of insulin-dependent diabetes in offspring of diabetic mothers and diabetic fathers." N Engl J Med 311(3): 149-52. Watanabe-Fukunaga, R., C. I. Brannan, N. G. Copeland, N. A. Jenkins and S. Nagata (1992). "Lymphoproliferation disorder in mice explained by defects in Fas antigen that mediates apoptosis." Nature 356(6367): 314-7. Watts, T. H. and M. A. DeBenedette (1999). "T cell co-stimulatory molecules other than CD28." Curr Opin Immunol 11(3): 286-93. Wegmann, D. R., M. Norbury-Glaser and D. Daniel (1994). "Insulin-specific T cells are a predominant component of islet infiltrates in pre-diabetic NOD mice." Eur J Immunol 24(8): 1853-7. Weir, G. C. and S. Bonner-Weir (1997). "Scientific and political impediments to successful islet transplantation." Diabetes 46(8): 1247-56. Wen, L., N. Y. Chen, J. Tang, R. Sherwin and F. S. Wong (2001). "The regulatory role of DR4 in a spontaneous diabetes DQ8 transgenic model." J Clin Invest 107(7): 871-80. Wen, L., F. S. Wong, J. Tang, N. Y. Chen, M. Altieri, C. David, R. Flavell and R. Sherwin (2000). "In vivo evidence for the contribution of human histocompatibility leukocyte antigen (HLA)-DQ molecules to the development of diabetes." J Exp Med 191(1): 97-104. Werlen, G., B. Hausmann, D. Naeher and E. Palmer (2003). "Signaling life and death in the thymus: timing is everything." Science 299(5614): 1859-63. Werner, S. L., D. Barken and A. Hoffmann (2005). "Stimulus specificity of gene expression programs determined by temporal control of IKK activity." Science 309(5742): 1857-61. Wertz, I. E., K. M. O'Rourke, H. Zhou, M. Eby, L. Aravind, S. Seshagiri, P. Wu, C. Wiesmann, R. Baker, D. L. Boone, A. Ma, E. V. Koonin and V. M. Dixit (2004). "De-ubiquitination and ubiquitin ligase domains of A20 downregulate NF-kappaB signalling." Nature 430(7000): 694-9. WHO (1999). Definition, Diagnosis and Classification of Diabetes Mellitus and its Complications. Geneva, World Health Organisation, Department of Noncommunicable Disease Surveillance. Wicker, L. S., M. C. Appel, F. Dotta, A. Pressey, B. J. Miller, N. H. DeLarato, P. A. Fischer, R. C. Boltz, Jr. and L. B. Peterson (1992). "Autoimmune syndromes in major - 200 - References histocompatibility complex (MHC) congenic strains of nonobese diabetic (NOD) mice. The NOD MHC is dominant for insulitis and cyclophosphamide-induced diabetes." J Exp Med 176(1): 67-77. Wicker, L. S., J. Clark, H. I. Fraser, V. E. Garner, A. Gonzalez-Munoz, B. Healy, S. Howlett, K. Hunter, D. Rainbow, R. L. Rosa, L. J. Smink, J. A. Todd and L. B. Peterson (2005). "Type 1 diabetes genes and pathways shared by humans and NOD mice." J Autoimmun 25 Suppl: 29-33. Wicker, L. S., E. H. Leiter, J. A. Todd, R. J. Renjilian, E. Peterson, P. A. Fischer, P. L. Podolin, M. Zijlstra, R. Jaenisch and L. B. Peterson (1994). "Beta 2-microglobulin- deficient NOD mice do not develop insulitis or diabetes." Diabetes 43(3): 500-4. Wicker, L. S., B. J. Miller and Y. Mullen (1986). "Transfer of autoimmune diabetes mellitus with splenocytes from nonobese diabetic (NOD) mice." Diabetes 35(8): 855- 60. Wild, S., G. Roglic, A. Green, R. Sicree and H. King (2004). "Global prevalence of diabetes: estimates for the year 2000 and projections for 2030." Diabetes Care 27(5): 1047-53. Wiley, S. R., K. Schooley, P. J. Smolak, W. S. Din, C. P. Huang, J. K. Nicholl, G. R. Sutherland, T. D. Smith, C. Rauch, C. A. Smith and et al. (1995). "Identification and characterization of a new member of the TNF family that induces apoptosis." Immunity 3(6): 673-82. Williams, S. B., A. B. Goldfine, F. K. Timimi, H. H. Ting, M. A. Roddy, D. C. Simonson and M. A. Creager (1998). "Acute hyperglycemia attenuates endothelium- dependent vasodilation in humans in vivo." Circulation 97(17): 1695-701. Witkowski, P., S. B. Zakai, A. Rana, Z. Sledzinski and M. A. Hardy (2006). "Pancreatic islet transplantation, what has been achieved since Edmonton break- through." Ann Transplant 11(2): 5-13; discussion 32-43. Woda, B. A., A. A. Like, C. Padden and M. L. McFadden (1986). "Deficiency of phenotypic cytotoxic-suppressor T lymphocytes in the BB/W rat." J Immunol 136(3): 856-9. Wong, G. H., J. H. Elwell, L. W. Oberley and D. V. Goeddel (1989). "Manganous superoxide dismutase is essential for cellular resistance to cytotoxicity of tumor necrosis factor." Cell 58(5): 923-31. Wucherpfennig, K. W. and G. S. Eisenbarth (2001). "Type 1 diabetes." Nat Immunol 2(9): 767-8. Xiao, G., E. W. Harhaj and S. C. Sun (2001). "NF-kappaB-inducing kinase regulates the processing of NF-kappaB2 p100." Mol Cell 7(2): 401-9. Yale, J. F., M. Grose and E. B. Marliss (1985). "Time course of the lymphopenia in BB rats. Relation to the onset of diabetes." Diabetes 34(10): 955-9. Yamagata, K., H. Nakajima, K. Tomita, N. Itoh, J. Miyagawa, T. Hamaguchi, M. Namba, S. Tamura, S. Kawata, N. Kono, M. Kuwajima, T. Noguchi, T. Hanafusa and Y. Matsuzawa (1996). "Dominant TCR alpha-chain clonotypes and interferon-gamma are expressed in the pancreas of patients with recent-onset insulin-dependent diabetes mellitus." Diabetes Res Clin Pract 34(1): 37-46.

- 201 - References

Yang, J., Y. Lin, Z. Guo, J. Cheng, J. Huang, L. Deng, W. Liao, Z. Chen, Z. Liu and B. Su (2001). "The essential role of MEKK3 in TNF-induced NF-kappaB activation." Nat Immunol 2(7): 620-4. Yang, J., X. Liu, K. Bhalla, C. N. Kim, A. M. Ibrado, J. Cai, T. I. Peng, D. P. Jones and X. Wang (1997). "Prevention of apoptosis by Bcl-2: release of cytochrome c from mitochondria blocked." Science 275(5303): 1129-32. Yeh, W. C., J. L. Pompa, M. E. McCurrach, H. B. Shu, A. J. Elia, A. Shahinian, M. Ng, A. Wakeham, W. Khoo, K. Mitchell, W. S. El-Deiry, S. W. Lowe, D. V. Goeddel and T. W. Mak (1998). "FADD: essential for embryo development and signaling from some, but not all, inducers of apoptosis." Science 279(5358): 1954-8. Yu, L., D. T. Robles, N. Abiru, P. Kaur, M. Rewers, K. Kelemen and G. S. Eisenbarth (2000). "Early expression of antiinsulin autoantibodies of humans and the NOD mouse: evidence for early determination of subsequent diabetes." Proc Natl Acad Sci U S A 97(4): 1701-6. Zagorska, A. and J. Dulak (2004). "HIF-1: the knowns and unknowns of hypoxia sensing." Acta Biochim Pol 51(3): 563-85. Zhang, J., D. Cado, A. Chen, N. H. Kabra and A. Winoto (1998). "Fas-mediated apoptosis and activation-induced T-cell proliferation are defective in mice lacking FADD/Mort1." Nature 392(6673): 296-300. Zhang, S. J., C. J. Zhu, Y. F. Zhao, J. Li and W. Z. Guo (2003). "Different ischemic preconditioning for rat liver graft: protection and mechanism." Hepatobiliary Pancreat Dis Int 2(4): 509-12. Zhang, S. Q., A. Kovalenko, G. Cantarella and D. Wallach (2000). "Recruitment of the IKK signalosome to the p55 TNF receptor: RIP and A20 bind to NEMO (IKKgamma) upon receptor stimulation." Immunity 12(3): 301-11. Zhong, H., H. SuYang, H. Erdjument-Bromage, P. Tempst and S. Ghosh (1997). "The transcriptional activity of NF-kappaB is regulated by the IkappaB-associated PKAc subunit through a cyclic AMP-independent mechanism." Cell 89(3): 413-24. Zhong, H., R. E. Voll and S. Ghosh (1998). "Phosphorylation of NF-kappa B p65 by PKA stimulates transcriptional activity by promoting a novel bivalent interaction with the coactivator CBP/p300." Mol Cell 1(5): 661-71. Zhou, Y. P., J. C. Pena, M. W. Roe, A. Mittal, M. Levisetti, A. C. Baldwin, W. Pugh, D. Ostrega, N. Ahmed, V. P. Bindokas, L. H. Philipson, D. Hanahan, C. B. Thompson and K. S. Polonsky (2000). "Overexpression of Bcl-x(L) in beta-cells prevents cell death but impairs mitochondrial signal for insulin secretion." American Journal of Physiology - Endocrinology & Metabolism 278(2): E340-51. Zipris, D. (1996). "Evidence that Th1 lymphocytes predominate in islet inflammation and thyroiditis in the BioBreeding (BB) rat." J Autoimmun 9(3): 315-9. Zipris, D., D. L. Greiner, S. Malkani, B. Whalen, J. P. Mordes and A. A. Rossini (1996). "Cytokine gene expression in islets and thyroids of BB rats. IFN-gamma and IL-12p40 mRNA increase with age in both diabetic and insulin-treated nondiabetic BB rats." J Immunol 156(3): 1315-21.

- 202 - References

Zou, H., Y. Li, X. Liu and X. Wang (1999). "An APAF-1.cytochrome c multimeric complex is a functional apoptosome that activates procaspase-9." J Biol Chem 274(17): 11549-56. Zumsteg, U., S. Frigerio and G. A. Hollander (2000). "Nitric oxide production and Fas surface expression mediate two independent pathways of cytokine-induced murine beta-cell damage." Diabetes 49(1): 39-47.

- 203 -

APPENDIX 1

204 UNIQUE ID ID Gene Comment BALB/c IL1 BALB/c NOD IL1 NOD TNF TNF A disintegrin and metalloproteinase domain 19 (meltrin beta) 6083 6121 NM 009616 Adam19 -0.22142 -0.19223 -0.48492 -0.16639 Acid phosphatase prostate 1864 1899 NM 019807 Acpp -0.07444 -0.09734 0.00000 0.00000 Actin beta cytoplasmic 1015 1049 NM 007393 HK 0.27396 -0.33127 0.09491 0.12591 activated leukocyte cell adhesion molecule 3768 3802 NM 009655 Alcam 0.21493 0.06207 0.04185 0.18789 activating transcription factor 1 1672 1708 NM 007497 Atf1 0.00196 0.30473 0.18773 0.19713 activating transcription factor 2 1494 1528 NM 009715 Atf2 -0.14514 -0.14452 -0.50608 -0.10325 activating transcription factor 3 1210 1245 NM 007498 Atf3 1.48072 0.30954 1.88141 0.39298 activating transcription factor 4 593 627 NM 009716 Atf4 -0.10849 -0.18485 0.12752 -0.00391 activating transcription factor 5 1230 1264 NM 030693 Atf5 -0.25929 -0.08435 -0.20338 -0.13015 activating transcription factor 7 interacting protein 3809 3843 NM 019426 Atf7ip -0.20164 -0.03858 -0.31154 -0.07988 Activin A receptor type 1 2124 2158 NM 007394 Acvr1 -0.27355 -0.30093 -0.30354 -0.10073 Activin A receptor type 1B 1212 1246 NM 007395 Acvr1b -0.32709 -0.32376 -0.15751 0.09365 Activin A receptor type II-like 1 1505 1539 NM 009612 Acvrl1 -0.08889 -0.34872 0.02138 0.02792 Activin receptor IIA 3935 3969 NM 007396 Acvr2 -0.34489 -0.34407 -0.11499 0.23633 Activin receptor IIB 819 853 NM 007397 Acvr2b -0.42669 -0.38446 -0.32824 -0.13348 ADAM-like decysin 1 2218 2252 NM 021475 Adamdec1 -0.17974 -0.23179 -0.13499 -0.05453 Adaptor protein complex AP-1 sigma 1 896 930 NM 007457 Ap1s1 0.24882 0.67107 -0.40090 -0.39438 Adaptor-related protein complex 1 sigma 2 subunit 2740 2777 NM 026887 Ap1s2 0.06707 0.26271 -0.06378 -0.00518 Adenosine deaminase RNA-specific 3358 3392 NM 019655 Adar -0.24955 -0.25541 -0.07856 0.13161 Adipsin 9 43 NM 013459 Adn -0.26764 -0.28090 -0.20026 -0.01163 ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase) 1 3417 3452 NM 007415 Adprt1 -0.27408 -0.10662 -0.06393 0.14834 Adrenergic receptor alpha 1a 3507 3541 NM 013461 Adra1a -0.03142 0.13424 -0.55313 -0.16835 Adrenergic receptor beta 3 884 918 NM 013462 Adrb3 -0.13197 -0.38940 -0.64128 -0.50796 Allograft inflammatory factor 1 118 152 NM 019467 Aif1 -0.22554 -0.11062 -0.20483 -0.00740 Angiopoietin 2 2378 2412 NM 007426 Angpt2 -0.05024 -0.25869 0.84294 0.72561 Angiotensin converting enzyme 2262 2296 NM 009598 Ace -0.15806 -0.29808 0.05453 0.00289 Angiotensin I converting enzyme (peptidyl-dipeptidase A) 2 1936 1970 NM 027286 Ace2 -0.38026 -0.18917 -0.22311 0.10543 Angiotensinogen 906 940 NM 007428 Agt -0.32499 -0.05046 -0.20125 -0.02269 Ankyrin repeat family A (RFXANK-like) 2 1539 1576 NM 023472 Ankra2 0.01587 0.22020 -0.04936 0.10273 Anti-Mullerian hormone 1021 1055 NM 007445 Amh -0.22682 -0.16936 -0.44051 -0.15307 Apolipoprotein E 110 144 NM 009696 Apoe 0.12437 -0.12058 0.70709 0.48159 apoptosis caspase activation inhibitor 568 604 NM 028844 Aven 0.03594 -0.12817 -0.55976 -0.40079 apoptosis antagonizing transcription factor 1597 1631 NM 019816 Aatf -0.33720 -0.29501 -0.21069 0.01578

Appendix-1 UNIQUE ID ID Gene Comment BALB/c IL1 BALB/c NOD IL1 NOD TNF TNF apoptosis inhibitor 5 3265 3299 NM 007466 Api5 -0.20554 -0.05293 -0.01885 -0.07406 apoptosis-associated tyrosine kinase 4309 4343 NM 007377 Aatk -0.47839 -0.09455 -0.19639 -0.01034 Aquaporin 2 540 574 NM 009699 Aqp2 -0.47837 -0.62402 -0.60032 -0.58248 aryl hydrocarbon receptor nuclear translocator 2 5430 5467 NM 007488 Arnt2 -0.24511 -0.03589 -0.21180 -0.21574 aryl hydrocarbon receptor nuclear translocator 1916 1950 NM 009709 Arnt -0.10849 -0.09954 -0.26865 -0.05816 aryl hydrocarbon receptor nuclear translocator-like 1918 1952 NM 007489 Arntl -0.23102 -0.15292 -0.32436 -0.20246 aryl hydrocarbon receptor-interacting protein-like 1 555 589 NM 053245 Aipl1 -0.23325 -0.28242 -0.20402 -0.20104 aryl-hydrocarbon receptor-interacting protein 565 599 NM 016666 Aip -0.08254 -0.02735 0.13406 0.34646 Ataxia telangiectasia mutated homolog (human) 8670 8704 NM 007499 Atm -0.25796 -0.32315 0.01964 0.02687 ATP-binding cassette sub-family C (CFTR/MRP) member 8 2371 2405 NM 011510 Abcc8 -0.25680 0.00191 -0.16934 0.02410 Avian musculoaponeurotic fibrosarcoma (v-maf) AS42 oncogene S74567 Maf -0.38405 -0.49343 -0.28768 -0.14979 homolog 2049 2083 Avian reticuloendotheliosis viral (v-rel) oncogene related B 1913 1947 NM 009046 Relb 0.77921 0.72237 1.38334 1.22869 AXL receptor tyrosine kinase 3784 3821 NM 009465 Axl 0.23193 0.24804 0.66486 0.52536 axonal-associated cell adhesion molecule 1412 1446 NM 007518 Axcam -0.09891 -0.03770 0.00000 0.00000 baculoviral IAP repeat-containing 1a 5369 5407 NM 008670 Birc1a 0.32194 0.33426 -0.21963 -0.06857 baculoviral IAP repeat-containing 1b 4135 4170 NM 010872 Birc1b -0.26856 -0.07838 -0.05663 -0.22376 baculoviral IAP repeat-containing 1e 4579 4613 NM 010870 Birc1e -0.33719 0.05086 -0.68327 -0.08337 baculoviral IAP repeat-containing 1f 4013 4048 NM 010871 Birc1f -0.43146 -0.25416 -0.18757 0.12700 baculoviral IAP repeat-containing 2 2101 2135 NM 007464 Birc2 0.38428 0.44367 0.66562 0.48916 baculoviral IAP repeat-containing 3 3053 3087 NM 007465 Birc3 1.88219 1.29964 2.43200 1.74423 baculoviral IAP repeat-containing 4 2102 2136 NM 009688 Birc4 -0.23206 -0.16745 -0.45902 -0.25878 baculoviral IAP repeat-containing 5 720 757 NM 009689 Birc5 0.16892 0.47081 -0.25549 -0.00782 baculoviral IAP repeat-containing 6 14723 14761 NM 007566 Birc6 -0.38912 -0.45915 -0.22019 0.01427 basic leucine zipper transcription factor ATF-like 573 607 NM 016767 Batf 0.36697 0.16262 0.76969 0.56018 B-cell CLL/lymphoma 11A (zinc finger protein) 2875 2909 NM 016707 Bcl11a -0.05785 -0.11120 -0.39147 -0.14115 B-cell CLL/lymphoma 6 member B 2477 2515 NM 007528 Bcl6b 0.39167 0.66084 0.62975 0.49553 B-cell CLL/lymphoma 7A 3259 3293 NM 029850 Bcl7a -0.45634 -0.08595 -0.65265 -0.10588 B-cell CLL/lymphoma 7B 662 697 NM 009745 Bcl7b -0.32602 -0.14724 -0.11285 -0.03878 B-cell CLL/lymphoma 7C 540 574 NM 009746 Bcl7c -0.13638 -0.21183 -0.10672 -0.32218 B-cell CLL/lymphoma 9 1664 1699 BC019641 Bcl9 -0.26685 -0.06527 -0.33230 -0.12106 B-cell leukemia/lymphoma 10 859 893 NM 009740 Bcl10 0.78587 0.31638 1.35376 0.89367 B-cell leukemia/lymphoma 11B 1932 1966 NM 021399 Bcl11b -0.34173 -0.26860 -0.54175 -0.47725

Appendix-1 UNIQUE ID ID Gene Comment BALB/c IL1 BALB/c NOD IL1 NOD TNF TNF B-cell leukemia/lymphoma 2 related protein A1a 568 604 NM 009742 Bcl2a1a 0.33203 0.08646 0.95629 0.64682 B-cell leukemia/lymphoma 2 related protein A1c 112 148 NM 007535 Bcl2a1c 0.58469 0.55119 0.71598 0.42499 B-cell leukemia/lymphoma 2 related protein A1d 120 154 NM 007536 Bcl2a1d 0.35795 0.11847 0.98854 0.49121 B-cell leukemia/lymphoma 2 6233 6270 NM 009741 Bcl2 -0.22834 -0.06743 -0.20835 0.03406 B-cell leukemia/lymphoma 3 1517 1551 NM 033601 Bcl3 0.32127 0.40221 0.82690 0.76119 B-cell leukemia/lymphoma 6 2522 2558 NM 009744 Bcl6 0.17372 -0.09493 0.65826 0.39874 B-cell translocation gene 1 anti-proliferative 1070 1104 NM 007569 Btg1 0.69584 0.54868 0.60997 0.26364 Bcl-2 binding component 3 1656 1691 NM 133234 Bbc3 -0.11495 -0.38028 -0.25272 -0.09835 BCL2/adenovirus E1B 19kDa-interacting protein 1 NIP2 1734 1768 NM 016787 Bnip2 -0.20403 -0.37021 0.14361 -0.06159 BCL2/adenovirus E1B 19kDa-interacting protein 1 NIP3 1263 1297 NM 009760 Bnip3 0.03912 -0.22054 -0.19054 0.09213 BCL2/adenovirus E1B 19kDa-interacting protein 3-like 2553 2587 NM 009761 Bnip3l -0.27227 -0.32088 -0.04688 0.07197 BCL2-antagonist/killer 1 1745 1779 NM 007523 Bak1 -0.09327 -0.23462 -0.38265 -0.20687 Bcl2-associated athanogene 1 928 962 NM 009736 Bag1 0.14951 0.21100 0.02434 0.14881 Bcl2-associated athanogene 2 1360 1396 NM 145392 Bag2 -0.38594 -0.28477 -0.55634 -0.61252 Bcl2-associated athanogene 3 1995 2029 NM 013863 Bag3 0.52209 0.36176 0.07259 -0.19152 BCL2-associated athanogene 4 1636 1670 NM 026121 Bag4 -0.55329 -0.24744 -0.30823 -0.07439 BCL2-associated athanogene 5 1235 1269 AK005534 Bag5 -0.13298 -0.23080 -0.12767 0.10005 Bcl2-associated X protein 392 427 NM 007527 Bax -0.28102 -0.17510 -0.12902 -0.02553 Bcl2-interacting killer-like 303 337 NM 007546 Biklk -0.38844 -0.14215 0.04158 0.09765 Bcl2-like 10 261 295 NM 013479 Bcl2l10 -0.17890 0.03023 -0.41119 -0.09637 BCL2-like 11 (apoptosis facilitator) 4235 4269 NM 009754 Bcl2l11 -0.26766 -0.37072 -0.02177 -0.16489 BCL2-like 13 (apoptosis facilitator) 2405 2439 NM 153516 Bcl2l13 0.28085 0.44250 0.13575 0.17274 Bcl2-like 2 3138 3173 NM 007537 Bcl2l2 -0.30939 -0.15455 -0.62642 -0.57562 Bcl2-like 1417 1451 NM 009743 Bcl2l -0.17174 -0.04714 -0.04259 -0.12136 Bcl-2-related ovarian killer protein 656 690 NM 016778 Bok -0.44244 -0.23707 -0.32015 -0.36106 Bcl-associated death promoter 930 964 NM 007522 Bad -0.31447 -0.01364 -0.22448 -0.05758 beclin 1 (coiled-coil myosin-like BCL2-interacting protein) 1894 1929 NM 019584 Becn1 -0.17178 -0.15313 -0.40170 -0.54661 Beta-2 microglobulin 86 120 NM 009735 HK 0.10082 0.04840 0.65017 0.41350 Beta-glucuronidase 1774 1808 NM 010368 HK -0.23855 -0.44191 0.06659 0.25759 BH3 interacting (with BCL2 family) domain apoptosis agonist 720 754 NM 007545 Bid3 -0.24151 -0.33670 -0.12056 -0.12605 BH3 interacting domain death agonist 1670 1704 NM 007544 Bid -0.24749 -0.20209 -0.42349 -0.16025 bifunctional apoptosis regulator 1687 1721 NM 025976 Bfar -0.21231 -0.27083 -0.11450 -0.01481

Appendix-1 UNIQUE ID ID Gene Comment BALB/c IL1 BALB/c NOD IL1 NOD TNF TNF BMP and activin membrane-bound inhibitor homolog (Xenopus NM_026505 Bambi -0.14217 -0.01073 -0.55951 -0.22383 laevis) 4813 4847 Bone morphogenetic protein 1 3157 3191 NM 009755 Bmp1 -0.24656 -0.16755 -0.44261 -0.28924 Bone morphogenetic protein 2 680 714 NM 007553 Bmp2 -0.24246 -0.40498 -0.00580 0.04687 Bone morphogenetic protein 4 953 987 NM 007554 Bmp4 -0.03675 -0.04354 -0.35186 -0.21435 Bone morphogenetic protein 5 910 944 NM 007555 Bmp5 0.00514 -0.24309 -0.05304 -0.33281 Bone morphogenetic protein 7 1715 1749 NM 007557 Bmp7 -0.27885 -0.13356 0.05531 0.05531 Bone morphogenetic protein 8a 1608 1642 NM 007558 Bmp8a -0.12473 -0.29646 -0.33418 -0.00080 Bone morphogenetic protein receptor type 1A 4968 5002 NM 009758 Bmpr1a -0.39274 -0.25860 -0.21709 -0.16849 Bone morphogenetic protein receptor type 1B 5183 5217 NM 007560 Bmpr1b -0.33962 -0.21140 -0.49256 -0.05180 Bone morphogenic protein receptor type II (serine/threonine kinase) 2866 2901 NM 007561 Bmpr2 0.05624 -0.26884 0.11936 -0.25691 Burkitt lymphoma receptor 1 2379 2413 NM 007551 Blr1 -0.20442 0.03394 0.21366 -0.02218 butyrate-induced transcript 1 2259 2293 NM 021345 Hspc121-pending 0.18840 0.17644 0.16596 0.16096 C1q related factor 454 488 NM 011795 C1qrf -0.46654 -0.14536 -0.37331 -0.10299 calcium modulating ligand 516 550 NM 007596 Caml -0.40580 -0.12764 -0.15957 -0.00931 calcium regulated heat stable protein 1 2267 2301 NM 025821 Carhsp1 0.03030 0.24734 -0.02915 0.00952 calcium/calmodulin -dependent protein kinase II gamma 2825 2862 NM 178597 Camk2g -0.49467 -0.02771 -0.46234 -0.25405 calcium/calmodulin-dependent protein kinase I gamma 2334 2369 NM 144817 Camk1g -0.29019 -0.34783 -0.15685 0.14054 calcium/calmodulin-dependent protein kinase I 548 582 NM 133926 Camk1 -0.26506 0.00120 0.01065 0.01794 calcium/calmodulin-dependent protein kinase II beta 3775 3809 NM 007595 Camk2b -0.31065 -0.12881 -0.21449 -0.26104 calcium/calmodulin-dependent protein kinase II delta 1410 1444 NM 023813 Camk2d 0.09337 0.10721 0.21585 0.28557 calcium/calmodulin-dependent protein kinase II alpha 559 593 NM 009792 Camk2a -0.20402 -0.30954 -0.17673 -0.07015 calcium/calmodulin-dependent protein kinase IV 2352 2386 NM 009793 Camk4 0.11714 -0.31191 -0.22023 -0.14519 calcium/calmodulin-dependent protein kinase kinase 1 alpha 2487 2524 NM 018883 Camkk1 -0.52828 -0.02921 -0.39570 -0.08376 calcium/calmodulin-dependent protein kinase kinase 2 beta 1867 1901 NM 145358 Camkk2 0.00833 0.19556 0.08766 0.22729 Calmodulin 1 3597 3631 NM 009790 Calm1 -0.07206 -0.15764 -0.04744 0.08997 Calmodulin 2 327 364 NM 007589 Calm2 0.10947 0.20283 0.06606 -0.00933 Calmodulin 3 1743 1777 NM 007590 Calm3 -0.32280 -0.20399 -0.18303 -0.07370 calmodulin binding transcription activator 2 3589 3623 NM 178116 Camta2 -0.22256 -0.05635 -0.38035 -0.02243 Calpain 10 1801 1835 NM 011796 Capn10 -0.60110 -0.20913 -0.35732 -0.08225 CAMP responsive element binding protein 1 1341 1375 NM 133828 Creb1 0.09470 -0.02152 0.06436 0.11435 Cannabinoid receptor 1 (brain) 2086 2121 NM 007726 Cnr1 -0.43776 -0.24228 -0.34111 -0.09115 Casein kinase II alpha 1 polypeptide 3615 3650 NM 007788 Csnk2a1 -0.02448 -0.10022 -0.28814 -0.38724

Appendix-1 UNIQUE ID ID Gene Comment BALB/c IL1 BALB/c NOD IL1 NOD TNF TNF Casein kinase II beta subunit 315 349 NM 009975 Csnk2b -0.49402 0.28011 0.05847 0.06957 CASP2 and RIPK1 domain containing adaptor with death domain 1530 1564 NM 009950 Cradd -0.26304 -0.08664 0.09411 0.14445 CASP8 and FADD-like apoptosis regulator 708 742 NM 009805 Cflar 0.37342 0.00843 0.88109 0.47284 caspase 1 494 528 NM 009807 Casp1 -0.27322 -0.25405 -0.23974 -0.28517 caspase 12 2292 2329 NM 009808 Casp12 -0.24323 -0.12987 -0.47068 -0.33385 caspase 14 1612 1647 NM 009809 Casp14 -0.30406 -0.30459 -0.22761 -0.24578 caspase 2 3274 3308 NM 007610 Casp2 -0.11415 -0.22224 -0.16764 -0.18243 caspase 3 apoptosis related cysteine protease 1382 1417 NM 009810 Casp3 0.51597 0.20646 0.92164 0.46689 caspase 4 apoptosis-related cysteine protease 414 451 NM 007609 Casp4 0.17333 0.00642 1.18318 0.38651 caspase 6 631 665 NM 009811 Casp6 -0.03220 0.30356 0.22817 0.42093 caspase 7 1571 1605 NM 007611 Casp7 0.05741 0.19730 0.49687 0.47723 caspase 8 associated protein 2 6153 6187 NM 011997 Casp8ap2 -0.56477 -0.15293 -0.31911 -0.24926 caspase 8 1152 1186 NM 009812 Casp8 -0.09091 0.17508 0.54125 0.47777 caspase 9 3492 3526 NM 015733 Casp9 -0.25161 -0.33115 -0.17157 -0.05244 caspase recruitment domain family member 10 4258 4293 NM 130859 Card10 -0.13278 -0.24447 -0.59516 -0.27653 caspase recruitment domain family member 14 3035 3069 NM 130886 Card14 -0.36759 -0.23816 -0.04686 -0.08753 cathelicidin antimicrobial peptide 149 183 NM 009921 Camp -0.53901 -0.18674 -0.42854 -0.08957 CCAAT/enhancer binding protein (C/EBP) alpha 939 973 NM 007678 Cebpa -0.00338 0.09143 -0.62169 -0.34925 CCAAT/enhancer binding protein (C/EBP) beta 1174 1208 NM 009883 Cebpb 0.57402 0.37051 0.67971 0.48477 CCAAT/enhancer binding protein (C/EBP) delta 1394 1429 NM 007679 Cebpd 0.50357 0.05909 0.74123 0.16444 CD 207 antigen 1023 1057 NM 144943 Cd207 -0.20694 -0.49444 -0.29796 -0.12489 CD1d1 antigen 998 1032 NM 007639 Cd1d1 -0.32608 -0.31556 -0.03756 0.05889 CD2 antigen 327 361 NM 013486 Cd2 0.18261 0.04782 0.43933 0.18926 CD209a antigen 890 925 NM 133238 Cd209a -0.20951 0.00219 -0.47000 -0.14715 CD28 antigen 3754 3793 NM 007642 Cd28 -0.28956 -0.18861 -0.40271 0.02845 CD3 antigen epsilon polypeptide 963 998 NM 007648 Cd3e -0.21401 -0.21635 -0.40544 -0.08319 CD3 antigen gamma polypeptide 301 339 NM 009850 Cd3g 0.36871 0.14261 0.09722 -0.13986 CD3 antigen zeta polypeptide 888 922 NM 031162 Cd3z 0.03947 0.16838 -0.33744 -0.20227 CD36 antigen 2137 2174 NM 007643 Cd36 0.04654 0.21012 0.71494 0.58512 CD44 antigen 444 478 M27130 Cd44 -0.17983 -0.26341 -0.53641 -0.40086 CD47 antigen (Rh-related antigen integrin-associated signal NM_010581 Cd47 -0.03906 0.08108 0.21067 0.31204 transducer) 1569 1603 CD52 antigen 128 162 NM 013706 Cd52 0.55452 -0.13558 1.49355 0.35560

Appendix-1 UNIQUE ID ID Gene Comment BALB/c IL1 BALB/c NOD IL1 NOD TNF TNF CD68 antigen 707 741 NM 009853 Cd68 0.18006 0.18693 0.41281 0.32104 CD69 antigen 876 911 XM 132882 CD69 -0.03393 -0.13744 0.39281 0.05040 CD80 antigen 2086 2120 NM 009855 Cd80 -0.22475 -0.35409 -0.21765 -0.21862 CD83 antigen 1467 1504 NM 009856 Cd83 1.27394 0.99144 1.86502 1.39583 CD86 antigen 2260 2297 NM 019388 Cd86 0.03440 0.04443 0.59093 0.25250 CEA-related cell adhesion molecule 1 484 518 NM 011926 Ceacam1 -0.05556 -0.28139 -0.52384 -0.17605 CEA-related cell adhesion molecule 10 269 303 NM 007675 Ceacam10 -0.48139 -0.46813 0.05014 0.02890 CEA-related cell adhesion molecule 11 209 243 NM 023289 Ceacam11 -0.25662 -0.09999 -0.76105 -0.32963 CEA-related cell adhesion molecule 12 221 257 NM 026087 Ceacam12 -0.29805 -0.35589 -0.77256 -0.67846 CEA-related cell adhesion molecule 14 960 994 NM 025957 Ceacam14 -0.08908 0.10584 -0.50526 -0.02681 CEA-related cell adhesion molecule 2 2817 2852 NM 007543 Ceacam2 0.02230 0.52231 0.11806 0.09585 CEA-related cell adhesion molecule 9 424 459 NM 011927 Ceacam9 0.70982 0.00000 0.00000 0.00000 cell death-inducing DNA fragmentation factor alpha subunit-like effector NM_007702 Cidea -0.22691 -0.11482 0.26416 0.25466 A 787 821 cell death-inducing DNA fragmentation factor alpha subunit-like effector NM_009894 Cideb -0.36230 -0.32746 -0.32928 -0.11004 B 1016 1050 Cell division cycle 25 homolog A (S. cerevisiae) 1821 1855 NM 007658 Cdc25a -0.26988 -0.44689 -0.41299 -0.28233 Cell division cycle 42 homolog (S. cerevisiae) 1605 1640 NM 009861 Cdc42 0.22866 0.21930 0.27813 0.22950 Cerberus 1 homolog (Xenopus laevis) 1556 1593 NM 009887 Cer1 -0.00288 0.06176 0.00000 0.00000 C-fos induced growth factor 1074 1109 NM 010216 Figf -0.30637 -0.01266 0.08722 -0.03796 Chaperonin subunit 6a (zeta) 1212 1246 NM 009838 Cct6a 0.11676 0.35071 -0.17956 -0.20333 chemokine (C motif) ligand 1 375 409 NM 008510 Xcl1 -0.18510 0.13034 -0.13020 -0.04334 chemokine (C motif) receptor 1 3638 3672 NM 011798 Xcr1 -0.22077 -0.52234 -0.26264 -0.06165 chemokine (C-C motif) ligand 1 26 60 NM 011329 Ccl1 -0.11908 -0.03638 -0.07056 -0.05753 chemokine (C-C motif) ligand 12 59 93 NM 011331 Ccl12 -0.27694 -0.35558 -0.12926 0.09183 Chemokine (C-C motif) ligand 17 135 169 NM 011332 Ccl17 -0.16278 -0.27059 -0.18354 0.19327 chemokine (C-C motif) ligand 19 432 466 NM 011888 Ccl19 0.28842 0.03303 0.94998 0.19673 chemokine (C-C motif) ligand 2 444 479 NM 011333 Ccl2 3.30636 2.31274 4.31218 3.05614 Chemokine (C-C motif) ligand 20 200 235 NM 016960 Ccl20 1.49788 0.30208 1.83138 -0.04160 Chemokine (C-C motif) ligand 21a (serine) 604 639 NM 011335 Ccl21a -0.37208 -0.07498 -0.39428 -0.06077 Chemokine (C-C motif) ligand 21b (leucine) 632 667 NM 011124 Ccl21b -0.34653 -0.13764 -0.28037 0.00999 chemokine (C-C motif) ligand 22 1277 1313 NM 009137 Ccl22 0.16611 0.03891 1.01687 0.38835 chemokine (C-C motif) ligand 24 489 523 NM 019577 Ccl24 -0.22768 -0.31468 -0.24326 -0.01305

Appendix-1 UNIQUE ID ID Gene Comment BALB/c IL1 BALB/c NOD IL1 NOD TNF TNF chemokine (C-C motif) ligand 25 454 488 NM 009138 Ccl25 -0.09458 -0.50724 -0.29503 -0.23331 chemokine (C-C motif) ligand 27 124 158 NM 011336 Ccl27 -0.16428 -0.24387 -0.39836 -0.14712 chemokine (C-C motif) ligand 28 271 305 NM 020279 Ccl28 -0.16014 -0.12562 -0.69088 -0.46470 Chemokine (C-C motif) ligand 3 468 502 NM 011337 Ccl3 0.19252 0.04145 0.54681 0.05143 chemokine (C-C motif) ligand 4 421 455 NM 013652 Ccl4 -0.28541 -0.28249 -0.03829 0.05412 chemokine (C-C motif) ligand 5 162 196 NM 013653 Ccl5 -0.28031 -0.35476 -0.45972 -0.53033 chemokine (C-C motif) ligand 6 677 715 NM 009139 Ccl6 -0.26247 -1.28113 0.86066 0.73015 chemokine (C-C motif) ligand 7 305 340 NM 013654 Ccl7 1.47503 0.89751 2.63138 1.63762 chemokine (C-C motif) ligand 8 414 448 NM 021443 Ccl8 0.23833 0.11398 0.69140 -0.00811 chemokine (C-C motif) ligand 9 1083 1118 NM 011338 Ccl9 0.27095 0.26629 0.06105 0.20893 chemokine (C-C motif) receptor 1 2320 2355 NM 009912 Ccr1 -0.16596 -0.48337 -0.13110 -0.17336 chemokine (C-C motif) receptor 1-like 1 634 668 NM 007718 Ccr1l1 -0.20195 -0.23052 -0.62030 -0.24244 chemokine (C-C motif) receptor 4 1174 1208 NM 009916 Ccr4 -0.27606 -0.41644 -0.17805 -0.13468 chemokine (C-C motif) receptor 5 2366 2401 NM 009917 Ccr5 -0.24832 -0.18982 -0.41127 -0.09629 chemokine (C-C motif) receptor 6 1011 1045 NM 009835 Ccr6 -0.24467 0.03058 -0.35946 -0.23115 Chemokine (C-C motif) receptor 7 1370 1404 NM 007719 Ccr7 -0.29535 -0.27539 -0.00866 0.11750 chemokine (C-C motif) receptor 8 586 620 NM 007720 Ccr8 -0.41979 -0.19734 -0.07589 -0.15849 chemokine (C-C motif) receptor 9 2207 2242 NM 009913 Ccr9 -0.08204 -0.12000 -0.12990 0.05425 chemokine (C-C motif) receptor-like 2 1545 1579 NM 017466 Ccrl2 1.89205 0.92401 2.24112 1.34189 chemokine (C-C) receptor 2 2128 2166 NM 009915 Ccr2 -0.20445 -0.02440 -0.37244 -0.05140 chemokine (C-C) receptor 3 1944 1978 NM 009914 Ccr3 -0.23985 -0.33031 -0.31830 -0.02497 chemokine (C-C) receptor-like 1 1401 1435 NM 145700 Ccrl1 -0.25528 -0.20799 -0.60166 -0.53191 chemokine (C-X3-C motif) ligand 1 2121 2155 NM 009142 Cx3cl1 0.09413 0.22282 0.18208 0.28261 chemokine (C-X3-C) receptor 1 2469 2504 NM 009987 Cx3cr1 -0.32478 0.13296 -0.35932 -0.18121 Chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity NM_008176 Cxcl1 4.87142 2.07886 4.51842 1.93966 alpha) 819 853 chemokine (C-X-C motif) ligand 10 417 451 NM 021274 Cxcl10 2.11291 0.76849 3.92927 2.10697 chemokine (C-X-C motif) ligand 11 1141 1175 NM 019494 Cxcl11 -0.25314 -0.04427 -0.41254 -0.15496 chemokine (C-X-C motif) ligand 12 NM 013655 2367 2401 NM 013655 Cxcl12 -0.05552 -0.15651 -0.59956 -0.24290 Chemokine (C-X-C motif) ligand 12 1781 1815 NM 021704 Cxcl12 -0.32304 -0.48415 0.21215 0.16860 chemokine (C-X-C motif) ligand 13 736 771 NM 018866 Cxcl13 0.06030 -0.07282 1.09580 0.25133 chemokine (C-X-C motif) ligand 14 1191 1225 NM 019568 Cxcl14 -0.01223 0.01627 -0.33434 -0.22331 Chemokine (C-X-C motif) ligand 15 556 594 NM 011339 Cxcl15 -0.20278 0.38223 -0.80890 -0.23668

Appendix-1 UNIQUE ID ID Gene Comment BALB/c IL1 BALB/c NOD IL1 NOD TNF TNF chemokine (C-X-C motif) ligand 16 737 771 NM 023158 Cxcl16 0.25368 0.14034 0.64326 0.50372 chemokine (C-X-C motif) ligand 2 786 820 NM 009140 Cxcl2 3.62959 0.97482 4.41392 1.54315 chemokine (C-X-C motif) ligand 4 180 215 NM 019932 Cxcl4 -0.21035 -0.44347 0.04269 0.20643 chemokine (C-X-C motif) ligand 5 827 864 NM 009141 Cxcl5 2.12979 0.46198 2.17985 0.54890 chemokine (C-X-C motif) ligand 7 212 247 NM 023785 Cxcl7 -0.19499 -0.22920 -0.22230 -0.12381 Chemokine (C-X-C motif) ligand 9 294 328 NM 008599 Cxcl9 -0.09342 -0.29286 1.99801 0.71546 chemokine (C-X-C motif) receptor 3 770 804 NM 009910 Cxcr3 -0.56332 -0.45103 -0.40703 -0.25753 chemokine (C-X-C motif) receptor 4 1449 1488 NM 009911 Cxcr4 0.23143 0.24038 0.50259 0.24158 chemokine (C-X-C motif) receptor 6 971 1005 NM 030712 Cxcr6 0.23868 -0.05129 -0.38936 -0.29660 chemokine orphan receptor 1 2419 2453 NM 007722 Cmkor1 -0.39253 -0.17214 -0.07500 0.03308 chemokine-like factor super family 3 711 746 NM 024217 Cklfsf3 -0.12565 -0.15742 -0.22665 -0.08984 chemokine-like factor super family 6 2894 2930 NM 026036 Cklfsf6 0.03597 0.36060 0.04315 0.04500 chemokine-like factor super family 7 819 853 NM 133978 Cklfsf7 0.01108 0.15192 -0.03553 -0.01100 chemokine-like factor super family 8 709 743 NM 027294 Cklfsf8 0.01892 0.23233 0.06458 0.14689 chemokine-like receptor 1 963 998 NM 008153 Cmklr1 -0.20013 0.04250 -0.51925 -0.23811 Chordin 2808 2842 NM 009893 Chrd -0.08823 -0.44399 -0.13281 0.16849 Class II transactivator 5082 5117 NM 007575 C2ta -0.18735 -0.11742 -0.25853 -0.02337 c-myc binding protein 1283 1318 NM 019660 Mycbp -0.00195 -0.17665 -0.22990 -0.28604 Coagulation factor XIII alpha subunit 3369 3404 NM 028784 F13a -0.07020 -0.05649 -0.38751 -0.40928 Colony stimulating factor 1 (macrophage) 3433 3467 NM 007778 Csf1 1.64910 1.00314 2.34338 1.29329 Colony stimulating factor 1 receptor 3206 3242 NM 007779 Csf1r -0.18376 -0.12036 -0.12589 0.08660 Colony stimulating factor 2 (granulocyte-macrophage) 516 550 NM 009969 Csf2 0.35830 0.06246 1.64464 0.13977 Colony stimulating factor 3 (granulocyte) 891 930 NM 009971 Csf3 0.96214 0.07202 1.51377 0.33908 Complement component 3 4508 4542 NM 009778 C3 -0.31177 -0.36841 0.49053 0.10109 Conserved helix-loop-helix ubiquitous kinase 2752 2787 NM 007700 Chuk -0.17555 -0.09035 -0.30068 -0.08075 C-reactive protein petaxin related 880 914 NM 007768 Crp -0.01625 -0.27581 -0.25002 -0.03590 CREB binding protein 5657 5691 XM 148699 CBP -0.39838 -0.43165 -0.53238 -0.47533 C-type (calcium dependent carbohydrate recognition domain) lectin NM_020008 Clecsf12 -0.32695 -0.35032 -0.28105 -0.16519 superfamily member 12 1722 1758 C-type (calcium dependent carbohydrate recognition domain) lectin NM_011999 Clecsf6 0.04437 -0.20321 0.20266 0.42446 superfamily member 6 2156 2191 C-type (calcium dependent carbohydrate recognition domain) lectin NM_010819 Clecsf8 0.01586 0.04427 0.88962 0.68161 superfamily member 8 844 879

Appendix-1 UNIQUE ID ID Gene Comment BALB/c IL1 BALB/c NOD IL1 NOD TNF TNF Cyclin-dependent kinase inhibitor 1A (P21) 1672 1706 NM 007669 Cdkn1a 0.29451 0.38442 0.46209 0.30757 Cyclin-dependent kinase inhibitor 2B (p15 inhibits CDK4) 935 969 NM 007670 Cdkn2b 0.40410 -0.00976 1.02430 0.27100 Cystatin C 568 602 NM 009976 Cst3 0.12607 -0.07095 0.20598 0.40915 Cystatin F (leukocystatin) 786 820 NM 009977 Cst7 0.35306 0.00000 0.17702 0.24507 Cytotoxic T-lymphocyte-associated protein 4 1538 1572 NM 009843 Ctla4 0.00000 0.00000 0.24297 0.13620 D6 beta-chemokine receptor 2673 2708 NM 021609 D6-pending -0.41468 -0.51497 0.00000 0.00000 death associated protein 3 1074 1108 NM 022994 Dap3 0.15012 0.30832 -0.12289 0.09730 death associated protein kinase 1 4948 4982 NM 029653 Dapk1 -0.17731 -0.15440 -0.21858 -0.03787 death effector domain-containing 547 581 NM 011615 Dedd -0.18619 0.06771 -0.36983 -0.16187 death-associated kinase 2 1561 1595 NM 010019 Dapk2 -0.24160 -0.30586 -0.63253 -0.54694 death-associated kinase 3 477 511 NM 007828 Dapk3 -0.08757 0.01876 -0.32915 -0.26154 death-associated protein 775 809 NM 146057 Dap -0.10001 0.09024 -0.22809 -0.10856 defender against cell death 1 224 259 NM 010015 Dad1 -0.29616 -0.12360 -0.11954 -0.05170 Dip3 beta 1999 2033 NM 145220 Dip3b-pending -0.28270 -0.27514 -0.28515 -0.64507 Dipeptidylpeptidase 4 2572 2606 NM 010074 Dpp4 -0.27293 -0.17961 -0.23379 0.06151 DNA segment Chr3 Brigham & Women's Genetics 0562 expressed 4963 4997 NM 177664 D3Bwg0562e -0.48259 -0.20535 -0.30581 -0.08536 double cortin and calcium/calmodulin-dependent protein kinase-like NM_019978 Dcamkl1 -0.33370 -0.21983 -0.23774 -0.13005 1 4746 4780 Down syndrome cell adhesion molecule 6481 6518 NM 031174 Dscam -0.27940 -0.46960 -0.31698 0.03938 Down syndrome cell adhesion molecule-like 1 409 443 AF487348 Dscaml1 -0.27440 0.01243 -0.55865 -0.11824 dual specificity phosphatase 1 1447 1481 NM 013642 Dusp1 0.99739 0.31595 1.41507 0.41358 dual specificity phosphatase 10 2415 2449 NM 022019 Dusp10 0.05734 -0.23974 -0.31299 -0.36473 dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) 5570 5604 NM 028099 Dusp11 -0.28982 -0.19649 0.03276 0.13258 dual specificity phosphatase 12 656 690 NM 023173 Dusp12 -0.18445 0.01115 -0.50147 -0.14149 dual specificity phosphatase 13 733 767 NM 013849 Dusp13 -0.08618 -0.01907 -0.76828 -0.39719 dual specificity phosphatase 14 795 829 NM 019819 Dusp14 -0.34867 -0.22336 -0.29471 -0.02128 dual specificity phosphatase 16 4136 4170 NM 130447 Dusp16 0.46724 0.38588 1.05716 0.52510 dual specificity phosphatase 18 4169 4205 NM 173745 Dusp18 -0.39934 -0.11304 -0.39689 -0.06990 dual specificity phosphatase 19 749 783 NM 024438 Dusp19 -0.44115 -0.22900 -0.22476 -0.03559 dual specificity phosphatase 2 796 830 NM 010090 Dusp2 0.28773 0.19455 0.35400 0.12211 dual specificity phosphatase 22 324 358 NM 134068 Dusp22 -0.41329 -0.16992 0.03817 -0.09359 dual specificity phosphatase 3 (vaccinia virus phosphatase VH1- NM 028207 Dusp3 -0.26288 -0.13744 -0.31614 -0.09089 Dual specificity phosphatase 4 2218 2252 NM 176933 Dusp4 -0.07772 -0.15807 -0.44313 -0.42756

Appendix-1 UNIQUE ID ID Gene Comment BALB/c IL1 BALB/c NOD IL1 NOD TNF TNF dual specificity phosphatase 6 2649 2683 NM 026268 Dusp6 -0.30154 -0.39660 0.23892 0.22172 dual specificity phosphatase 7 1738 1773 NM 153459 Dusp7 -0.75970 0.01349 -0.56783 -0.42269 dual specificity phosphatase 8 1953 1987 NM 008748 Dusp8 1.14909 0.43142 1.27047 0.69392 dual specificity phosphatase 9 2550 2585 NM 029352 Dusp9 -0.44682 -0.67326 -0.41083 -0.30855 dual specificity phosphatase-like 15 123 157 NM 145744 Dusp15 -0.22899 -0.17218 -0.24148 -0.13628 Duffy blood group 414 449 NM 010045 Dfy -0.08720 0.01744 -0.18729 -0.09040 Early growth response 1 3035 3072 NM 007913 Egr1 1.36916 0.31173 0.96589 0.44162 Early growth response 2 2234 2268 NM 010118 Egr2 0.46987 0.26866 0.33492 0.08156 Early growth response 3 435 469 NM 018781 Egr3 -0.44348 -0.20858 -0.39655 -0.21956 Ecotropic viral integration site 1 2806 2840 NM 007963 Evi1 -0.09780 0.03996 -0.27532 -0.02308 Ectonucleotide pyrophosphatase/phosphodiesterase 1 2366 2400 NM 008813 Enpp1 -0.21679 -0.08426 -0.80811 -0.31451 EDAR (ectodysplasin-A receptor)-associated death domain 857 891 NM 133643 Edaradd -0.38681 -0.37657 -0.46256 -0.30752 ELK1 member of ETS oncogene family 1786 1821 NM 007922 Elk1 -0.21499 0.01015 -0.44568 -0.13658 ELK3 member of ETS oncogene family 2505 2543 NM 013508 Elk3 -0.02466 0.01813 -0.05702 0.04084 Endoglin 2114 2148 NM 007932 Eng -0.09356 -0.04896 -0.35060 -0.16598 Endothelial cell growth factor 1 (platelet-derived) 1506 1540 NM 138302 Ecgf1 -0.44344 -0.10456 -0.26009 -0.14933 eosinophil peroxidase 2162 2196 NM 007946 Epx -0.29306 -0.24389 -0.41827 -0.37227 Epstein-Barr virus induced gene 3 382 416 NM 015766 Ebi3 -0.52232 -0.17419 -0.21400 -0.02973 Erythropoietin 144 178 NM 007942 Epo -0.05012 0.05271 -0.02438 -0.10274 ESTs Highly similar to chromodomain helicase DNA binding protein 4; Mi-2b AI325534 CHD4-ESTs -0.16904 -0.20370 -0.29376 -0.01142 [Homo sapiens] [H.sapiens 365 399 Exportin tRNA (nuclear export receptor for tRNAs) 3886 3921 XM 125902 Exportin -0.22421 -0.19447 -0.09487 0.06111 Exportin 1 CRM1 homolog (yeast) 4681 4719 NM 134014 Xpo1 0.06427 0.13838 -0.34466 -0.02414 Exportin 4 3214 3248 NM 020506 Xpo4 -0.25187 -0.41551 -0.06884 -0.03686 Fas (TNFRSF6)-associated via death domain 2240 2274 NM 010175 Fadd -0.30496 -0.08682 -0.58323 -0.23876 Fas death domain-associated protein 2044 2078 NM 007829 Daxx -0.00818 0.02375 -0.43116 -0.23015 Fascin homolog 3 actin-bundling protein testicular (Strongylocentrotus NM_019569 Fscn3 -0.24097 -0.10047 -0.21867 0.03230 purpuratus) 1406 1440 FBJ osteosarcoma oncogene B 3652 3686 NM 008036 Fosb -0.28129 -0.11016 -0.33296 -0.11563 FBJ osteosarcoma oncogene 1117 1151 NM 010234 Fos -0.09243 -0.14701 -0.16385 -0.07562 Fc receptor IgA IgM high affinity 1053 1087 NM 144960 Fcamr 0.07777 -0.42354 0.06094 -0.26211 Fc receptor IgE high affinity I alpha polypeptide 563 598 NM 010184 Fcer1a 0.11054 0.05702 -0.08548 -0.10857 Fc receptor IgE high affinity I gamma polypeptide 522 557 NM 010185 Fcer1g -0.30305 -0.19291 -0.05532 0.17020

Appendix-1 UNIQUE ID ID Gene Comment BALB/c IL1 BALB/c NOD IL1 NOD TNF TNF Fc receptor IgE low affinity II alpha polypeptide 1589 1623 NM 013517 Fcer2a -0.28754 -0.30684 -0.34503 -0.02673 Fc receptor IgG high affinity I 2080 2114 NM 010186 Fcgr1 -0.35587 -0.29531 -0.32388 -0.11813 Fc receptor IgG low affinity IIb 886 922 NM 010187 Fcgr2b 0.13498 0.14467 0.33506 0.28493 Fc receptor IgG low affinity III 605 640 NM 010188 Fcgr3 -0.30487 -0.08526 -0.53703 -0.07982 Fc receptor-like 3 586 620 NM 144559 Fcrl3 -0.03425 -0.22801 -0.32765 -0.18156 Fibroblast growth factor 1 3036 3072 NM 010197 Fgf1 -0.17213 -0.08971 -0.29493 -0.15251 Fibroblast growth factor 10 3624 3658 NM 008002 Fgf10 0.16608 0.00000 0.00000 0.00000 Fibroblast growth factor 11 240 274 NM 010198 Fgf11 -0.23361 -0.16656 -0.27797 0.05412 Fibroblast growth factor 12 2255 2294 NM 010199 Fgf12 -0.10426 -0.01445 -0.87991 -0.49017 Fibroblast growth factor 14 2207 2241 NM 010201 Fgf14 -0.11616 -0.18772 -0.30923 -0.08302 Fibroblast growth factor 16 568 603 NM 030614 Fgf16 -0.14490 -0.20239 -0.56699 -0.09261 Fibroblast growth factor 17 1345 1379 NM 008004 Fgf17 -0.13710 -0.26401 -0.01152 0.12892 Fibroblast growth factor 18 400 434 NM 008005 Fgf18 0.08140 0.11064 0.03229 0.03229 Fibroblast growth factor 2 199 234 NM 008006 Fgf2 0.29493 0.38818 -0.49822 -0.05293 Fibroblast growth factor 20 527 562 NM 030610 Fgf20 0.15533 -0.20658 -0.15626 -0.18191 Fibroblast growth factor 21 502 536 NM 020013 Fgf21 -0.36437 0.08818 0.05092 -0.08778 Fibroblast growth factor 22 320 354 NM 023304 Fgf22 -0.28331 -0.55691 -0.36306 -0.14853 Fibroblast growth factor 3 367 401 NM 008007 Fgf3 -0.21968 -0.11316 -0.62775 -0.11490 Fibroblast growth factor 4 491 525 NM 010202 Fgf4 -0.44832 -0.35904 -0.32933 -0.18808 Fibroblast growth factor 5 2022 2056 NM 010203 Fgf5 0.17914 -0.24250 -0.71572 -0.60634 Fibroblast growth factor 9 216 250 NM 013518 Fgf9 -0.22771 -0.28506 -0.12425 -0.03325 FK506 binding protein 1b 773 807 NM 016863 Fkbp1b -0.33095 -0.23692 -0.09100 0.01574 Follistatin 940 974 NM 008046 Fst 0.07293 -0.21099 -0.34697 -0.11655 Forkhead box C2 1958 1992 NM 013519 Foxc2 -0.37539 -0.21222 -0.22429 -0.12999 Forkhead box P3 3597 3631 NM 054039 Foxp3 -0.16526 -0.51662 -0.09592 0.12941 Fos-like antigen 1 983 1017 NM 010235 Fosl1 -0.29426 -0.18252 -0.37457 -0.10492 Fos-like antigen 2 5373 5411 NM 008037 Fosl2 0.71912 0.43041 1.09809 0.46262 Fructose bisphosphatase 1 1304 1338 NM 019395 Fbp1 -0.18032 -0.37141 -0.35500 -0.46019 G protein-coupled receptor 109B 1002 1036 NM 030701 Gpr109b 0.90659 0.38356 1.63776 0.80918 G protein-coupled receptor 2 1548 1583 NM 007721 Gpr2 -0.51641 -0.27142 -0.25529 0.05752 G protein-coupled receptor 44 2148 2183 NM 009962 Gpr44 -0.25225 -0.21584 -0.79083 -0.28063 GATA binding protein 3 1867 1901 NM 008091 Gata3 0.15280 0.04817 0.00000 0.00000 GATA-binding transcription factor 2434 2468 NM 008092 Gata4 -0.22323 -0.13977 -0.43559 -0.08449

Appendix-1 UNIQUE ID ID Gene Comment BALB/c IL1 BALB/c NOD IL1 NOD TNF TNF glucagon-like peptide 1 receptor 894 932 NM 021332 Glp1r -0.41394 -0.44841 -0.38558 -0.20546 Glucokinase 1285 1319 NM 010292 Gck -0.35883 -0.24974 -0.19114 0.05423 Glucose-6-phosphatase catalytic 1359 1393 NM 008061 G6pc -0.33806 -0.30223 -0.40319 -0.11804 Glucose-6-phosphate dehydrogenase 2 644 678 NM 019468 HK -0.28987 -0.40916 -0.29801 -0.15819 glutathione peroxidase 1 204 238 NM 008160 Gpx1 0.37473 0.25695 0.44986 0.48994 glutathione peroxidase 2 140 174 NM 030677 Gpx2 -0.31828 -0.28272 -0.22459 -0.08019 glutathione peroxidase 4 356 391 NM 008162 Gpx4 -0.41057 -0.16639 -0.59044 -1.14502 glutathione peroxidase 5 1353 1387 NM 010343 Gpx5 -0.01662 -0.23874 -0.70083 -0.22114 Glyceraldehyde-3-phosphate dehydrogenase 437 472 NM 008084 Gapd -0.14914 -0.07042 -0.13691 -0.28768 Glycerol-3-phosphate dehydrogenase 1 (soluble) 2109 2143 NM 010271 Gpd1 -0.22731 -0.32527 -0.36689 -0.21100 Glycogen synthase kinase 3 beta 7472 7510 NM 019827 Gsk3b 0.17227 0.30495 0.12634 0.08542 glycosylation dependent cell adhesion molecule 1 456 491 NM 008134 Glycam1 0.21054 -0.02377 0.43884 0.15903 Growth factor independent 1 2124 2158 NM 010278 Gfi1 -0.14893 -0.41305 0.01939 0.02081 Guanylate nucleotide binding protein 2 2125 2159 NM 010260 Gbp2 0.91560 0.24990 2.26080 1.33720 Guanylate nucleotide binding protein 3 2064 2099 NM 018734 Gbp3 1.05015 0.25425 1.60941 0.62316 Gyk 3827 3861 NM 008194 HK -0.06198 -0.10988 -0.43748 0.00730 Harvey rat sarcoma virus oncogene 1 266 300 NM 008284 Hras1 -0.61730 -0.19219 -0.38273 -0.32218 heat shock 70kD protein 5 (glucose-regulated protein) 1603 1640 NM 022310 Hspa5 -0.13398 -0.11721 -0.35816 -0.71604 heat shock protein A 2293 2329 NM 010481 Hspa9a -0.31565 -0.08621 -0.09926 -0.23920 heat shock protein 1 alpha 2212 2250 NM 010480 Hspca 0.14078 0.26604 0.27167 0.15304 heat shock protein 1 beta 1760 1794 NM 008302 Hspcb -0.04478 0.02028 -0.34489 -0.61441 heat shock protein 1 (chaperonin 10) 496 531 NM 008303 Hspe1 -0.01787 0.05041 0.03458 0.09019 heat shock protein 1 (chaperonin) 1836 1870 NM 010477 Hspd1 -0.29679 -0.03475 -0.04281 0.00538 heat shock protein 1 520 554 NM 013560 Hspb1 0.06455 0.22828 0.22258 0.30186 heat shock protein 105 3014 3048 NM 013559 Hsp105 0.00747 0.24018 0.46574 0.35980 heat shock protein 12B 2093 2127 NM 028306 Hspa12b -0.27239 -0.62642 -0.43605 -0.36474 heat shock protein 1A 120 158 AW763765 Hspa1a 0.42022 0.13425 0.44647 0.28892 heat shock protein 1B 731 765 M12573 Hspa1b 0.19121 0.11790 0.28953 0.31667 heat shock protein 1-like 2043 2077 NM 013558 Hspa1l -0.26001 -0.29600 -0.48254 -0.25772 heat shock protein 2 NM 008301 1872 1906 NM 008301 Hspa2 0.03933 0.02474 0.20336 0.25764 heat shock protein 2 357 391 NM 024441 Hspb2 -0.07947 0.10190 -0.45319 -0.18262 heat shock protein 3 137 171 NM 019960 Hspb3 -0.04411 -0.11133 -0.67407 -0.45666 heat shock protein 4 NM 008300 2444 2478 NM 008300 Hspa4 0.00687 0.17845 0.10233 0.16489

Appendix-1 UNIQUE ID ID Gene Comment BALB/c IL1 BALB/c NOD IL1 NOD TNF TNF heat shock protein 4 1538 1572 NM 015765 Hsp70-4 0.01326 0.20216 0.18978 0.26367 heat shock protein 8 1616 1651 NM 031165 Hspa8 0.30232 0.28884 0.19104 0.18578 heat shock protein family member 7 (cardiovascular) 2261 2296 NM 013868 Hspb7 -0.60772 -0.31341 -0.01766 0.22748 heme binding protein 1 530 564 NM 013546 Hebp1 -0.18447 -0.24902 0.04683 0.12642 heme binding protein 2 1133 1167 NM 019487 Hebp2 -0.35024 -0.39232 -0.18671 -0.05193 heme oxygenase (decycling) 1 818 852 NM 010442 Hmox1 0.14265 0.09503 0.45035 0.22592 heme oxygenase (decycling) 2 468 502 NM 010443 Hmox2 -0.30556 -0.18921 -0.19044 -0.01402 Hepatic nuclear factor 4 4161 4195 NM 008261 Hnf4 -0.09970 0.07405 -0.10154 -0.01241 Hepatitis A virus cellular receptor 2 2268 2302 NM 134250 Havcr2 -0.32976 -0.52045 -0.10146 -0.27242 Histocompatibility 2 class II locus DMa 657 691 NM 010386 H2-DMa 0.04979 -0.00526 0.37390 0.23356 Histocompatibility 2 class II locus Mb2 344 378 NM 010388 H2-DMb2 -0.34900 -0.29425 -0.22232 -0.20439 Histocompatibility 2 class II antigen A beta 1 880 914 NM 010379 H2-Ab1 0.27305 -0.02519 1.22651 0.60919 Histocompatibility 2 class II antigen E beta 471 505 NM 010382 H2-Eb1 0.43889 0.19168 1.44122 0.56610 Hprt 585 619 NM 013556 HK 0.00999 0.16631 0.08671 0.15188 icos ligand 2631 2669 NM 015790 Icosl -0.06018 -0.02404 -0.37574 -0.36832 IL2-inducible T-cell kinase 3912 3946 NM 010583 Itk -0.30280 -0.35286 -0.44174 -0.21239 immunity-associated protein 1141 1175 NM 008376 Imap38 0.31273 0.09587 0.98322 0.20432 Immunoglobulin heavy chain 4 (serum IgG1) 2089 2125 XM 111360 Serum IgG1 -0.12287 -0.09910 0.06257 0.00000 Immunoglobulin superfamily member 6 1965 2004 NM 030691 Igsf6 -0.07563 0.10128 0.88712 0.96882 immunoresponsive gene 1 1399 1433 L38281 Irg1 -0.29623 -0.32441 -0.16441 0.05282 Induced in fatty liver dystrophy 2 258 292 NM 175093 Ifld2 -0.26074 -0.21319 -0.33033 -0.33848 inducible T-cell co-stimulator 1895 1930 NM 017480 Icos -0.10681 -0.24322 -0.22983 -0.18579 inhibitor of kappa light polypeptide enhancer in B-cells kinase complex- NM_026079 Ikbkap -0.26166 -0.18572 -0.05655 0.14975 associated protein 4141 4175 inhibitor of kappaB kinase beta 2975 3010 NM 010546 Ikbkb 0.00122 -0.27596 -0.74860 -0.36853 inhibitor of kappaB kinase epsilon 2457 2491 NM 019777 Ikbke 0.47484 0.40109 0.81194 0.27193 inhibitor of kappaB kinase gamma 1322 1356 NM 010547 Ikbkg -0.31753 -0.33891 -0.20933 -0.05309 Inositol polyphosphate phosphatase-like 1 4039 4073 NM 010567 Inppl1 -0.18025 0.01345 -0.12865 -0.13688 Insulin degrading enzyme 2874 2908 NM 031156 Ide 0.13872 0.11479 0.09751 0.23521 insulin I 11 45 NM 008386 Ins1 -0.28483 -0.40163 -0.22795 -0.40344 insulin II 144 178 NM 008387 Ins2 -0.23494 -0.08354 -0.08142 -0.31425 insulin induced gene 2 1922 1956 NM 133748 Insig2 -0.25789 -0.26326 -0.10072 -0.08471 insulin promoter factor 1 homeodomain transcription factor 1265 1299 NM 008814 Ipf1 -0.33618 -0.55964 -0.10295 -0.18825

Appendix-1 UNIQUE ID ID Gene Comment BALB/c IL1 BALB/c NOD IL1 NOD TNF TNF insulin receptor substrate 1 4687 4724 NM 010570 Irs1 -0.17247 0.02348 -0.54508 -0.18745 Insulin receptor substrate 2 1941 1975 AF090738 Irs2 -0.26312 -0.38958 -0.24107 0.00845 insulin receptor substrate 3 1435 1469 NM 010571 Irs3 -0.29175 -0.33581 -0.03234 0.05742 insulin receptor substrate 4 5423 5459 NM 010572 Irs4 -0.38252 -0.00563 -0.41065 -0.04237 insulin receptor 3987 4021 NM 010568 Insr -0.34007 -0.42056 -0.47083 -0.31629 insulin receptor-related receptor 4813 4847 NM 011832 Insrr -0.29575 -0.13980 -0.29215 -0.08246 insulin related protein 2 (islet 2) 1619 1653 NM 027397 Isl2 -0.05187 -0.10018 -0.02638 0.00000 insulin-like 3 324 358 NM 013564 Insl3 -0.27120 -0.41705 -0.19241 0.03415 insulin-like 5 124 158 NM 011831 Insl5 -0.16555 0.04730 -0.05924 -0.08598 insulin-like 6 612 647 NM 013754 Insl6 0.07278 0.15209 0.44761 0.38762 Insulin-like growth factor 1 765 799 NM 010512 Igf1 -0.05483 -0.14088 -0.55293 -0.23038 Insulin-like growth factor 2 4412 4446 NM 010514 Igf2 -0.10698 -0.08400 -0.25247 0.11205 Insulin-like growth factor binding protein 3 704 738 NM 008343 Igfbp3 -0.19430 -0.52484 -0.32912 -0.17583 Insulin-like growth factor binding protein 5 2783 2818 NM 010518 Igfbp5 -0.24036 -0.28707 -0.28271 0.08761 insulinoma-associated 1 1847 1881 NM 016889 Insm1 -0.44182 -0.23533 -0.30412 -0.31351 insulinoma-associated 2 1325 1359 NM 020287 Insm2 -0.21259 -0.21047 -0.17210 -0.02710 Integrin alpha M 4086 4120 NM 008401 Itgam -0.28931 -0.37433 -0.04268 -0.00915 Integrin beta 2 1994 2028 NM 008404 Itgb2 0.32511 0.28008 -0.17809 -0.21463 Integrin beta 5 2643 2678 NM 010580 Itgb5 -0.22467 -0.03443 0.01918 0.12446 Integrin beta 7 2354 2389 NM 013566 Itgb7 -0.67199 -0.40606 -0.16089 0.10499 intercellular adhesion molecule 2 823 857 NM 010494 Icam2 0.14867 0.12711 0.35545 0.31491 intercellular adhesion molecule 4 Landsteiner-Wiener blood group 411 445 NM 023892 Icam4 -0.52864 -0.45045 -0.22866 -0.07082 intercellular adhesion molecule 5 telencephalin 2399 2433 NM 008319 Icam5 -0.22122 -0.11885 -0.51610 -0.10442 intercellular adhesion molecule 2363 2397 NM 010493 Icam1 2.90902 2.45019 3.14385 2.34844 Interferon alpha-inducible protein 319 353 NM 015783 G1p2 0.33018 -0.06884 2.71552 1.34900 Interferon gamma-inducible protein 16 1925 1961 NM 008329 Ifi16 0.10773 -0.01729 1.84528 0.65634 Interferon alpha family gene 1 52 86 NM 010502 Ifna1 -0.18703 -0.08814 -0.46031 -0.12349 Interferon alpha family gene 11 1153 1189 NM 008333 Ifna11 0.15020 0.25272 -0.32901 -0.08122 Interferon alpha family gene 2 240 275 NM 010503 Ifna2 -0.11007 -0.34241 -0.68650 -0.41134 Interferon alpha family gene 4 282 320 NM 010504 Ifna4 -0.23035 -0.12330 -0.18711 0.14558 Interferon alpha family gene 5 248 282 NM 010505 Ifna5 -0.19854 -0.35738 -0.54236 -0.24581 Interferon alpha family gene 6 655 689 NM 008335 Ifna6 -0.16540 -0.32347 -0.27275 -0.24260 Interferon alpha family gene 7 96 133 NM 008334 Ifna7 -0.15774 -0.24260 -0.91303 -0.55026

Appendix-1 UNIQUE ID ID Gene Comment BALB/c IL1 BALB/c NOD IL1 NOD TNF TNF Interferon alpha family gene B 280 314 NM 008336 Ifnab -0.16966 0.00504 -0.51513 -0.16609 Interferon beta 1 fibroblast 158 192 NM 010510 Ifnb1 -0.17697 -0.37991 -0.11826 -0.05389 Interferon gamma inducible protein 30 225 259 NM 023065 Ifi30 -0.28720 -0.17757 0.11610 0.13535 Interferon gamma receptor 1 1917 1953 NM 010511 Ifngr1 0.45245 0.37488 0.61143 0.53880 Interferon gamma 497 531 NM 008337 Ifng -0.31556 -0.42385 -0.05246 -0.03339 Interferon induced transmembrane protein 3 505 539 NM 025378 Ifitm3 0.28815 -0.04010 1.27558 0.81120 Interferon regulatory factor 1 1487 1521 NM 008390 Irf1 2.02144 1.45850 2.12235 1.56346 Interferon-induced protein 35 1013 1049 NM 027320 Ifi35 -0.03540 0.15317 0.37057 0.17507 Interferon-induced protein with tetratricopeptide repeats 1 1161 1195 NM 008331 Ifit1 0.30517 -0.28333 1.08710 0.64792 Interferon-induced protein with tetratricopeptide repeats 2 3296 3331 NM 008332 Ifit2 0.15186 -0.01277 1.82914 0.06561 Interferon-induced protein with tetratricopeptide repeats 3 1064 1099 NM 010501 Ifit3 0.11846 -0.18789 2.24480 0.59080 Interferon-related developmental regulator 1 1122 1156 NM 013562 Ifrd1 0.93748 0.16216 1.21054 0.26793 Interferon-stimulated protein 353 387 NM 020583 Isg20 0.10311 -0.03317 0.29797 0.03556 interkeukin 1 receptor accessory protein-like 2 1862 1897 NM 030688 Il1rapl2 -0.29509 -0.12660 -0.53840 -0.30241 interleukin 1 alpha 1494 1528 NM 010554 Il1a 0.20857 -0.23241 0.78165 0.30832 interleukin 1 beta 968 1002 NM 008361 Il1b -0.13538 -0.13625 -0.12807 -0.25371 interleukin 1 family member 5 (delta) 748 782 NM 019451 Il1f5 -0.01474 -0.08486 -0.62970 -0.45580 interleukin 1 family member 6 198 235 NM 019450 Il1f6 0.09490 0.06818 0.24659 0.21381 interleukin 1 family member 7 112 147 NM 153077 Il1f10 -0.32903 -0.22346 -0.18586 0.00934 interleukin 1 family member 8 112 149 AY071842 Il1f8 -0.49052 -0.69230 -0.32343 -0.08446 interleukin 1 family member 9 255 289 NM 153511 Il1f9 -0.30254 -0.31210 -0.29803 0.03243 interleukin 1 receptor type I 3912 3946 NM 008362 Il1r1 -0.26994 -0.03642 -0.06516 0.02270 interleukin 1 receptor type II 913 947 NM 010555 Il1r2 -0.04960 0.13873 0.17916 0.36274 interleukin 1 receptor accessory protein 2571 2606 NM 008364 Il1rap -0.10095 0.20850 -0.39730 0.05990 interleukin 1 receptor antagonist 1806 1844 NM 031167 Il1rn 0.41662 0.57549 0.83328 0.29492 interleukin 1 receptor-like 1 ligand 1397 1431 NM 010744 Il1rl1l -0.31226 -0.09254 -0.06580 0.08708 interleukin 1 receptor-like 1 2413 2447 NM 010743 Il1rl1 -0.38066 -0.24285 -0.45884 -0.13883 interleukin 1 receptor-like 2 1169 1204 NM 133193 Il1rl2 -0.33009 -0.02764 -0.40595 -0.18307 interleukin 10 receptor alpha 2547 2581 NM 008348 Il10ra -0.16393 -0.12409 -0.66292 -0.32998 interleukin 10 receptor beta 1310 1346 NM 008349 Il10rb 0.25054 0.15508 0.03712 0.07725 interleukin 10 982 1016 NM 010548 Il10 -0.22928 -0.13478 -0.16718 0.07835 interleukin 11 receptor alpha chain 1 1475 1510 NM 010549 Il11ra1 -0.32131 -0.21270 -0.08594 0.00630 interleukin 11 331 365 NM 008350 Il11 0.42519 0.23075 1.05286 0.63502

Appendix-1 UNIQUE ID ID Gene Comment BALB/c IL1 BALB/c NOD IL1 NOD TNF TNF interleukin 12 receptor beta 1 2196 2230 NM 008353 Il12rb1 -0.13949 0.00223 -0.40496 -0.19356 interleukin 12 receptor beta 2 2792 2826 NM 008354 Il12rb2 -0.13731 0.18164 -0.59679 -0.41563 interleukin 12a 336 370 NM 008351 Il12a -0.13843 -0.20345 -0.01925 -0.14556 interleukin 12b 1551 1585 NM 008352 Il12b -0.08287 0.43190 -0.72716 -0.30478 interleukin 13 receptor alpha 1 3031 3066 NM 133990 Il13ra1 0.35618 0.26829 0.63654 0.48455 interleukin 13 receptor alpha 2 759 793 NM 008356 Il13ra2 -0.28456 -0.00767 -0.23441 -0.00325 interleukin 13 438 472 NM 008355 Il13 -0.39480 -0.37796 -0.30103 -0.13042 interleukin 15 receptor alpha chain 398 432 NM 008358 Il15ra -0.25546 -0.39873 -0.35360 0.15388 interleukin 15 1039 1073 NM 008357 Il15 -0.01523 -0.08376 -0.35009 -0.02677 interleukin 16 4768 4802 NM 010551 Il16 -0.29461 -0.20313 -0.32584 -0.04047 interleukin 17 receptor B 2396 2430 NM 019583 Il17rb -0.50363 -0.52794 -0.29512 0.07360 interleukin 17 receptor C 1332 1366 NM 134159 Il17rc -0.38801 -0.15157 -0.09891 0.08739 interleukin 17 receptor D 3104 3138 NM 134437 Il17rd -0.01423 0.04375 -0.40483 -0.32666 interleukin 17 receptor E 2276 2310 NM 145826 Il17re -0.34042 -0.11916 -0.12540 0.06305 interleukin 17 receptor 2551 2585 NM 008359 Il17r 0.10254 0.01930 0.25951 0.31247 interleukin 17 210 245 NM 010552 Il17 -0.34944 -0.07592 -0.32510 -0.08463 interleukin 17B 641 675 NM 019508 Il17b -0.34075 -0.08233 -0.26301 -0.29592 interleukin 17D 825 859 NM 145837 Il17d -0.53857 -0.58630 -0.59941 -0.35787 interleukin 17E 734 768 NM 080729 Il17e 0.16523 0.19173 -1.15457 -0.59671 interleukin 18 binding protein 1078 1116 NM 010531 Il18bp 0.28516 0.25016 0.45722 0.36932 Interleukin 18 receptor 1 2448 2482 NM 008365 Il18r1 -0.26846 -0.27694 -0.25269 -0.06784 interleukin 18 receptor accessory protein 2083 2117 NM 010553 Il18rap -0.26022 0.14757 -0.59589 -0.16548 interleukin 18 812 850 NM 008360 Il18 -0.01697 -0.03665 0.58227 0.25804 Interleukin 19 929 963 XM 283649 Il19 -0.08003 -0.18272 -0.80951 -0.36001 interleukin 2 receptor alpha chain 3747 3782 NM 008367 Il2ra -0.55462 -0.33921 -0.28684 -0.09987 interleukin 2 receptor beta chain 2552 2586 NM 008368 Il2rb 0.30672 0.14693 0.19890 -0.07977 interleukin 2 receptor gamma chain 681 715 NM 013563 Il2rg 0.26229 -0.16939 1.40310 0.33340 interleukin 2 516 550 NM 008366 Il2 -0.14210 -0.06543 -0.61859 -0.09158 interleukin 20 378 412 NM 021380 Il20 -0.28047 -0.07358 -0.51347 -0.00995 interleukin 21 receptor 2178 2215 NM 021887 Il21r 0.16258 0.04143 0.88957 0.32509 interleukin 21 2261 2295 NM 021782 Il21 -0.11911 -0.23370 -0.08443 -0.19361 Interleukin 22 241 275 NM 016971 Il22 0.10539 0.04558 -0.39670 -0.22907 interleukin 23 alpha subunit p19 1197 1233 NM 031252 Il23a 0.57387 -0.07513 0.84414 0.17042

Appendix-1 UNIQUE ID ID Gene Comment BALB/c IL1 BALB/c NOD IL1 NOD TNF TNF interleukin 24 962 996 NM 053095 Il24 -0.38319 -0.34214 -0.44769 -0.30860 interleukin 25 635 669 NM 080837 Il25 -0.09183 -0.16194 -0.07385 0.08534 interleukin 3 receptor alpha chain 622 656 NM 008369 Il3ra -0.46374 -0.72866 -0.49825 -0.34530 interleukin 3 492 526 NM 010556 Il3 -0.23878 -0.14393 -0.47117 -0.02970 interleukin 4 induced 1 1849 1883 NM 010215 Il4i1 1.33066 -0.11470 1.24592 0.48754 interleukin 4 receptor alpha 3455 3489 NM 010557 Il4ra 0.07560 -0.02247 0.65587 0.33590 Interleukin 4 48 82 NM 021283 Il4 -0.28203 0.00814 -0.54150 -0.12395 interleukin 5 receptor alpha 2857 2892 NM 008370 Il5ra -0.45734 -0.44099 -0.38461 -0.25304 interleukin 5 924 958 NM 010558 Il5 -0.36154 -0.42753 -0.34611 -0.25781 interleukin 6 receptor alpha 1008 1042 NM 010559 Il6ra -0.09497 -0.34310 -0.21323 0.09692 interleukin 6 signal transducer 4521 4555 NM 010560 Il6st 0.27548 0.51740 0.47148 0.39737 interleukin 6 643 678 NM 031168 Il6 2.19753 1.39431 3.90204 2.22781 interleukin 7 receptor 2603 2638 NM 008372 Il7r -0.08320 -0.21651 -0.21322 -0.06493 interleukin 7 2013 2047 NM 008371 Il7 -0.31077 -0.33132 0.02506 -0.09459 Interleukin 8 receptor alpha 905 939 NM 178241 Il8ra -0.08213 -0.25086 -0.34747 0.08355 interleukin 8 receptor beta 1954 1989 NM 009909 Il8rb -0.01454 0.18487 -0.61599 -0.38990 interleukin 9 receptor 2231 2265 NM 008374 Il9r -0.24239 -0.37337 -0.38408 -0.15985 interleukin 9 188 222 NM 008373 Il9 -0.15523 -0.03880 -0.53915 0.00279 interleukin enhancer binding factor 2 1461 1500 NM 026374 Ilf2 -0.15138 -0.12945 -0.84694 -0.94735 interleukin enhancer binding factor 3 2707 2741 NM 010561 Ilf3 -0.15962 -0.14393 -0.06444 -0.03442 interleukin-1 receptor-associated kinase 1 binding protein 1 1480 1514 NM 022986 Irak1bp1 -0.22047 -0.27518 0.07340 0.07859 interleukin-1 receptor-associated kinase 1 2495 2529 NM 008363 Irak1 -0.27565 -0.20028 -0.39220 -0.63133 Interleukin-1 receptor-associated kinase 2 2259 2293 NM 172161 Irak2 -0.20765 -0.12622 -0.42095 -0.11207 interleukin-1 receptor-associated kinase 4 2039 2075 NM 029926 Irak4 -0.43039 -0.08018 -0.23631 0.03323 Involucrin 1312 1347 NM 008412 Ivl -0.17115 -0.13054 -0.19570 0.05014 ISL1 transcription factor LIM/homeodomain (islet 1) 1560 1599 NM 021459 Isl1 -0.73211 -0.46170 -0.67411 -0.16799 islet amyloid polypeptide 290 324 NM 010491 Iapp -0.33205 -0.40889 -0.25639 -0.31589 islet cell autoantigen 1 1126 1161 NM 010492 Ica1 -0.19160 -0.02272 -0.24829 -0.34794 islet neogenesis associated protein-related protein 624 660 NM 013893 Ingaprp-pending 0.00510 0.07200 -0.71002 -0.48827 Janus kinase 1 3394 3428 NM 146145 Jak1 -0.01078 -0.07145 0.31545 0.32406 Janus kinase 2 3147 3181 NM 008413 Jak2 -0.18475 -0.32741 0.16449 0.05624 Janus kinase 3 3048 3082 NM 010589 Jak3 0.04677 0.38820 0.09002 0.20534 Jun oncogene 2907 2946 NM 010591 Jun 1.29208 0.25797 1.61988 0.39455

Appendix-1 UNIQUE ID ID Gene Comment BALB/c IL1 BALB/c NOD IL1 NOD TNF TNF Jun proto-oncogene related gene d1 1593 1627 NM 010592 Jund1 0.45641 0.22381 0.89558 0.47590 Jun-B oncogene 1280 1314 NM 008416 Junb 1.43655 0.73509 1.55813 1.18364 Karyopherin (importin) alpha 1 3146 3180 NM 008465 Kpna1 -0.27051 -0.05938 -0.06918 -0.01119 Karyopherin (importin) alpha 3 3648 3682 NM 008466 Kpna3 0.10049 0.12639 0.18375 0.21432 Karyopherin (importin) alpha 4 3062 3100 NM 008467 Kpna4 0.29710 0.83350 0.38708 0.12790 Karyopherin (importin) alpha 6 896 930 NM 008468 Kpna6 -0.25173 -0.27940 0.05283 -0.07811 Karyopherin (importin) beta 3 4002 4036 NM 023579 Kpnb3 -0.38792 -0.06045 -0.08561 0.16381 Kit ligand 4861 4900 NM 013598 Kitl 0.35776 0.17498 0.37035 0.43636 L1 cell adhesion molecule 2942 2976 NM 008478 L1cam -0.33078 -0.18172 -0.34174 0.01466 lactoperoxidase 2842 2876 NM 080420 Lpo -0.22062 -0.41864 -0.13395 -0.02207 Leptin receptor 2622 2656 NM 010704 Lepr -0.08933 -0.19977 -0.41002 -0.33503 Leptin 3032 3066 NM 008493 Lep -0.23840 -0.20793 -0.10886 0.13098 leucine-rich and death domain containing 2518 2552 NM 022654 Lrdd -0.68050 -0.38547 -0.00393 0.09090 Leukemia inhibitory factor 5348 5382 NM 008501 Lif -0.19996 -0.37192 -0.22438 0.17109 Leukotriene B4 receptor 1 574 608 NM 008519 Ltb4r1 -0.14693 -0.36697 -0.36253 -0.04585 Leukotriene B4 receptor 2 835 869 NM 020490 Ltb4r2 -0.15085 -0.18852 -0.50253 -0.17779 Linker for activation of T cells 1064 1098 NM 010689 Lat 0.12180 0.26733 0.44349 0.19063 lipopolysaccharide binding protein 1361 1398 NM 008489 Lbp -0.24093 -0.67950 -0.55229 -0.65302 Lipoprotein lipase 2989 3023 NM 008509 Lpl -0.32961 -0.30266 -0.08200 -0.00380 Liver glycogen phosphorylase 1940 1974 NM 133198 Pygl 0.02457 -0.20745 -0.17269 -0.41372 Low density lipoprotein receptor-related protein 1 14219 14254 NM 008512 Lrp1 -0.22344 -0.10100 -0.11043 -0.12491 Lymphocyte antigen 75 6199 6238 NM 013825 Ly75 -0.14572 -0.15307 -0.01135 -0.14951 lymphoid blast crisis-like 1 2286 2320 NM 008487 Lbcl1 -0.20451 -0.01895 -0.14052 -0.24369 Lymphotoxin A 593 627 NM 010735 Lta -0.16962 -0.23765 -0.57028 -0.16467 Lymphotoxin B receptor 1208 1243 NM 010736 Ltbr -0.27665 -0.16911 -0.06895 0.10999 Lymphotoxin B 150 184 NM 008518 Ltb 0.48757 0.26520 0.93026 0.21215 Lysosomal acid lipase 1 2026 2060 NM 021460 Lip1 -0.03983 -0.25171 -0.23856 -0.20770 Lysosomal-associated membrane protein 3 2975 3010 NM 177356 Lamp3 -0.14548 -0.20964 -0.73945 -0.74754 Macrophage migration inhibitory factor 368 403 NM 010798 Mif -0.09008 -0.17193 -0.08347 -0.15603 MAD homolog 1 (Drosophila) 2656 2690 NM 008539 Smad1 0.22639 0.28320 0.45646 0.31414 MAD homolog 2 (Drosophila) 1538 1572 NM 010754 Smad2 -0.10687 -0.04255 -0.14786 0.10157 MAD homolog 3 (Drosophila) 4882 4916 NM 016769 Smad3 0.28218 0.21886 0.03397 0.19540 MAD homolog 4 (Drosophila) 3221 3257 NM 008540 Smad4 0.10216 0.20546 0.09880 0.07055

Appendix-1 UNIQUE ID ID Gene Comment BALB/c IL1 BALB/c NOD IL1 NOD TNF TNF MAD homolog 5 (Drosophila) 6168 6203 NM 008541 Smad5 -0.28768 0.12997 -0.04483 -0.23188 MAD homolog 6 (Drosophila) 1359 1393 NM 008542 Smad6 -0.41314 -0.38760 -0.49645 -0.13296 MAD homolog 7 (Drosophila) 2767 2801 NM 008543 Smad7 -0.33287 -0.14586 -0.45693 -0.10338 MAD homolog 9 (Drosophila) 373 407 NM 019483 Smad9 -0.46063 -0.23219 -0.38138 -0.17935 Malic enzyme supernatant 2392 2426 NM 008615 Mod1 -0.16988 -0.11028 0.06323 -0.09337 MAP kinase-activated protein kinase 2 802 841 BG918951 Mapkapk2 -0.00245 0.02840 -0.38484 -1.07793 MAP kinase-activated protein kinase 5 1318 1352 NM 010765 Mapkapk5 -0.27923 -0.08375 -0.24462 0.04810 MAP-kinase activating death domain 5036 5070 NM 145527 Madd -0.31251 -0.30356 -0.15791 0.00208 MARCKS-like protein 970 1004 NM 010807 Mlp 1.07181 0.99049 1.32941 1.04474 Max protein 1221 1255 NM 008558 Max -0.22439 -0.45193 -0.24493 -0.03549 melanoma cell adhesion molecule 2558 2593 NM 023061 Mcam -0.29376 -0.23055 -0.23255 -0.12470 MHC (A.CA/J(H-2K-f) class I antigen 1063 1098 NM 019909 LOC56628 0.02705 -0.05296 -0.81625 -0.50262 Mitochondrial translational release factor 1 1137 1171 NM 145960 Mtrf1 -0.46507 -0.27901 -0.30818 -0.04219 mitogen activated protein kinase 1 2401 2440 NM 011949 Mapk1 0.10426 0.21267 -0.07214 -0.00139 mitogen activated protein kinase 10 2483 2517 NM 009158 Mapk10 -0.06544 -0.45291 -0.73398 -0.96254 mitogen activated protein kinase 13 367 401 NM 011950 Mapk13 -0.17166 -0.13029 -0.26997 -0.09984 mitogen activated protein kinase 14 2508 2543 NM 011951 Mapk14 -0.18035 -0.19934 -0.18123 0.03656 mitogen activated protein kinase 3 932 966 NM 011952 Mapk3 -0.24962 -0.29354 -0.26782 -0.24286 mitogen activated protein kinase 8 interacting protein 2701 2735 NM 011162 Mapk8ip -0.23440 -0.01082 -0.23584 -0.22268 mitogen activated protein kinase 8 1141 1175 NM 016700 Mapk8 -0.15282 -0.09283 -0.38866 -0.24337 mitogen activated protein kinase 9 3492 3528 NM 016961 Mapk9 -0.17389 -0.13309 -0.49110 -0.25656 mitogen activated protein kinase kinase 1 1123 1158 NM 008927 Map2k1 0.13091 -0.04837 0.18223 0.28547 mitogen activated protein kinase kinase 2 1246 1285 NM 023138 Map2k2 -0.17768 0.03207 -0.37369 -0.71879 mitogen activated protein kinase kinase 3 1266 1300 NM 008928 Map2k3 -0.43967 -0.25961 -0.19592 -0.07050 mitogen activated protein kinase kinase 4 3555 3594 NM 009157 Map2k4 0.18670 0.25707 0.15314 0.23196 mitogen activated protein kinase kinase 5 1708 1742 NM 011840 Map2k5 0.07489 0.35273 0.12904 0.31201 mitogen activated protein kinase kinase 6 1607 1641 NM 011943 Map2k6 -0.31643 -0.47444 -0.59069 -0.67686 mitogen activated protein kinase kinase 7 1692 1726 NM 011944 Map2k7 -0.01676 -0.11627 -0.33041 -0.07678 mitogen activated protein kinase kinase kinase 1 4317 4356 NM 011945 Map3k1 -0.02038 0.03392 -0.49931 -0.08408 mitogen activated protein kinase kinase kinase 11 3062 3096 NM 022012 Map3k11 -0.11054 0.13711 0.27074 0.19160 mitogen activated protein kinase kinase kinase 12 4569 4603 NM 009582 Map3k12 -0.25595 -0.18052 -0.36376 -0.07495 mitogen activated protein kinase kinase kinase 2 2222 2256 NM 011946 Map3k2 -0.29144 -0.61138 -0.20736 0.00065 mitogen activated protein kinase kinase kinase 3 2748 2782 NM 011947 Map3k3 -0.17792 -0.29595 -0.56603 -0.10630

Appendix-1 UNIQUE ID ID Gene Comment BALB/c IL1 BALB/c NOD IL1 NOD TNF TNF mitogen activated protein kinase kinase kinase 4 4717 4751 NM 011948 Map3k4 -0.16773 -0.29187 -0.65056 -0.37390 mitogen activated protein kinase kinase kinase 5 4170 4205 NM 008580 Map3k5 -0.56652 -0.00921 -0.10484 -0.15396 mitogen activated protein kinase kinase kinase 7 2046 2082 NM 172688 Map3k7 -0.24205 -0.18660 -0.04189 -0.03658 mitogen activated protein kinase kinase kinase 8 1871 1906 NM 007746 Map3k8 1.03649 0.52924 1.02167 0.18004 mitogen activated protein kinase kinase kinase kinase 1 1785 1819 NM 008279 Map4k1 -0.40044 -0.16392 -0.45754 -0.14817 mitogen activated protein kinase kinase kinase kinase 2 1470 1504 NM 009006 Map4k2 -0.39591 -0.17616 0.00457 -0.07885 mitogen-activated protein kinase 11 2088 2122 NM 011161 Mapk11 -0.17300 -0.24283 -0.37940 -0.19320 mitogen-activated protein kinase 12 1056 1090 NM 013871 Mapk12 -0.24761 -0.19401 -0.16127 0.09654 mitogen-activated protein kinase 6 2711 2750 NM 015806 Mapk6 0.71593 0.48127 0.45566 -0.12438 mitogen-activated protein kinase 7 2019 2053 NM 011841 Mapk7 -0.19488 -0.19989 -0.50493 -0.24014 mitogen-activated protein kinase 8 interacting protein 2 2603 2637 NM 021921 Mapk8ip2 -0.43646 -0.28179 -0.47290 -0.28099 mitogen-activated protein kinase 8 interacting protein 3 5060 5094 NM 013931 Mapk8ip3 -0.18990 -0.17921 -0.22915 -0.01613 mitogen-activated protein kinase associated protein 1 2274 2308 NM 177345 Mapkap1 -0.41119 -0.06291 -0.39611 -0.12072 mitogen-activated protein kinase kinase 1 interacting protein 1 873 907 NM 019920 Map2k1ip1 -0.32335 -0.12256 -0.11669 0.04290 mitogen-activated protein kinase kinase kinase 14 3824 3858 NM 016896 Map3k14 -0.36019 -0.18395 -0.08844 -0.08911 mitogen-activated protein kinase kinase kinase 6 4014 4048 NM 016693 Map3k6 -0.29357 -0.03572 -0.45957 -0.12207 mitogen-activated protein kinase kinase kinase 7 interacting protein NM_025609 Map3k7ip1 -0.32436 -0.18687 -0.38934 -0.00316 1 2683 2717 mitogen-activated protein kinase kinase kinase 7 interacting protein NM_138667 Map3k7ip2 -0.20465 -0.09747 -0.15624 0.03346 2 2952 2986 Mitogen-activated protein kinase kinase kinase kinase 3 2782 2816 XM 128800 Map4k3 -0.28327 -0.39409 -0.17648 0.00989 mitogen-activated protein kinase kinase kinase kinase 4 3037 3071 NM 008696 Map4k4 -0.14054 0.23794 0.42528 0.28364 mitogen-activated protein kinase kinase kinase kinase 5 3403 3437 NM 024275 Map4k5 -0.07766 -0.14347 -0.07176 0.13168 mitogen-activated protein kinase kinase kinase kinase 6 4048 4082 NM 016713 Map4k6-pending -0.32807 -0.17274 0.07109 -0.21925 Moderately similar to P300_HUMAN E1A-associated protein p300 BE133216 P300-ESTs 0.40406 0.13156 -0.40552 -0.15885 [H.sapiens] 76 113 modulator of apoptosis 1 1663 1697 NM 022323 Moap1 -0.15714 -0.27832 -0.04407 -0.09746 mucosal vascular addressin cell adhesion molecule 1 1217 1253 NM 013591 Madcam1 -0.29946 -0.11817 -0.37483 -0.10784 Mus musculus clone TSAP7 p53-induced apoptosis differentially expressed AV303381 --- -0.35568 -0.38005 -0.12246 0.12638 mRNA sequence. 49 83 Mus musculus mRNA similar to putative c-Myc-responsive (cDNA clone BE949497 --- -0.15816 -0.37623 -0.11911 -0.30158 MGC:54855 IMAGE:5388297) complete cds 402 436

Appendix-1 UNIQUE ID ID Gene Comment BALB/c IL1 BALB/c NOD IL1 NOD TNF TNF Mus musculus transcribed sequence with strong similarity to protein pir:I38863 BG073508 --- -0.25763 -0.18752 -0.37366 -0.32916 (H.sapiens) I38863 E1B 19K/Bcl-2-interacting protein Nip1 - human 521 555 myc target 1 1098 1135 NM 026793 Myct1 -0.01518 -0.06788 -0.35229 -0.05016 Mycbp associated protein 1654 1688 NM 170671 Mycbpap -0.21420 -0.09860 -0.19037 0.04321 myc-like oncogene s-myc protein 1079 1113 NM 010850 Mycs -0.40144 -0.08298 -0.34980 0.00828 myelocytomatosis oncogene 1914 1948 NM 010849 Myc 0.31402 0.24205 0.60642 0.30543 Myeloid differentiation primary response gene 88 1291 1325 NM 010851 Myd88 0.11688 0.36518 0.53604 0.60542 myeloperoxidase 1843 1877 NM 010824 Mpo -0.70585 -0.47021 -0.29463 0.10153 Myocyte enhancer factor 2B 473 507 NM 008578 Mef2b -0.53517 -0.57032 -0.55050 -0.55514 Myocyte enhancer factor 2D 1377 1411 NM 133665 Mef2d -0.22868 -0.23812 -0.35843 -0.08555 Myogenic factor 5 1657 1694 NM 008656 Myf5 -0.02236 -0.13453 -0.06581 0.00816 Myristoylated alanine rich protein kinase C substrate 2037 2075 NM 008538 Marcks 0.19327 0.42338 0.35616 0.31338 Myxovirus (influenza virus) resistance 1 2962 2996 NM 010846 Mx1 -0.31760 -0.02935 -0.23146 0.11206 Myxovirus (influenza virus) resistance 2 1519 1553 NM 013606 Mx2 0.21495 0.11002 0.58815 -0.06161 Natriuretic peptide precursor type B 131 165 NM 008726 Nppb -0.15545 -0.08594 -0.43702 -0.12395 N-ethylmaleimide sensitive fusion protein 3183 3217 NM 008740 Nsf -0.13415 -0.15175 -0.30631 -0.08359 neural cell adhesion molecule 1 2056 2090 NM 010875 Ncam1 -0.17225 -0.20952 -0.08907 0.03871 neural cell adhesion molecule 2 4665 4703 NM 010954 Ncam2 -0.19933 0.09308 -0.19685 0.19300 Neuroblastoma suppression of tumorigenicity 1 1266 1300 NM 008675 Nbl1 -0.18876 -0.07554 -0.37249 -0.16547 Neurogenic differentiation 1 1755 1792 NM 010894 Neurod1 -0.13224 0.19141 -0.77865 -1.19025 nitric oxide synthase 1 neuronal 3936 3975 NM 008712 Nos1 0.30593 0.19036 0.01192 0.08539 nitric oxide synthase 2 inducible macrophage 3935 3969 NM 010927 Nos2 -0.27440 -0.45922 -0.20466 -0.32489 nitric oxide synthase 3 endothelial cell 3471 3505 NM 008713 Nos3 -0.42402 -0.27843 -0.16094 -0.03627 non MHC restricted killing associated 937 971 NM 018729 Nmrk 0.03173 -0.30017 -0.36047 -0.48852 Non-catalytic region of tyrosine kinase adaptor protein 2 2162 2197 NM 010879 Nck2 -0.14762 0.10873 -0.25709 -0.39590 Nuclear factor of activated T-cells cytoplasmic calcineurin-dependent NM_016791 Nfatc1 0.37713 0.61128 0.68639 0.67231 1 3973 4009 Nuclear factor of activated T-cells cytoplasmic calcineurin-dependent 2 NM_010900 Nfatc2ip -0.34299 0.04774 -0.71992 -0.16789 interacting protein 2478 2514 Nuclear factor of activated T-cells cytoplasmic calcineurin-dependent NM_010899 Nfatc2 -0.02350 -0.27606 -0.57068 -0.43259 2 3106 3140 Nuclear factor of activated T-cells cytoplasmic calcineurin-dependent NM_010901 Nfatc3 -0.60037 -0.43860 -0.06174 0.06844 3 3063 3100

Appendix-1 UNIQUE ID ID Gene Comment BALB/c IL1 BALB/c NOD IL1 NOD TNF TNF Nuclear factor of activated T-cells cytoplasmic calcineurin-dependent NM_023699 Nfatc4 -0.19430 0.00388 -0.09758 0.03867 4 2295 2329 Nuclear factor of activated T-cells 5 4024 4058 NM 018823 Nfat5 -0.32936 -0.23176 -0.83770 -0.25116 nuclear factor of kappa light chain gene enhancer in B-cells 1 p105 3381 3415 NM 008689 Nfkb1 0.75678 0.44653 1.08086 0.55439 nuclear factor of kappa light chain gene enhancer in B-cells inhibitor NM_010907 Nfkbia 2.61702 1.44311 3.05586 2.14586 alpha 603 637 nuclear factor of kappa light chain gene enhancer in B-cells inhibitor NM_010908 Nfkbib 0.26522 0.18188 0.51644 0.41492 beta 1829 1863 nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 NM_019408 Nfkb2 0.27776 0.47778 0.74209 0.49366 p49/p100 2240 2274 nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor NM_008690 Nfkbie 1.24484 0.91598 2.05177 1.66308 epsilon 2012 2046 nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like NM_010909 Nfkbil1 0.11346 0.13505 -0.00126 0.24814 1 1109 1143 Nuclear receptor subfamily 3 group C member 2 3939 3974 XM 356093 Nr3c2 -0.36043 0.06642 -0.68656 -0.10169 Nuclear respiratory factor 1 2606 2640 NM 010938 Nrf1 -0.27766 -0.08923 -0.18682 0.10172 nucleolar protein 3 (apoptosis repressor with CARD domain) 2766 2801 NM 030152 Nol3 -0.20012 -0.01302 -0.29432 -0.13314 Opioid receptor delta 1 3772 3806 NM 013622 Oprd1 -0.29595 -0.28406 -0.05528 0.00571 Orosomucoid 1 240 278 NM 008768 Orm1 -0.05037 0.09864 -0.65978 -0.26445 P21 (CDKN1A)-activated kinase 1 1032 1066 NM 011035 Pak1 0.00105 0.22826 0.19889 -0.03714 P450 (cytochrome) oxidoreductase 1972 2006 NM 008898 Por -0.09462 0.01900 -0.14098 -0.19523 p53 apoptosis effector related to Pmp22 1414 1448 NM 022032 Perp-pending -0.20025 0.27548 -0.31213 -0.74337 PDZ domain containing guanine nucleotide exchange factor (GEF) 1 8790 8828 XM 203999 Pdzgef1 -0.18658 0.02809 -0.17834 -0.16263 Peptidylprolyl isomerase A 560 594 NM 008907 HK -0.14428 -0.15280 -0.08811 -0.12843 perlecan (heparan sulfate proteoglycan 2) 11817 11851 NM 008305 Hspg2 -0.35748 -0.38094 -0.49735 -0.26290 peroxisome proliferative activated receptor gamma coactivator 1 2376 2410 NM 008904 Ppargc1 -0.28724 -0.29860 -0.48386 -0.39045 peroxisome proliferator activated receptor alpha 2621 2655 NM 011144 Ppara -0.13655 -0.07361 -0.50764 -0.22848 peroxisome proliferator activated receptor binding protein 4908 4942 NM 013634 Pparbp -0.48995 -0.35516 -0.12383 0.07078 peroxisome proliferator activated receptor gamma 976 1011 NM 011146 Pparg -0.14734 -0.15294 -0.06726 0.00764 peroxisome proliferator activator receptor delta 2582 2616 NM 011145 Ppard -0.04861 -0.22769 -0.67865 -0.57885 Phosphatidylinositol 3-kinase regulatory subunit polypeptide 1 (p85 NM_011085 Pik3r1 -0.22642 -0.14045 -0.12944 0.10853 alpha) 1759 1794 Phosphatidylinositol 3-kinase catalytic delta polypeptide 2792 2826 NM 008840 Pik3cd -0.38108 -0.28325 -0.38908 -0.14161

Appendix-1 UNIQUE ID ID Gene Comment BALB/c IL1 BALB/c NOD IL1 NOD TNF TNF Phosphoenolpyruvate carboxykinase 1 cytosolic 1657 1691 NM 011044 Pck1 -0.18264 -0.25688 -0.11089 0.24023 Plasminogen activator tissue 1952 1990 NM 008872 Plat 0.50038 0.53577 0.25955 -0.13175 Plasminogen activator urokinase 2010 2044 NM 008873 Plau 0.33470 0.29487 0.82668 0.49096 Platelet derived growth factor alpha 442 477 NM 008808 Pdgfa -0.13178 -0.26256 -0.54167 -0.52067 Platelet derived growth factor B polypeptide 2451 2485 NM 011057 Pdgfb 0.26058 0.81021 0.67499 0.42733 platelet/endothelial cell adhesion molecule 2199 2233 NM 008816 Pecam 0.18461 0.11471 1.01859 0.80983 Pleckstrin homology Sec7 and coiled-coil domains binding protein 1931 1965 NM 139200 Pscdbp 0.21672 -0.00913 0.82589 0.20239 Pleiotrophin 1471 1505 NM 008973 Ptn -0.11181 -0.26451 -0.48139 -0.18104 PRKC apoptosis WT1 regulator 75 114 BB398886 Pawr 0.00311 0.33793 -0.07925 0.07797 Procollagen type I alpha 1 4242 4276 NM 007742 Col1a1 0.49302 -0.13830 0.87338 0.50145 Procollagen type I alpha 2 3565 3599 NM 007743 Col1a2 -0.39421 -0.13192 -0.32269 -0.09264 Profilin 1 405 439 NM 011072 Pfn1 -0.15299 0.01375 -0.05637 -0.19656 programmed cell death 1 ligand 1 2849 2888 NM 021893 Pdcd1lg1 0.04734 0.15417 0.43933 0.10975 programmed cell death 1 ligand 2 897 931 NM 021396 Pdcd1lg2 -0.14933 0.06200 -0.44454 -0.05195 programmed cell death 1 1199 1233 NM 008798 Pdcd1 -0.06566 -0.19348 -0.36414 -0.22440 programmed cell death 10 1532 1569 NM 019745 Pdcd10 -0.00527 0.25074 0.23295 0.20443 programmed cell death 2 876 910 NM 008799 Pdcd2 -0.40861 -0.11105 -0.15786 -0.00424 programmed cell death 4 1332 1368 NM 011050 Pdcd4 -0.36429 -0.43936 -0.24228 -0.15723 programmed cell death 5 276 311 NM 019746 Pdcd5 -0.17486 -0.00077 -0.04060 0.08217 programmed cell death 6 interacting protein 1806 1841 NM 011052 Pdcd6ip -0.08453 -0.10609 0.42487 0.33612 programmed cell death 6 527 561 NM 011051 Pdcd6 -0.12369 -0.00199 -0.22108 -0.30756 programmed cell death 8 1423 1457 NM 012019 Pdcd8 0.00501 0.21096 0.16984 0.23598 programmed cell death protein 7 1726 1760 NM 016688 Pdcd7 -0.12066 0.25565 0.17654 0.24961 Proline-rich nuclear receptor coactivator 1 1000 1034 XM 131355 Pnrc1 0.85388 0.36994 1.31027 0.75420 Protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting 1 3296 3330 NM 023371 Pin1 0.26309 0.03170 -0.01700 0.01544 Protein kinase interferon inducible double stranded RNA dependent NM_011871 Prkra -0.16666 -0.04508 -0.02083 -0.12806 activator 883 917 Protein kinase C alpha 3055 3089 NM 011101 Prkca -0.27404 -0.08650 -0.57674 -0.16349 Protein phospatase 3 regulatory subunit B alpha isoform (calcineurin B type NM_024459 Ppp3r1 -0.09274 -0.26792 -0.04159 0.13244 I) 235 269 Protein phosphatase 1 catalytic subunit alpha isoform 432 470 NM 031868 Ppp1ca -0.14772 0.04393 0.03047 -0.08124 Protein phosphatase 3 catalytic subunit gamma isoform 965 1000 NM 008915 Ppp3cc -0.22476 -0.22822 -0.17369 -0.13557 Protein tyrosine phosphatase non-receptor type 1 1224 1258 NM 011201 Ptpn1 0.06489 -0.13426 0.19691 0.37901

Appendix-1 UNIQUE ID ID Gene Comment BALB/c IL1 BALB/c NOD IL1 NOD TNF TNF Protein tyrosine phosphatase receptor type C 4269 4305 NM 011210 Ptprc 0.38716 0.17192 1.17874 0.24337 Proteoglycan 1 secretory granule 849 883 NM 011157 Prg1 0.35525 -0.18817 1.38533 0.78396 Proviral integration site 2 1681 1715 NM 145737 Pim2 0.19521 0.12080 0.05520 0.21974 PUC18 Plasmid DNA 2411 2445 L08752 PUC18 0.14939 0.18682 -0.62430 -0.30228 Purinergic receptor P2X ligand-gated ion channel 7 1189 1223 NM 011027 P2rx7 0.09264 0.06087 -0.63792 -0.52000 RAB4A member RAS oncogene family 990 1024 NM 009003 Rab4a -0.30201 -0.13660 -0.42144 -0.03664 receptor (TNFRSF)-interacting serine-threonine kinase 1 4083 4117 NM 009068 Ripk1 -0.15247 -0.35080 -0.29551 -0.18887 receptor (TNFRSF)-interacting serine-threonine kinase 2 1368 1406 NM 138952 Ripk2 1.35159 1.07727 1.75892 1.04512 receptor-interacting serine-threonine kinase 3 1299 1333 NM 019955 Ripk3 -0.14813 0.01246 -0.25574 -0.08007 regenerating islet-derived 1 175 209 NM 009042 Reg1 -0.09080 0.28628 0.32778 0.41651 regenerating islet-derived 2 202 236 NM 009043 Reg2 0.03214 0.38321 -0.12277 -0.13387 regenerating islet-derived 3 alpha 218 252 NM 011259 Reg3a -0.21663 -0.02492 -0.42661 -0.26179 regenerating islet-derived 3 gamma 546 584 NM 011260 Reg3g 0.03766 0.36609 0.25920 0.37672 regenerating islet-derived family member 4 275 309 NM 026328 Reg4 -0.38450 -0.14909 -0.30529 -0.03215 Regulatory factor X 1 (influences HLA class II expression) 4052 4086 NM 009055 Rfx1 -0.46761 -0.41708 -0.01951 0.06769 Regulatory factor X 2 (influences HLA class II expression) 2239 2273 NM 009056 Rfx2 -0.58363 -0.07794 -0.25073 0.04253 Regulatory factor X 3 (influences HLA class II expression) 2139 2173 NM 011265 Rfx3 -0.02835 -0.20673 -0.43615 -0.18689 Regulatory factor X 5 (influences HLA class II expression) 1093 1128 NM 017395 Rfx5 -0.21426 -0.05609 -0.36747 -0.13426 Regulatory factor X-associated ankyrin-containing protein 923 957 NM 011266 Rfxank -0.14667 -0.11063 -0.01141 0.16012 Regulatory factor X-associated protein 632 666 NM 133231 Rfxap -0.13748 -0.22255 -0.55345 -0.43194 Resistin 896 934 NM 022984 Retn 0.21417 0.07860 -0.04249 -0.00127 Reticuloendotheliosis oncogene 1923 1958 NM 009044 Rel 0.79041 0.31509 1.04303 0.28479 Rho GDP dissociation inhibitor (GDI) beta 906 940 NM 007486 Arhgdib 0.16753 -0.16534 0.95169 0.44969 ribosomal protein 119 232 266 NM 009078 HK 0.02681 0.07021 -0.04768 0.14508 Ribosomal protein L13a 389 423 NM 009438 HK -0.10945 -0.01959 0.26709 0.29103 Ribosomal protein S27a 304 343 NM 024277 Rps27a 0.08083 0.26688 0.10580 0.03108 RIKEN cDNA 2310042E05 gene 713 747 NM 027151 2310042E05Rik -0.19578 -0.03917 -0.22331 -0.04251 RIKEN cDNA 9130221H12 gene 908 942 NM 178400 9130221H12Rik -0.15556 -0.11202 -0.51445 -0.32785 RIKEN cDNA A430056A10 gene 2713 2747 NM 133871 A430056A10Rik 0.17053 0.15649 1.58336 0.57878 RIKEN cDNA B930050E02 gene 2209 2243 XM 284227 B930050E02Rik -0.13917 -0.03418 -0.56761 -0.05247 Ring finger protein 110 963 997 NM 009545 Rnf110 -0.13729 -0.14689 -0.45199 -0.25968 Runt related transcription factor 1 4158 4192 NM 009821 Runx1 0.07324 0.17769 0.02374 -0.02117 Runt related transcription factor 2 1659 1693 NM 009820 Runx2 -0.14420 -0.25443 -0.25659 -0.25432

Appendix-1 UNIQUE ID ID Gene Comment BALB/c IL1 BALB/c NOD IL1 NOD TNF TNF ryanodine receptor 1 skeletal muscle 914 948 X83932 Ryr1 -0.02973 0.08123 -0.53672 -0.32503 ryanodine receptor 2 cardiac 14270 14304 NM 023868 Ryr2 -0.17409 -0.09447 -0.32177 0.11493 ryanodine receptor 3 703 739 X83934 Ryr3 0.06569 0.25305 -0.09237 -0.01473 S100 calcium binding protein A4 304 338 NM 011311 S100a4 0.03654 -0.31360 -0.00281 -0.07063 S100 protein beta polypeptide neural 354 388 NM 009115 S100b -0.27179 -0.29960 -0.14238 -0.00044 Secreted phosphoprotein 1 930 964 NM 009263 Spp1 -0.03743 -0.21159 -0.35880 -0.47748 secretory carrier membrane protein 1 262 297 BM115445 Scamp1 -0.27695 -0.30954 -0.45653 -0.45860 secretory carrier membrane protein 2 1895 1934 NM 022813 Scamp2 0.06066 0.34397 -0.00131 0.08379 secretory carrier membrane protein 3 672 706 NM 011886 Scamp3 -0.31698 -0.17360 -0.18602 -0.06717 secretory carrier membrane protein 4 1080 1114 NM 019575 Scamp4 -0.25782 0.07735 -0.18129 -0.15675 secretory carrier membrane protein 5 2339 2376 NM 020270 Scamp5 -0.32416 -0.08141 -0.10487 -0.02437 Selectin endothelial cell 2477 2511 NM 011345 Sele 0.10925 -0.02894 0.43154 -0.08672 Selectin lymphocyte 1333 1368 NM 011346 Sell 0.46269 0.52623 0.48327 0.00765 Selectin platelet (p-selectin) ligand 853 887 NM 009151 Selpl 0.04339 -0.09769 0.42758 -0.00645 Serine (or cysteine) proteinase inhibitor clade E member 1 2689 2723 NM 008871 Serpine1 1.14793 0.83230 1.91746 0.87980 serine/threonine kinase 17b (apoptosis-inducing) 3063 3102 NM 133810 Stk17b 0.34448 0.43927 0.37426 0.09014 Serine/threonine kinase 4 5076 5111 NM 021420 Stk4 -0.21253 -0.05904 0.10925 0.19829 Serum amyloid A 1 384 420 NM 009117 Saa1 -0.20669 0.11289 -0.68892 -0.20750 Serum response factor 3318 3352 NM 020493 Srf -0.39359 -0.46902 -0.30863 -0.16196 signal transducer and activator of transcription 1 3874 3908 NM 009283 Stat1 -0.24139 -0.22978 -0.12241 -0.15122 signal transducer and activator of transcription 2 3410 3444 NM 019963 Stat2 -0.36360 -0.34817 -0.13678 0.03557 signal transducer and activator of transcription 3 2381 2415 NM 011486 Stat3 0.18782 -0.04275 0.20621 0.36283 signal transducer and activator of transcription 4 1994 2028 NM 011487 Stat4 -0.18795 -0.08414 -0.36082 -0.18246 signal transducer and activator of transcription 5A 3355 3391 NM 011488 Stat5a -0.26094 -0.27259 -0.30823 -0.01423 signal transducer and activator of transcription 5B 4459 4493 NM 011489 Stat5b -0.25574 0.04278 -0.25294 -0.01216 signal transducer and activator of transcription 6 2535 2569 NM 009284 Stat6 -0.16142 0.08100 -0.10412 -0.07718 signal transducer and activator of transcription interacting protein 1 1856 1893 NM 021448 Statip1 -0.26934 0.08201 -0.13968 0.01751 Similar to AIM2 protein 247 281 XM 357160 AIM2-est 0.03331 0.06838 -0.07391 -0.03349 small chemokine (C-C motif) ligand 11 353 387 NM 011330 Ccl11 -0.29981 -0.30523 -0.38357 -0.26428 Small inducible cytokine subfamily E member 1 109 143 NM 007926 Scye1 -0.17739 0.10008 -0.05457 -0.14050 Solute carrier family 14 (urea transporter) member 2 1097 1131 NM 030683 Slc14a2 -0.31923 -0.18969 -0.18825 0.05553 solute carrier family 2 (facilitated glucose transporter) member 8 1276 1310 NM 019488 Slc2a8 -0.15267 0.06740 -0.58524 -0.34637 solute carrier family 2 (facilitated glucose transporter) member 1 1952 1986 NM 011400 Slc2a1 -0.19586 -0.20795 -0.19538 0.03223

Appendix-1 UNIQUE ID ID Gene Comment BALB/c IL1 BALB/c NOD IL1 NOD TNF TNF solute carrier family 2 (facilitated glucose transporter) member 10 2916 2950 NM 130451 Slc2a10 0.13307 0.42847 -0.48303 -0.17715 solute carrier family 2 (facilitated glucose transporter) member 2 1843 1882 NM 031197 Slc2a2 -0.43511 -0.06144 -0.14318 -0.06388 solute carrier family 2 (facilitated glucose transporter) member 3 3154 3188 NM 011401 Slc2a3 -0.41572 -0.26495 -0.43798 -0.22246 solute carrier family 2 (facilitated glucose transporter) member 4 1561 1595 NM 009204 Slc2a4 0.10871 0.00000 0.00000 0.00000 solute carrier family 2 (facilitated glucose transporter) member 5 2189 2223 NM 019741 Slc2a5 -0.45215 -0.16818 -0.27007 -0.07865 solute carrier family 2 (facilitated glucose transporter) member 9 3002 3036 NM 145559 Slc2a9 -0.23916 -0.39434 -0.28798 -0.02910 Src-like adaptor 706 740 NM 009192 Sla 0.33014 0.45096 -0.10952 -0.05169 Stearoyl-Coenzyme A desaturase 1 4462 4497 NM 009127 Scd1 -0.23323 -0.41450 -0.30431 -0.10082 Sterol regulatory element binding factor 1 3529 3563 NM 011480 Srebf1 -0.22813 -0.11065 -0.12871 0.01946 Sterol regulatory element binding factor 2 3849 3883 XM 127995 Golgi apparatus 0.16118 0.36921 0.21857 0.12884 Stratifin 998 1032 NM 018754 Sfn -0.28124 -0.07679 -0.26505 -0.04048 stress-induced phosphoprotein 1 1305 1339 NM 016737 Stip1 0.16013 0.13963 0.19749 0.27221 superoxide dismutase 1 soluble BC002066 160 199 BC002066 Sod1 -0.21100 -0.11218 -0.30991 -0.52390 superoxide dismutase 1 soluble 371 405 BM240246 Sod1 0.06038 -0.01493 -0.32967 -0.29131 superoxide dismutase 2 mitochondrial 519 553 NM 013671 Sod2 0.63200 0.39664 0.46404 0.24154 superoxide dismutase 3 extracellular 1222 1256 NM 011435 Sod3 -0.45642 -0.48112 -0.55565 -0.48254 suppressor of cytokine signaling 1 455 489 NM 009896 Socs1 -0.30374 -0.18441 -0.21652 -0.11989 suppressor of cytokine signaling 2 488 522 NM 007706 Socs2 0.28584 0.34467 0.81040 0.62399 suppressor of cytokine signaling 3 1941 1976 NM 007707 Socs3 0.22166 0.19788 0.72136 0.52278 suppressor of cytokine signaling 4 3044 3080 NM 018821 Socs4 -0.06199 0.15674 -0.42784 -0.07745 suppressor of cytokine signaling 5 3528 3563 NM 019654 Socs5 -0.15716 -0.20464 -0.23526 -0.20539 suppressor of cytokine signaling 7 2110 2144 NM 080843 Socs7 -0.16789 -0.19244 -0.23555 -0.28815 Synaptosomal-associated protein 23 1744 1778 NM 009222 Snap23 -0.36926 -0.10134 0.00803 0.07299 Synaptosomal-associated protein 25 1748 1785 NM 011428 Snap25 0.12724 -0.04455 -0.61484 -0.97745 Syntaxin 4A (placental) 1282 1316 NM 009294 Stx4a -0.11506 -0.35022 0.01637 0.21937 Syntaxin binding protein 1 2956 2990 NM 009295 Stxbp1 -0.17263 -0.29174 0.05488 0.00756 Syntaxin binding protein 2 1157 1191 NM 011503 Stxbp2 -0.22323 0.13720 -0.19205 -0.09630 Syntaxin binding protein 4 1677 1711 NM 011505 Stxbp4 -0.20120 -0.07767 -0.16118 -0.02503 TAP binding protein 1028 1062 NM 009318 Tapbp -0.17032 -0.38707 -0.06910 0.02390 Tax1 (human T-cell leukemia virus type I) binding protein 1 2090 2124 NM 025816 Tax1bp1 -0.18549 -0.18184 0.03533 0.00576 T-box 21 2114 2152 NM 019507 Tbx21 0.12550 0.56812 -0.29092 -0.20981 T-complex protein 10b 1853 1887 NM 009341 Tcp10b -0.15324 -0.53996 -0.33103 -0.10044 Teratocarcinoma-derived growth factor 1582 1616 NM 011562 Tdgf1 -0.11478 -0.03496 -0.34178 0.06479

Appendix-1 UNIQUE ID ID Gene Comment BALB/c IL1 BALB/c NOD IL1 NOD TNF TNF testicular cell adhesion molecule 1 2508 2542 NM 029467 Tcam1 -0.17886 -0.18750 -0.62132 -0.36613 Tfrc/Trfr//Tfr1 4134 4173 NM 011638 HK -0.09104 0.00121 -0.06553 0.01417 TG interacting factor 1380 1414 NM 009372 Tgif 0.39443 0.41352 1.02441 0.56150 TH1-like homolog (Drosophila) 1590 1624 NM 020580 Th1l -0.28413 -0.24909 -0.13194 -0.13924 thioredoxin 1 693 727 NM 011660 Txn1 -0.17471 -0.12301 -0.36551 0.00179 thioredoxin 2 444 478 NM 019913 Txn2 -0.15110 -0.00043 -0.16827 -0.08263 thioredoxin domain containing 1 2104 2140 NM 028339 Txndc1 -0.17126 -0.21211 -0.20738 -0.07663 thioredoxin domain containing 4 (endoplasmic reticulum) 1047 1081 NM 029572 Txndc4 -0.05172 -0.10631 -0.12649 -0.08497 thioredoxin domain containing 5 2349 2383 NM 145367 Txndc5 -0.08253 -0.00861 -0.36536 -0.68120 thioredoxin interacting protein 2418 2452 NM 023719 Txnip 0.37093 0.23839 0.88505 0.35418 thioredoxin reductase 1 2502 2537 NM 015762 Txnrd1 0.05560 0.16399 0.08929 0.02201 thioredoxin reductase 2 1216 1251 NM 013711 Txnrd2 -0.27363 -0.17815 -0.35878 -0.10577 thioredoxin reductase 3 1966 2000 NM 153162 Txnrd3 -0.01785 0.19716 0.12770 0.35200 thioredoxin-like 2 1390 1424 NM 023140 Txnl2 -0.37999 -0.23126 -0.41110 -0.00847 thioredoxin-like 1688 1722 NM 016792 Txnl -0.38701 -0.34770 -0.04728 -0.02668 Thrombopoietin 1434 1468 NM 009379 Thpo 0.04534 -0.01641 -0.97589 -0.49753 Thymoma viral proto-oncogene 2 2338 2375 NM 007434 Akt2 -0.33886 -0.09462 -0.25245 -0.02245 thyroid peroxidase 2869 2903 NM 009417 Tpo -0.18243 -0.33893 -0.11271 -0.17502 Thyroid transcription factor 1 2284 2319 NM 009385 Titf1 -0.36356 -0.48458 -0.60728 -0.69502 Tissue inhibitor of metalloproteinase 1 153 190 NM 011593 Timp1 0.13491 -0.07004 0.71651 0.19197 Tnf receptor associated factor 4 3131 3165 NM 009423 Traf4 -0.19316 0.03762 -0.35776 -0.12119 Tnf receptor-associated factor 1 2155 2192 NM 009421 Traf1 0.03434 -0.24581 -0.21111 -0.03688 Tnf receptor-associated factor 2 2754 2789 NM 009422 Traf2 -0.09709 0.21061 -0.45373 -0.29121 Tnf receptor-associated factor 3 7014 7048 NM 011632 Traf3 0.01416 0.19228 0.30716 0.34644 Tnf receptor-associated factor 5 1324 1358 NM 011633 Traf5 -0.01128 -0.30294 0.10212 0.01972 Tnf receptor-associated factor 6 5164 5198 NM 009424 Traf6 -0.04163 0.20317 0.32464 0.21015 TNFAIP3 interacting protein 1 2752 2786 NM 021327 Tnip1 0.99027 0.94075 1.58636 1.31929 TNFAIP3 interacting protein 2 1789 1823 NM 139064 Tnip2 -0.36241 -0.09885 -0.25897 -0.10625 TNFRSF1A-associated via death domain AA201054 605 639 AA201054 Tradd -0.31479 -0.24390 -0.15403 -0.09847 TNFRSF1A-associated via death domain 132 166 BB749262 Tradd -0.19109 -0.03702 -0.31797 0.00854 Toll interacting protein 2712 2746 NM 023764 Tollip -0.16697 -0.13108 0.04402 -0.07823 toll-like receptor 1 1581 1617 NM 030682 Tlr1 -0.14380 -0.24265 -0.16776 0.12342 toll-like receptor 2 2768 2802 NM 011905 Tlr2 1.09771 0.49619 1.27824 0.45902

Appendix-1 UNIQUE ID ID Gene Comment BALB/c IL1 BALB/c NOD IL1 NOD TNF TNF toll-like receptor 3 3700 3739 NM 126166 Tlr3 0.14577 0.43131 0.18119 0.13612 toll-like receptor 4 3552 3589 NM 021297 Tlr4 0.01606 -0.24044 -0.10575 0.01469 Toll-like receptor 5 3828 3862 NM 016928 Tlr5 -0.28307 0.02543 -0.38906 -0.03277 toll-like receptor 6 2403 2437 NM 011604 Tlr6 -0.36080 -0.29296 -0.22546 0.10348 toll-like receptor 7 3243 3277 NM 133211 Tlr7 -0.36415 -0.16588 -0.35308 -0.09077 toll-like receptor 8 2352 2387 NM 133212 Tlr8 0.10888 0.18812 -0.01783 -0.12765 toll-like receptor 9 3142 3176 NM 031178 Tlr9 -0.36714 -0.32747 -0.42617 -0.29740 Tpb 108 144 NM 013684 HK -0.46524 -0.38225 -0.34332 -0.04535 Traf2 binding protein 1623 1662 NM 145133 T2bp-pending 0.23994 0.16527 0.90506 0.60260 TRAF-interacting protein 2143 2178 NM 011634 Traip -0.56262 0.04891 -0.68751 -0.62824 Trans-acting transcription factor 1 3988 4022 NM 013672 Sp1 0.09247 -0.07552 -0.26550 -0.37404 Trans-acting transcription factor 3 2462 2500 NM 011450 Sp3 0.20564 0.37507 0.14475 0.18037 Transcription factor 2 1946 1980 NM 009330 Tcf2 0.11305 0.07238 0.24948 0.19370 Transcription factor CP2 2570 2604 NM 033476 Tcfcp2 -0.36025 -0.37549 -0.52190 -0.33719 transformation related protein 53 binding protein 1 5268 5302 NM 013735 Trp53bp1 -0.05813 0.18119 -0.34746 -0.06421 transformation related protein 53 inducible nuclear protein 1 4687 4725 NM 021897 Trp53inp1 0.08890 0.25188 0.37551 0.04882 transformation related protein 53 1972 2006 NM 011640 Trp53 0.38652 0.33218 0.26145 0.34325 Transforming growth factor beta 1 1997 2031 NM 011577 Tgfb1 0.19662 0.25798 0.59898 0.39627 Transforming growth factor beta 2 3299 3336 NM 009367 Tgfb2 -0.03638 -0.17682 0.53388 0.27438 Transforming growth factor beta 3 2431 2465 NM 009368 Tgfb3 -0.28524 -0.47209 -0.19472 0.01913 Transforming growth factor beta induced 2493 2527 NM 009369 Tgfbi -0.03333 -0.33527 0.50971 0.51245 Transforming growth factor beta receptor I 4851 4890 NM 009370 Tgfbr1 0.17240 0.46350 0.09660 0.07480 Transforming growth factor beta receptor II 3824 3862 NM 009371 Tgfbr2 0.26156 0.35131 0.08345 -0.10654 Transforming growth factor beta receptor III 5605 5639 NM 011578 Tgfbr3 0.23360 0.38942 -0.07837 0.13526 Transforming growth factor alpha 2895 2929 NM 031199 Tgfa -0.18068 -0.07488 -0.54710 -0.16630 Transforming growth factor beta 1 induced transcript 1 2465 2499 NM 009365 Tgfb1i1 -0.37067 -0.28822 -0.18355 0.02537 Transforming growth factor beta 1 induced transcript 4 1493 1527 NM 009366 Tgfb1i4 -0.34399 -0.23322 -0.14181 -0.14205 Transient receptor potential cation channel subfamily V member 6 2279 2313 NM 022413 Trpv6 -0.11571 -0.19287 -0.23513 -0.07419 Transporter 1 ATP-binding cassette sub-family B (MDR/TAP) 1720 1754 NM 013683 Tap1 0.09783 0.27853 0.86533 0.63718 Transporter 2 ATP-binding cassette sub-family B (MDR/TAP) 2249 2284 NM 011530 Tap2 0.31648 0.43327 0.38540 0.39501 tuberoinfundibular peptide of 39 residues (TIP39) preprohormone 74 108 NM 053256 Tifp39-pending -0.32387 -0.38459 -0.53822 -0.33626 tumor necrosis factor alpha-induced protein 1 (endothelial) 2690 2727 NM 009395 Tnfaip1 -0.21325 -0.07760 0.06131 0.15702 tumor necrosis factor alpha-induced protein 2 2692 2726 NM 009396 Tnfaip2 0.83582 0.21731 1.12739 0.58631

Appendix-1 UNIQUE ID ID Gene Comment BALB/c IL1 BALB/c NOD IL1 NOD TNF TNF tumor necrosis factor alpha-induced protein 3 3911 3945 NM 009397 Tnfaip3 3.40824 2.19888 3.79492 2.49483 tumor necrosis factor (ligand) superfamily member 10 505 539 NM 009425 Tnfsf10 -0.12298 -0.20922 -0.35996 -0.23398 tumor necrosis factor (ligand) superfamily member 11 1747 1784 NM 011613 Tnfsf11 0.01585 -0.09927 -0.35316 -0.39965 tumor necrosis factor (ligand) superfamily member 12 309 343 NM 011614 Tnfsf12 -0.30917 -0.37061 -0.18157 -0.18732 tumor necrosis factor (ligand) superfamily member 13 1238 1273 NM 023517 Tnfsf13 -0.51517 -0.22142 -0.16650 0.03298 tumor necrosis factor (ligand) superfamily member 13b 1541 1575 NM 033622 Tnfsf13b -0.13141 0.03958 -0.70100 -0.31082 tumor necrosis factor (ligand) superfamily member 14 1684 1718 NM 019418 Tnfsf14 0.24648 0.06884 -0.01822 0.01866 tumor necrosis factor (ligand) superfamily member 4 1299 1333 NM 009452 Tnfsf4 -0.00393 -0.20207 -0.55611 -0.29042 tumor necrosis factor (ligand) superfamily member 5 391 425 NM 011616 Tnfsf5 0.04355 -0.27884 -0.72925 -0.62350 tumor necrosis factor (ligand) superfamily member 6 1560 1594 NM 010177 Tnfsf6 -0.01110 -0.11711 -0.44243 -0.34474 tumor necrosis factor (ligand) superfamily member 7 744 778 NM 011617 Tnfsf7 0.05466 0.12148 -0.54756 -0.18643 tumor necrosis factor (ligand) superfamily member 8 1995 2030 NM 009403 Tnfsf8 0.02748 0.08197 -0.69466 -0.36179 tumor necrosis factor (ligand) superfamily member 9 346 380 NM 009404 Tnfsf9 -0.30791 -0.48287 -0.15539 0.03893 tumor necrosis factor alpha induced protein 6 653 688 NM 009398 Tnfaip6 0.57445 -0.07648 1.11726 0.38497 tumor necrosis factor receptor superfamily member 10b 2569 2603 NM 020275 Tnfrsf10b -0.30878 -0.12635 -0.45399 -0.22549 tumor necrosis factor receptor superfamily member 11a 2263 2297 NM 009399 Tnfrsf11a -0.31173 -0.40337 -0.11163 -0.06103 tumor necrosis factor receptor superfamily member 11b NM_008764 Tnfrsf11b 1.16311 0.90110 0.56931 0.06344 (osteoprotegerin) 2570 2608 tumor necrosis factor receptor superfamily member 12a 570 604 NM 013749 Tnfrsf12a 0.11380 0.13569 0.35146 0.13421 tumor necrosis factor receptor superfamily member 13b 574 608 NM 021349 Tnfrsf13b -0.33320 -0.20657 -0.27607 -0.05487 tumor necrosis factor receptor superfamily member 13c 1117 1151 NM 028075 Tnfrsf13c 0.36527 0.04807 0.25107 0.18156 tumor necrosis factor receptor superfamily member 14 (herpesvirus entry NM_178931 Tnfrsf14 -0.35571 -0.28643 -0.35575 -0.17160 mediator) 271 305 tumor necrosis factor receptor superfamily member 17 240 274 NM 011608 Tnfrsf17 -0.31213 -0.22675 -0.45387 0.02382 tumor necrosis factor receptor superfamily member 18 763 797 NM 009400 Tnfrsf18 -0.38599 -0.34752 -0.21011 -0.08951 tumor necrosis factor receptor superfamily member 19 3436 3472 NM 013869 Tnfrsf19 -0.38221 -0.32691 -0.65984 -0.18627 tumor necrosis factor receptor superfamily member 1a 1674 1708 NM 011609 Tnfrsf1a -0.32490 -0.35051 -0.34962 -0.06382 tumor necrosis factor receptor superfamily member 1b 661 695 NM 011610 Tnfrsf1b -0.22217 0.05380 -0.69096 -0.35340 Tumor necrosis factor receptor superfamily member 21 NM 178589 Tnfrsf21 -0.15129 -0.10701 -0.34701 -0.13296 tumor necrosis factor receptor superfamily member 21 1024 1058 NM 052975 Tnfrsf21 -0.29983 -0.41354 -0.34663 -0.01177 tumor necrosis factor receptor superfamily member 22 1724 1758 NM 023680 Tnfrsf22 -0.16057 0.04274 -0.59379 -0.28716 tumor necrosis factor receptor superfamily member 23 1155 1193 NM 024290 Tnfrsf23 -0.35428 -0.51448 -0.26256 -0.18539 tumor necrosis factor receptor superfamily member 25 1601 1635 NM 033042 Tnfrsf25 0.18008 0.12317 -0.05120 -0.00096

Appendix-1 UNIQUE ID ID Gene Comment BALB/c IL1 BALB/c NOD IL1 NOD TNF TNF tumor necrosis factor receptor superfamily member 4 319 353 NM 011659 Tnfrsf4 -0.26296 -0.30791 0.12722 0.01504 tumor necrosis factor receptor superfamily member 5 1389 1423 NM 011611 Tnfrsf5 0.43387 0.09612 0.60742 0.16489 tumor necrosis factor receptor superfamily member 6 1168 1202 NM 007987 Tnfrsf6 0.58938 0.64912 1.29746 0.89417 tumor necrosis factor receptor superfamily member 7 L24495 1263 1297 L24495 Tnfrsf7 0.13367 0.11068 0.18460 0.10094 Tumor necrosis factor receptor superfamily member 7 398 432 XM 284241 CD27 -0.26120 -0.13452 -0.17831 0.04047 tumor necrosis factor receptor superfamily member 8 882 916 NM 009401 Tnfrsf8 -0.29930 -0.18928 -0.19019 0.05223 tumor necrosis factor receptor superfamily member 9 1946 1980 NM 011612 Tnfrsf9 -0.35615 -0.59914 -0.40692 -0.24207 tumor necrosis factor 1086 1120 NM 013693 Tnf 1.98878 0.33747 1.88182 0.27541 Tumor rejection antigen gp96 2313 2347 NM 011631 Tra1 -0.05744 -0.01827 -0.29072 -0.18459 Tyrosine kinase 2 4408 4442 NM 018793 Tyk2 -0.41782 -0.19361 -0.09288 0.08162 UDP-Gal:betaGlcNAc beta 1 3-galactosyltransferase polypeptide 2 3697 3735 NM 020025 B3galt2 -0.13410 0.16206 -0.57128 -0.21190 uncoupling protein 1 mitochondrial 1054 1088 NM 009463 Ucp1 -0.21051 -0.28330 -0.21803 0.08627 uncoupling protein 2 mitochondrial 2966 3000 NM 011671 Ucp2 -0.27113 -0.71686 -0.18894 -0.04561 uncoupling protein 3 mitochondrial 1700 1734 NM 009464 Ucp3 0.02146 -0.00057 -0.48784 -0.25278 Urokinase plasminogen activator receptor 1263 1297 BC010309 Plaur 0.42385 0.43431 0.50584 0.05034 vascular cell adhesion molecule 1 2819 2853 NM 011693 Vcam1 1.23600 1.03468 2.50697 1.50345 Vascular endothelial growth factor A 2700 2737 NM 009505 Vegfa -0.41599 -0.05897 -0.05075 0.07650 Vascular endothelial growth factor B 1012 1047 NM 011697 Vegfb -0.21726 -0.23569 -0.28506 -0.33170 Vascular endothelial growth factor C 1289 1323 NM 009506 Vegfc 0.13835 0.09606 0.09551 0.09913 Vav 1 oncogene 2199 2233 NM 011691 Vav1 -0.10398 -0.49744 -0.09138 -0.03128 Vav 3 oncogene 2621 2655 NM 020505 Vav3 0.08932 0.06168 0.08711 0.03357 Vav2 oncogene 2913 2947 NM 009500 Vav2 -0.16108 -0.10135 -0.31326 0.01166 Vesicle-associated membrane protein associated protein B and C 1155 1189 NM 019806 Vapb -0.09680 -0.50393 0.08441 0.54421 Vesicle-associated membrane protein 2 1347 1381 NM 009497 Vamp2 -0.18378 -0.02740 -0.34016 -0.07198 Vesicle-associated membrane protein 3 1278 1313 NM 009498 Vamp3 -0.28929 -0.15797 -0.21747 -0.30628 Vinculin 4725 4760 NM 009502 Vcl -0.31292 -0.11537 0.01863 -0.32335 V-raf-1 leukemia viral oncogene 1 2475 2511 NM 029780 Raf1 -0.37764 0.23217 -0.18952 -0.09685 V-rel reticuloendotheliosis viral oncogene homolog A (avian) 1971 2005 NM 009045 Rela 0.49483 0.39835 0.53765 0.33518 YY1 transcription factor 1778 1815 NM 009537 Yy1 0.04673 0.40168 0.04185 0.03764 Zinc finger containing RAN binding domain containing 1 1519 1555 NM 207302 Zranb1 -0.31413 -0.12033 0.01852 0.18453 Zinc finger protein multitype 2 4768 4807 NM 011766 Zfpm2 -0.07380 -0.37109 -0.18019 0.00468 Zinc finger protein 398 2118 2152 NM 173034 Zfp398 -0.37564 -0.15043 -0.12780 -0.21405

Appendix-1

APPENDIX 2

235 Appendix 2. Anti-apoptotic gene induction in BALB/c mice Gene Gene Title Gene Bank Fold  p-value Fold  p-value2 Symbol ID IL-1 TNF Aatf apoptosis antagonizing transcription NM_019816 0.792 0.07619 0.774 0.099 factor Aven apoptosis caspase activation inhibitor NM_028844 1.004 0.98755 1.100 0.758 Birc1a baculoviral IAP repeat-containing 1a NM_008670 0.873 0.61192 0.916 0.771 Birc1b baculoviral IAP repeat-containing 1b NM_010872 0.836 0.24248 0.854 0.170 Birc1e baculoviral IAP repeat-containing 1e NM_010870 0.804 0.38722 0.871 0.579 Birc1f baculoviral IAP repeat-containing 1f NM_010871 0.963 0.84162 1.038 0.839 Birc2 baculoviral IAP repeat-containing 2 NM_007465 1.045 0.6347 1.166 0.122 Birc3 baculoviral IAP repeat-containing 3 NM_007464 2.86 4.6E-05 2.252 0.000 Birc4 baculoviral IAP repeat-containing 4 NM_009688 0.851 0.49658 0.810 0.375 Birc5 baculoviral IAP repeat-containing 5 NM_009689 1.076 0.7095 1.067 0.757 Birc6 baculoviral IAP repeat-containing 6 NM_007566 1.086 0.75496 1.205 0.593 Bcl2 B-cell leukemia/lymphoma 2 NM_009741 0.854 0.35754 0.872 0.312 Bcl2a1a B-cell leukemia/lymphoma 2 related NM_009742 1.259 0.22993 1.171 0.405 protein A1a Bcl2a1c B-cell leukemia/lymphoma 2 related NM_007535 1.5 0.06081 1.517 0.058 protein A1c Bcl2a1d B-cell leukemia/lymphoma 2 related NM_007536 1.201 0.38467 1.112 0.597 protein A1d Bcl3 B-cell leukemia/lymphoma 3 NM_033601 1.249 0.13722 1.441 0.042 Bag4 BCL2-associated athanogene 4 NM_026121 0.681 0.0167 0.883 0.425 Bcl2l Bcl2-like NM_009743 0.888 0.50019 0.917 0.454 Bcl2l10 Bcl2-like 10 NM_013479 0.883 0.51434 0.975 0.865 Bcl2l2 Bcl2-like 2 NM_007537 0.827 0.21458 0.903 0.632 Bfar bifunctional apoptosis regulator NM_025976 0.946 0.74679 0.965 0.811 Dad1 defender against cell death 1 NM_010015 0.814 0.07271 0.889 0.454 Gpx1 glutathione peroxidase 1 NM_008160 1.297 0.33427 1.431 0.237 Gpx2 glutathione peroxidase 2 NM_030677 0.962 0.79379 0.850 0.198 Gpx4 glutathione peroxidase 4 NM_008162 1.022 0.91535 1.087 0.735 Gpx5 glutathione peroxidase 5 NM_010343 0.989 0.92434 0.939 0.702 Hras1 Harvey rat sarcoma virus oncogene 1 NM_008284 0.861 0.15515 0.920 0.418 Hspa5 heat shock 70kD protein 5 (glucose- NM_022310 1.07 0.78869 1.183 0.586 regulated protein) Hspe1 heat shock protein 1 (chaperonin 10) NM_008303 0.985 0.95029 1.195 0.537 Hspd1 heat shock protein 1 (chaperonin) NM_010477 0.975 0.86021 1.127 0.449 Hspca heat shock protein 1 alpha NM_010480 1.102 0.70649 1.357 0.268 Hspcb heat shock protein 1 beta NM_008302 0.887 0.42896 1.144 0.416 Hsp105 heat shock protein 105 NM_013559 1.005 0.98534 1.499 0.147 Hspa12b heat shock protein 12B NM_028306 1.023 0.89744 0.976 0.896

Hspa1a heat shock protein 1A AW763765 1.338 0.66306 1.942 0.271 Hspa1b heat shock protein 1B M12573 1.139 0.74137 1.506 0.238 Hspa1l heat shock protein 1-like NM_013558 0.835 0.28578 0.806 0.235 Hspa2 heat shock protein 2 NM_008301 NM_008301 1.028 0.89738 0.986 0.958 Hspb3 heat shock protein 3 NM_019960 0.97 0.89401 0.870 0.408 Hspa4 heat shock protein 4 NM_008300 NM_008300 1.005 0.97804 1.161 0.437 Hspa8 heat shock protein 8 NM_031165 1.233 0.41557 1.456 0.199 Hspb7 heat shock protein family member 7 NM_013868 0.656 0.16868 0.713 0.217 (cardiovascular) Hebp2 heme binding protein 2 NM_019487 0.784 0.0676 0.710 0.052 Hmox1 heme oxygenase (decycling) 1 NM_010442 0.904 0.3172 0.891 0.234 Hmox2 heme oxygenase (decycling) 2 NM_010443 0.939 0.68237 1.034 0.866 Hnf4 Hepatic nuclear factor 4 NM_008261 0.933 0.58077 1.037 0.753 Sod1 superoxide dismutase 1 soluble BM240246 1.132 0.68967 1.536 0.169 Sod1 superoxide dismutase 1 soluble BC002066 0.942 0.71237 0.971 0.911 BC002066 Appendix 2. Anti-apoptotic gene induction in BALB/c mice Gene Gene Title Gene Bank Fold  p-value Fold  p-value2 Symbol ID IL-1 TNF Sod2 superoxide dismutase 2 mitochondrial NM_013671 1.305 0.17538 1.195 0.461

Sod3 superoxide dismutase 3 extracellular NM_011435 0.729 0.14741 0.616 0.088 Txn1 thioredoxin 1 NM_011660 0.925 0.54355 1.064 0.623 Txn2 thioredoxin 2 NM_019913 0.901 0.2082 0.999 0.992 Txndc1 thioredoxin domain containing 1 NM_028339 0.878 0.40106 1.000 0.999 Txndc5 thioredoxin domain containing 5 NM_145367 0.971 0.83646 1.017 0.924 Txnip thioredoxin interacting protein NM_023719 1.293 0.397 1.513 0.240 Txnrd1 thioredoxin reductase 1 NM_015762 0.939 0.71404 0.963 0.851 Txnrd2 thioredoxin reductase 2 NM_013711 0.827 0.4158 0.858 0.472 Txnrd3 thioredoxin reductase 3 NM_153162 0.988 0.94436 1.106 0.571 Txnl thioredoxin-like NM_016792 0.765 0.0706 0.813 0.051 Txnl2 thioredoxin-like 2 NM_023140 1.001 0.99586 1.161 0.483 Tnfaip6 tumor necrosis factor alpha induced NM_009398 1.305 0.43278 1.179 0.632 protein 6 Tnfaip1 tumor necrosis factor alpha-induced NM_009395 0.934 0.56789 1.058 0.534 protein 1 Tnfaip2 tumor necrosis factor alpha-induced NM_009396 1.14 0.41601 0.905 0.590 protein 2 Tnfaip3 tumor necrosis factor alpha-induced NM_009397 10.612 5.2E-06 5.917 1.4E-04 protein 3 Appendix 2. Anti-apoptotic gene induction in NOD mice Gene Gene Title Gene Bank Fold  p-value Fold  p-value2 Symbol ID IL-1 TNF Aatf apoptosis antagonizing transcription NM_019816 0.842 0.199 0.985 0.914 factor Aven apoptosis caspase activation inhibitor NM_028844 1.364 0.431 1.304 0.493 Birc1a baculoviral IAP repeat-containing 1a NM_008670 0.643 0.365 0.789 0.628 Birc1b baculoviral IAP repeat-containing 1b NM_010872 0.813 0.437 0.875 0.593 Birc1e baculoviral IAP repeat-containing 1e NM_010870 0.696 0.075 0.936 0.678 Birc1f baculoviral IAP repeat-containing 1f NM_010871 0.666 0.094 0.841 0.350 Birc2 baculoviral IAP repeat-containing 2 NM_007465 1.263 0.024 1.255 0.004 Birc3 baculoviral IAP repeat-containing 3 NM_007464 3.742 0.013 2.695 0.039 Birc4 baculoviral IAP repeat-containing 4 NM_009688 0.692 0.103 0.795 0.201 Birc5 baculoviral IAP repeat-containing 5 NM_009689 0.736 0.176 0.987 0.947 Birc6 baculoviral IAP repeat-containing 6 NM_007566 1.427 0.381 1.344 0.447 Bcl2 B-cell leukemia/lymphoma 2 NM_009741 0.889 0.304 1.052 0.647 Bcl2a1a B-cell leukemia/lymphoma 2 related NM_009742 1.639 0.488 1.323 0.720 protein A1a Bcl2a1c B-cell leukemia/lymphoma 2 related NM_007535 1.733 0.172 1.416 0.436 protein A1c Bcl2a1d B-cell leukemia/lymphoma 2 related NM_007536 1.703 0.495 1.340 0.731 protein A1d Bcl3 B-cell leukemia/lymphoma 3 NM_033601 1.548 0.152 1.479 0.215 Bag4 BCL2-associated athanogene 4 NM_026121 0.844 0.187 0.992 0.931 Bcl2l Bcl2-like NM_009743 0.951 0.788 0.901 0.606 Bcl2l10 Bcl2-like 10 NM_013479 0.624 0.139 0.777 0.408 Bcl2l2 Bcl2-like 2 NM_007537 0.938 0.741 1.038 0.838 Bfar bifunctional apoptosis regulator NM_025976 0.708 0.076 0.844 0.304 Dad1 defender against cell death 1 NM_010015 0.947 0.417 0.993 0.926 Gpx1 glutathione peroxidase 1 NM_008160 1.586 0.066 1.631 0.053 Gpx2 glutathione peroxidase 2 NM_030677 0.702 0.076 0.829 0.191 Gpx4 glutathione peroxidase 4 NM_008162 1.171 0.657 1.295 0.477 Gpx5 glutathione peroxidase 5 NM_010343 0.573 0.042 0.799 0.314 Hras1 Harvey rat sarcoma virus oncogene 1 NM_008284 0.781 0.067 0.912 0.400 Hspa5 heat shock 70kD protein 5 (glucose- NM_022310 1.443 0.578 1.242 0.737 regulated protein) Hspe1 heat shock protein 1 (chaperonin 10) NM_008303 1.395 0.504 1.473 0.441 Hspd1 heat shock protein 1 (chaperonin) NM_010477 1.099 0.470 1.241 0.198 Hspca heat shock protein 1 alpha NM_010480 1.495 0.187 1.377 0.284 Hspcb heat shock protein 1 beta NM_008302 1.070 0.454 1.070 0.404 Hsp105 heat shock protein 105 NM_013559 1.242 0.287 1.155 0.460 Hspa12b heat shock protein 12B NM_028306 0.817 0.188 0.903 0.470

Hspa1a heat shock protein 1A AW763765 1.308 0.643 1.172 0.785 Hspa1b heat shock protein 1B M12573 0.938 0.880 1.019 0.957 Hspa1l heat shock protein 1-like NM_013558 0.680 0.047 0.794 0.075 Hspa2 heat shock protein 2 NM_008301 NM_008301 1.391 0.227 1.443 0.170 Hspb3 heat shock protein 3 NM_019960 0.652 0.111 0.758 0.131 Hspa4 heat shock protein 4 NM_008300 NM_008300 1.302 0.315 1.361 0.241 Hspa8 heat shock protein 8 NM_031165 1.486 0.284 1.479 0.297 Hspb7 heat shock protein family member 7 NM_013868 0.663 0.461 0.786 0.647 (cardiovascular) Hebp2 heme binding protein 2 NM_019487 0.745 0.259 0.818 0.428 Hmox1 heme oxygenase (decycling) 1 NM_010442 0.799 0.359 0.894 0.609 Hmox2 heme oxygenase (decycling) 2 NM_010443 1.174 0.486 1.267 0.304 Hnf4 Hepatic nuclear factor 4 NM_008261 1.146 0.611 1.220 0.467 Sod1 superoxide dismutase 1 soluble BM240246 0.630 0.104 0.757 0.177 Sod1 superoxide dismutase 1 soluble BC002066 1.082 0.319 1.149 0.071 BC002066 Appendix 2. Anti-apoptotic gene induction in NOD mice Gene Gene Title Gene Bank Fold  p-value Fold  p-value2 Symbol ID IL-1 TNF Sod2 superoxide dismutase 2 mitochondrial NM_013671 1.200 0.290 1.052 0.802

Sod3 superoxide dismutase 3 extracellular NM_011435 0.677 0.011 0.712 0.031 Txn1 thioredoxin 1 NM_011660 1.102 0.389 1.164 0.113 Txn2 thioredoxin 2 NM_019913 0.957 0.731 1.015 0.911 Txndc1 thioredoxin domain containing 1 NM_028339 1.093 0.564 1.134 0.429 Txndc5 thioredoxin domain containing 5 NM_145367 1.154 0.353 1.267 0.120 Txnip thioredoxin interacting protein NM_023719 2.014 0.005 1.395 0.156 Txnrd1 thioredoxin reductase 1 NM_015762 1.550 0.234 1.538 0.239 Txnrd2 thioredoxin reductase 2 NM_013711 0.641 0.158 0.764 0.342 Txnrd3 thioredoxin reductase 3 NM_153162 1.175 0.258 1.374 0.093 Txnl thioredoxin-like NM_016792 1.005 0.970 1.019 0.900 Txnl2 thioredoxin-like 2 NM_023140 1.320 0.438 1.299 0.451 Tnfaip6 tumor necrosis factor alpha induced NM_009398 1.259 0.590 1.151 0.716 protein 6 Tnfaip1 tumor necrosis factor alpha-induced NM_009395 1.071 0.625 1.067 0.630 protein 1 Tnfaip2 tumor necrosis factor alpha-induced NM_009396 1.048 0.925 0.928 0.878 protein 2 Tnfaip3 tumor necrosis factor alpha-induced NM_009397 8.884 0.019 3.610 0.115 protein 3

First Author Publication Arising From this Thesis

240 Nuclear Factor-␬B Regulates ␤-Cell Death A Critical Role for A20 in ␤-Cell Protection David Liuwantara,1 Mark Elliot,2 Mariya W. Smith,2 Andrew O. Yam,1 Stacy N. Walters,1 Eliana Marino,1 Andy McShea,2 and Shane T. Grey1

Apoptotic ␤-cell death is central to the pathogenesis of and as the final effector mechanism (5,6). Evidence from type 1 diabetes and may be important in islet graft rejec- the NOD mouse (a widely studied model of autoimmune tion. Despite this, genetic control of ␤-cell apoptosis is only diabetes) (7) indicates that autoreactive cytolytic T-cells poorly understood. We report that inhibition of gene tran- (8), as well as soluble mediators including proinflamma- scription sensitized ␤-cells to tumor necrosis factor (TNF)- tory cytokines and free radicals, contribute to increased ␣–induced apoptosis, indicating the presence of a regulated ␤-cell apoptotic destruction during the pathogenesis of antiapoptotic response. Using oligonucleotide microarrays type 1 diabetes (6,9). Transplantation of islets is consid- and real-time PCR, we identified TNFAIP3/A20 as the most ered to be one potential approach that could restore highly regulated antiapoptotic gene expressed in cytokine- stimulated human and mouse islets. Cytokine induction of normal metabolic control for the cure of type 1 diabetes. A20 mRNA in primary islets and insulinoma cells was rapid However, multiple obstacles are faced in islet transplants, and observed within 1 h, consistent with A20 being an including cellular rejection akin to the mechanisms in- immediate early response gene in ␤-cells. Regulation of volved in autoimmune destruction of ␤-cells, and also A20 was nuclear factor-␬B (NF-␬B)–dependent, two NF-␬B primary nonfunction, a phenomena related to lack of sites within the A20 promoter were found to be necessary nutrients, hypoxia, and nonspecific inflammatory media- and sufficient for A20 expression in ␤-cells. Activation of tors (10–12). NF-␬B by TNF receptor–associated factor (TRAF) 2, Despite the importance of apoptosis in the pathophysi- ␬ TRAF6, NF- B–inducing kinase, or protein kinase D, which ology of ␤-cell death, the genetic control of apoptosis in transduce signals downstream of Toll-like receptors, TNF islets is poorly understood. Determining the molecular receptors, and free radicals, respectively, were all potent ␤ activators of the A20 promoter. Moreover, A20 expression basis of -cell susceptibility to apoptosis would increase was induced in transplanted islets in vivo. Finally, A20 our understanding of the mechanisms underscoring ␤-cell expression was sufficient to protect ␤-cells from TNF- loss, as well as reveal potential gene therapy candidates induced apoptosis. These data demonstrate that A20 is the for the creation of “death-defying” islets (13), capable of cardinal antiapoptotic gene in ␤-cells. Further, A20 expres- resisting immune and nonimmune insults. With this goal in sion is NF-␬B dependent, thus linking islet proinflamma- mind, we generated a custom microarray, a so-called tory gene responses with protection from apoptosis. “death-CHIP,” to map the immediate early antiapoptotic Diabetes 55:2491–2501, 2006 gene expression profile of cytokine-activated islets. Though later changes in islet gene expression after cyto- kine activation have been mapped in a number of studies (14,15), we focused only on the immediate early response, poptosis or programmed cell death is a geneti- as it is this response that determines cell fate after cally controlled response of the cell to commit inflammatory insult (16–19). Surprisingly, we found that in suicide (1,2). Apoptosis is the physiological contrast to other cell types, primary islets have a highly A process for cell deletion in normal, reorganiz- restricted immediate early antiapoptotic gene response, ing, or involuting tissue and is required for shaping of the with TNFAIP3/A20 being the most highly regulated anti- endocrine pancreas (3,4). Aside from its role in normal cell apoptotic gene. Significantly, we demonstrate that A20 is biology, ␤-cell apoptosis has been implicated in the patho- regulated at the level of gene transcription in pancreatic physiology of type 1 diabetes, both at its initiation phase ␤-cells by the proinflammatory transcription factor nu- clear factor-␬B (NF-␬B), thus linking islet inflammatory From the 1Arthritis and Inflammation Program, Garvan Institute for Medical gene responses with protection from apoptosis. Together, Research, Darlinghurst, New South Wales, Australia; and the 2Biology and with our previous studies demonstrating an anti-inflamma- Chemistry Section, CombiMatrix Corporation, Mukilteo, Washington. tory and antiapoptotic function for A20 (13,20–22), these Address correspondence and reprint requests to Dr. Shane T Grey, Gene Therapy & Autoimmunity Group, Arthritis and Inflammation Program, Garvan present data indicate that A20 is a critical component of Institute of Medical Research, 384 Victoria Street, Darlinghurst, NSW 2010 the islet-regulated response to inflammatory stress and Australia. E-mail: [email protected]. injury. Thus, we demonstrate that loss of A20 expression Received for publication 31 January 2006 and accepted in revised form 1 ␤ June 2006. renders -cells susceptible to apoptotic death; conversely, FACS, fluorescence-activated cell sorter; FADD, Fas-associated death do- enhancing A20 expression in ␤-cells may improve their main; FADD-DN, FADD dominant negative inhibitor; ␤-gal, ␤-galactosidase; survival in the face of inflammatory and autoimmune IL, interleukin; IFN, interferon; I␬B␣, inhibitor of NF-␬B; NF-␬B, nuclear insults (13,21). factor-␬B; NIK, NF-␬B-inducing kinase; PKD, protein kinase D; Th, T-helper; TLR, Toll-like receptor; TNF, tumor necrosis factor; TNF-R, TNF receptor; TRAF, TNF receptor–associated factor. RESEARCH DESIGN AND METHODS DOI: 10.2337/db06-0142 BALB/c and C57BL/6 mice were purchased from ARC (Perth, WA, Australia). © 2006 by the American Diabetes Association. NOD mice were purchased from The Walter and Eliza Hall Institute (Mel- The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance bourne, VIC, Australia). Procedures complied with the Australian Code of with 18 U.S.C. Section 1734 solely to indicate this fact. Practice for the Care and Use of Animals for Scientific Purposes.

DIABETES, VOL. 55, SEPTEMBER 2006 2491 CRITICAL ROLE FOR A20 IN ␤-CELL PROTECTION

Cell death assays. Assays were performed using a modified crystal violet ␤ ␤ method (23,24). Briefly, -insulinoma ( -TC3) cells were pretreated (30 min) with 0.01 ␮mol/l actinomycin D (Calbiochem, Kilsyth, Australia) before the addition of 100, 500, or 1000 units/ml of recombinant mouse tumor necrosis factor (TNF)-␣ (R&D Systems, Minneapolis, MN). Twenty-four hours later, cell death was determined as described (23). Cytokine stimulation. Human primary islets, provided by Prof. Phillip O’Connell (Westmead Hospital, Sydney, NSW, Australia), were isolated from cadaveric organ donors and cultured as described (25). Mouse islets were isolated and cultured as we have described (13,26). For cytokine stimulation, islets (150–200 islets/treatment) were stimulated with 200 units/ml of the appropriate cytokine for the indicated times. Human and mouse recombinant T-helper (Th) 1 cytokines interleukin (IL)-1␤, TNF-␣,or␥-interferon (IFN), ␤ and the Th2 cytokines IL-4, IL-13, or IL-15 (R&D Systems). -TC3 and Min6 cells were cultured as described (27). Cells were stimulated with 200 units/ml FIG. 1. ␤-Cells have an inducible antiapoptotic response. Survival of of mouse recombinant IL-1␤ or TNF-␣ for the indicated time points. In some ␤-TC cells treated with increasing concentrations of TNF-␣ with (f) ␮ 3 cases islets were first pretreated with 100 mol/l of the pharmacological or without (Ⅺ) Actinomycin D. Data represent mean ؎ SD percentage NF-␬B inhibitor, pyrrolidine dithiocarbamate (Sigma, St. Louis, MO) as survival from four independent experiments, performed in duplicate. described (28). Data with 500 and 1,000 units are significant (**P < 0.005). Gene expression in ␤-cells sorted with a fluorescence-activated cell sorter. For cell sorting, primary mouse islets were first stimulated with cytokines as above and then washed (4% EDTA-PBS), and dispersed into RESULTS single cells by a brief incubation with 0.05% trypsin-EDTA (Invitrogen). ␤-Cells have an inducible antiapoptotic response. Dispersed islets were then washed free of trypsin and resuspended in 1% Despite the importance of cell death in pathological ␤-cell BSA-PBS and sorted in a fluorescence-activated cell sorter (FACS) based upon autofluorescence (FL-1) as described (29). Sorted cells were then analyzed for loss, little is known about the genetic control of apoptosis A20 expression as described below. The percentage of insulin-positive ␤-cells in these cells. Cell death is a highly regulated event, in the FL-1Hi and FL-1Lo sorted populations was determined by insulin (mouse controlled in a proinflammatory setting by an inducible set anti-insulin; Zymed Laboratories, South San Francisco, CA) and glucagon of antiapoptotic genes rapidly upregulated in response to (rabbit anti-glucagon; ICN Immunologicals, Lisle, IL) specific labeling on this same inflammatory stress and/or injury (16–19). We cytospun cells. were particularly interested in determining whether Real-time PCR. mRNA was extracted as described (26); we obtained ϳ3–5 ␤ ␮g mRNA per 200 islets. cDNA was produced from 0.5 ␮g of RNA using the -cells could also generate a rapid and inducible antiapop- SuperScript III Reverse Transcriptase Kit (Invitrogen, Australia). Reactions totic response after exposure to inflammatory cytokines as were performed on the RG300 Real Time PCR System (Rotorgene), using has been described for other cell types (16–18). We first SYBR green chemistry (JumpStart, Sigma, Castle Hill, Australia). A20 primers ␤ ␣ tested this concept by stimulating -TC3 cells with TNF- were human (F: AAAGCCCTCATCGACAGAAA; R: CAGTTGCCAGCGGAA in the presence or absence of the general transcription TTTA) and mouse (F: TGGTTCCAATTTTGCTCCTT; R: CGTTGATCAGGTGA inhibitor, actinomycin D. Blockade of de novo gene tran- GTCGTG). Human and mouse samples were normalized with glyceraldehyde- scription in combination with TNF-␣ stimulation sensi- 3-phosphate dehydrogenase (F: CACATCAAGAAGGTGGTG; R: TGTCATACC ␤ AGGAAATGA) or CPH2, respectively (F: TGGACCAAACACAAACGGTTCC; R: tized -TC3 cells to cell death, whereas either treatment ACATTGCGAGCAGATGGGGTAG). Fold change was calculated following the alone had minimal effect upon cell survival (Fig. 1). Cell 2⌬⌬CT method. survival decreased from 100% in control cells to 53% when Microarray. Before hybridization, total RNA was amplified and labeled using cells were treated with 1000 units of TNF-␣ and actinomy- the MessageAmp II aRNA Amplification Kit (Ambion, Austin, TX). Amplified cinD(P Յ 0.005). These data demonstrate that blockade RNA quality was evaluated by capillary electrophoresis using an Agilent 2100 ␤ ␣ Bioanalyzer (Agilent Technologies, Palo Alto, CA). Samples were hybridized of de novo gene transcription sensitizes -cells to TNF- – on a custom-designed death-CHIP, a CustomArray 12K-Microarray platform induced cell death, consistent with the notion that TNF-␣ (CombiMatrix, Mukilteo, WA). Genes were selected for inclusion on the triggers a proapoptotic death cascade that can be pre- microarray based upon their reported role in the regulation of cell death vented by gene induction (16–18). Thus, ␤-cells do have a (Table 1). The microarray probe design and feature layout, hybridization and cytokine-dependent regulated antiapoptotic response as scanning protocol, data normalization, and quality control data will be has been demonstrated for other cell types. reported elsewhere (D. Liuwantara, S.T. Grey, unpublished data). All data were first normalized and background corrected, then log (base 2) trans- Islets exhibit a limited immediate early antiapoptotic formed. For each experiment, islets were isolated from 10 mice, pooled, and gene response. Having established that ␤-cells do have an treated with cytokines, and RNA was harvested as described. Each experi- inducible protective response, we next determined the ment was performed on three (NOD) or four (BALB/c) independent islet molecular basis of this response. We used a custom- preparations. All samples were run on duplicate arrays; 42 arrays were run in designed microarray (death-CHIP) to analyze the immedi- total. The mean coefficients of variation (CVs) based on replicate features on ate early antiapoptotic gene response of primary rodent the microarrays were Յ20%. ␤ islets. Antiapoptotic genes from all known and putative Transfection and reporter assay. Transfection of -TC3 cells, luciferase, and ␤-galactosidase (␤-gal) activity was performed as described (21). The A20 antiapoptotic gene families were included on the death- reporter constructs were a kind gift of Dr. R. Dikstein (The Weizmann CHIP (Table 1). cRNA was prepared from islets isolated Institute of Science, Rehovot, Israel) (30). The expression plasmids encoding from nondiabetic-prone BALB/c mice or diabetic-prone Fas-associated death domain (FADD), TNF receptor–associated factor NOD mice. For each islet preparation, islets were either (TRAF) 2, TRAF6, NF-␬B–inducing kinase (NIK), P65, and protein kinase D left untreated or stimulated with IL-1␤ or TNF-␣ for1h. (PKD) have been described (22,31,32). All data are expressed as relative light activity (21). These cytokines were chosen based on their established Islet transplantation. Islet transplantation into diabetic (blood glucose roles in inducing ␤-cell apoptosis both in vitro (21,33,34) Ն300 mg/dl) recipients was performed essentially as described (13). Islets and in vivo (35–37). (isolated from three donor mice per recipient) from BALB/c mice were Of the 63 antiapoptotic genes represented on the death- transplanted either into diabetic BALB/c recipients (syngeneic model) or into CHIP, we found that islets constitutively expressed a diabetic C57BL/6 mice (allogeneic model). To harvest the transplanted islets, broad selection of antiapoptotic genes over a range of nephrectomy was performed on postoperative day 5. The islet graft was collected by carefully peeling off the kidney capsule; mRNA was then isolated expression levels (Table 1). To confirm the findings of the as described above. In some cases the graft was prepared for histological death-CHIP, the basal expression of selected genes (Table assessment as described (13). 1) was established by Western blot and/or PCR analysis in

2492 DIABETES, VOL. 55, SEPTEMBER 2006 D. LIUWANTARA AND ASSOCIATES

TABLE 1 Analysis of inducible antiapoptotic genes expressed in islets from BALB/c or NOD mice Basal Fold ⌬ Fold ⌬ Gene GenBank expres- IL-1/ TNF/ symbol Gene title ID sion media P value media P value BALB/c Aatf Apoptosis antagonizing transcription factor NM_019816 1,356.2 0.792 0.076 0.774 0.099 Aven Apoptosis caspase activation inhibitor NM_028844 173.1 1.004 0.988 1.100 0.758 Birc1a Baculoviral IAP repeat-containing 1a NM_008670 492.9 0.873 0.612 0.916 0.771 Birc1b Baculoviral IAP repeat-containing 1b NM_010872 1,094.9 0.836 0.242 0.854 0.170 Birc1e Baculoviral IAP repeat-containing 1e NM_010870 358.3 0.804 0.387 0.871 0.579 Birc1f Baculoviral IAP repeat-containing 1f NM_010871 904.1 0.963 0.842 1.038 0.839 Birc2 Baculoviral IAP repeat-containing 2* NM_007465 1,069.4 1.045 0.635 1.166 0.122 Birc3 Baculoviral IAP repeat-containing 3* NM_007464 422.2 2.86 0.00004550 2.252 0.00030850 Birc4 Baculoviral IAP repeat-containing 4* NM_009688 490.2 0.851 0.497 0.810 0.375 Birc5 Baculoviral IAP repeat-containing 5 NM_009689 1,462.4 1.076 0.710 1.067 0.757 Birc6 Baculoviral IAP repeat-containing 6 NM_007566 715.6 1.086 0.755 1.205 0.593 Bcl2 B-cell leukemia/lymphoma 2* NM_009741 145.5 0.854 0.358 0.872 0.312 Bcl2a1a B-cell leukemia/lymphoma 2 related protein A1a* NM_009742 297.4 1.259 0.230 1.171 0.405 Bcl2a1c B-cell leukemia/lymphoma 2 related protein A1c NM_007535 421.3 1.5 0.061 1.517 0.058 Bcl2a1d B-cell leukemia/lymphoma 2 related protein A1d NM_007536 269.3 1.201 0.385 1.112 0.597 Bcl3 B-cell leukemia/lymphoma 3 NM_033601 1,067.2 1.249 0.137 1.441 0.042 Bag4 BCL2-associated athanogene 4 NM_026121 242.7 0.681 0.017 0.883 0.425 Bcl2l Bcl2-like* NM_009743 347.5 0.888 0.500 0.917 0.454 Bcl2l10 Bcl2-like 10 NM_013479 1,548.8 0.883 0.514 0.975 0.865 Bcl2l2 Bcl2-like 2 NM_007537 1,140.7 0.827 0.215 0.903 0.632 Bfar Bifunctional apoptosis regulator NM_025976 1,554.3 0.946 0.747 0.965 0.811 Dad1 Defender against cell death 1 NM_010015 8,589.7 0.814 0.073 0.889 0.454 Gpx1 Glutathione peroxidase 1 NM_008160 3,801.6 1.297 0.334 1.431 0.237 Gpx2 Glutathione peroxidase 2 NM_030677 2,112.7 0.962 0.794 0.850 0.198 Gpx4 Glutathione peroxidase 4 NM_008162 4,202.2 1.022 0.915 1.087 0.735 Gpx5 Glutathione peroxidase 5 NM_010343 3,446.1 0.989 0.924 0.939 0.702 Hras1 Harvey rat sarcoma virus oncogene 1 NM_008284 2,061 0.861 0.155 0.920 0.418 Hspa5 Heat shock 70 kD protein 5 (glucose-regulated protein)* NM_022310 10,768.6 1.07 0.789 1.183 0.586 Hspe1 Heat shock protein 1 (chaperonin 10) NM_008303 3,781.1 0.985 0.950 1.195 0.537 Hspd1 Heat shock protein 1 (chaperonin) NM_010477 3,407.4 0.975 0.860 1.127 0.449 Hspca Heat shock protein 1 ␣ NM_010480 8,052.7 1.102 0.706 1.357 0.268 Hspcb Heat shock protein 1 ␤ NM_008302 12,568.9 0.887 0.429 1.144 0.416 Hsp105 Heat shock protein 105 NM_013559 2,763.3 1.005 0.985 1.499 0.147 Hspa12b Heat shock protein 12B NM_028306 360.4 1.023 0.897 0.976 0.896 Hspa1a Heat shock protein 1A AW763765 228.4 1.338 0.663 1.942 0.271 Hspa1b Heat shock protein 1B M12573 3,598.2 1.139 0.741 1.506 0.238 Hspa1l Heat shock protein 1-like NM_013558 437.9 0.835 0.286 0.806 0.235 Hspa2 Heat shock protein 2 NM_008301 327.2 1.028 0.897 0.986 0.958 Hspb3 Heat shock protein 3 NM_019960 516.5 0.97 0.894 0.870 0.408 Hspa4 Heat shock protein 4 NM_008300 2,515.1 1.005 0.978 1.161 0.437 Hspa8 Heat shock protein 8 NM_031165 9,024.8 1.233 0.416 1.456 0.199 Hspb7 Heat shock protein family member 7 (cardiovascular) NM_013868 1,878.8 0.656 0.169 0.713 0.217 Hebp2 Heme binding protein 2 NM_019487 2,216.5 0.784 0.068 0.710 0.052 Hmox1 Heme oxygenase (decycling) 1* NM_010442 5,708.6 0.904 0.317 0.891 0.234 Hmox2 Heme oxygenase (decycling) 2 NM_010443 1,657.5 0.939 0.682 1.034 0.866 Hnf4 Hepatic nuclear factor 4 NM_008261 895.2 0.933 0.581 1.037 0.753 Sod1 Superoxide dismutase 1 soluble* BM240246 228.6 1.132 0.690 1.536 0.169 Sod1 Superoxide dismutase 1 soluble BC002066 15,483.3 0.942 0.712 0.971 0.911 Sod2 Superoxide dismutase 2 mitochondrial* NM_013671 4,534.3 1.305 0.175 1.195 0.461 Sod3 Superoxide dismutase 3 extracellular NM_011435 5,812.8 0.729 0.147 0.616 0.088 Txn1 Thioredoxin 1 NM_011660 5,806 0.925 0.544 1.064 0.623 Txn2 Thioredoxin 2 NM_019913 1,676 0.901 0.208 0.999 0.992 Txndc1 Thioredoxin domain containing 1 NM_028339 2,152.5 0.878 0.401 1.000 0.999 Txndc5 Thioredoxin domain containing 5 NM_145367 2,078.1 0.971 0.836 1.017 0.924 Txnip Thioredoxin interacting protein NM_023719 1,257.5 1.293 0.397 1.513 0.240 Txnrd1 Thioredoxin reductase 1 NM_015762 2,784.4 0.939 0.714 0.963 0.851 Continued on following page DIABETES, VOL. 55, SEPTEMBER 2006 2493 CRITICAL ROLE FOR A20 IN ␤-CELL PROTECTION

TABLE 1 Continued Basal Fold ⌬ Fold ⌬ Gene GenBank expres- IL-1/ TNF/ symbol Gene title ID sion media P value media P value Txnrd2 Thioredoxin reductase 2 NM_013711 633.6 0.827 0.416 0.858 0.472 Txnrd3 Thioredoxin reductase 3 NM_153162 148.4 0.988 0.944 1.106 0.571 Txnl Thioredoxin-like NM_016792 304 0.765 0.071 0.813 0.051 Txnl2 Thioredoxin-like 2 NM_023140 2,667.9 1.001 0.996 1.161 0.483 Tnfaip6 Tumor necrosis factor ␣–induced protein 6 NM_009398 121.4 1.305 0.433 1.179 0.632 Tnfaip1 Tumor necrosis factor ␣–induced protein 1 NM_009395 3,090.2 0.934 0.568 1.058 0.534 Tnfaip2 Tumor necrosis factor ␣–induced protein 2 NM_009396 590 1.14 0.416 0.905 0.590 Tnfaip3 Tumor necrosis factor ␣–induced protein 3* NM_009397 117.6 10.612 0.0000052 5.917 0.00014460 NOD Aatf Apoptosis antagonizing transcription factor NM_019816 1,130.10 0.842 0.199 0.985 0.914 Aven Apoptosis caspase activation inhibitor NM_028844 145.30 1.364 0.431 1.304 0.493 Birc1a Baculoviral IAP repeat-containing 1a NM_008670 375.80 0.643 0.365 0.789 0.628 Birc1b Baculoviral IAP repeat-containing 1b NM_010872 1,020.50 0.813 0.437 0.875 0.593 Birc1e Baculoviral IAP repeat-containing 1e NM_010870 314.00 0.696 0.075 0.936 0.678 Birc1f Baculoviral IAP repeat-containing 1f NM_010871 933.10 0.666 0.094 0.841 0.350 Birc2 Baculoviral IAP repeat-containing 2* NM_007465 1,067.40 1.263 0.024 1.255 0.004 Birc3 Baculoviral IAP repeat-containing 3* NM_007464 429.90 3.742 0.013 2.695 0.039 Birc4 Baculoviral IAP repeat-containing 4* NM_009688 350.20 0.692 0.103 0.795 0.201 Birc5 Baculoviral IAP repeat-containing 5 NM_009689 1,555.30 0.736 0.176 0.987 0.947 Birc6 Baculoviral IAP repeat-containing 6 NM_007566 945.70 1.427 0.381 1.344 0.447 Bcl2 B-cell leukemia/lymphoma 2* NM_009741 183.00 0.889 0.304 1.052 0.647 Bcl2a1a B-cell leukemia/lymphoma 2–related protein A1a* NM_009742 519.60 1.639 0.488 1.323 0.720 Bcl2a1c B-cell leukemia/lymphoma 2–related protein A1c NM_007535 689.80 1.733 0.172 1.416 0.436 Bcl2a1d B-cell leukemia/lymphoma 2–related protein A1d NM_007536 450.60 1.703 0.495 1.340 0.731 Bcl3 B-cell leukemia/lymphoma 3 NM_033601 933.90 1.548 0.152 1.479 0.215 Bag4 BCL2-associated athanogene 4 NM_026121 238.50 0.844 0.187 0.992 0.931 Bcl2l Bcl2-like* NM_009743 334.90 0.951 0.788 0.901 0.606 Bcl2l10 Bcl2-like 10 NM_013479 1,782.80 0.624 0.139 0.777 0.408 Bcl2l2 Bcl2-like 2 NM_007537 1,340.40 0.938 0.741 1.038 0.838 Bfar Bifunctional apoptosis regulator NM_025976 1,541.90 0.708 0.076 0.844 0.304 Dad1 Defender against cell death 1 NM_010015 12,015.20 0.947 0.417 0.993 0.926 Gpx1 Glutathione peroxidase 1 NM_008160 2,953.10 1.586 0.066 1.631 0.053 Gpx2 Glutathione peroxidase 2 NM_030677 2,011.40 0.702 0.076 0.829 0.191 Gpx4 Glutathione peroxidase 4 NM_008162 4,327.80 1.171 0.657 1.295 0.477 Gpx5 Glutathione peroxidase 5 NM_010343 4,482.00 0.573 0.042 0.799 0.314 Hras1 Harvey rat sarcoma virus oncogene 1 NM_008284 2,310.70 0.781 0.067 0.912 0.400 Hspa5 Heat shock 70 kD protein 5 (glucose-regulated protein)* NM_022310 11,382.50 1.443 0.578 1.242 0.737 Hspe1 Heat shock protein 1 (chaperonin 10) NM_008303 3,376.70 1.395 0.504 1.473 0.441 Hspd1 Heat shock protein 1 (chaperonin) NM_010477 2,855.00 1.099 0.470 1.241 0.198 Hspca Heat shock protein 1 ␣ NM_010480 7,447.90 1.495 0.187 1.377 0.284 Hspcb Heat shock protein 1 ␤ NM_008302 11,423.10 1.070 0.454 1.070 0.404 Hsp105 Heat shock protein 105 NM_013559 2,676.50 1.242 0.287 1.155 0.460 Hspa12b Heat shock protein 12B NM_028306 370.90 0.817 0.188 0.903 0.470 Hspa1a Heat shock protein 1A AW763765 329.20 1.308 0.643 1.172 0.785 Hspa1b Heat shock protein 1B M12573 3,062.50 0.938 0.880 1.019 0.957 Hspa1l Heat shock protein 1-like NM_013558 442.30 0.680 0.047 0.794 0.075 Hspa2 Heat shock protein 2 NM_008301 355.40 1.391 0.227 1.443 0.170 Hspb3 Heat shock protein 3 NM_019960 466.30 0.652 0.111 0.758 0.131 Hspa4 Heat shock protein 4 NM_008300 2,247.70 1.302 0.315 1.361 0.241 Hspa8 Heat shock protein 8 NM_031165 9,660.00 1.486 0.284 1.479 0.297 Hspb7 Heat shock protein family member 7 (cardiovascular) NM_013868 1,487.30 0.663 0.461 0.786 0.647 Hebp2 Heme binding protein 2 NM_019487 2,048.90 0.745 0.259 0.818 0.428 Hmox1 Heme oxygenase (decycling) 1* NM_010442 5,759.00 0.799 0.359 0.894 0.609 Hmox2 Heme oxygenase (decycling) 2 NM_010443 1,226.50 1.174 0.486 1.267 0.304 Hnf4 Hepatic nuclear factor 4 NM_008261 687.50 1.146 0.611 1.220 0.467 Sod1 Superoxide dismutase 1 soluble BM240246 277.20 0.630 0.104 0.757 0.177 Sod1 Superoxide dismutase 1 soluble BC002066 19,857.70 1.082 0.319 1.149 0.071 Continued on following page 2494 DIABETES, VOL. 55, SEPTEMBER 2006 D. LIUWANTARA AND ASSOCIATES

TABLE 1 Continued Basal Fold ⌬ Fold ⌬ Gene GenBank expres- IL-1/ TNF/ symbol Gene title ID sion media P value media P value Sod2 Superoxide dismutase 2 mitochondrial* NM_013671 5,852.10 1.200 0.290 1.052 0.802 Sod3 Superoxide dismutase 3 extracellular NM_011435 4,550.40 0.677 0.011 0.712 0.031 Txn1 Thioredoxin 1 NM_011660 6,255.90 1.102 0.389 1.164 0.113 Txn2 Thioredoxin 2 NM_019913 1,779.30 0.957 0.731 1.015 0.911 Txndc1 Thioredoxin domain containing 1 NM_028339 2,646.10 1.093 0.564 1.134 0.429 Txndc5 Thioredoxin domain containing 5 NM_145367 1,720.00 1.154 0.353 1.267 0.120 Txnip Thioredoxin interacting protein NM_023719 928.30 2.014 0.005 1.395 0.156 Txnrd1 Thioredoxin reductase 1 NM_015762 1,685.20 1.550 0.234 1.538 0.239 Txnrd2 Thioredoxin reductase 2 NM_013711 601.00 0.641 0.158 0.764 0.342 Txnrd3 Thioredoxin reductase 3 NM_153162 116.60 1.175 0.258 1.374 0.093 Txnl Thioredoxin-like NM_016792 327.60 1.005 0.970 1.019 0.900 Txnl2 Thioredoxin-like 2 NM_023140 2,450.00 1.320 0.438 1.299 0.451 Tnfaip6 Tumor necrosis factor ␣–induced protein 6 NM_009398 142.00 1.259 0.590 1.151 0.716 Tnfaip1 Tumor necrosis factor ␣–induced protein 1 NM_009395 3,049.80 1.071 0.625 1.067 0.630 Tnfaip2 Tumor necrosis factor ␣–induced protein 2 NM_009396 561.50 1.048 0.925 0.928 0.878 Tnfaip3 Tumor necrosis factor ␣–induced protein 3* NM_009397 248.70 8.884 0.019 3.610 0.115 *Genes validated by PCR and/or Western blot. primary human and rodent islets and ␤-insulinoma cell NF-␬B family members by IL-1␤ versus TNF-␣, respec- lines (data not shown). Of the genes confirmed to be tively, which can then lead to distinct patterns of gene expressed in all three tissue samples, highly expressed expression (41). The poor induction of A20 by TNF-␣ is genes (Ն10,000 mean intensity units) including heat shock interesting, given the fact that TNF-␣ is one of the earliest protein 70, HSPA1A/HSP70, and SOD1/CuZnSOD; moder- ␤-cell–toxic cytokines detected in the islet infiltrate during ately expressed genes (1–10,000 mean intensity units) the development of type 1 diabetes in NOD mice (36). including Heme oxygenase 1 and SOD2/MnSOD; and genes However, Fig. 3B shows that there was no difference in including the cellular inhibitors of apoptosis, BIRC2/c- A20 expression between the male and female NOD mice, IAP1, BIRC3/c-IAP2, BIRC4/XIAP, and the BCL family demonstrating that the lower disease incidence in the male genes BCL2, BCL2L1/BCLXL, BCL2A1A/Bfl-1/A1, and NOD mice is not associated with A20 expression. TNFAIP3/A20 were expressed at relatively low constitu- Regulation of A20 in human islets. We next examined Յ tive basal levels ( 1,000 mean intensity units). In contrast, A20 regulation in primary human islets. As shown in Fig. examination of the expression profile after cytokine stim- 3C, A20 mRNA expression was rapidly induced after IL-1␤ ulation indicated that islets have a relatively sparse imme- stimulation, reaching a maximal ϳ25-fold induction at 1 h diate early antiapoptotic gene response (Fig. 2A and B). after stimulation and decreasing thereafter. Again IL-1␤ Establishing a twofold cutoff for statistical significance, was a more potent inducer of A20 expression than TNF-␣. only two genes were determined to be upregulated, In contrast with IL-1␤ and TNF-␣, other Th1-type cyto- namely, TNFAIP3/A20 and BIRC3/c-IAP-2, of which A20 kines such as ␥-IFN and IL-15 and the Th2-type cytokines was consistently the most highly regulated antiapoptotic IL-4 and IL-13 did not induce A20 expression in human or gene (Fig. 2C). These data contrast islets with other rodent islets (data not shown). Together, these data dem- tissues such as endothelial cells, which express a broad onstrate that A20 is an immediate early response gene in range of antiapoptotic genes under similar conditions (19,38,39). both human and rodent islets, preferentially regulated by the Th1-type cytokines, IL-1␤ and TNF-␣. Regulation of A20 in rodent islets. As A20 was the most ␤ highly regulated immediate early antiapoptotic gene in -Cell–specific expression of A20 in islets. Islets of Langerhans are a heterogeneous tissue comprising not islets, we focused on its regulation in more detail. Primary ␤ islets isolated from BALB/c or NOD mice were stimulated only insulin-secreting -cells but also additional hormone- ␣ ␥ ␤ with the cytokines IL-1␤ or TNF-␣ for 1–8 h, and steady- secreting cells including - and -cells. -Cells from state mRNA expression was analyzed by PCR. As shown in freshly isolated islets are autofluorescent due to intracel- Fig. 3A, A20 was expression was markedly upregulated by lular flavin adenine dinucleotide levels and can be FACS- ϳ23-fold (P Յ 0.005) and ϳ16-fold (P Յ 0.001) in BALB/c purified on this basis (29). To determine the cellular and NOD islets, respectively, within 1 h after IL-1␤ stimu- source of A20 expression in intact primary islets, we next lation. Kinetic analysis of A20 expression revealed that examined A20 expression in FACS-purified primary ␤-cells although the expression declined thereafter, it was still and non–␤-cells (Fig. 4A). We found that inducible A20 maintained at significant levels. Thus, A20 is a cytokine- expression was restricted to insulin-positive ␤-cells (ap- inducible immediate early response gene in islets, consis- proximately threefold induction P Յ 0.05) as A20 expres- tent with its regulation in other cell types (40). In sion was not induced by IL-1␤ in glucagon-positive cells comparison with IL-1␤, TNF-␣ was a relatively poor in- (Fig. 4B). We also examined inducible A20 expression in ducer of A20 expression, stimulating only an approxi- the insulinoma cell line, Min6. Stimulation of Min6 cells mately fourfold increase in A20 mRNA expression at 1 h with IL-1␤ or TNF-␣ resulted in a rapid and marked for islets isolated from either BALB/c or NOD mice (P Յ induction of A20, with kinetics similar to that seen for 0.05). This finding may relate to differential activation of primary human and rodent islets (Fig. 4C). Thus, these

DIABETES, VOL. 55, SEPTEMBER 2006 2495 CRITICAL ROLE FOR A20 IN ␤-CELL PROTECTION

FIG. 2 data demonstrate ␤-cell–specific regulation of A20 expres- with IL-1␤ or TNF-␣. As shown in Fig. 5C, IL-1␤ and TNF-␣ sion within pancreatic islets. induced approximately fourfold (P Յ 0.001) and approxi- Cytokine-dependent regulation of A20 requires de mately twofold (P Յ 0.01) increases in luciferase activity, novo gene transcription. We next began to address the respectively. Together these data demonstrate that A20 is mechanism(s) by which A20 was regulated in islets. Pri- regulated at the level of gene transcription in ␤-cells, and mary rodent islets were pretreated with actinomycin D to prevention of A20 expression by inhibition of gene tran- block de novo gene transcription and then stimulated with scription correlated with sensitization to TNF-␣–induced IL-1␤ for 1 h. Analysis of A20 steady-state mRNA revealed apoptosis. that induction of A20 was completely abolished (Ͼ90%, NF-␬B is both necessary and sufficient to initiate P Յ 0.001) by actinomycin D treatment, indicating that in transcriptional activation of the A20 promoter. A20 islets, cytokine-dependent induction of A20 is regulated at has been described previously to be an NF-␬B target gene the level of de novo gene transcription (Fig. 5A). To and contains two NF-␬B binding sequences in its promoter confirm that A20 was regulated at the level of transcrip- region (42). To determine whether or not the induction of ␤ ␤ ␬ tion, -TC3 cells were transfected with an A20 promoter A20 transcription in -cells is NF- B dependent, we trans- ␤ sequence upstream of a luciferase reporter and stimulated fected -TC3 cells with an A20 promoter construct in

2496 DIABETES, VOL. 55, SEPTEMBER 2006 D. LIUWANTARA AND ASSOCIATES

FIG. 2. Islets have a limited antiapoptotic response. A: Hierarchical cluster analysis

of 63 antiapoptotic genes. Each column represents change in gene expression (log2) from an individual array experiment. Red, upregulation; green, downregulation. B: Top 10 most highly expressed antiapoptotic genes. Data represent mean ؎ SD

average fold change (log2 ratios) from at least three independent experiments. C: Fold changes in gene expression for A20 and Birc3; each column represents an individual array. Only A20 and Birc3 were significant (P < 0.001). which the two NF-␬B binding sites were deleted (⌬NF-␬B) A20 transcription is regulated by multiple NF-␬B (Fig. 5B) and examined its activation in response to either signaling pathways. NF-␬B constitutes a family of tran- IL-1␤ or TNF-␣. As shown in Fig. 5C, compared with the scription factors that together act as major integrators of wild-type promoter, both the cytokine-dependent and con- the cellular inflammatory response (39,43). Activation of stitutive A20 promoter activities were completely abro- discrete NF-␬B pathways through the Toll-like receptors gated (P Յ 0.001) in the NF-␬B–deleted reporter. (TLRs) or TNR receptors (TNF-Rs) or via free radicals We next utilized an alternative approach to confirm the results in the induction of a distinct sets of genes importance of NF-␬B in the regulation of de novo tran- (39,41,44). To determine the important NF-␬B pathways scription of the A20 promoter. We achieved this by over- regulating A20 expression in ␤-cells, we utilized a transient ␬ ␤ ␤ expressing the p65/RelA subunit of NF- B (39) in -TC3 transfection approach, cotransfecting -TC3 cells with the cells and examined whether this change would result in A20 reporter and specific kinases or adapter proteins, induction of the A20 promoter. As shown in Fig. 6B, forced known to activate distinct NF-␬B signaling pathways. expression of p65/RelA resulted in a marked dose-depen- TRAF6 is an adaptor protein required for NF-␬B signaling dent activation of the A20 promoter, showing an ϳ19-fold through the TLR family, whereas TRAF2 mediates NF-␬B increase (P Յ 0.001) at the highest concentration tested. signaling through the TNF-R family. As shown in Fig. 7A Importantly, forced expression of p65/RelA also resulted and B, forced expression of either TRAF6 or TRAF2 dose in a fivefold induction (P Յ 0.005) in endogenous A20 dependently activated the A20 promoter with ϳ9-fold (P Յ mRNA levels, indicating that NF-␬B was sufficient to drive 0.001) and ϳ6.5-fold (P Յ 0.001) increases in reporter the endogenous A20 promoter (Fig. 6A). Finally, inhibition activity at the highest concentrations used, respectively. of NF-kB activity using the chemical inhibitor, pyrrolidine Thus, we demonstrate that A20 is a downstream target dithiocarbamate (28), abolished IL-1␤–stimulated A20 gene of the canonical NF-␬B pathway, activated via liga- mRNA (Ͼ90%, P Յ 0.01) expression in islets (Fig. 6C.) tion of TLR and TNF-R families. These data are consistent Together these data demonstrate that NF-␬B is both with our experiments demonstrating that increased A20 necessary and sufficient to initiate transcriptional activa- expression in IL-1␤– (TLR-activating) and TNF-␣– (TNF- tion of the A20 promoter and drive expression of A20 R–activating) stimulated ␤-cells. mRNA. These data are consistent with our finding that A20 We next addressed whether A20 would be regulated in is regulated by the NF-␬B–activating cytokines IL-1␤ and response to the noncanonical and free radical–dependent TNF-␣, but not cytokines such as ␥-IFN, IL-4, IL-13, and pathways. NIK is critical for mediating signaling through IL-15, which do not activate NF-␬B. the noncanonical TNF-R pathway (39), whereas free rad-

DIABETES, VOL. 55, SEPTEMBER 2006 2497 CRITICAL ROLE FOR A20 IN ␤-CELL PROTECTION

Forced expression of NIK resulted in an ϳ3.6-fold (P Յ 0.005) activation of the A20 promoter, whereas PKD induced a more modest ϳ2.6-fold (P Յ 0.001) induction of reporter activity. These data demonstrate that A20 tran- scription can be induced by TNF-Rs that activate the noncanonical pathway and by free radicals. Together our data identify A20 as a major NF-␬B target gene regulated by diverse NF-␬B signaling pathways. Expression of A20 in stressed islets in vivo. Trans- planted islets are exposed to a hyperglycemic environ- ment, nonspecific inflammatory reactions (i.e., including cytokines and free radicals), and immune-mediated rejec- tion as well as stresses relating to hypoxia and lack of adequate nutrients (10,11). Many of these factors are able to induce NF-␬B. Having identified A20 as a major NF-␬B– regulated gene in ␤-cells, we hypothesized that A20 ex- pression should be heavily regulated in islets in vivo after exposure to inflammatory stress. To assess this directly, we examined A20 expression levels in islets after trans- plantation into either diabetic syngeneic or diabetic allo- geneic hosts. As shown in Fig. 8, already at day 5 after transplantation, there were significant approximately threefold (P Յ 0.05) and approximately fourfold (P Յ 0.05) increases in A20 steady-state mRNA expression in islets transplanted into either syngeneic or allogeneic recipients, respectively. These data demonstrate that transplanted islets FIG. 3. A20 is an immediate early response gene in ␤-cells. A: A20 do have a regulated antiapoptotic stress response and that expression in BALB/c or NOD islets treated with IL-1␤ or TNF-␣. Data .represents means ؎ SD from three independent experiments. B: A20 A20 is a critical component of this stress response in vivo expression in male or female NOD islets stimulated with IL-1␤ or A20 is sufficient to protect ␤-cells from TNF-␣– TNF-␣ for 1 h. Data represents means ؎ SD from three independent induced cell death. We demonstrated that blocking de experiments. C: A20 expression in primary human islets treated with ␤ IL-1␤ or TNF-␣. Data represent means ؎ SD from four independent novo gene transcription sensitizes -cells to apoptosis and experiments. All differences are significant (P < 0.05). prevents A20 upregulation, indicating that loss of A20 expression may be partly responsible for the sensitization icals activate NF-␬B through a PKD-dependent signaling to TNF-␣–induced apoptosis. To determine the impor- pathway (44). To determine whether A20 is a target gene tance of A20 in regulating ␤-cell apoptosis, we next asked ␤ ␤ of these pathways, we cotransfected -TC3 cells with the whether A20 expression was sufficient to protect -cells A20 promoter and either NIK or PKD (Fig. 7C and D). from TNF-␣–induced apoptosis.

FIG. 4. A20 is expressed in insulin-producing ␤-cells. A: A20 expression in FACS-sorted primary ␤-cells. Primary islets were stimulated with IL-1␤ for 1 h, dispersed into single cells, and FACS-sorted based on autofluorescence into FL-1Hi (insulin-positive and glucagon-negative) and FL-1Lo (insulin-negative and glucagon-positive) cells. B: A20 expression was induced by IL-1␤ in FL-1Hi cells (*P < 0.05) but not in FL-1Lo cells. RT, real-time; CTL, control. C: A20 expression in Min6 cells following IL-1␤ or TNF-␣ stimulation. Data represents means ؎ SD from four independent experiments. All differences were significant (P < 0.05).

2498 DIABETES, VOL. 55, SEPTEMBER 2006 D. LIUWANTARA AND ASSOCIATES

FIG. 6. NF-␬B is necessary and sufficient to drive de novo A20 ␤ expression. A: Induction of the A20 reporter in -TC3 by p65/RelA. Data represent means ؎ SD from a representative experiment of three independent experiments. B: Induction of endogenous A20 mRNA in ؎ ␤ -TC3 by p65/RelA. Data represent means SD from a representative experiment of three independent experiments conducted. C: A20 expression in BALB/c islets treated with IL-1␤ for 1 h with or without pyrrolidine dithiocarbamate. Data represent means ؎ SD of three independent experiments. All differences are significant (*P < 0.05; **P < 0.01; ***P < 0.001). RLA, relative light activity; PDTC, pyrroli- FIG. 5. A20 is regulated at the level of transcription by NF-␬B. A: A20 dine dithiocarbamate. expression in BALB/c islets treated with IL-1␤ for 1 h with or without actinomycin D (AcD). Data represent means ؎ SD from two indepen- transiently cotransfected with a cytomegalovirus-driven dent experiments. B: A20 promoter sequence indicating deleted NF-␬B ␤ binding sites used for reporter studies. C: Induction of the native or -gal reporter, which was used to determine the percent- ؎ ␣ ␤ ␤ ␬ ⌬ NF- B A20 reporter in -TC3 by IL-1 or TNF- . Data are means SD age of viable cells for each group (22). As shown in Fig. 9, from a representative experiment of three independent experiments. forced expression of FADD resulted in the rapid destruc- All differences are significant (**P < 0.001). ␤ ␤ tion of -TC3 cells as evidenced by the decrease in -gal reporter activity (ϳ60%, P Յ 0.005) compared with base- Activation of the TNF receptor by its cognate ligand line levels observed in control groups (e.g., pcDNA3 or results in the recruitment of FADD, which subsequently FADD-DN), whereas expression of FADD-DN had little recruits and activates procaspase 8/FLICE, triggering ap- effect upon cell viability (P ϭ 0.132). In contrast, A20 ␤ optosis (1,39). For this experiment, -TC3 cells were expressing cells were completely protected from the pro- transiently cotransfected with a FADD expression vector apoptotic effect of FADD (P Յ 0.05). These data demon- to induce apoptosis in the presence or absence of an A20 strate for the first time that A20 is sufficient to protect expression plasmid. Controls cells were transfected with a ␤-cells from TNF-␣–induced apoptosis; thus, loss of A20 vector expressing a FADD dominant negative inhibitor expression by transcriptional blockade sensitizes ␤-cells (FADD-DN) or the empty vector pcDNA3. All groups were to apoptotic cell death.

DISCUSSION Apoptotic ␤-cell death is an important pathological mech- anism of ␤-cell loss in type 1 diabetes and islet graft rejection (5,6). Apoptosis is a highly regulated process, such that the decision to undergo apoptosis is dependent upon the balance between antiapoptotic and proapoptotic signals (19). In an inflammatory setting, cells are required to express a new or inducible set of antiapoptotic genes as a mechanism to counteract the physiological stresses that otherwise lead to cellular damage and apoptosis (19,39). Blockade of this regulated antiapoptotic response sensi- tizes many cell types to apoptotic death, underscoring the

FIG. 7. A20 expression is NF-␬B dependent in ␤-cells. Induction of the ␤ A20 reporter in -TC3 by (A) TRAF6, (B) TRAF2, (C) NIK, and (D) FIG. 8. A20 is upregulated in islets in vivo. Islet A20 expression at -PKD. Data represent means ؎ SD from one representative experiment postoperative day 5. Data represent means ؎ SD from three indepen of four to six independent experiments conducted. All differences are dent experiments. All differences are significant (*P < 0.05). Non Tx, significant (*P < 0.05; **P < 0.001). RLA, relative light activity. nontransplanted; Syn, syngeneic; Allo, allogeneic.

DIABETES, VOL. 55, SEPTEMBER 2006 2499 CRITICAL ROLE FOR A20 IN ␤-CELL PROTECTION

FLIP, Bfl-1/A1 (39), and A20 (20,42). In cells that lack the NF-␬B family member p65/RelA, exposure to TNF-␣ will induce apoptosis (16). Furthermore, blockade of NF-␬B activation, by nonspecifically inhibiting transcription with actinomycin D (52) or specifically via the use of an I␬B␣ super-repressor (17,18), also sensitizes cells to TNF-␣– mediated apoptosis. Importantly blockade of NF-␬Bin ␤-cells by means of an I␬B␣ super-repressor (53) or via actinomycin D as we demonstrate here, also sensitizes cells to TNF-␣–dependent apoptotic death. We propose that this sensitization was due to blockade of NF-␬B activation and, at least in part, the subsequent loss of A20 expression. Consistent with this, prevention of A20 induc- tion in vitro sensitizes endothelial cells to TNF-dependent apoptosis (20). Thus in ␤-cells, as has been demonstrated for other cell types, NF-␬B activation governs both proin- flammatory responses and protection from apoptosis (39). FIG. 9. A20 rescues ␤-cells from FADD-induced cell death. Cell survival ␤ Therefore, targeting NF-␬B activation in an in vivo setting in -TC3 cells expressing pcDNA3, FADD-DN, FADD, or FADD plus A20. Data represent mean ؎ SD percentage survival from four inde- in which multiple factors are at play may sensitize ␤-cells pendent experiments. Differences between FADD and FADD plus A20 < to apoptosis (53). In light of this, we propose that more are significant (**P 0.05). RLA, relative light activity. sophisticated approaches than mere blanket blockade of NF-␬B are warranted if one aims to prevent the unwanted physiological relevance of this signaling network in cell proinflammatory effects of NF-␬B activation without in- biology (16–18). curring the associated risk of sensitizing ␤-cells to apopto- In this present study we demonstrate that this paradigm tic death. Alternative strategies might include expressing is true for ␤-cells, as ␤-cells were sensitized to TNF-␣– genes such as A20 (13,20) or targeting specific upstream induced death by inhibition of de novo gene transcription. regulators of NF-␬B activation (54). Our microarray-based approach revealed that TNFAIP3/ In conclusion, we demonstrate that primary islets up- A20 is one potential candidate gene providing a molecular regulated a relatively small set of antiapoptotic genes in basis for this protective response. A20 is a zinc finger– response to inflammatory stress, of which TNFAIP3/A20 containing, immediate early-response gene with a potent was the most highly regulated. Here we demonstrate that antiapoptotic and anti-inflammatory function (20,40,45). A20 is regulated at the level of gene transcription in This essential antiapoptotic and anti-inflammatory func- pancreatic ␤-cells, under the control of the transcription tion of A20 is preserved in islets (13,21). Once expressed, factor NF-␬B; thus, tightly linking islet proinflammatory A20 binds to and targets TNF receptor interacting protein gene responses with protection from apoptosis. Together for proteosomal degradation, thereby preventing TNF-␣– with our previous studies demonstrating an anti-inflamma- induced NF-␬B activation (46). The antiapoptotic mecha- tory and antiapoptotic function for A20 in islets (13,21), nism of A20 is less well understood but may also involve these present data indicate that A20 is a critical compo- inhibition of key proximal signaling events, as A20 inhibits nent of the islet-regulated response to inflammatory stress activation of initiator caspases after death receptor liga- and injury. Thus, pathologic loss of A20 expression may tion (22), consistent with our data demonstrating that A20 render ␤-cells susceptible to apoptotic death; conversely, protects ␤-cells from FADD-induced apoptosis. enhancing A20 expression in ␤-cells may improve their The transcription factor NF-␬B regulates multiple survival in the face of inflammatory and autoimmune proinflammatory genes that can contribute to islet de- insults. Importantly, our data indicate that blockade of struction. NF-␬B can promote T-cell–mediated killing NF-␬B, as a means to prevent islet inflammatory responses and the generation of ␤-cell toxins through the induc- in vivo, may have the unwanted side effect of sensitizing tion of molecules such as Fas (47,48), inducible nitric ␤-cells to apoptosis by preventing the upregulation of oxide synthase (48,49) and cyclooxygenase-2 (50), antiapoptotic genes such as A20 (16,17,20). respectively. In addition, the promoters of other proinflam- matory genes induced in ␤-cells, including chemokines (i.e., ACKNOWLEDGMENTS monocyte chemoattractant protein-1) and adhesion mole- This work was supported by the Juvenile Diabetes Foun- cules (i.e., intercellular adhesion molecule-1), also possess ␬ ␬ dation International (JDRF 2-2000-719) and a BioFirst binding elements for NF- B (43). The importance of NF- Bin Award from the New South Wales Ministry for Science and ␤-cell inflammatory responses is underscored by the fact ␬ Medical Research (to S.T.G.). that blockade of NF- B in in vitro models, by means of an The authors thank Drs. J. Gunton and R. Laybutt for inhibitor of NF␬B(I␬B␣) super-repressor or via A20 ␤ ␥ ␤ critical reading of this manuscript and T. Shukri, L. Choi, overexpression, prevents IL-1 – and -IFN–induced -cell J. Chan, Jerome Darakdjian, and the Biological Testing dysfunction and death (21,48,49,51). Collectively these Facility staff for technical assistance. data implicate NF-␬B as a major player in cytokine- dependent ␤-cell dysfunction and indicate that targeting NF-␬B may have therapeutic utility as a means to improve REFERENCES islet function in the face of inflammatory insults. 1. Green DR: Apoptotic pathways: the roads to ruin. Cell 94:695–698, 1998 However, aside from its important proinflammatory 2. Vaux DL, Haecker G, Strasser A: An evolutionary perspective on apoptosis ␬ (Review). Cell 76:777–779, 1994 role, NF- B is a major regulator of cellular apoptosis 3. Scaglia L, Cahill CJ, Finegood DT, Bonner-Weir S: Apoptosis participates in through its ability to control the expression of multiple the remodeling of the endocrine pancreas in the neonatal rat. Endocrinol- antiapoptotic genes including the c-IAPs, caspase-8-c- ogy 138:1736–1741, 1997

2500 DIABETES, VOL. 55, SEPTEMBER 2006 D. LIUWANTARA AND ASSOCIATES

4. Scaglia L, Smith FE, Bonner-Weir S: Apoptosis contributes to the involu- Mechanism of rapid transcriptional induction of tumor necrosis factor tion of beta cell mass in the post partum rat pancreas. Endocrinology alpha-responsive genes by NF-kappaB. Mol Cell Biol 22:6354–6362, 2002 136:5461–5468, 1995 31. Anrather J, Csizmadia V, Brostjan C, Soares MP, Bach FH, Winkler H: 5. Mathis D, Vence L, Benoist C: Beta-cell death during progression to Inhibition of bovine endothelial cell activation in vitro by regulated diabetes. Nature 414:792–798, 2001 expression of a transdominant inhibitor of NF-kappa B. J Clin Invest 6. Cnop M, Welsh N, Jonas JC, Jorns A, Lenzen S, Eizirik DL: Mechanisms of 99:763–772, 1997 pancreatic ␤-cell death in type 1 and type 2 diabetes: many differences, few 32. Storz P, Doppler H, Ferran C, Grey ST, Toker A: Functional dichotomy of similarities. Diabetes 54 (Suppl. 2):S97–S107, 2005 A20 in apoptotic and necrotic cell death. Biochem J 387:47–55, 2005 7. Delovitch TL, Singh B: The nonobese diabetic mouse as a model of 33. Arnush M, Heitmeier MR, Scarim AL, Marino MH, Manning PT, Corbett JA: autoimmune diabetes: immune dysregulation gets the NOD. Immunity IL-1 produced and released endogenously within human islets inhibits beta 7:727–738, 1997 [Erratum in Immunity 8:531, 1998] cell function. J Clin Invest 102:516–526, 1998 8. Tisch R, McDevitt H: Insulin-dependent diabetes mellitus. Cell 85:291–297, 1996 34. Cetkovic-Cvrlje M, Eizirik DL: TNF-alpha and IFN-gamma potentiate the 9. Corbett JA, Kwon G, Marino MH, Rodi CP, Sullivan PM, Turk J, McDaniel deleterious effects of IL-1 beta on mouse pancreatic islets mainly via ML: Tyrosine kinase inhibitors prevent cytokine-induced expression of generation of nitric oxide. Cytokine 6:399–406, 1994 iNOS and COX-2 by human islets. Am J Physiol 270:C1581–C1587, 1996 35. Thomas HE, Irawaty W, Darwiche R, Brodnicki TC, Santamaria P, Allison 10. Ricordi C, Strom TB: Clinical islet transplantation: advances and immuno- J, Kay TW: IL-1 receptor deficiency slows progression to diabetes in the logical challenges. Nat Rev Immunol 4:259–268, 2004 NOD mouse. Diabetes 53:113–121, 2004 11. Lechler RI, Garden OA, Turka LA: The complementary roles of deletion and 36. Dahlen E, Dawe K, Ohlsson L, Hedlund G: Dendritic cells and macrophages regulation in transplantation tolerance. Nat Rev Immunol 3:147–158, 2003 are the first and major producers of TNF-alpha in pancreatic islets in the 12. Weir GC, Bonner-Weir S: Scientific and political impediments to successful nonobese diabetic mouse. J Immunol 160:3585–3593, 1998 islet transplantation. Diabetes 46:1247–1256, 1997 37. Pakala SV, Chivetta M, Kelly CB, Katz JD: In autoimmune diabetes the 13. Grey ST, Longo C, Shukri T, Patel VI, Csizmadia E, Daniel S, Arvelo MB, transition from benign to pernicious insulitis requires an islet cell response Tchipashvili V, Ferran C: Genetic engineering of a suboptimal islet graft to tumor necrosis factor alpha. J Exp Med 189:1053–1062, 1999 with A20 preserves beta cell mass and function. J Immunol 170:6250– 38. Brouard S, Berberat PO, Tobiasch E, Seldon MP, Bach FH, Soares MP: Heme 6256, 2003 oxygenase-1-derived carbon monoxide requires the activation of transcription 14. Cardozo AK, Kruhoffer M, Leeman R, Orntoft T, Eizirik DL: Identification factor NF-kappa B to protect endothelial cells from tumor necrosis factor- of novel cytokine-induced genes in pancreatic ␤-cells by high-density alpha-mediated apoptosis. J Biol Chem 277:17950–17961, 2002 oligonucleotide arrays. Diabetes 50:909–920, 2001 39. Karin M, Lin A: NF-kappaB at the crossroads of life and death. Nat 15. Cardozo AK, Heimberg H, Heremans Y, Leeman R, Kutlu B, Kruhoffer M, Immunol 3:221–227, 2002 Orntoft T, Eizirik DL: A comprehensive analysis of cytokine-induced and 40. Opipari AW Jr, Boguski MS, Dixit VM: The A20 cDNA induced by tumor nuclear factor-kappa B-dependent genes in primary rat pancreatic beta- necrosis factor alpha encodes a novel type of zinc finger protein. J Bio cells. J Biol Chem 276:48879–48886, 2001 Chem 265:14705–14708, 1990 16. Beg AA, Baltimore D: An essential role for NF-kappaB in preventing 41. Werner SL, Barken D, Hoffmann A: Stimulus specificity of gene expression TNF-alpha-induced cell death. Science 274:782–784, 1996 programs determined by temporal control of IKK activity. Science 309: 17. Van Antwerp DJ, Martin SJ, Kafri T, Green DR, Verma IM: Suppression of 1857–1861, 2005 TNF-alpha-induced apoptosis by NF-kappaB. Science 274:787–789, 1996 42. Krikos A, Laherty CD, Dixit VM: Transcriptional activation of the tumor 18. Wang CY, Mayo MW, Baldwin AS Jr: TNF- and cancer therapy-induced necrosis factor alpha-inducible zinc finger protein, A20, is mediated by apoptosis: potentiation by inhibition of NF-kappaB. Science 274:784–787, 1996 kappa B elements. J Bio Chem 267:17971–17976, 1992 19. Bach FH, Hancock WW, Ferran C: Protective genes expressed in endothe- 43. May MJ, Ghosh S: Signal transduction through NF-kappa B. Immunol lial cells: a regulatory response to injury. Immunol Today 18:483–486, 1997 Today 19:80–88, 1998 20. Ferran C, Stroka DM, Badrichani AZ, Cooper JT, Wrighton CJ, Soares M, 44. Storz P, Toker A: Protein kinase D mediates a stress-induced NF-kappaB Grey ST, Bach FH: A20 inhibits NF-kappaB activation in endothelial cells activation and survival pathway. EMBO J 22:109–120, 2003 without sensitizing to tumor necrosis factor-mediated apoptosis. Blood 45. Lee EG, Boone DL, Chai S, Libby SL, Chien M, Lodolce JP, Ma A: Failure 91:2249–2258, 1998 to regulate TNF-induced NF-kappaB and cell death responses in A20- 21. Grey ST, Arvelo MB, Hasenkamp W, Bach FH, Ferran C: A20 inhibits deficient mice. Science 289:2350–2354., 2000 cytokine-induced apoptosis and nuclear factor kappaB- dependent gene 46. Wertz IE, O’Rourke KM, Zhou H, Eby M, Aravind L, Seshagiri S, Wu P, activation in islets. J Exp Med 190:1135–1146, 1999 Wiesmann C, Baker R, Boone DL, Ma A, Koonin EV, Dixit VM: De- 22. Daniel S, Arvelo MB, Patel VI, Longo CR, Shrikhande G, Shukri T, Mahiou ubiquitination and ubiquitin ligase domains of A20 downregulate NF- J, Sun DW, Mottley C, Grey ST, Ferran C: A20 protects endothelial cells kappaB signalling. Nature 430:694–699, 2004 from TNF-, Fas-, and NK-mediated cell death by inhibiting caspase 8 47. Darville MI, Eizirik DL: Cytokine induction of Fas gene expression in activation. Blood 104:2376–2384, 2004 insulin-producing cells requires the transcription factors NF-␬B and 23. Grey ST, Tsuchida A, Hau H, Orthner CL, Salem HH, Hancock WW: C/EBP. Diabetes 50:1741–1748, 2001 Selective inhibitory effects of the anticoagulant activated protein C on the 48. Heimberg H, Heremans Y, Jobin C, Leemans R, Cardozo AK, Darville M, responses of human mononuclear phagocytes to LPS, IFN-gamma, or Eizirik DL: Inhibition of cytokine-induced NF-␬B activation by adenovirus- phorbol ester. J Immunol 153:3664–3672, 1994 mediated expression of a NF-␬B super-repressor prevents ␤-cell apoptosis. 24. Gunther L, Berberat PO, Haga M, Brouard S, Smith RN, Soares MP, Bach Diabetes 50:2219–2224, 2001 FH, Tobiasch E: Carbon monoxide protects pancreatic ␤-cells from 49. Kwon G, Corbett JA, Hauser S, Hill JR, Turk J, McDaniel ML: Evidence for apoptosis and improves islet function/survival after transplantation. Dia- involvement of the proteasome complex (26S) and NF␬B in IL-1␤–induced betes 51:994–999, 2002 nitric oxide and prostaglandin production by rat islets and RINm5F cells. 25. Gunton JE, Kulkarni RN, Yim S, Okada T, Hawthorne WJ, Tseng YH, Diabetes 47:583–591, 1998 Roberson RS, Ricordi C, O’Connell P J, Gonzalez FJ, Kahn CR: Loss of 50. Sorli CH, Zhang HJ, Armstrong MB, Rajotte RV, Maclouf J, Robertson RP: ARNT/HIF1beta mediates altered gene expression and pancreatic-islet Basal expression of cyclooxygenase-2 and nuclear factor-interleukin 6 are dysfunction in human type 2 diabetes. Cell 122:337–349, 2005 dominant and coordinately regulated by interleukin 1 in the pancreatic 26. Krauss S, Zhang CY, Scorrano L, Dalgaard LT, St-Pierre J, Grey ST, Lowell islet. Proc Natl Acad SciUSA95:1788–1793, 1998 BB: Superoxide-mediated activation of uncoupling protein 2 causes pan- 51. Giannoukakis N, Rudert WA, Trucco M, Robbins PD: Protection of human creatic beta cell dysfunction. J Clin Invest 112:1831–1842, 2003 islets from the effects of interleukin-1beta by adenoviral gene transfer of an 27. D’Ambra R, Surana M, Efrat S, Starr RG, Fleischer N: Regulation of insulin Ikappa B repressor. J Biol Chem 275:36509–36513, 2000 secretion from beta-cell lines derived from transgenic mice insulinomas 52. Wong GH, Elwell JH, Oberley LW, Goeddel DV: Manganous superoxide resembles that of normal beta-cells. Endocrinology 126:2815–2822, 1990 dismutase is essential for cellular resistance to cytotoxicity of tumor 28. Kwon G, Corbett JA, Rodi CP, Sullivan P, McDaniel ML: Interleukin-1 necrosis factor. Cell 58:923–931, 1989 beta-induced nitric oxide synthase expression by rat pancreatic beta-cells: 53. Chang I, Kim S, Kim JY, Cho N, Kim YH, Kim HS, Lee MK, Kim KW, Lee MS: evidence for the involvement of nuclear factor kappa B in the signaling Nuclear factor ␬B protects pancreatic ␤-cells from tumor necrosis factor- mechanism. Endocrinology 136:4790–4795, 1995 ␣–mediated apoptosis. Diabetes 52:1169–1175, 2003 29. Pipeleers DG, in’t Veld PA, Van de Winkel M, Maes E, Schuit FC, Gepts W: 54. Giannoukakis N, Rudert WA, Ghivizzani SC, Gambotto A, Ricordi C, Trucco A new in vitro model for the study of pancreatic A and B cells. Endocri- M, Robbins PD: Adenoviral gene transfer of the interleukin-1 receptor nology 117:806–816, 1985 antagonist protein to human islets prevents IL-1␤–induced ␤-cell impairment 30. Ainbinder E, Revach M, Wolstein O, Moshonov S, Diamant N, Dikstein R: and activation of islet cell apoptosis in vitro. Diabetes 48:1730–1736, 1999

DIABETES, VOL. 55, SEPTEMBER 2006 2501