Cutting Edge: Endogenous IFN-Β Regulates Survival and Development of Transitional B Cells

Cutting Edge: Endogenous IFN-β Regulates Survival and Development of Transitional B Cells

This information is current as Jennie A. Hamilton, Qi Wu, PingAr Yang, Bao Luo, of September 28, 2021. Shanrun Liu, Huixian Hong, Jun Li, Mark R. Walter, Eleanor N. Fish, Hui-Chen Hsu and John D. Mountz J Immunol 2017; 199:2618-2623; Prepublished online 13 September 2017;

doi: 10.4049/jimmunol.1700888 Downloaded from http://www.jimmunol.org/content/199/8/2618

Supplementary http://www.jimmunol.org/content/suppl/2017/09/13/jimmunol.170088 Material 8.DCSupplemental http://www.jimmunol.org/ References This article cites 25 articles, 14 of which you can access for free at: http://www.jimmunol.org/content/199/8/2618.full#ref-list-1

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision by guest on September 28, 2021

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2017 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Th eJournal of Cutting Edge Immunology

Cutting Edge: Endogenous IFN-b Regulates Survival and Development of Transitional B Cells Jennie A. Hamilton,* Qi Wu,* PingAr Yang,* Bao Luo,* Shanrun Liu,* † ‡,x Huixian Hong,* Jun Li,* Mark R. Walter,{ Eleanor N. Fish, Hui-Chen Hsu,* and John D. Mountz*, The transitional stage of B cell development is a forma- and extrinsic factors that regulate the abnormal survival re- tive stage in the spleen where autoreactive speciﬁcities sponses of T1 B cells in SLE are poorly understood. are censored as B cells gain immune competence, but Most studies into the differential survival responses of the intrinsic and extrinsic factors regulating survival transitional B cells, both in normal B cell development and in of transitional stage 1 (T1) B cells are unknown. We autoimmunity, have focused on the interactions between cell- report that B cell expression of IFN-b is required for surface Ag receptors and costimulatory molecules as well as the Downloaded from optimal survival and TLR7 responses of transitional role of factors present in the extracellular environment, in a B cells in the spleen and was overexpressed in T1 particular IFN- and TLR ligands (5). The responsiveness of B cells to IFN-b has been less well studied compared with B cells from BXD2 lupus-prone mice. Single-cell gene a b expression analysis of B6 Ifnb+/+ versus B6 Ifnb–⁄– T1 IFN- , although it has been shown that IFN- has a higher afﬁnity for IFNARs than IFN-a (6, 7). It has been proposed

B cells revealed heterogeneous expression of Ifnb in http://www.jimmunol.org/ that IFN-b acts as an initial signal that potentiates subsequent wild-type B cells and distinct gene expression patterns b signaling by other type I IFNs and cytokines (8), and a role associated with endogenous IFN- . Single-cell analysis for IFN-b in the promotion of TLR signaling has been dem- of BXD2 T1 B cells revealed that Ifnb is expressed in onstrated (9, 10). early T1 B cell development with subsequent upregu- In this study, we report a mechanistic model in which lation of Tlr7 and Ifna1. Together, these data suggest b b endogenous expression of IFN- is central to the survival that T1 B cell expression of IFN- plays a key role in responses of new immigrant T1 B cells. Endogenous IFN-b is regulating responsiveness to external factors. The an important regulator of TLR7 responses during T1 B cell

Journal of Immunology, 2017, 199: 2618–2623. development and promotes their development into immune- by guest on September 28, 2021 competent B cells (3). he survival responses of transitional B cells play a key role in shaping the development of mature, Ab- Materials and Methods T producing B cells. Transitional stage 1 (T1) B cells Mice are the initial immigrants in the spleen and are highly sus- Ifnb-deﬁcient C57BL/6J mice were provided by Dr. E. Fish, University of ceptible to negative selection following strong BCR ligand Toronto, Canada (11). Rag1-deﬁcient and B6 Cd45.1 and Cd45.2 mice were engagement (1, 2). T1 B cells that survive this negative se- purchased from the Jackson Laboratory. BXD2 GFP mice were generated by crossing of BXD2 mice with B6 GFP mice for .15 generations. lection become transitional stage 2 (T2) or mature B cells that are competent to respond to immune challenges (3). Failures Bone marrow transplantation in this selection checkpoint are associated with aberrant ac- Bone marrow (BM) cells (1 3 107) from the indicated donors were transferred tivation and development of polyreactive self-antigen–reactive 2 2 or mixed at a 1:1 ratio of Cd45.1 B6/Cd45.2 B6-Ifnb / or a 1:1:1 ratio of 2 2 mature B cells in systemic lupus erythematous (SLE) and the Cd45.1 B6/Cd45.2 B6-Ifnb / /GFP+ BXD2, and injected i.v. into recipient development of anti-nuclear autoantibodies (4). The intrinsic mice as previously described (12).

*Division of Clinical Immunology and Rheumatology, Department of Medicine, Uni- Research Award (to M.R.W. and H.-C.H.), and a Tier 1 Canada Research Chair grant versity of Alabama at Birmingham, Birmingham, AL 35294; †Department of Microbi- (to E.N.F). ology, University of Alabama at Birmingham, Birmingham, AL 35294; ‡Toronto Address correspondence and reprint requests to Dr. John D. Mountz, Division of General Research Institute, University Health Network, Toronto, Ontario M5G 2C4, x Clinical Immunology and Rheumatology, Department of Medicine, University of Ala- Canada; Department of Immunology, University of Toronto, Toronto, Ontario M5G { bama at Birmingham, Shelby Interdisciplinary Biomed Research Building, Room SHEL 2M1, Canada; and Birmingham Veterans Administration Medical Center, Birming- 307, 1825 University Boulevard, Birmingham, AL 35294-2182. E-mail address: ham, AL 35233 [email protected] Received for publication June 22, 2017. Accepted for publication August 21, 2017. The online version of this article contains supplemental material. This work was supported by National Institutes of Health (NIH) Grant R01-AI-071110 Abbreviations used in this article: BM, bone marrow; C , cycle threshold; pDC, plas- and Veterans Administration Merit Review Grant 1I01BX000600 (to J.D.M.), NIH T macytoid dendritic cell; SLE, systemic lupus erythematous; T1, transitional stage 1; WT, Grant R01-AI-083705 (to H.-C.H.), NIH Immunology T32 Training Grant wild-type. 2T32AI007051-39 (to J.A.H.), NIH Grant P30-AR-048311/Pilot and Feasibility Study Project (to J.L.), NIH Grants P30-AR-048311 and P30-AI-027767, a Lupus Founda- Ó tion of America Finzi Summer Fellowship (to J.A.H.), a Lupus Research Institute Novel Copyright 2017 by The American Association of Immunologists, Inc. 0022-1767/17/$35.00

www.jimmunol.org/cgi/doi/10.4049/jimmunol.1700888 The Journal of Immunology 2619

In vitro stimulation and type I IFN neutralization relatively lower on T1 B cells (16) (Fig. 1B). Stimulation of b Purified B cells were stimulated with mouse IFN-a or IFN-b (a gift from the sorted B cells in vitro confirmed that high-affinity IFN- Dr. V. Ghanta, CytImmune), 2 mg/ml TLR7 agonist CL264 (InvivoGen), or exhibited increased ability to stimulate all B cell subsets, CL264 + a polyclonal anti-mouse IgM (1 mg/ml; Jackson ImmunoResearch) compared with IFN-a (Fig. 1C). or nonspecific rat-IgG isotype control. For specific neutralization of type I b IFNs, cells were preincubated with 50 mg/ml anti-IFNAR (clone MAR1-5A3; To explore whether IFN- plays a role in the survival and b development of T1 B cells in vivo, we reconstituted irradiated Bio X Cell) or 500 IU/ml anti–IFN- (rabbit IgG, protein A purified, PBL ⁄ ⁄ Assay Science). Rag1– – recipients with BM from WT B6 Ifnb+ + (CD45.1) ⁄ mice and Ifnb– – (CD45.2) mice. This chimeric approach Real-time quantitative RT-PCR enabled distinction of the effects of endogenous production of RNA isolation, cDNA synthesis, and real-time PCR reactions were carried out IFN-b from exogenous influences. Confocal imaging of as described previously (12). spleens during B cell repopulation (Fig. 1D) confirmed that –⁄– Single-cell quantitative RT-PCR B cells derived from the BM of both WT and Ifnb mice were capable of seeding the same region of the spleen; how- For single-cell analyses, single T1 B cells were obtained from the spleens of 2 2 + CD45.1 B6: CD45.2 B6 Ifnb / BM chimeras or 4 mo old female BXD2 ever, IgM B cells of WT origin were significantly increased –⁄– mice. Analyses were performed using the BioMark Real-Time quantitative relative to those derived from Ifnb BM. Consistent with PCR system (Fluidigm, South San Francisco, CA) using the standard Flu- this, there was a significantly higher percentage of Annexin V+ idigm protocols. Primer sets amplifying the mRNAs of the relevant genes are apoptotic cells in transitional B cells derived from the B6 presented in Supplemental Table I. The averaged cycle threshold (CT) values –⁄– were calculated from the system software (BioMark Real-Time PCR Analysis; Ifnb BM compared with those derived from the WT BM Downloaded from Fluidigm). (Fig. 1E). The highest rates of apoptosis were observed in the ‒ΔC Gene expression values were calculated using the 2 T value. Briefly, the IgMlo T3 population, suggesting that anergic, Ag-engaged CT value of each gene in each cell obtained from the BioMark system was –⁄– Δ Ifnb B cells are especially sensitive to apoptosis (17) normalized with the CT value of Gapdh ( CT) of each cell, and this was ‒Δ ‒Δ further converted to 2 CT toshowtheexpressionvalueofeachgene.The2 CT (Fig. 1E). values were transferred to the ClustVis online web tool for hierarchical To identify the pathways associated with the altered survival clustering analysis (13). ClustVis uses the heatmap feature available from the of T1 B cells lacking endogenous expression of IFN-b,we http://www.jimmunol.org/ R package (version 0.7.7) for plotting the values as a heatmap. Expression levels of all genes were auto-scaled to give all the genes equal weight in the compared the gene expression patterns of T1 B cells isolated classification algorithms. Missing data in the BioMark system were assigned a from the chimeric mice focusing on expression of 34 genes CT of 999 by the instrument software and removed. Because high CTs in the that have been shown to be associated with type I IFN. BioMark 96 3 96 microfluidic card were expected to be false positives due to + + + + hi 2 baseline drift or formation of aberrant products, and because a sample with a CD45.1 or CD45.2 T1 B cells (B220 CD93 IgM CD23 ) single template molecule is expected to generate a lower CT,CT values that were isolated and subjected to single-cell analysis using the were larger than a cutoff of 25 were also removed (14). Cells not expressing Fluidigm BioMark system. In T1 B cells derived from the the Gapdh housekeeping gene, or expressing it at extremely low values (CT WT BM, there was heterogeneous expression of Ifnb1, which .35), were removed from the analysis, on the assumption that these cells were dead or damaged during the preparation process. was most closely clustered with Tlr7, Pkr, Irf9, Cd86, and the by guest on September 28, 2021 2 2 Data used for the Ifnb / versus wild-type (WT) T1 B cell clustering Ifna genes (Fig. 1F, red box). In T1 B cells derived from ⁄ analysis can be obtained at http://biit.cs.ut.ee/clustvis/?s=KXZgiafggsgiqXF. Ifnb– – BM, there was significantly lower expression of Tlr7, Data used for the BXD2 T1 B cell clustering analysis can be obtained at http://biit.cs.ut.ee/clustvis/?s=ngDyEqjWVFxljgb (for the Ifna versus Ifnb Tlr3, Pkr, Cd86, Ifna7, and Ifna1, suggesting that the en- dataset), http://biit.cs.ut.ee/clustvis/?s=GGGWfDLltagktnA (for the Cd93 dogenous expression of IFN-b can act in an autocrine fashion versus Cd23 dataset), and http://biit.cs.ut.ee/clustvis/?s=jBXpSUfvIiPfBeF (for to affect the expression of nucleic acid sensing and costimu- the Cd93, Cd23, Ifnb,andIfna7 dataset). latory genes in developing T1 B cells (Fig. 1G, Supplemental Flow cytometry Table I). Consistent with the gene expression data, live T1 B cells lacking endogenous IFN-b exhibited decreased TLR7 The following anti-mouse Abs were used: BioLegend Pacific Blue–a-B220 (RA3-6B2), BV510-a–CD23 (B3B4), FITC-a–CD21/35 (7E9), PE–a- agonist-induced CD69 expression, whereas responses of the IFNAR1 (MAR1-5A3), PE–a-BAFFR (7H22-E16), Pacific Blue–a-CD45.1 other B cell subsets were not significantly affected (Fig. 1H, (A20), AF647–a-CD45.2 (104); BD Biosciences BV650–a-CD93 (AA4.1), 1I). Together, these data suggest that endogenous IFN-b– BV510–a-IgD (11-26c.2a); eBioscience PE–a-CD69 (H1.2F3), PECy7–a- a expressing T1 B cells are initially autonomous, and that their IgM (eB121-15F9), APC– -CD317 (PDCA1, eBio129c); PBL Assay Science b FITC–a-IFN-b (RMMB-1). All FACS analyses included dead cell exclusion expression of IFN- plays a key role in their survival and using fixable viability dye eFluor780 (eBioscience). La13–27 tetramer staining responsiveness to external factors, including externally derived was carried out as previously described (15). Intracellular staining and flow type I IFNs and TLR7 ligands. cytometry analysis was carried out as previously described (12). b Histology IFN- promotes survival of autoreactive transitional B cells Freezing of sections and analysis was carried out as previously described (12). We observed previously that, in lupus-prone BXD2 mice, a deficiency of the IFNAR1 ameliorated autoantibody pro- Statistics duction and autoimmune disease (12, 18). Circulating + Results are shown as the mean 6 SD or mean 6 SEM. The p values ,0.05 ARID3a transitional and naive B cells from SLE patients were considered significant. have been shown to express high levels of IFN-a (19). Comparison of type I IFN expression in freshly isolated, Results and Discussion FACS-sorted cells from BXD2 and age-matched B6 mice b Endogenous IFN- regulates survival and development of revealed significantly elevated levels of endogenous type I IFN transitional B cells genes in T1 but not in other subsets of B cells from BXD2 FACS analysis revealed that T1 and T2 B cells expressed the mice (Fig. 2A). This prominent type I IFN expression in T1 highest levels of IFN-aR1 (Fig. 1A). As has been reported, B cells was not associated with increased expression of type I BAFF receptor is upregulated at the T2 B cell stage and is IFN signature gene Ifit2 or with increased Arid3a expression. 2620 CUTTING EDGE: TRANSITIONAL B CELL–INTRINSIC IFN-b Downloaded from http://www.jimmunol.org/

FIGURE 1. Endogenous IFN-b regulates survival and development of transitional B cells. (A and B) Flow cytometry quantiﬁcation of (A) IFNAR1 and (B) ,

BAFF receptor expression in the indicated subsets of B cells in B6 mouse spleen (one-way ANOVA with Tukey post hoc test, p 0.0001; groups shown with by guest on September 28, 2021 different letters are significantly different from each other, n = 4). (C) Flow cytometry quantification of CD69 expression in the indicated subsets of B6 mouse B cells following in vitro stimulation with either IFN-b (200 ng/ml) or IFN-a (200 ng/ml) analyzed 4 h after stimulation (***p , 0.005 between IFN-b– versus ‒⁄‒ IFN-a–stimulation response in the same B subset; unpaired Student t test, n = 4). (D–G) BM-chimeric mice were generated by reconstitution of CD45.2 Rag1 ‒⁄‒ mice with equal numbers of BM derived from CD45.1 Ifnb+/+ (WT) mice and CD45.2 Ifnb (knockout) mice. Recipient mice were sacrificed at day 15 after BM transfer. (D) Upper panel: confocal imaging analysis of IgM+ WT (magenta) and IgM+ knockout (yellow) B cells in a representative spleen section from double-chimeric recipient mice (objective lens = 403) (left). Boxed area was digitally magnified (right). Lower panel: digitally magnified two-color IgM/CD45.1 ‒⁄‒ or IgM/CD45.2 confocal images (left) with a bar graph showing the percent of IgM+ B cells derived from either WT BM or Ifnb BM (right). (E) FACS analysis of Annexin V+ apoptotic cells in different transitional B cell subpopulations in chimeric mice. (F and G) BioMark quantitative RT-PCR heatmap (F) and dot plot ‒⁄‒ (G) analysis of the expression of the indicated genes in single T1 B cells derived from CD45.1 B6-Ifnb+/+ (n = 36) or CD45.2-Ifnb (n = 34) [data in (G) are mean 6 SD; nonparametric Mann–Whitney U test]. (H) FACS plots and bar graph quantification of percent CD69+ T1, T2/T3, and FO-B cells 6 h after in vitro stimulation with CL264 (a TLR7 agonist) + a-IgM or CL264 alone. (I) Quantification of percent CD69+ live or dead T1 B cells 6 h after in vitro stimulation ‒⁄‒ with CL264. Unless specified, all data are mean 6 SEM. **p , 0.01, ***p , 0.005 for WT versus Ifnb . n = 2–3 mice per group for two independent experiments, unpaired Student t test for (D, E, and G–I).

The lack of significant elevation of type I IFN in plasmacytoid reduction in the total number of transitional and mature dendritic cells (pDCs) (Fig. 2A) is consistent with the recent B cells at all stages (Fig. 2D) compared with B cells derived ⁄ finding that, in SLE, type I IFN expression in circulating from the BM of B6-Ifnb+ +, and more strikingly compared pDCs was not elevated compared with B cells (20). The with BM of GFP+ BXD2 mice. identity of sorted cells was verified by high expression of the To determine whether IFN-b contributes to the TLR7- Cd19 gene in B cells and Cd317 in pDCs (Fig. 2A, lower mediated induction of CD69 in BXD2 autoimmune mice, panel). sorted B cells were stimulated in the presence and absence of BXD2 mice produce autoantibodies to RNP Ags, a char- neutralizing Abs to IFN-b or IFNAR (Fig. 2E). Blockade of acteristic of SLE (15); thus, we determined whether endoge- IFN-b inhibited .50% of T1 B cell activation following nous expression of IFN-b by T1 B cells affects the CL264 + anti-IgM stimulation, and no significant additional ‒⁄‒ development of La13–27 reactive B cells. Irradiated Rag1 inhibition of activation was observed with IFNAR blockade. ‒⁄‒ mice were reconstituted with BM from CD45.2 B6-Ifnb , Together, these data suggest that endogenous IFN-b in T1 ⁄ CD45.1 B6-Ifnb+ +, and CD45.2 GFP+ BXD2 mice (1:1:1). B cells enables escape of autoreactive T1 B cells from censor- ‒⁄‒ B cells from the BM of B6-Ifnb origin exhibited a signifi- ship. Importantly, environmental signals, which were equiva- + cantly lower percentage (Fig. 2B) and total number of La13–27 lent for all B cells in the chimeric mice, did not compensate for B cells (Fig. 2C) and, as found for the double chimeras, a the lack of B cell endogenous IFN-b. The Journal of Immunology 2621 Downloaded from http://www.jimmunol.org/

FIGURE 2. IFN-b promotes survival of autoreactive transitional B cells. (A) Quantitative RT-PCR analysis of gene expression in the indicated cell populations in B6 and BXD2 mice. Primer pairs are presented in Supplemental Table I. ARID3a primers (forward: 59-CCGTGGACGTCCTCAGATTG-39; reverse: 59- ‒⁄‒ TTGGGCTCATTCAAGCACCT-39). (B–D) BM-chimeric mice (B6-Rag1 ) were generated by reconstitution with equal numbers of BM cells from CD45.1 +/+ ‒⁄‒ + B6-Ifnb1 mice, CD45.2 B6-Ifnb1 mice, and GFP BXD2 mice. Recipient mice were sacrificed at day 30 after reconstitution. (B) Flow cytometry analysis by guest on September 28, 2021 + + + C showing the percent of La13–27 B cells (left) and percent of transitional B cells in the CD93 La13–27 subpopulation (right) in recipient mice. ( ) Quantitation of + D + E absolute numbers of La13–27 B cells. ( ) Quantitation of absolute numbers of La13–27 B cells in the indicated transitional or mature B cell subpopulation. ( )B cells purified from BXD2 mice were stimulated in vitro with TLR7 agonist CL264 + anti-IgM (a-IgM) in the presence of control medium (CM), a–IFN-b, a-IFNAR, or isotype-control Ab. Representative FACS plots (left) and quantification (right) show the percent CD69+ in T1, T2/T3, and FO-B cells 4 h after the indicated stimulation. Throughout, data are mean 6 SEM (n = 4–6 mice). *p , 0.05, **p , 0.01, ***p , 0.005, two-tailed unpaired Student t test (A) or one- way ANOVA with Tukey post hoc test (B–E).

Endogenous IFN-b is associated with distinct subpopulations of T1 ulation of CD93 coincided with upregulation of CD23 B cells in BXD2 mice during transitional B cell maturation in the BXD2 mice To gain insights into the dynamics of Ifnb expression in re- (Supplemental Fig. 1D). Therefore, the expression of Ifnb, lation to Ifna genes and Tlr7 in T1 B cells of BXD2 mice, we Tlr7, and Ifna1 was analyzed along with Cd93 and Cd23, carried out single-cell gene expression analysis. T1 B cells were leading to the identification of five subpopulations within T1 FACS sorted and the purity was verified by analysis of single- B cells as shown in Fig. 3C. Cluster I expressed the highest cell expression of Cd19, Cd23, Cd3,andCd317, which con- levels of Cd93 and intermediate levels of Ifnb, whereas Tlr7 firmed that there was no contamination by T cells or pDCs and Ifna1 were expressed at low levels in this population (Fig. (Supplemental Fig. 1A). 3C, 3D). Cluster II and Cluster III were distinguished by Single-cell analysis of T1 B cells from three BXD2 mice upregulation of Tlr7 and Ifna1, respectively, and this was revealed segregation of Ifnbhi versus Ifnalo T1 B cells in T1 coincident with downregulation of Cd93 in these two pop- B cells in BXD2 mice (Fig. 3A, 3B, Supplemental Fig. 1B). ulations (Fig. 3C, 3D). Cluster IV exhibited the peak ex- Heterogeneity of transitional B cells has been studied exten- pression of Ifnb, and Cluster V exhibited low expression of sively in terms of the specificity of the Ag receptor (4) and the Ifnb, Ifna, and Tlr7, and the highest Cd23 expression. At the expression of costimulatory molecules (21, 22) as well as the protein level, flow cytometry analysis confirmed that relative 2 relative expression of CD93 and CD23 (23). During devel- to B6 mice, IFN-b expression occurred in CD93+++CD23 opment of the most immature T1 B cell stage, acquisition of and peaked in CD93+CD23dim IgM+ B cell subpopulations CD23 coincides with the downregulation of CD93 (23, 24). (23) of BXD2 mice (Fig. 3E, 3F). Heatmap and principal component analyses confirmed a These data indicate a previously unrecognized level of distinct inverse expression pattern of Cd93 and Cd23 in single heterogeneity within the T1 B cell subpopulation. Interest- T1 B cells from all three BXD2 mice analyzed (Supplemental ingly, in our single-cell dataset, the T1 B cells producing the Fig. 1C). Flow cytometry analysis confirmed that downreg- highest levels of type I IFN genes were distinct from those 2622 CUTTING EDGE: TRANSITIONAL B CELL–INTRINSIC IFN-b Downloaded from http://www.jimmunol.org/

FIGURE 3. Endogenous IFN-b is associated with distinct subpopulations of T1 B cells in BXD2 mice. (A–D) T1 B cells isolated from the spleen of three BXD2 mice were prepared for single-cell gene expression analysis (n = 153 data points). (A) Heatmap of type I IFN gene clustering in individual T1 B cells. (B) Dot plots showing the normalized expression type I IFN genes in the Ifnbhi versus Ifnahi cluster. Results are mean 6 SD. **p , 0.01; ***p , 0.005, unpaired t test. (C) Hierarchical clustering heatmap showing the normalized expression of Ifnb, Ifna1, Tlr7, Cd93, and Cd23 in the five major clusters of T1 B cells. (D) Mean 6 SEM expression of Cd93, Cd23, Ifnb, Tlr7, and Ifna1 in each cluster of T1 B cells. (E) Representative FACS plots of IFN-b expression in the indicated B by guest on September 28, 2021 cell subsets. (F) Quantification of IFN-b+ cells in the indicated B cell population (mean 6 SD, n = 4). (D and F) One-way ANOVA Tukey multiple comparison test. *p , 0.05, **p , 0.01, ***p , 0.001 between the indicated comparisons. (G) A model showing T1 B cell self-production of IFN-b in the induction of TLR7 and other type I IFNs during T1 B cell development. expressing the highest levels of Tlr7 (Fig. 3C). Notably, the T1 dysregulated autocrine IFN-b during B cell development B cells expressing the highest Tlr7 represented a relatively imprints on the responses of mature B cells. small subpopulation. This phenomenon was also observed for classical type I IFN response gene Ifit2 (Supplemental Fig. Disclosures 1E), where Ifit2 upregulation occurred in a small subpopu- The authors have no financial conflicts of interest. lation relative to the Ifna and Ifnb high populations. This suggests additional complexity in the type I IFN network, where distinct type I IFN producing and responding cells References occupy a presumed homogenous B cell population. Together, 1. Carsetti, R., G. Ko¨hler, and M. C. Lamers. 1995. Transitional B cells are the target of negative selection in the B cell compartment. J. Exp. Med. 181: 2129–2140. the present findings suggest a hypothetical model in which the 2. Norvell, A., L. Mandik, and J. G. Monroe. 1995. Engagement of the antigen- endogenous production of IFN-b and autocrine signaling in receptor on immature murine B lymphocytes results in death by apoptosis. J. Immunol. 154: 4404–4413. T1 B cells leads to an ordered unfolding expression of genes, 3. Chung, J. B., M. Silverman, and J. G. Monroe. 2003. Transitional B cells: step by including Tlr7, other type I IFNs, and IFN response genes step towards immune competence. Trends Immunol. 24: 343–349. 4. Yurasov, S., H. Wardemann, J. Hammersen, M. Tsuiji, E. Meffre, V. Pascual, and (Fig. 3G). Although the exact developmental order of these M. C. Nussenzweig. 2005. Defective B cell tolerance checkpoints in systemic lupus subpopulations remains uncertain, this cellular heterogeneity erythematosus. J. Exp. Med. 201: 703–711. 5. Bekeredjian-Ding, I. B., M. Wagner, V. Hornung, T. Giese, M. Schnurr, S. Endres, may influence and diversify subsequent responsiveness to and G. Hartmann. 2005. Plasmacytoid dendritic cells control TLR7 sensitivity of differentiation signals (25). The current study does not ex- naive B cells via type I IFN. [Published erratum appears in 2005 J. Immunol. 174: clude the effects of B cell exogenous factors that may occur 5884.] J. Immunol. 174: 4043–4050. 6. Schreiber, G., and J. Piehler. 2015. The molecular basis for functional plasticity in after the transitional T1 stage; however, it does reveal that type I interferon signaling. Trends Immunol. 36: 139–149. B cell–endogenous IFN-b influences responses of T1 B cells 7. Lamken, P., S. Lata, M. Gavutis, and J. Piehler. 2004. Ligand-induced assembling of the type I interferon receptor on supported lipid bilayers. J. Mol. Biol. 341: 303– at a critical peripheral tolerance checkpoint. As SLE is char- 318. acterized by both early B cell selection abnormalities and 8. Taniguchi, T., and A. Takaoka. 2001. A weak signal for strong responses: b interferon-alpha/beta revisited. Nat. Rev. Mol. Cell Biol. 2: 378–386. polymorphisms in components of the IFN- enhanceosome 9. Green, N. M., A. Laws, K. Kiefer, L. Busconi, Y. M. Kim, M. M. Brinkmann, (4, 26), future studies would be important to determine if E. H. Trail, K. Yasuda, S. R. Christensen, M. J. Shlomchik, et al. 2009. Murine The Journal of Immunology 2623

B cell response to TLR7 ligands depends on an IFN-beta feedback loop. J. Immunol. 18. Wang, J. H., J. Li, Q. Wu, P. Yang, R. D. Pawar, S. Xie, L. Timares, C. Raman, 183: 1569–1576. D. D. Chaplin, L. Lu, et al. 2010. Marginal zone precursor B cells as cellular agents for 10. Sheikh, F., H. Dickensheets, A. M. Gamero, S. N. Vogel, and R. P. Donnelly. type I IFN-promoted antigen transport in autoimmunity. J. Immunol. 184: 442–451. 2014. An essential role for IFN-b in the induction of IFN-stimulated gene ex- 19. Ward, J. M., M. L. Ratliff, M. G. Dozmorov, G. Wiley, J. M. Guthridge, pression by LPS in macrophages. J. Leukoc. Biol. 96: 591–600. P. M. Gaffney, J. A. James, and C. F. Webb. 2016. Human effector B lymphocytes 11. Deonarain, R., A. Verma, A. C. Porter, D. R. Gewert, L. C. Platanias, and express ARID3a and secrete interferon alpha. J. Autoimmun. 75: 130–140. E. N. Fish. 2003. Critical roles for IFN-beta in lymphoid development, myelo- 20. Rodero, M. P., J. Decalf, V. Bondet, D. Hunt, G. I. Rice, S. Werneke, poiesis, and tumor development: links to tumor necrosis factor alpha. Proc. Natl. S. L. McGlasson, M. A. Alyanakian, B. Bader-Meunier, C. Barnerias, et al. 2017. Acad. Sci. USA 100: 13453–13458. Detection of interferon alpha protein reveals differential levels and cellular sources in 12. Li, H., Y. X. Fu, Q. Wu, Y. Zhou, D. K. Crossman, P. Yang, J. Li, B. Luo, disease. J. Exp. Med. 214: 1547–1555. L. M. Morel, J. H. Kabarowski, et al. 2015. Interferon-induced mechanosensing 21. Sims, G. P., R. Ettinger, Y. Shirota, C. H. Yarboro, G. G. Illei, and P. E. Lipsky. defects impede apoptotic cell clearance in lupus. J. Clin. Invest. 125: 2877–2890. 2005. Identification and characterization of circulating human transitional B cells. 13. Metsalu, T., and J. Vilo. 2015. ClustVis: a web tool for visualizing clustering of Blood 105: 4390–4398. multivariate data using Principal component analysis and heatmap. Nucleic Acids 22. Palanichamy, A., J. Barnard, B. Zheng, T. Owen, T. Quach, C. Wei, R. J. Looney, Res. 43: W566–W570. I. Sanz, and J. H. Anolik. 2009. Novel human transitional B cell populations 14. Conrad, S., H. Azizi, M. Hatami, M. Kubista, M. Bonin, J. Hennenlotter, revealed by B cell depletion therapy. J. Immunol. 182: 5982–5993. K. D. Sievert, and T. Skutella. 2016. Expression of genes related to germ cell lineage 23.Allman,D.,R.C.Lindsley,W.DeMuth,K.Rudd,S.A.Shinton,andR.R.Hardy. and pluripotency in single cells and colonies of human adult germ stem cells. 2001. Resolution of three nonproliferative immature splenic B cell subsets reveals multiple Stem Cells Int. DOI: 10.1155/2016/8582526. selection points during peripheral B cell maturation. J. Immunol. 167: 6834–6840. 15. Hamilton, J. A., J. Li, Q. Wu, P. Yang, B. Luo, H. Li, J. E. Bradley, J. J. Taylor, 24. Kleiman, E., D. Salyakina, M. De Heusch, K. L. Hoek, J. M. Llanes, I. Castro, T. D. Randall, J. D. Mountz, and H. C. Hsu. 2015. General approach for tetramer- J. A. Wright, E. S. Clark, D. M. Dykxhoorn, E. Capobianco, et al. 2015. Distinct based identification of autoantigen-reactive B cells: characterization of La- and transcriptomic features are associated with transitional and mature B-cell pop- snRNP-reactive B cells in autoimmune BXD2 Mice. J. Immunol. 194: 5022– ulations in the mouse spleen. [Published erratum appears in 2016 Front. Immunol. 5034. 7: 267.] Front. Immunol. 6: 30. 16. Shulga-Morskaya, S., M. Dobles, M. E. Walsh, L. G. Ng, F. MacKay, S. P. Rao, 25. Soni, C., E. B. Wong, P. P. Domeier, T. N. Khan, T. Satoh, S. Akira, and S. L. Kalled, and M. L. Scott. 2004. B cell-activating factor belonging to the TNF Z. S. Rahman. 2014. B cell-intrinsic TLR7 signaling is essential for the development Downloaded from family acts through separate receptors to support B cell survival and T cell- of spontaneous germinal centers. J. Immunol. 193: 4400–4414. independent antibody formation. J. Immunol. 173: 2331–2341. 26. Fu, Q., J. Zhao, X. Qian, J. L. Wong, K. M. Kaufman, C. Y. Yu, M. Y. Mok, 17. Merrell, K. T., R. J. Benschop, S. B. Gauld, K. Aviszus, D. Decote-Ricardo, J. B. Harley, J. M. Guthridge, Y. W. Song, et al; Hwee Siew Howe; Tan Tock Seng L. J. Wysocki, and J. C. Cambier. 2006. Identification of anergic B cells within a Hospital Lupus Study Group. 2011. Association of a functional IRF7 variant with wild-type repertoire. Immunity 25: 953–962. systemic lupus erythematosus. Arthritis Rheum. 63: 749–754. http://www.jimmunol.org/ by guest on September 28, 2021

Supplmental Data

Supplemental Table 1. Genes differentially expressed by T1 B cells derived from B6- Ifnb‒⁄‒ mice versus B6-Ifnb+/+ mice in the same environment. BM-chimeric mice were generated by reconstitution with equal numbers of BM derived from CD45.1 Ifnb+/+ (WT) mice and CD45.2 Ifnb‒⁄‒ (KO) mice into irradiated CD45.2 Rag1‒⁄‒ mice. Recipient mice were sacrificed at day 15 post BM transfer. T1 B cells were sorted based on the expression of CD45.1 and CD45.2. BioMark qRT-PCR analysis was used to determine the expression of the indicated gene in Fluidigm single captured T1 B cells derived from CD45.1 Ifnb+/+ or CD45.2 Ifnb‒⁄‒ in recipient mice. The significance in difference of expression between the WT (n =36) and KO (n =34) single cells is indicated by the P value in the Table. Data are mean of gene expression after normalization using the Clustvis analysis. Gene cluster analysis (shown on the left) was carried out using the Clustvis online software. Differentially expressed genes between WT and KO T1 B cells are red color coded. Significance was determined by the non-parametric Mann-Whitney test. All primers used are shown in the right.

Supplemental Figure 1. Verification of single cell gene expression in T1 B cells. T1 B cells were FACS sorted from the spleens of 4-mo-old BXD2 mice. (A) Heatmap showing the expression of the indicated genes in single T1 B cells. The expression of Cd19 and Cd23 was used as the marker genes for B cells. The expression levels of Cd3 and Cd317 (the gene encoding PDCA1) were used as marker genes for T cells and pDCs, respectively. Forward and reversed primers used for amplification of Cd3 are ATGCGGTGGAACACTTTCTGG and GCACGTCAACTCTACACTGGT; and for amplification of Cd317 (Bst2) are TGAAGTCACGAAGCTGAACC and TGACACTTTGAGCACCAGTAG. Primers used for amplification of Cd19 and Cd23 are described in Supplemental Table 1. (B) X and Y axis show principal component (PC)1 and PC2 that explain 56.7% and 20.1% of the total variance, respectively. PCA was carried out based on the expression of Ifnb and Ifna genes from a total of 153 individual T1 B cells isolated from 3 BXD2 mice (left) or based on PC1 and PC2 segregation of IIfna1, Ifna11, Ifna4, Ifna7 and Ifnab1 genes in the T1 B cell Ifna cluster and the Ifnb cluster (right). (C) Heatmap and PCA of the T1 B cell Cd93 cluster versus the T1 B cell Cd23 cluster from three BXD2 mice (n = 153) using the Clustvis web tool software. (D) Left: Representative flow cytometry plots for subpopulations of transitional B cells isolated from spleens of BXD2 mice (n=3). Lymphocytes were first gated on total CD93+ cells within the B220+ population followed by sub-gating based on IgM and CD23 expression. Right: Comparison of CD93 mean fluorescence intensity (MFI) in different subpopulations of transitional B cells from a total of 153 individual T1 B cells isolated from 3 BXD2 mice. (E) Hierarchical clustering heatmap showing the expression of the indicated genes in single T1 B cells isolated from the spleen of 3 individual BXD2 mice (Results are mean ± s.d.; P < 0.05, P < 0.01, Tukey’s multiple comparison one-way ANOVA test). For all PCA plots, prediction ellipses are such that with probability 0.95, a new observation from the same group will fall inside the ellipse.