Unraveling the Function of Trehalose Biosynthesis Genes in Lateral Root Development

Acknowledgement

Unraveling the function of trehalose biosynthesis genes in lateral root development

Celine DE MAESSCHALCK

Master‟s dissertation submitted to obtain the degree of Master of Biochemistry and Biotechnology Major Plant Biotechnology Academic year 2009-2010

Promoter(s): Prof. Dr. Tom Beeckman Scientific supervisor: Drs. Lorena López Department Plant Biotechnology and Genetics VIB - Department Plant Systems Biology

Acknowledgement

ACKNOWLEDGEMENTS

First I would like to thank Prof. Dr. T. Beeckman for the opportunities to make my Master thesis possible in his Lab. También me gustaría agradecer a Lorena por haber sido tan buena consejera y por la preocupación que siempre ha mostrado. Ella me ha apoyado durante todo el proceso de componer y analizar los informes. I also need to thank the other people in the lab, Gert, Dominique, Boris, Giel, Marlies, Leen, Wei and Maria, who helps me when I had some questions or problems during the pratical work and to motivate me during writing. Daarnaast moet ik mijn medestudenten bedanken: Evy, Isabel, Morgane, Silke, Lynda, Brecht en Wolf, voor de leuke vijf jaar als student. Ook een dankwoordje voor de klimmers, Bram, Kristof en Thomas die steeds luisterden naar mijn avonturen over epjes wegen en zijwortels tellen. Bram wil ik nog eens extra bedanken voor het nalezen en verbeteren van mijn thesis en steeds klaar te staan met nuttige tips and tricks. Thomas zorgde dan weer voor de muzikale noot gedurende mijn thesis. Ook de brugse vrienden en vriendinnen moet ik bedanken: Loesje voor de Girls-talk en er gewoon te zijn wanneer het nodig was, Charlotte voor het leren van mijn eerste zinnetjes spaans, de scouts,…. Dan hebben we natuurlijk ook de oppeppers van de muffe PC-klas: Annelies, Fien, Silke, Lieven en Brecht. Bedankt voor de gezellige pizza avonden, de vele lachmomenten met onze over-uitbundige Silke, het oplossen van de rebussen op het oppep-bord, de Rihanna muziek op de late uurtjes, het klagen/zagen/raadgeven en vooral het samen schrijven. En als laatste mag ik ook niet mijn ouders en zusjes vergeten te bedanken, voor hun onvoorwaardelijke steun gedurende mijn hele studie en deze thesis. Het is niet altijd gemakkelijk geweest, maar ze bleven toch steeds in mij geloven.

Thank all of you!! Celine Table of contents

TABLE OF CONTENTS Acknowledgements ...... I

List of abbreviations ...... IV Samenvatting ...... VI

Summary ...... VII

1 Introduction ...... 1 1.1 Trehalose ...... 2

1.1.1 The synthesis of trehalose ...... 2

1.1.2 The breakdown of trehalose ...... 3 1.2 Trehalose pathway enzymes ...... 4

1.2.1 Trehalose phosphate synthases (TPS) in plants ...... 5

1.2.2 Trehalose phosphate phosphatases (TPP) in plants ...... 6 1.2.3 trehalase ...... 7

1.2.4 The relationship of the enzymes ...... 7

1.3 The modulation of the trehalose pathway in plants ...... 9 1.3.1 Trehalose-6-phosphate (T6P) ...... 9

1.3.2 TPS1 ...... 9

1.3.3 The inflorescence arcitecture ...... 10 1.3.4 Starvation ...... 11

1.3.5 Sucrose ...... 12

1.3.6 Abiotic stress...... 12 1.3.7 Nitrogen ...... 13

1.4 Lateral root development ...... 14

1.4.1 Lateral root development ...... 15 1.4.2 Lateral root initation (LRI) ...... 15

1.4.3 The developmental stages of the lateral root ...... 19

2 Aim ...... 20 3 Results ...... 21

3.1 Expression pattern of TPP genes ...... 21

3.1.1 Expression during lateral root development ...... 22 3.1.2 Expression in the root tissue ...... 24

3.1.3 TPP genes expression pattern ...... 25

Table of contents

3.2 Effects of knockout and overexpression TPPB lines in the development of A.Thaliana...... 26

3.3 Effects of day length on the root growth of TPP knockout and overexpression lines ...... 28

3.4 The effect of trehalose on the plant growth of knockout and overexpression TPP lines ...... 31

3.5 Effect of sucrose on plant growth in different TPP knockout and overexpression lines ...... 33

3.6 Effect of drought on the growth of the TPP mutant lines ...... 34

3.7 The effects of nitrogen starvation on root/shoot biomass in knockout and overexpression lines ...... 36 4 Discussion ...... 39

4.1 Expression pattern of TPP genes ...... 39

4.2 Effects of TPPB knockout and overexpression in the development of A.Thaliana ...... 40

4.3 Effects of day length on the root growth of TPP knockout and overexpression lines ...... 41

4.4 The effect of trehalose on the plant growth of knockout and overexpression TPP lines ...... 41

4.5 Effect of sucrose on plant growth in different TPP knockout and overexpression lines ...... 42 4.6 Effect of drought on the growth of the TPP mutant lines ...... 42

4.7 The effects of nitrogen starvation on root/shoot biomass in knockout and overexpression lines ...... 43

4.8 Conclusion ...... 43

5 Material and methods ...... 44

5.1 TPP-GUS/GFP markerlines ...... 44

5.2 TPP knock-out and overexpression lines ...... 44 5.3 Plant materials and general growth conditions ...... 45

5.3.1 Sucrose (Acros-organics, Geel, Belgium) ...... 45

5.3.2 Trehalose (Sigma-Aldrich, Steinheim, Germany)...... 45 5.3.3 Validamycin A ...... 45

5.3.4 Sorbitol ...... 45

5.3.5 Nitrogen ...... 45 5.4 Expression and localization analysis ...... 46

5.5 Phenotyping of the lateral root and the root...... 46

5.6 Phenotyping of leaf development ...... 47 5.7 Phenotyping of the biomass ...... 47

5.8 RNA EXTRACTION, cDNA SYNTHESIS AND Q-PCR ...... 47

5.9 Statistical measurements ...... 47

Table of contents

6 References ...... 48

7 Addendum ...... 54

7.1 Sterilisation seeds ...... 54 7.2 Growth media: ½ MS ...... 54

7.3 Gus staining ...... 54

7.4 Clearing roots by (Malamy & Benfey, 1997) ...... 55 7.5 Embedding plant material ...... 55

7.6 Microtome use ...... 59

7.7 Measure the root lenght ...... 62 7.8 RNA extration protocol ...... 63

7.9 RNA clean-up ...... 63

7.10 cDNA synthesis ...... 64 7.11 qPCR ...... 64 7.12 qPCR primers ...... 65

III

List of abbreviations

LIST OF ABBREVIATIONS

ABA abiscisic acid ADP adenosinediphosphate AGPase ADP glucose pyrophosphorylase ALF4 ABERRANT LATERAL ROOT FORMATION4 AR adventitious root A.t Arabidopsis thaliana bp basepair BR brassinosteriods C cortex CDK Cycline-dependent kinases cDNA complementary DNA CK cytokinins CL continuous light CYC cyclin DAF Days after flowering DAG Days after germination DIC differential interference contrast dNTPs deoxynucleotidtriphosphate E endodermis E.coli Escherichia coli EP epidermis FACS fluorescence-activated cell sorter Fru6P fructose-6-phosphate fw forward G phases Lag or Gap phases G1P glucose-1-phosphate G6P glucose-6-phosphate GFP green fluorescent protein GUS β-glucuronidase h hours HATS high-affinity transport system HXK HEXOKINASE IL Inner layer KO knock out KRP kinesin-related protein LATS low-affinity transport system LR lateral root LRF lateral root formation LRI lateral root initiation LRP lateral root primordium

List of abbreviations

M phase mitosis phase MS Murashige and Skoog N nitrogen NA no ammonium NAC no amplification control NH4 ammonium NN no nitrate NN-NA no nitrate-no ammonium NO3 nitrate NTC no template control OE overexpression OL outer layer ON overnight PR primary root Q-PCR quantitative PCR RAM root apical meristem RA3 RAMOSA3 RBR retinoblastoma-related protein RH Root hair RSA root system architecture RT-PCR Reverse transcriptase PCR rev reverse S.c Saccharomyces cerevisiae S.I Selaginella lepidophylla SNF sucrose- non fermenting1 SnRK1 SNF1 related kinase S phase synthesis phase T6P trehalose-6-phosphate TPP trehalose phosphate phosphatase TPS trehalose phosphate synthase Tps1 T6P synthase (yeast) Tps2 T6P phosphatase (yeast) Tre trehalose TreH trehalase TreP trehalose phosphorylase TreS trehalose synthase TreT trehalose glycosyltransferring synthase TreY maltooligosyl-trehalose synthase TreZ maltooligosyl-trehalose trehalohydrolase UBQ ubiquitin UDP uridine diphosphate UDPGlc uridine diphosphateglucose Val A Validamycin A WT/wt wild type x-gluc 5-bromo-4-chloro-3-indolyl glucuronide

Samenvatting

SAMENVATTING

Suikers zijn essentieel voor het overleven van planten. Deze worden meestal gesynthetiseerd in planten met behulp van de fotosynthese. Suikers kunnen functioneren als directe en transporteerbare energiebron en bovendien kunnen ze ook de groei en de ontwikkeling van de plant coördineren. Een belangrijke suiker in planten is trehalose. Dit is een niet-reducerend disaccharide dat voor het eerst werd ontdekt in Saccharomyces cerevisiae en in Escherichia coli. Voor de synthese van trehalose wordt er gebruik gemaakt van twee sleutel-enzymen, trehalose-6-fosfaat synthase enerzijds en trehalose-6-fosfatase anderzijds. Trehalose-6-fosfaat synthase vormt trehalose-6-fosfaat uit een molecule glucose-6-fosfaat en een molecule UDP-glucose. Trehalose-6-fosfatase defosforyleert het trehalose-6-fosfaat tot trehalose en anorganisch fosfaat. Trehalose kan ook terug afgebroken worden door trehalase, met de vorming van twee moleculen D-glucose. Heterologe expressie van microbiële trehalose synthase/fosfatase genen kan veranderingen in groei, ontwikkeling, metabolisme en stressresistentie veroorzaken in hogere planten. Deze effecten wijzen op een regulatorische functie van trehalose in deze planten. Via genomisch onderzoek werden verschillende homologen van de relevante trehalose biosynthese genen gevonden in planten. Om de precieze functie van trehalose of van het intermediair trehalose-6-fosfaat te achterhalen, wordt gebruik gemaakt van transgene planten met een trehalose-6-fosfaat synthase/fosfatase gen van gistof E.coli of van planten met een mutant enzym uit de trehalose pathway. Zo is er aangetoond dat de knock-out van het trehalose-6-fosfaat synthase1 gen embryo-lethaal is, wat het belang van trehalose aanduidt in de ontwikkeling van de plant. Voor de andere trehalose-6-fosfaat synthase genen is er tot op heden geen gelijkaardige functie gevonden. Verschillende studies hebben echter wel het belang van trehalose-6-fosfaat in de ontwikkeling en overleving van de plant aangetoond. Zo is er aangetoond dat een verlaagd trehalose-6-fosfaat gehalte zorgt voor de activatie van de „verhongeringsfactor‟ KIN10. Daarentegen zorgt een verhoogd trehalose gehalte voor betere droogte resistentie. Bij de meeste studies die gedaan zijn op trehalose werd echter gebruik gemaakt van enzymen uit gist of E. coli . In dit werk wordt nagegaan wat de functie is van trehalose-6-fosfaat fosfatase tijdens wortelontwikkeling in Arabidopsis. Hiervoor kijken we eerst waar de verschillende trehalose- 6-fosfaat fosfatase genen tot expressie komen in de primaire wortel en de zijwortels. Vervolgens proberen we de functie van deze genen te onderzoeken door middel van een studie van de ontwikkeling van wortel en/of stengel onder verschillende condities zoals een veranderde daglengte en onder stress condities. We onderzoeken het effect van exogeen trehalose en het gevolg van meer of minder sucrose in het groeimedium. De resultaten tonen aan dat trehalose-6-fosfaat gerelateerd is aan het koolhydaat gebruik van de plant.

Summary

SUMMARY

Sugars are essential for the survival of plants. Those are mostly synthesized in plants with the aid of photosynthesis. Sugars can function as direct and transported energy sources. However they can also coordinate the growth and development of the plant. One of the sugars in plants is trehalose. This is a non-reducing disaccharide first discovered in Saccharomyces cerevisiae and in Escherichia coli. For the synthesis of trehalose, there are two key enzymes: trehalose-6-phosphate synthase and trehalose-6-phosphatase. Trehalose-6- phosphate synthase uses one molecule glucose-6-phosphate and one UDP-glucose to produce trehalose-6-phosphate. Trehalose-6-phosphatase will dephosphorylate trehalose-6-phosphate to trehalose and an inorganic phosphate. Trehalose can be broken down by the enzyme trehalase, thereby forming two molecules of D-glucose. Heterologous expression of microbial trehalose synthase/phosphatase genes in plants causes alterations in growth, development, metabolism and stress resistance in higher plants. These alterations indicate that trehalose might have a regulatory function in plants. Trough genome analysis several homologues of the trehalose biosynthetic genes were found in plants. To investigate the function of trehalose or the intermediate trehalose-6-phosphate, transgenic plants with a trehalose-6-phosphate sythase/phosphatase of yeast or Escherichia coli or plants with own mutant trehalose enzymes were used. The knockout of trehalose-6-phosphate synthase1 gene causes an embryo-lethal phenotype. This underscores the importance of trehalose in the development of the plant. For other trehalose-6-phosphate synthase genes no similar function in plant development is described. However, some studies do show the importance of trehalose-6-phosphate in development and survival of the plant. A decreased level of trehalose-6-phosphate causes activation of the starvation factor KIN10. On the other hand an increased level of trehalose enhances the resistance to stress (e.g. drought stress). However, most studies on trehalose were done in yeast or Escherichia coli. In this study we investigated the function of the trehalose-6-phosphate enzyme during root development in Arabidopsis. Therefore, we first looked where the ten different trehalose-6- phosphate phosphatase genes are expressed in the primary and lateral root. Next, we wanted to determine the exact function of the trehalose phosphate enzyme by looking at the development of root and/or shoot in different conditions such as altered day length or under stress conditions. We also tested the effect of exogenous trehalose and the effect of having more or less sucrose in the growth medium. Our findings indicate that trehalose is involved in the regulation of carbohydrate metabolism in plants and has some response to stress conditions.

VII

Introduction

1 INTRODUCTION Sugars are fundamental to life, they represent direct and transported energy sources (Paul et al, 2008). Most sugars are polysaccharides, which are a longer-term energy store. But sugars can also have important hormone-like functions as primary messengers in signal transduction. The central feature of biological systems is the communication of internal and external information and is necessary for the coordination of metabolism with development and environmental pressures. The nutrient availability is the main extracellular factor, that controls the growth and the metabolism of the different organisms (Rolland et al, 2002). In plants, atmospheric carbon dioxide is converted to more complex organic compounds such as sugars through photosynthesis. The yield of photosynthesis is large and determines the sugar status. The sugar status then modulates and coordinates internal regulators and the environmental cues that govern growth and development (Koch, 1996; Sheen, 1999; Smeekens, 2000). The plant uses different types of sugars such as glucose, fructose, sucrose, trehalose, etc.. These sugars help the plant to grow and to develop. Glucose and fructose are monosaccharides and are the basic units of biologically important carbohydrates. These are the building blocks of disaccharides (such as sucrose and lactose) and polysaccharides (such as starch). Disaccharides are formed when two monosaccharides undergo a condensation reaction. Trehalose and sucrose are two non-reducing disaccharides with a different configuration. Trehalose consists of two glucose disaccharides linked in an α-1,1-α configuration and sucrose consists of a glucose and a fructose unit linked in an α,β-1,2- configuration (Figure 1).

Figure 1: Structures of trehalose (A) and sucrose (B) presented as cyclic Haworth projections. Both sugars are disaccharides formed from two monosaccharides. (Figure adapted from Paul et al, 2008)

Introduction

1.1 TREHALOSE Like mentioned before trehalose is a nonreducing disaccharide consisting of two α-1,1-α linked glucose molecules (Figure 1). It is present in a wide variety of organisms, including bacteria, yeast, fungi, insect, invertebrates and lower or higher plants. Trehalose serves as an energy source, but in plants and yeast it may also serve as a signaling molecule to direct or control certain metabolic pathways or to affect growth (Elbein et al, 2003). However, the precise function of trehalose is still not clear.

1.1.1 THE SYNTHESIS OF TREHALOSE There are five known trehalose biosynthetic routes in different organisms (Figure 2). First there is the OtsA-OtsB pathway, also called the TPS/TPP pathway. This pathway is the most widespread one, it is found in all prokaryotic and eukaryotic organisms that synthesize trehalose and it is the only pathway found in plants. There are two enzymes to synthesize trehalose, first trehalose phosphate synthase (TPS) and then trehalose phosphate phosphatase (TPP). TPS catalyzed the transfer of glucose from UDP-glucose to glucose-6-phosphate (G6P) with the formation of trehalose-6-phosphate (T6P) and UDP (uridine diphosphate). The TPP dephosphorylates T6P with the formation of trehalose and an inorganic phosphate (Pi) (Figure 2a). This pathway is the only one that has T6P as an intermediate. This pathway is studied in Saccharomyces cerevisiae (S.cerevisiae) (Bell et al, 1998) and Escherichia coli (E.coli). Another pathway found in eukaryotes is the TreP pathway. This is the potential reversible synthesis from glucose-1-phosphate (G1P) and glucose to trehalose and inorganic phosphate. The reaction is catalyzed by trehalose phosphorylase (TreP) (Belocopitow & Marechal, 1970; Wannet et al, 2000). There are also three pathways in the prokaryotes (Figure 2b). The first is the TreS pathway, where trehalose synthase (TreS) isomerizes the α1-α4 bond of maltose to the α1-α1 bond of trehalose (Tsusaki et al, 1996). The second pathway was a two-step conversion from malto- oligosaccharides or α-1,4-glucans to malto-oligotrehalose and subsequently trehalose. The name of that pathway was the TreY-TreZ (Maltooligosyl-trehalose synthase and Maltooligosyl-trehalose trehalohydrolase) pathway (Elbein et al, 2003; Maruta et al, 1996a; Maruta et al, 1996b). Finally, the TreT pathway is catalysed by trehalose glycosyltransferring synthase (TreT) (Qu et al, 2004; Ryu et al, 2005). This uses ADP (adenosinediphosphate)- glucose and glucose to form trehalose.

Introduction

Figure 2: Five different trehalose synthesis pathways. (a) in eukaryotes and prokaryotes (b) in prokaryotes. UDP, uridine diphosphate; Glucose-6P, glucose-6-phosphate; T6P, trehalose-6-phosphate; Glucose-1P, glucose-1-phosphate; ADP, adenosine triphosphate. (figure adapted from paul et al, 2008)

1.1.2 THE BREAKDOWN OF TREHALOSE The breakdown of trehalose is catalyzed through the TreH (trehalase) pathway, this is the only pathway in the different organisms (Figure 3). Trehalase catalyzes the breakdown of trehalose in two D-glucose molecules (Muller et al, 2001). Trehalase can be inhibited by Validamycin A (Val A) in a dose-dependent manner (Goddijn et al, 1997; Kameda et al, 1987). In the presence of high concentrations Validamycin A, trehalose is not degraded to glucose and there is a strong reduction in root elongation (Wingler et al, 2000).

Figure 3: Trehalase pathway to break down the trehalose into two molecules glucose. Figure adapted from (Avonce et al, 2006)

Introduction

1.2 TREHALOSE PATHWAY ENZYMES Depending on the various organisms, the synthesis of trehalose has different pathway possibilities (Figure 2). But for plants there is just one pathway, the OtsA-OtsB pathway or the TPS/TPP pathway. This pathway requires two enzymes, the TPS and the TPP, to form trehalose. Those enzymes were first discovered in yeast Saccharomyces cerevisiae and Escherichia Coli (Leyman et al, 2001). In Saccharomyces cerevisiae, the trehalose biosynthesis reaction is catalyzed by T6P synthase (Tps1) and T6P phosphatase (Tps2). These enzymes are part of a complex with two other proteins Tsl1 and Tps3, who has no catalytic activity (Bell et al, 1998). The Tps1 has only a TPS1 domain, the Tps2 has a TPS1-similar domain (similar to S.cerevisiae TPS1) and a TPS2 domain with phosphatase boxes (Figure 4). In E.Coli, this reaction is catalyzed by OtsA (trehalose-6-phosphate synthase) and OtsB (trehalose-6-phosphate phosphatase) (Kaasen et al, 1994). Those proteins display sequence homology with the subunits of the Saccharomyces cerevisiae trehalose-6-phosphate synthase/phosphatase complex (Figure 4). OtsA is homologous to the full-length TPS1, the N- terminal part of TPS2 and an internal region of Tsl1. OtsB has homology to the C-terminal part of TPS2, but not to other subunits. Homologous genes present in species like rice, maize, potato, tobacco, Arabidopsis, canola and cotton shows that trehalose metabolism is not restricted to specific taxa. The functions of these homologous genes has not been elucidated. Some are able to complement yeast strains mutated in their trehalose metabolism, which suggest a similar role in plant metabolism (Goddijn & van Dun, 1999). Most studies that unravel the function of those enzymes, used transgenic plants with the overexpression of OtsA or OtsB. In this project is used the knockout and overexpression lines of the TPP genes of Arabidopsis to unravel the function of trehalose and T6P in different conditions.

Figure 4: Distribution of TPS1, TPS1-like and TPS2 domains within the different trehalose biosynthesis genes. Escherichia Coli (E.Coli) OtsA and OtsB; Saccharomyces cerevisiae (S.c.) TPS1 and TPS2; Selaginella lepidophylla (S.I.); TPS1, Arabidopsis thaliana (A.t.) Class I: TPS1-4, A.thaliana Class II: TPS5-11 and A.thaliana TPPA-B . TPS, trehalose phosphate synthase. Figure received from (Leyman et al, 2001).

Introduction

1.2.1 TREHALOSE PHOSPHATE SYNTHASES (TPS) IN PLANTS In Arabidopsis thaliana, there are 11 genes coding for trehalose phosphate synthase (TPS) (Table 1). These TPS homologues were found after completing the A.thaliana genome sequence (Nature, 2000). The TPS-coding genes can be divided in two subfamilies according to their similarity with the yeast TPS1 or TPS2 (Figure 4). The first subfamily, Class I with AtTPS1-4, contain four highly similar genes. The gene At- TPS1 has been proven to encode a functional TPS-enzyme by complementation analysis in a yeast tps1 mutant. This AtTps1 enzyme is characterized by the presence of a unique N- terminal extension. The members of second subfamily, Class II with AtTPS5-11, are closely related to each other. These contain a C-terminal phosphatase domain, which is generally present in a large family of phosphatases that also includes yeast Tps2 (Leyman et al, 2001; Thaller et al, 1998). Table 1: Trehalose phosphate synthase genes of Arabidopsis thaliana. This showed the two subfamilies of the TPS genes in A. thaliana and also the AGI code of each gene and the gene structure are given. gene locus gene structure Class I TPS1 At1g78580

TPS2 At1g16980

TPS3 At1g17000

TPS4 At4g27550

Class II TPS5 At4g17770

TPS6 At1g68020

TPS7 At1g06410

TPS8 At1g70290

TPS9 At1g23870

TPS10 At1g60140

TPS11 At2g18700

Introduction

Bron: Paul et al 2008 PLAZA, a resource for plant comparative genomics

1.2.2 TREHALOSE PHOSPHATE PHOSPHATASES (TPP) IN PLANTS The Arabidopsis thaliana genome contains 10 genes (AtTPPA-J) that encode the trehalose phosphate phophatases (TPP) (Table 2). All the plant TPPs are characterized by a conserved amino acid motif characteristic similar to the 2-haloacid dehalogenase super family of enzymes (Burroughs et al, 2006; Paul et al, 2008). There are two candidate TPP genes (TPPA and TPPB), these were isolated from A.thaliana by multi-copy suppression of the heat sensitivity of yeast tps2Δ mutant (Vogel et al, 1998). Both of these genes are expressed in flowers and young developing tissue of Arabidopsis. The TPPA and TPPB genes contain two phosphatase consensus sequences that have been found in all TPP enzymes (Figure 4). However, besides the sequence similarity of these phosphatase domains, there is low similarity to the other TPP genes (Goddijn & van Dun, 1999). The TPP A and B enzyme dephosphorylated T6P but not glucose-6-phosphate or sucrose-6- phosphate. That indicates the existence of a trehalose biosynthesis pathway in plants (Vogel et al, 1998). Table 2: Trehalose phosphate phosphatase genes of Arabidopsis thaliana. This showed the TPP genes in A. thaliana with their AGI code and the gene structure are given. gene locus gene structure TPPA At5g51460

TPPB At1g78090

TPPC At1g22210

TPPD At1g35910

TPPE At2g22190

TPPF At4g12430

TPPG At4g22590

TPPH At4g39770

TPPI At5g10100

TPP J At5g65140

Introduction

Bron: Paul et al 2008 PLAZA, a resource for plant comparative genomics

1.2.3 TREHALASE Arabidopsis thaliana has one trehalase gene (Table 3). Trehalase converted trehalose to two D-glucose molecules. The function of this enzyme is determinate by Validamycine A, which is a trehalase inhibitor (Goddijn et al, 1997). The expression of trehalase in A.thaliana is presented in flowers and seeds. Trehalase is a plasma membrane-bound enzyme with catalytic domain oriented toward the cell wall, indicating extracellular activity (Frison et al, 2007). Table 3:Trehalose phosphate hydrolase gene of Arabidopsis thaliana. This showed the TreH gene in A. thaliana with their AGI code and the protein coding gene model are given. gene locus Gene structure trehalase At4g24040

Bron: Paul et al 2008 Tair (The arabidopsis information resource)

1.2.4 THE RELATIONSHIP OF THE ENZYMES The phylogenetic tree (Figure 5) exhibits clearly the three subgroups of the TPS and TPP genes, as previously described: Class I (AtTPS1-4), Class II (AtTPS5-11) and Class III (AtTPPA-J). The Class I and II both have a fused TPS domain and seem monophyletic with the fungal TPS. Class III includes small protein with only a TPP domain. Therefore it is likely that this class was recruited in plants after divergence from fungi since they are not present in the latter organisms as single domain (Avonce et al, 2006). This indicates a high evolutionary correlation between TPP and TPS domains.

Introduction

Figure 5: Relationship of the TPS and TPP genes. Showed a rooted tree of the amino acid sequence alignment of the 21 putative trehalose metabolism proteins in Arabidopsis thaliana compared to yeast Tps1 and Tps2. (Ramon , unpublished)

Introduction

1.3 THE MODULATION OF THE TREHALOSE PATHWAY IN PLANTS

1.3.1 TREHALOSE-6-PHOSPHATE (T6P) Trehalose-6-phosphate is an intermediate of the OtsA-OtsB pathway and the precursor of trehalose (Figure 2). The information about this precursor has been gained from the analysis of mutant and transgenic plants which has altered phenotypes (Paul, 2008). Analysis showed that T6P controls carbohydrate utilization and the growth would be controlled by glycolysis in a manner analogous to the yeast. The control of T6P is indispensable for the development of the plant (Schluepmann et al, 2003). Tobacco and Arabidopsis plants with a high T6P level have high photosynthetic capacity per unit leaf area due to more Rubisco and chlorophyll (Pellny et al, 2004). Low T6P levels produced the opposite phenotype, namely a lower photosynthetic capacity per unit leaf area. It is likely T6P affects early leaf development which affects leaf size and investment of photosynthetic apparatus. It is unclear if the effect on photosynthesis is linked to the impact of T6P on starch synthesis. Therefore looked to the ADP-glucose pyrophosphorylase (AGPase) that catalyzes the first commited step of starch synthesis independently of light. Leaves of T6P synthase-expressing plants had increased redox activation of AGPase and increased starch, where TPP-expressing plants showed the oppossit. The TPP expression prohibited the increase in AGPase activation in response to sucrose or trehalose feeding. The result showed that T6P allowing starch synthesis to be regulated independently of light. (Kolbe et al, 2005). The transformation of S.cerevisiae TPS1 with a CaMV35S in tobacco and rice lead to smaller leaves and leaf area that would like improve drought tolerance. This construct causes no longer the developmental changes typically occurring in plants with high T6P, yet this mediate resistance to a variety of abiotic stresses including drought, cold and salt tolerance. Drought tolerance by way of TPS overexpression in chloroplasts suggests the trehalose or T6P accumulation in this compartment is important in triggering drought responses. The expression of the E.coli OtsA/OtsB gene fusion yielded rice plants with reduced photo- oxidative damage which maintained photosynthesis during the initial exposure to drought compared to wild type control (Garg et al, 2002). It can be concluded that certain targets of protections to abiotic stress by trehalose metabolism are found in the chloroplast compartment. The precise function of trehalose on abiotic stress is explain further on.

1.3.2 TPS1 The function of the TPS genes was discovered by the study of the function of TPS1. Eastmond et al. reported the tps1 mutant in Arabidopsis, that showed a disruption in the gene that codes for the enzyme that catalyzes the first step of trehalose biosynthesis (trehalose-6- phosphate synthase). The tps1 mutation is recessive embryo lethal (Figure 6). Tps1-mutants show a normal embryo morphogenesis, however the development is retarded (Gomez et al, 2006) For wild type embryo‟s it takes 18 days after flowering (DAF) to reach an embryo at the end of the maturation phase with fully expanded cotyledons. In contrast, the tps1 embryos in the same silique have just completed morphogenesis and have reached the torpedo or early cotyledon stage (Figure 6a) whereas wild type embryos reach the torpedo stage at 7 DAF (figure 6b). It is suggested that TPS1 plays a major role in coordinating cell wall biosynthesis

Introduction and cell division with cellular metabolism during embryo development. And thus indicates an essential requirement of the trehalose pathway in plants. Furthermore, the expression of yeast TPS1 is sufficient to allow trehalose accumulation in transgenic tobacco plants and to cause an altered carbohydrate metabolism, morphological changes and an improved drought tolerance (Romero et al, 1997). The TPS1 is also required for the sustained growth in Arabidopsis, including during the floral transition (van Dijken et al, 2004). This is shown by a vegetative tps1 mutant who shows retarded growth with small rosette leaves. In summary, tps1 mutants have a decreased root meristematic region, a reduced leaf growth and an absence of floral transition.

Figure 6: Embryo development of wild type (WT) versus tps1 embryo’s. (a) development of WT compared with tps1 at different embryo stages. The numbers on the scale represent days after flowering (DAF). (b) WT stages of development used for comparison with tps1 embryos in microarrays and electron microscopy experiments. WT torpedo-stage embryos were excised from the seeds seven DAF and bent- cotyledon and tps1 embryos were taken at 15 DAF. (figure recieved from (Gomez et al, 2006))

1.3.3 THE INFLORESCENCE ARCITECTURE The inflorescence branching, a major yield trait in crops, is controlled by the developmental fate of the axillary shoot meristem (Ward & Leyser, 2004), which is regulated by several growth regulators like auxins, cytokinins and carotenoid derivatives (Schmitz & Theres, 2005). The inflorescence branching in maize is regulated by three RAMOSA genes (Vollbrecht et al, 2005). Satoh-Nagasawa et al., showed that RAMOSA3 (RA3) encodes a trehalose-6-phosphate phosphatase. This RA3 regulates the inflorescence branching by the modification of a sugar signal that moves into the axillary meristems (Figure 7). The RA3 TPP activity was tested by a phosphate release assay with the use of a recombinant RA protein (Klutts et al, 2003). This showed that RA3 catalysed phosphate release from T6P but not from other sugar phosphates or general substrate of protein phosphatase, indicating that it might act specifically as a TPP. The TPP activity is also confirmed by the complementation of a yeast TPP mutant (Devirgilio et al, 1993) by RA3. These data indicate that RA3 acts specifically as TPP in vivo

Introduction

Figure 7: RA3 wild type and mutant phenotype. (a) a mature wild-type ear (b) a mature ra3 ears introgressed into B73 (left) or in a mixed genetic background (right) had normal branches and irregular seed rows. Figure received from (Satoh-Nagasawa et al, 2006).

1.3.4 STARVATION The plant undergo continuous multiple types of stress, failure to mount an initial „emergency‟ response may results in nutrient deprivation and irreversible senescence and cell death. The stress signaling is partly regulated by the evolutionarily conserved energy sensor protein kinases, SNF1 (sucrose-non-fermenting1) in yeast and SnRK1 (SNF1-related kinase) in plants. Recent work indentified two Arabidopsis protein kinases (PKs), KIN10 and KIN11, these are central regulators of the transcriptome in response to multiple types of stress (Baena- Gonzalez, 2010; Baena-Gonzalez et al, 2007; Baena-Gonzalez & Sheen, 2008). These are designated as SnRK1s, orthologes of the yeast SNF1 and target a wealth of signaling and regulatory factors. If now see these factors in the trehalose signaling. In most plants, trehalose accumulates to trace amount and implicates in development, stress respons and metabolism (Paul et al, 2008; Ramon & Rolland, 2007). Studies showed that overexpression of AtTPS1 are more resistance to drought. The T6P levels are correlated with increased expression of many stress genes as well as those encoding KIN11 and the S6 ribosomal kinase AtS6K2 (Avonce et al, 2004; Schluepmann et al, 2004). This can implicated the regulation of sugar metabolism controlling the rate of starch synthesis through redox modification of ADP-glucose pyrophosphorylase (AGPase) (Kolbe et al, 2005; Lunn et al, 2006). There is a interplay with SnRK1 suggest by the observation of the activation state of AGPase in potato in the study of Tiessen et al,2003. Recently it was shown that T6P could inhibit AtSnRK1 activity at much lower concentration than those reported for G6P (Toroser et al, 2000; Zhang et al, 2009). Different studies demonstrate that T6P is regulated photosynthesis and starch synthesis, this process is mediated by activation of ADP-glucose pytophosphorylase. (Figure 8) And this response is dependent on expression of SNF1-related kinase (SnRK1) and affected transcripts who are playing a central role in the respons to starvation (Baena-Gonzalez et al, 2007; Kolbe et al, 2005). Recent is demonstrated that T6P functions as inhibitor of SnRK1, the microarray data showed a upregulation of T6P in the biosynthetic reactions and down-regulation of SnRK1. This indicate that T6P, trehalose and AtTPS1 promote the seedling development, photosynthesis, carbohydrate regulation and stress adaptive responses.

Introduction

Eukaryotes

Figure 8: Role of trehalose pathway in eukaryotes. Trehalose-6-phosphate (T6P) plays a central role in the regulation of sugar metabolism and plant development. Glucose and trehalose are important keys to serveral signaling and regulatory pathways. G6P, gluceose-6-phosphate; TPS, trehalose-6-phosphate synthase; TPP=,trehalose-6-phosphate phosphatase; HXK1, hexokinase1; SnRK1, SNF1-related kinase; AGPase, ADG-glucose pyrophosphorylase; ABI4, Abscisic acid insensitive 4 and UDPG, UDPglucose . Figure received from (Iturriaga et al, 2009).

1.3.5 SUCROSE Sucrose is the main product of the photosynthesis. Sucrose is exported from the leaves to provide the rest of the plant with carbon and energy needed for the growth and the synthesis of storage reserves (Lunn & Furbank, 1999). Sucrose therefore functions as transport sugar, storage reserve but also as solute and signal compound. Sucrose can affect the expression of genes involved in cell division and differentiation. Sucrose has also been implicated in the control of many developmental processes such as induction of flowering, the differentiation of vascular tissue (Lunn & MacRae, 2003).

1.3.6 ABIOTIC STRESS Plants have the ability to modify their morphology according to environmental conditions like stress conditions. Trehalose can act as a protectant in response to different stress conditions in a large number of microorganisms (Wiemken, 1990). In the yeast Saccharomyces cerevisiae, the trehalose accumulation is correlated with thermotolerance (Devirgilio et al, 1993) and resistance to cold and water stress (Mackenzie et al, 1988). A correlative evidence suggests that trehalose can stabilizes proteins and membrane structures under stress (Iwahashi et al, 1995). In plants, the role of trehalose in stress tolerance (e.g.drought) is demonstrated for cryptobiotic species such as the desiccation-tolerant S.lepidophylla. In higher plants, the trehalose accumulation is more rare. This suggests that in most plants, the role of trehalose as preservative during desiccation can be taken over by sucrose (Wiemken, 1990). Therefore a combination of the accumulation of both sucrose and trehalose might be sufficient to protect

Introduction the plant against effects caused by desiccation. Importantly, trehalose can stabilize dehydrated biological structures such as lipid membranes or enzymes more effectively than other sugar (Colaco et al, 1995). Garg et al. demonstrated that controlled overexpression of the trehalose biosynthetic genes in rice had a considerable potential for the improvement of abiotic stress tolerance and increased productivity under stress and non-stress conditions. This study confirms that tolerance to multiple abiotic stresses can be managed by means of overexpression of trehalose biosynthesis pathway components without the negative pleiotropic effects as were seen in previous studies. Furthermore the increase in trehalose levels in transgenic lines results in a higher capacity for photosynthesis and a decrease in the amount of photo-oxidative damage during stress. Thus, there it is suggested that trehalose accumulation leads to stress tolerance (Table 4). This has also been shown by transgenic research with microbial trehalose biosynthesis genes (Iordachescu & Imai, 2008). Table 4: Transgenic plants expressing trehalose biosynthesis genes with 35S promoter , Otsa = E.coli trehalose-6-phosphate synthase, TPS1= trehalose-6-phosphate1. (received from(Iturriaga et al, 2009)) Used gene origin Transformed Tolerance reference plant TPS1 Yeast Tobacco Drought (Holmstrom et al, 1994) OtsA E.Coli Tobacco Drought (Garg et al, 2002; Pilon- Smits et al, 1998)

TPS1 Yeast Potato Drought (Yeo et al, 2000)

TPS1 Yeast Tomato Drought, salinity (Cortina & Culianez- Macia, 2005)

TPS1 Arabidopsis Arabidopsis drought (Avonce et al, 2004)

1.3.7 NITROGEN Nitrogen is an important nutrient for plants, its avaibility is a major limiting factor for plant growth. The main source of nitrogen (N) in the soil are ammonium, nitrite and nitrate. Two N- uptake mechanisms are described (Glass et al, 2002). The low-affinity transport system (LATS) functions as N is plentiful and the high-affinity transport system (HATS) functions as N is limiting. In Arabidopsis, a high external N concentration showed a reduced primary and lateral root elongation. In contrast, the LR elongation is induced under a N-limit (Linkohr et al, 2002). So the lateral root density is relatively constant during different nitrogen conditions. The lateral root growth is systemically inhibited in the response to globally high levels of N, but locally induced in response to N-rich patches. So in Arabidopsis, there are characterized four morphological adaption‟s to the nitrogen supply. First a local stimulatory effect of external nitrate on lateral root elongation, second a systemic inhibition of high tissue nitrate concentrations on the activation of lateral root meristems, third a suppression of lateral root initiation by high C:N ratio and last the inhibition of primary root growth and stimulation of root branching by external L-glutamate (Zhang et al, 2007). The regulation of the root nitrogen uptake for the whole-plant signaling of N status examined a molecular level in A.thaliana plants to expression analysis of AtNrt2.1 and AtAmt1.1. These

Introduction genes display a clear upregulation of their expression in response to N starvation (Koltermann - + et al, 2003; Lejay et al, 1997) and it encodes starvation-induced high-affinity NO3 and NH4 transporters. AtNrt2.1 expression is regulated by shoot-to-root signals of nitrogen demand. This is the first identified molecular target of the long-distance signaling informing the roots of the whole plant‟s nitrogen status. In contrast, AtAmt1.1 expression is depending on the local nitrogen status of the roots and it is stimulated in the portion of the root system directly + experiencing nitrogen starvation. There is a suggestion that the NH4 uptake system is much - less efficient than the NO3 uptake system. The AtNrt2.1 is strongly upregulated by moderate level of N limitation while AtAmt1.1 transcript level is markedly increased only undersevere N deficiency (Gansel et al, 2001).

1.4 LATERAL ROOT DEVELOPMENT Plant roots are responsible for the uptake of water and nutrients from the soil, as well as to respond to abiotic and biotic stresses. In this process, the root and the shoot communicate in a reciprocal manner. The plant root also function as a physical anchor in the soil (Nibau et al, 2008). The plant root system consists of a primary root (PR) (Figure 9), this is formed during the embryogenesis and has dividing cells in the tip-meristems. During development, some cells within the PR have the ability to divide and form lateral roots (LR) (Figure 9). These LR branch out of the PR and increase the total surface area of the root system. The new roots allow the plant to explore the soil environment. Adventitious roots (AR) (Figure 9) are formed post-embryonally at the shoot-root junction and are important for the exploration of the upper soil layers (Nibau et al, 2008). The lateral root formation and development is influenced by different factors like hormonal and environmental signals, but those factors will also affect other components in the root system architecture (RSA) and the overall root surface area (root hair development, PR growth and AR formation). Therefore lateral roots are a good model to study the genes that regulate plant growth in response to different treatments.

Figure 9: Components of the root system. A typical dicot (e.g Arabidopsis) seedling root system, constisting of a primary root (PR), lateral root (LR), adventitious root (AR) and root hairs (RH). (figure adapted from (Nibau et al, 2008))

Introduction

1.4.1 LATERAL ROOT DEVELOPMENT Plants make lateral roots during their development through the stimulation of the mature pericycle cells, to proliferate and redifferentiate. The stimulation of those pericycle cells is coordinated by cell division and differentiation (Benkova et al, 2003).The pericycle cells are the outermost layer of the stele, which contains phloem, xylem and stellar parenchyma cells. Each of those cell layers forms vertical files of cells and traces to meristematic initials in root apical meristem (RAM). The pericycle founder cells are defined as „cells that acquire a developmental fate different from that of their mother‟ and, as a consequence, play a role during the first stages of LRI (Dubrovsky et al, 2001). This indicate the central role of those pericycle cells in the creation of a developmental potential that is needed for the development of the root system. The whole process of lateral root initiation and so the specification of the pericycle cells is triggered by auxin.

1.4.2 LATERAL ROOT INITATION (LRI) To investigate lateral root initiation, there is developed a hypothetical model (De Smet et al, 2006), consists of different steps depending on different factors (Figure 10). The first event is the specification of the lateral root founder cells to form a lateral root primordium (LRP). How this specification is activated, is not fully understood. A founder cell is a pericycle cell that provides the initiation of the primordia and needs a specification- and activation signal. So after the specification, the pericycle founder cell proceeds to the first formative division. Therefore the founder cell needs to be activated by different factors. The second event of the LRI model takes place at the xylem pole of the root. The specified founder cell will now enter the S-phase, this process is induced by auxin, allowing the G1-to-S transition in the cell cycle (Box 1). After completion of DNA synthesis, a third event starts that requires ALF4 (ABERRANT LATERAL ROOT FORMATION4). The ALF4 is necessary to bring the cells in a mitosis-competent stadia. For the last events a local auxin accumulation is needed in the founder cells, which is built up via the GNOM/PIN1-controlled auxin efflux. This auxin- accumulation is required for the induction of the asymmetric divisions of the founder cells allowing the formation of the lateral root initiation. In summary, lateral root initiation requires asymmetric divisions, first transversal or anticlinal and then periclinal. The formation of a lateral root depends on the auxin concentration, the cell cycle progression and the developmental stadia of the pericycle.

Introduction

Figure 10: Hypothetical model for lateral root initiation. (1) the first event is the specification of the founder cells, the initial trigger is unknown (indicated as ?) (2) auxin-induces a G1-to-S transition (3) followed by a pre-mitotic phase mediated by ALF4 (4) an auxin gradient is built up in the founder cells through the GNOM-mediated targeting of the auxin efflux carrier PIN1 to particular cell walls (5) the asymmetric division is initiated. (Figure received from (De Smet et al, 2006))

The lateral root initiation requires several checkpoints of which two are crucial (De Smet et al, 2006). The first is the specification of the founder cells in the pericycle. These founder cells provide the formation of the lateral root primordia. The second checkpoint comprises the formative divisions to form a lateral root, an initial transversal and anticlinal oriented divisions and than followed by a periclinal division. This control point depends on the concentration of auxin, which is dependent on auxin transport through the root primordia.

Introduction

Box 1: The cell cycle The cell cycle is a tightly coordinated process that can be divided in to four distinct phases. These distinguish the cellular events from the replication of genetic material to the segregation of duplicated chromosomes into two daughter cells (Dewitte & Murray, 2003). The lag or gap (G) phases separates the replication of the DNA (S phase from the segregation of the chromosomes (M phases, mitosis). The G1 phase intercedes between the previous mitosis and the entry into the next S phase. The G2 phase separates the S phase from the subsequent M phase, the cells of this phase have a double DNA content. The gap phases acts as a control of the previous phases, so that these are accurately and fully completed. If no M phase takes place, there is an endoreduplication process. Only the replication of the DNA continues making the cell polyploid. The G1-to-S transition is important because the cell integrates signals to activate a division program (G0/G1), to commit to genome duplication and to cell division (Gutierrez et al, 2002). The cell cycle initiates upon stimulation by different growth factors such as cytokines, auxins, brassinosteroids, sucrose and gibberellins (Inze & De Veylder, 2006). These mitogens trigger the production of D-type cyclins (CYCD) and activated CDK (cycline-dependent kinases) during the late G1 phase (De Veylder et al, 2003). So the CDKs who were activated by D-type cyclins will push cells into the next phase of the cell cycle, the G1-to-S transition point (Figure 10). This transition point is controlled by the E2F/retinoblastoma-related (RBR) pathway.

Figure 11: Regulation of the G1-to-S transition in plants (schematic representation). BR, brassinosteriods; CYCD, D-type cyclin; CDKA, A-type CDK; CDKF, F-type CDK; CDKD, D-type CDK; CYCH, H-type cyclin; ABA, abiscisic acid, KRP, kinesin-related protein; RBR, retinoblastoma-related protein (figure received from Inze & De Veylder, 2006)

Introduction

When and which pericycle cells are primed to become LR initiation site (Beemster et al, 2003; De Smet et al, 2007)? The position of Arabidopsis LR formation is determined in a region at the transition between the meristem and the elongation zone, called the basal meristem (Figure 12). This meristem is immediately behind the primary root apical meristem (RAM). It has been shown that the auxin signaling in the central cylinder of the basal meristem is correlated with the lateral root spacing. The disruption of the auxin response in the xylem pole pericycle cells blocked the initial asymmetric division of founder cells. The pericycle founder cells must have been exposed to an inductive auxin signal which is because their nuclei are able to migrate to the common cell wall. So close to the root apex in the basal membrane, the priming of xylem pole pericycle cells become founder cells by occuring auxin signaling (Figure 12).

Figure 12: A schematic longitudinal and transversal presentation of the different tissue in root and root tip (a). The lateral root priming occurs in the basal meristem. (b) the auxin signaling maximum present in the root tissue, reported by the DR5::GUS marker line (De Smet et al, 2007). The regularly spaced auxin accumulation sites in the protoxylem primes the adjacent pericycle cells to become pericycle founder cells. (figure received from (Peret et al, 2009))

Introduction

1.4.3 THE DEVELOPMENTAL STAGES OF THE LATERAL ROOT Malamy & Benfey, 1997 described that the formation of the lateral roots occurs in eight morphological stages (Figuur 1). The first stage has an increased frequency of the anticlinal divisions, these divisions are perpendicular on the root axis and influence the diameter of the lateral root (12 A). In the second stage a periclinal division takes place, this division is parallel to the root axis and makes the lateral root longer (12 B). After this event the lateral root primordia will have two cell layers (the outer and the inner cell layer (OL-IL)). In the third stage, the outer cell layer divides in two layers (OL1 and OL2), leading to the formation of three cell layers (12 C). In the fourth stage, the inner layer divides periclinally thereby giving rise to four cell layers (12 D). During this stage, the lateral root primordia penetrate through the endoderm of the main root. In the fifth stage, the central cells of both outer layers divide anticlinal with the formation of four small cuboidal cells (12 E-F). The cells next to the cells of OL1 and OL2 will also divide and create an OL1 that contains 10-12 cells. In stage six the outer layer undergoes periclinal divisions and a new inner layer is built up (12 G-H). The four central cells divide periclinal and the lateral root primordia now penetrates the cortex and the epidermis of the main root. At this stage, there is already a strong resemblance to a mature root tip. The characterization of the divisions is very difficult in stage seven (12 I). At this stage, 8-10 central cells are formed and additionally, 8-10 cells form at one side of the central cells. In the last stage, the emergence stadium, there is an 8-8-8 pattern (12 J-K). Both sides and the central cells will now have eight or up to ten cells.

Figure 13: Lateral root development. (A-L) The stages of lateral root primordium development, Nomarski images of cleared whole mount of 2- to 6-week old roots. See text for details. (figure received from (Malamy & Benfey, 1997))

Aim

2 AIM Trehalose was discovered first in yeast and bacteria E.coli and it was related to function as a sugar for stress protection and carbon reserve (Bell et al, 1998). Later on, it was found that trehalose was also present in plants. For the synthesis of trehalose, plants need trehalose-6- phosphate synthesis (TPS) and trehalose-6-phosphate phosphatase (TPP) (Eastmond et al, 2002; Paul et al, 2008). We are interested in understanding the function of TPP genes in root development of Arabidopsis thaliana. To know where these TPP genes are expressed in the tissue of the roots and lateral roots TPP marker lines were used. Furthermore we wanted to investigate the phenotypes of TPP mutant plants with putatively different levels of trehalose or trehalose-6-phosphate in plants. This was done by looking at the main and lateral roots growth and leaf development of these mutant lines in different growth conditions. Given the phenotypes displayed by plants overexpressing E. coli TPS and TPP genes, we tried to confirm these phenotypes by modulating the expression of the endogenous AtTPPs. Therefore we looked at the effect of different conditions such as light, sugar, trehalose, drought and nitrogen in the growth of TPP knockout and overexpression plants.

Results

3 RESULTS To unravel the function of the trehalose biosynthesis genes we used a knockout and an overexpression line of the trehalose-6-phosphate phosphatase enzymes and looked at their development under different sugars and light, nitrogen starvation and drought conditions.

3.1 EXPRESSION PATTERN OF TPP GENES To investigate the expression of the individual TPP genes in the root we used TPP-GUS/GFP markerlines. These TPP-GUS/GFP allow to detect were TPP is expressed by mean of β- glucuronidase activity or green fluorescent protein (Figure 14). For the construction of TPP- GUS/GFP reporter lines, a 2kb promoter fragment of each TPP was cloned in frame with the gene coding for β-

Figure 14: promoter-GUS-GFP marker line. These glucuronidase (β-gluc) and GFP. β-gluc is markerlines are building up by the promoter of the TPP an E.Coli derived enzyme that catalyzed gene and is coupled with the β-glucuronidase gene and the green fluorescent gene. When the promoter is the conversion of X-gluc (5-bromo-4- activated a blue unsoluble precipitate is formed in the chloro-3-indolyl glucuronide) to 5,5‟- tissue where the TPP gene is expressed. dibromo-4,4‟-dichloro-indigo forming an insoluble blue precipitate in the cell were β- gluc was expressed. This allowed us to detect in which cells the promoter was activated. To choose at which genes we will looked for the root and LR development we look at the

Figure 15: Expression pattern of Class III TPP genes in young seedlings. The pictures are taken two days after germination, plants were grown on ½ MS with 1% sucrose in continuous light. A detail view of the whole seedling, the shoot meristematic zone and root tip. Seedlings were stained with GUS for 4h. (Lopez, L., unpublished data)

Results expression pattern of Class III TPP genes in the young seedlings (Figure 15). This figure shows that AtTPPA has overall overexpression in seedling tissue from root tip to the leaf primordia. The AtTPPH, AtTPPI and AtTPPJ are expressed in lateral and columella root cap cell zones, the AtTPPD is expressed strongly in this zones. The meristemic zone has expression of AtTPPA and AtTPPG in the epidermal layer, AtTPPB in a specific root zone (suggestion in the pericycle cells) and AtTPPI in endodermal layers. The AtTPPC, AtTPPE and AtTPPF showed no expression in the seedlings, therefore we will not looked to there expression in our study. And for the coupes we will not use the AtTPPJ, because this showed only a weak expression in the root cap and is not easy to detect.

3.1.1 EXPRESSION DURING LATERAL ROOT DEVELOPMENT To look at the expression of TPP genes during lateral root development, plants were grown on ½ MS (Murashige and Skoog) media for 5DAG (days after germination). GUS staining was performed and roots were cleared. Analysis was done by using the differential interference contrast (DIC) microscope (40x). For the TPPA gene there is a weak expression present in the pericycle of the root in stage I to IV (Figure 16). From stage V, there is a clear expression in the tissue of the lateral root . The TPP B gene was expressed in the pericycle cells of the main root during the whole lateral root development. GUS staining was also present in the lateral root itself, but not in the epidermis of the lateral root. There was no expression in the lateral root for TPPD, only in the vasculature of the main root. This was shown clearly in the emergence stadia of the lateral root. There was almost no expression of TPPG development. But in the emergence stage of the lateral root there was a weak expression in the epidermis cell of the lateral root. The TPPH gene was expressed during the whole LR development and expressed in the vascular tissue of the main root as well in the lateral root a blue band in the middle of the lateral root. TPPI was expressed in both the cortex of the lateral root as in the main root. There was no detectable expression of TPPJ during the lateral root formation. Just a blue spot in the epidermis of the lateral root present for the TPPJ, this can be the consequent of leakage of GUS staining.

Results

Figure 16: A detailed overview of TPP reporter genes expression in lateral root iniatiation of five days old seedlings. The lateral root development consisted of eight different stages (Malamy & Benfey, 1997). TPP genes that were analyzed are TPPA (A), TPPB (B), TPPD (D), TPPG (G), TPPH (H), TPPI (I) and TPPJ (J). Picture were taken by a DIC microscope (40x). The plants are stained overnight with GUS.

Results

3.1.2 EXPRESSION IN THE ROOT TISSUE To understand where the TPP genes are expressed in the root, plants were grown on ½ MS media for 3DAG. Plants were GUS-stained and the roots were cleared, followed by an embedding protocol to prepare them for making transversal and longitudinal coupes of the root and the root tip. The slides made from the coupes were analysed by the DIC microscope (40x) (Figure 17). The aim of the coupes is to increase the resolution of the picture that you get from the whole mounted root in lactic acid because you are able to distinguish the different cell layers of the root. We have to take into account that we need a strong GUS staining in the seedlings because after the whole process of dehydration, rehydratation and technovit, there is a lot of staining that can be faded away. Thus it doesn‟t mean that when there is no expression, that it is not there. It can mean that you can not see it or that it is not detectable. The coupes showed that TPPA has a weak expression in the epidermis cell by the longitudinal section. This epidermal expression was not visible in the transversal section. The TPPB gene showed no expression in the transversal and longitudinal sections. On the other hand TPPD root tip has clear expression in longitudinal section. The TPPG showed a little expression in the epidermis on the longitudinal section, this is not visible on the tranversal section. The TPPH root has expression in the pericycle cells and in the vasculature tissue, that was visible on the transversal section. Overall expression in the vasculature tissue and pericycle for the TPPI gene, saw on the longitudinal and transversal section.

Figure 17: Expression pattern of the TPP genes in main root. The transversal section through mature zone of the seedlings root and a longitudinal section of the root tip from the seedlings. The seedling roots were 3-days old. This is done for different TPP genes. Only the representative TTP genes are shown. The picture of the coupes were took by a Nikon camera on the DIC microscopy (40x).

Results

3.1.3 TPP GENES EXPRESSION PATTERN To summary the complete expression pattern of the TPP genes, we compared the findings of the promoter-GUS/GFP marker lines with the available microarray data. All these microarray data is collected in the eFP browser (www.bar.utoronto.ca/efp/development/). This site represented different data sources to look at the tissue specific expression of a given gene in root cells and other organs of the plant. The representation of data is an “absolute” expression level, this compared a user‟s gene in each tissue directly to the highest signal recorded for the given gene. Low levels of expression of a given gene are represented by yellow color, high levels by red (Winter et al, 2007). The absolute eFP browser data (Figure 18) of the root cells showed for the TPPA no color difference in the root tip. The TPPB showed that the stele cells were red in stage I of the root. A little expression in the stele at the stage I and III of the TPPD root tip. TPPG and TPPH had both almost no expression in the root tip. Besides the TPPI is expressed in the endodermis and the pericycle. And the expression was higher in the stage II than in stage I and III. The TPP J showed color difference in the epidermis, in the endodermis and the cortex of stage III. This can indicate that there is may be expression in the root tip for TPPJ.

Figure 18: Absolute root cell expression of root expressed TPP genes. Data were extracted from eFP browser (www.bar.utoronto.ca/efp/development/).

To obtain the data of the root expression, plant are grown for six days in16h-8h light conditions on ½ Ms media wit hour and a half percentage sucrose. The GFP-expressing cells were then isolated by protoplasting and FACS (fluorescent-activated Cell Sorting). Their mRNA were analyzed with the use of microarrays, ATH1 genechip (Brady et al, 2007). We have to take in mind that the data is received by FACS, for that reason we can looked to different tissue separatly. The absolute data (Figure 19) for the root shows that the TPPA has expression in the epidermis of maturation zone. The TPPB is expressed in the pericycle of the root and also in the lateral root tissue. For the TPPD, there was no expression visible in the different zones of the root. TPPG showed expression in the cortex of the whole root and a higher expression in the epidermis of the elongation zone. Almost no expression for the TPPH gene in the root, only a weak expression in the pericycle of the maturation zone. Besides the TPPI is expressed in the cortex, endodermis and the pericycle on different places in the root. This gene has also expression in the lateral root tissue. And the TPP J showed no expression in the root, just a little bit in the root cap.

Results

Figure 19: Detailed root expression of some TPP genes. Data were extracted from eFP browser.

3.2 EFFECTS OF KNOCKOUT AND OVEREXPRESSION TPPB LINES IN THE DEVELOPMENT OF A.THALIANA. Preliminary results have shown that KO lines of TPPB display a better root and shoot growth than the wilt type and the opposite is true for the OE lines. In order to get details of such phenotypes in the different lines, we looked at the development of lateral roots by counting the number of root primordia at different stages. And in the case of the shoot, the leaf area of 21DAG plants was determined together with the cell area and the cell number of the first pair of leaves of the same age plants. For the lateral root primordia staiging, two different KO and two different OE plants were grown on ½ MS in continuous light. After 6DAG, the roots were cleared (Malamy & Benfey, 1997). The staiging of the plant was done by DIC microscope (40x objective). The previous results showed that the knockout lines have more lateral roots, and the overexpression lines on the other hand have less LR to know whether this process is affected in the priming or in the emergence of the LR, we scored the number of primordia in each stage of lateral root development in 6DAG seedlings. For the root length we saw that all the lines are significant against the wild type (Figure 20). Tppb1 showed more primordia and LR than the wild type. The overexpression lines versus the knockout lines showed that the knockout forms more primordia than the overexpression. And the knockout lines proved more LR in the emergence stadia than the overexpression and the wild type. Looking to the early LR development, we saw a significant higher number for the knockout lines than for the overexpression.

Results

Figure 20: Phenotyping of the lateral root development in the TPP B lines. (A) lateral root development for the TPPB lines, early = stage I-III, late = stage IV-VII and emergence = stage VIII (B) number of LR and primordia (C) main root length and (D) LR and primordia density. Plant were grown 6DAG. The data is the mean of 6 plants and the error bars are the standard deviations of these data. Signification is determine between the wild type and the overexpression/knockout lines, * = P <0.05; ** = P <0.01; *** = P <0.001 and no * = no signification

For the determination of the leaf area, cell area and the cell number, plants were grown on horizontal plates for 21DAG in 16-8 light conditions on ½ MS media. To count the cells and stomata, leaf 1 and 2 were cleared in 100% etanol:acetone 9:1 V/V ON and transferred to lactic acid for 12h. Pictures of the abaxial side were taken and an area of about 30 epidermal cells was determined by Image J, in the same area stomata and epidermal cells were counted. For the total leaf area, pictures of the whole leaf were taken and analyzed with Image J. Previous results have shown that the leaf area of knockout lines is larger than for overexpression and wild type lines. By leaf series, from the cotyledons to the newest leaf, we determined the leaf area, length and width for each leaf, and the total leaf area of each mutant using 6 plants per line. Looking to the cell area of the leaf, the knockout lines had slightly bigger cells than the wild type and the opposite is true for the overexpression lines (Figure 22A). The number of stomata per cm2 was slightly higher in the OE lines than in the wt and it was smaller in the KO lines (Figure 22B), the same for the total cells per cm2 (Figure 22C). Although these differences were not statistically significant. If we looked to the total leaf area then we saw that the knockout lines had higher leaf area than the wild type, the overexpression Figure 21: Leaf series of 21DAG knockout and lines were smaller than the wild type. overexpression plants of TPPB grown in vitro. Looking at the leaf series (Figure 21), the Pictures were taken with a Nikon camera, and knockouts lines have larger leaves than the analyzed by Image J. wild type and the overexpression lines showed the oppossite (Figure 22D). And the knockout lines have also more leaves at 21DAG than the wt, while the overexpression lines has less (Figure 22E).

Results

Figure 22: Phenotype of the leaf growth in TPPB mutants. (A) cell area in mm2, (B) number of stomata per cm2 , (C) number of cells per cm2, (D) total leaf area in mm2 and (E) leaf area for the leaf series in mm2. All these values are measured with Image J. The data that is showed is the mean of 6 plants and the error bars are the standard deviations of these data. There is no signification for the cell area, total cells/cm2 and #stomata/cm2 and no signification measured for the total leaf area and leaf area.

3.3 EFFECTS OF DAY LENGTH ON THE ROOT GROWTH OF TPP KNOCKOUT AND OVEREXPRESSION LINES Plants with higher T6P levels, by means of OE of TPS enzyme from E.coli are able to grow in high sugar conditions that are restrictive for the growth of wild type and TPP OE plants (Schluepmann et al, 2003). Overexpression of endogenous TPP genes on Arabidopsis could lead to lower levels of T6P, which will then activate KIN10 to trigger starvation responses (Baena-Gonzalez et al, 2007). To understand the involvement of T6P as signal molecule of the sucrose on the plant, knockout and overexpression lines of TPP genes with putatively high or less T6P content were analyzed under different light conditions. Plants were grown under different day length conditions to relate their phenotypes with high or low energy levels. The plants were grown for 11-13DAG on ½ MS media with 1% sucrose in continuous light, 16h-8h (day/night) and 12h-12h (day/night). The germination of all these plants took place in continuous light. The plants were phenotyped after 13DAG by counting the lateral roots under a binocular and by measuring the main root length with Image J. These two parameters are used to deduce the lateral root density (Figure 25). The TPS1 overexpression line works as a positive control for high T6P in the plant.

Results

Figure 23: Main root length in different light Figuur 24: Number of the lateral root in conditions. (A) CL (continuous light) (B) 16h- different light conditions. (A) CL (continuous 8h (C) 12h-12h. The data is the mean of 7 plants light) (B) 16h-8h (C) 12h-12h. The data is the for the CL and 16h-8h conditions and 4 plants mean of 7 plants for the CL and the 16h-8h for the 12h-12h, the error bars are the standard conditions and 4 plants for the 12h-12h, the error deviations. For the signification, the knockout bars are the standard deviations. For the line were compared with the overexpression line signification, the knockout line were compared (indicated with a line) and the wild type with the with the overexpression line (indicated with a knockout/overexpression line ( * = P <0.05, ** line) and the wild type with the =P <0.01, *** =P <0.001, no * =no knockout/overexpression line ( * =P <0.05, ** signification). =P <0.01, *** =P <0.001, no * =no signification).

The number of LR in the continuous light is lower for KO and OE of TPPs compared with the wild type and this is showed by signification of the different genes except for TPPG and TPPH (Figure 24A-B). The same is noticeable for the 16h-8h conditions. On the other hand the data of the 12-12h conditions showed lots of variation and there is just signification for the TPPG, TPPH and TPPI by comparing the knockout line with the overexpression line. The last ones have more lateral roots (Figure 24C). If we now compared the knockout with the overexpression lines in the other conditions then we saw that the knockout has a higher number of LR than the overexpression lines, except for the TPPG and TPPI. The TPS1 overexpression line followed in the CL and in the 16-8h conditions, the growth pattern of the knockout lines.

Results

The main root length was for the CL and 16-8h conditions almost the same between overexpression, knockout and wild type (Figure 23A-B). Most lines showed a longer roots for the knockout lines than the overexpression lines with signification. Only TPPG in 16-8h and TPPI in both conditions showed the opposite expression with signification. For the 12-12h conditions most lines have shorter roots than the wild type except for tppd and TPPH (Figure 23C). Only the TPPI has signification for the comparison with wild type. Looking to the knockout lines versus the overexpression lines we saw that the TPPD and TPPH has signification, but they have the opposite growth. The TPPD has longer roots for the knockout while the overexpression line of TPPH has longer roots. The TPS1 followed also in the root length, the expression range of the knockout lines. The root density for the knockout and overexpression lines showed almost the same trend as the one detected by the number of LR and the main root length. This parameter showed how many LR are formed in a centimeter of the root. For the CL and 16-8h conditions there is no big difference between the mutant lines and the wild type (Figure 25A-B). Although most lines showed that the knockout has higher expression than the overexpression, again is the opposite significant for the TPPG and TPPI. As saying for the LR number and root length, the

Figure 25: Root density in different light 12-12h conditions showed a lot of difference conditions. (A) CL (continuous light) (B) 16h-8h between the lines (Figure 25C). Only the (C) 12h-12h The data is the mean of 7 plants for TPPG, TPPH, TPS1 and TPPI showed a the CL and 16h-8h conditions and 4 plants for the 12h-12h, the error bars are the standard deviations. clear trend. But only the ttpg and TPS1 has For the signification, the knockout line were some signification in comparison with the compared with the overexpression line (indicated wild type en the TPPI has signification with a line) and the wild type with the knockout/overexpression line ( * = P <0.05, ** = between the knockout and overexpression. In P <0.01, *** = P <0.001, no * = no signification). this line, the overexpression has a higher density than the knockout.

Results

3.4 THE EFFECT OF TREHALOSE ON THE PLANT GROWTH OF KNOCKOUT AND OVEREXPRESSION TPP LINES To look at the effect of exogenous trehalose on the root growth of TPP mutant lines, seedlings were grown on 10mM trehalose 1xMS media with and without 10µM ValidamycinA, sorbitol was used as an osmotic control. The plants were germinated in continuous light and grown in 12h-12h conditions for 14DAG. Trehalose is a sugar that can be used by the plant as a carbon source, the plant is able to hydrolyze trehalose into two molecules of glucose by means of the trehalase enzyme. Although when validamycin A is added to the media, the activity of TPP enzyme is blocked and the accumulation of trehalose lead to plants with arrested root growth (Wingler et al, 2000).

Figuur 26: Trehalose and sorbitol plates with a concentration of 10mM for the TPPA gene. (A) sorbitol without ValA (B) sorbitol with ValA (C) trehalose without ValA (D) trehalose with ValA. ttpa = the knockout gene of TPPA, TPPA = the overexpression gene of TPPA. The plants were grown 14DAG in 12h-12h conditions, germination in contiuous light. (the same pictures were made for the other genes with same trend but no showing)

Results

Sorbitol was used an osmotic control, in this treatment plants germinated and grew normally. Although on media with trehalose, the seedlings grew slowly. In the presence of ValidamycinA, there is a strong inhibition of root growth (Figure 26). Plants grown on control treatment have the same root length for the wild type compared with the trehalose treatment (Figure 27). When we looked to the different TPP lines between the two treatments, we see that TPPG, TPPH and TPPJ have longer roots in the control treatment but it has no signification except the TPPH with trehalose. The TPPI has a big difference in length for both treatments; the control is almost the double in length compared with the trehalose. If we looked at the trehalose treatment, we cannot find a general trend for the knockout line compared with the overexpression. The TPPD, TPPH and TPPI has a signification between KO and OE. But the TPPD and TPPH has longer root in the knockout than in the overexpression, while the TPPI showed the opposite.

Figure 27: Main root length of the TPP genes in a 10mM trehalose or sorbitol treatment. (A) the sorbitol treatment (root length in cm) (B) the trehalose treatment (root length in cm). All the plants were grown in 12h-12h conditions for 14DAG. This data is the mean of 10 plants of each gene and the error bars are the standard deviation. For the signification, the knockout line were compared with the overexpression line (indicated with a line) and the wild type with the knockout/overexpression line ( * = P <0.05, ** = P <0.01, *** = P <0.001, no * = no signification).

Results

3.5 EFFECT OF SUCROSE ON PLANT GROWTH IN DIFFERENT TPP KNOCKOUT AND OVEREXPRESSION LINES As described by Schuelpmann et al., 2003, plants with high levels of T6P display shoots with smaller dark green leaves, while for TPP OE plant leaves look bigger and pale green, these phenotypes are related to the level of T6P in these plants. To tested the hypothesis of T6P as a sugar signal, TPP mutant lines were grown horizontally on rounded plates with ½ MS media with 1% sucrose (29.4mM) or without sucrose (29.4mM sorbitol, as osmotic control) and we looked at the shoot biomass. The plants germinated in continuous light and grew in 16/8 light conditions. Around every five days the growth of the plants was recorded by pictures. After 21DAG shoots were collected in eppendorf and dried out overnight and the biomass, namely dry weight, was determined the next day (Figure 28). To look at the effects of sucrose, we use some TPP KO and OE lines (Figure 28). The first time we did this, the treatment work not properly (data not showed). Because the concentration of sorbitol was to high, for the repeat we used less. And then the plants were able to grow, we determinate the growth by looking at the biomass of the shoot (Figure 28). The relative data showed for the 1% sucrose, that all the lines has a signification against each other except TPPH (Figure 28D ). And they all got a higher biomass for the knockout than for the overexpression. The knockout lines had a similar biomass as the wild type. For the TPPB and TPPD, there was a reduction of almost 50% against the wild type biomass. In the 0% sucrose data, any TPP line showed growth with significant differences (Figure 28C ). And if we looked to the different lines, there is no general pattern visible. The absolute data showed that the 1% sucrose plants have a weight of 2.5mg/plant while the 0% sucrose plants just have a weight of 1.2mg/plant (Figure 28A-B). There was thus a reduction around 50% for the biomass between the two sucrose conditions for both lines. The absolute data showed in most TPP genes that the knockout lines has a higher biomass than the overexpression. And this showed also that the 1% sucrose treatment has a better growth than the 0% sucrose.

Results

Figure 28: Shoot biomass of some TPP genes between conditions with and without sucrose. (A-B) absolute data (C-D) relative data compared with WT (1%=26.0625, 0%=12.4375). This data showed the mean of 4 plants for 1%sucrose and 2 plants for 0% sucrose, these were compared with the mean of the wild types of 8 plants for the relative data. The error bars are standard deviation. For the signification, the knockout line were compared with the overexpression line (indicated with a line) and the wild type with the knockout or overexpression line ( * = P <0.05, ** = P <0.01, *** = P <0.001, no * = no signification).

3.6 EFFECT OF DROUGHT ON THE GROWTH OF THE TPP MUTANT LINES Some studies showed that trehalose can act as a protectant in respons to different stress conditions. To prove the effect of trehalose or T6P on the drought tolerance, we used 25mM mannitol treatment for different mutant TPP lines.. Mannitol is widely use as an osmoticum in in vitro conditions for water-limiting conditions (Skirycz et al, 2010). Plants were grown horizontally in rounded plates containing ½ MS media with 1% sucrose with or without 25mM mannitol, they were germinated in continuous light and grown in 16h-8h. The shoot was collected at 21DAG and dried overnight, to measure the next day the shoot biomass. Around every fifth day, the growth of the plants was recorded by picturing the plates (Figure 29). If we now compared the mannitol with the 1% sucrose, than we saw that the wild type has a better growth then the knockout line and the Col-0. But for the overexpression line, the plants on the mannitol treatment looks bigger than the ones on the 1% sucrose. The plants growing on the mannitol treatment has more green color than the plants on the 1% sucrose. In both treatments, the knockout lines showed a biomass similar with the wild type (Figure 30). And for the TPPB, TPPD, TPPF and TPPJ overexpression lines have a significant reduction in comparison with the knockouts (Figure 31B and D). For TPPB and TPPD, there was in both treatments almost reduction of 50% of biomass. The TPPH in the mannitol treatment showed the opposite significant expression namely that the overexpression line has a higher biomass than the knockout. In the sucrose treatment, the difference between the lines is not significant. For the TPPs on Figure 31A and31 C, which are grown on other days but in

Results the same condition, there was no signification. And there is no difference between any line and the wild type, only for the overexpression TPPI in the 1% sucrose treatment. This line showed a biomass that is the double of the wild type, but is not significant.

Figure 29: Shoot growth for different sugar treatments for the TPP H lines. hsh4 = tpph, H6C=TPPH, Col = WT (the same pictures were made for the other genes but no showing)

In the absolute data we saw that the 1% sucrose plants have a biomass around 2.5mg/pI, while the mannitol plants have a biomass around 1.2mg/pI (Figure 30). Thus there is a reduction about 50% for the mannitol plants if they are compared with the 1% sucrose plants. This experiment is the repeat of one for the TPPD, TPPH and TPPJ lines (data not showed). And only for the TPPD gene, we saw the same expression pattern. The TPPH and TPPJ have an opposite expression pattern between the two experiments.

Figure 30: Absolute shoot biomass for mannitol or 1% sucrose treatments. (A-B) 1% sucrose, (C-D) 25mM mannitol. The plants of graph A and C are grown on the same days, the plants of graph B and D are grown 5 days latter but in the same conditions. The data is the mean of four plants, the error bars are the standard deviation. We looked to the signification for knockout among overexpression genes (indicating by a lines) and knockout or overexpression among wild type (* = P < 0.05, ** = P < 0.01,*** = P < 0.001, no * = no signification).

Results

Figure 31: Relative shoot biomass for mannitol or 1% sucrose treatment. (A-B) 1% sucrose, (C-D) 25mM mannitol. The plants of graph A and C are grown on the same days, the plants of graph B and D are grown 5 days latter but in the same conditions. The data are the mean of four plants compared with the mean of the 10 wild type plants and the error bars are the standard deviation. We looked to the signification for knockout among overexpression genes (indicating by a lines) and knockout or overexpression among wild type (* = P < 0.05, ** = P < 0.01,*** = P < 0.001, no * = no signification).

3.7 THE EFFECTS OF NITROGEN STARVATION ON ROOT/SHOOT BIOMASS IN KNOCKOUT AND OVEREXPRESSION LINES Plant growth is influenced by the nitrogen concentrations in the media, we therefore wanted to investigate the effect of nitrogen starvation on the plant growth. Wang et al, 2003 has already looked at the effect of nitrate but by using microarray analysis. Now we wanted to check if the microarray compared with the phenotyping of the biomass in nitrogen starvation conditions. We looked to three different nitrogen starvation conditions with either no nitrate (KNO3), no ammonium (NH4NO3) or none of both. The media is prepared by using micro/macro salt MS media with or without some nitrate and/or ammonium concentration. Plants were germinated in continuous light and were grown in 16/8 light conditions. The root and the shoot were collected after 12DAG in eppendorfs and dried out overnight to determine the biomass the next day (Figure 32). For the nitrogen starvation conditions, we saw that the no ammonium treatments has the most effect on the shoot/root biomass. In most cases has the mutant TPP lines higher biomass than the wild type. In the control treatment we saw that the knockout lines has a higher biomass than the overexpression. The same trend is visible in the NN and NA treatment, except for the TPPH in the NA treatment but this has no signification. If we looked at the NN-NA treatment than we the opposite of by the other treatments. The overexpression genes has a higher shoot/root biomass than the overexpression, except the TPPH. The TPPB mutant lines

Results

Figure 32: The nitrogen starvation for the TPP genes. A micro and macro salt starvation media. Looking to the shoot/root ratio (10-1mg). The data are the mean of three times two plants end the error bars are standard deviation. Each time we compared the overexpression or knockout genes with the wild type, but we also compared against each other (indicated by a line). NN = no nitrate, NA = no ammonium, NN-NA = no nitrate and no ammonium (* = P < 0.05, **=P <0.01,***=P <0.001, no * = no signification) showed in most cases a significant level. This data has now be compared with the microarray data of Wang et al, 2003. To control the experimental conditions regarding to the nitrogen starvation, we look for genes that are specifically related to nitrogen starvation conditions and we tested them by qPCR. The ones that we founded were two transport genes of nitrate and ammonium respectively, AtNrt2.1 and AtAmt1.1. And with the aid of Vector NTI™ and Beacon designer we looked for a forward and a reverse primer sequence of these marker genes.

Results

For the Q-PCR we used the program Q-base to analyze the data (Figure 33). We wanted to know if the marker genes of starvation were upregulated as expected and how was the regulation of some TPP genes under the different nitrogen starvation treatments. For the NN treatment, no genes are downregulated and all the TPP genes are upregulated. In the NA treatment only the TPPH is downregulated and TPPB and TPPD are upregulated. The NN- NA treatment showed upregulation for the TPPB, TPPD and TPPH but downregulation for the TPPJ. The NRT2.1 primers (Figure 33A) showed a very high upregulation when no ammonium is present.

Figure 33: Q-base date of the Q-PCR with different primers for the nitrogen starvation treatment. (A) the nitrate primers for different treatments (B) the other primers: the different TPP gene primer, the ammonium primers and the housekeeping genes (cDKA, EEF and UBQ). NN = no nitrate, NA = no ammonium, NN-NA = no nitrate-no ammonium and N control = normal nitrogen concentration.

Discussion

4 DISCUSSION Trehalose was discovered in yeast and E.coli as a stress protectant ,carbohydrate and carbon source (Bell et al, 1998). Although as minute amounts of trehalose can be found in plants it was thought to be a sugar with minor relevance for their development. Surprisingly 10 TPP genes can be found in Arabidopsis thaliana that have a not clear function in plant development. Therefore by using TPP marker lines and lines with different expression levels of AtTPP genes under different conditions, the importance of trehalose and trehalose-6- phosphate in root and shoot development can be unveil.

4.1 EXPRESSION PATTERN OF TPP GENES To elucidate the function of the TPP genes, we need a detailed analysis of their expression pattern. We looked at the expression of the genes in the root and the lateral roots by using promoter-GUS/GFP marker lines (Figure 16-17). Previously the expression pattern of TPP genes was analyze by GUS expression in whole mounted seedlings (Figure15) and by confocal microscopy. But the weak GFP expression was not useful in the generation of a high resolution map of TPP expression in different root cell types, therefore generation of coupes of the root was necessary to define cell type TPP expression. (Figure 17). The GUS staining depends on the expression level and on the tissue-specificity of the gene, but also on the time of the staining 1h/4h/ON. The disadvantage of the coupes is that they could lost a lot of blue color after the whole process of dehydration, rehydration and technovit. Therefore it is better when you get a strong GUS staining on the samples of your gene of interest, to see a clear expression after the coupes preparation. We investigated GUS-staining for the TPP genes in the roots by looking at transversal- and longitudinal sections of the root and all the stages of the LR development (Figures 16-17). This was done for all TPPs except TPPC, TPPE and TPPF which are not expressed in roots (Figure 18). Our expression analysis was compared with the published available microarray data displayed in the eFP browser (Figures 18-19). The concluding TPP expression pattern is described as follow TPPA and TPPG have expression in the epidermis of the root. And TPPA is also expressed in the pericycle when the LRs are formed. TPPB is activated in the pericycle and has expression in the lateral roots. TPPI is present in the LR and in the cortex of the root. In the vascular tissue of the roots there is expression of TPPD and TPPH. TPPD is also expressed in the root tip, like TPPJ. The expression patterns we discovered were highly similar to the available microarray data, although the expression of TPPI was different. The microarray data suggest TPPI-expression in the endodermis, cortex and pericycle while the GUS staining revealed expression only in the pericycle. Through the weak expression of TPPJ in the roots of young seedlings (Figure 15) we decided to make no sections, because the expression was to weak in the root tip to make it possible detect a staining in the root. By comparison of the yeast TPP, ScTPS2, with the AtTPPs a rooted tree was generated (Figure 5). This revealed that the 10 TPP-genes are divided into 3 groups, in one of these groups TPPA-G are together, interestingly these genes are expressed in the epidermis of the root and also in the pollen (data not shown). However the other grouped TPPs were not sharing common expression patterns. Plaza, a resource for plant comparative genomics

Discussion showed that the TPPs are duplications of a common ancestor, if these genes are duplications maybe they could act having a redundant function or in the other way evolve to more specialized functions which can be related to the specialized cell types where the TPPs are expressed. Based on these information we can now decide which genes we have to look for in specific conditions. This will help to unravel the specific function of each TPP gene in the trehalose metabolism of higher plants. By modulating the expression of TPP genes we hope to find phenotypes related to growth when plants, with probably high or low levels of T6P and trehalose, are subjected to different light, sugar, osmotic and nitrogen conditions.

4.2 EFFECTS OF TPPB KNOCKOUT AND OVEREXPRESSION IN THE DEVELOPMENT OF A.THALIANA Trehalose-6-phosphate is an essential component in the coordinated metabolism needed for plant growth adaption and development (Paul, 2007). Romero et al, 1997 suggest that the synthesis of trehalose alters sugar metabolism and regulatory pathways affecting the plant development and stress tolerance. Transgenic plants expressing Escherichia coli and Saccharomyces cerevisiae genes for trehalose synthesis showed strong developmental alterations like stunted growth, lancet-shaped leaves and disturbed root systems (Goddijn et al, 1997; Romero et al, 1997). In Arabidopsis, the TPPB gene is expressed in specific root tissues such as the pericycle cells and also in the lateral roots. To see whether the previously described effects are also present in Arabidopsis, we looked at the growth of overexpression and knockout lines of the TPPB gene in the root and leaves We looked for phenotypes during LR development and the leaf growth. We also investigated if our phenotype is indeed related to TPPB knockout or overexpression to compare we used two different knockout (KO) and overexpressor (OE) lines. Previous results shows that knockout lines have higher number of lateral roots and longer roots compared with the overexpression lines. We therefore looked at the number of primordia during the LR development, to order to determine whether more or less LR was related to higher number of primordia in the KO or to less emergence in the OE. The TPPB lines showed no big difference in number of primordia between the early and the late stage, but the number of emergenced LR is higher in the KO than in the OE and wilt type(Figure 20A). The OE lines retards the emergence of the lateral roots. For the KO lines we see that there is a higher number of early LR primordia, but the late primordia development has a similar number as the wild type and the OE line. When the T6P is depleted upon the overexpression of TPP, starvation responses will be trigger. As it is know that T6P is an inhibitor of KIN10, an important kinase involved in the regulation of starvation and stress inducible genes (Baena-Gonzalez, 2010). We can think that the depletion of T6P in pericycle cells and in the primordia is important for the development and emergence of LR, as is shown by less number of LR in TPPB OE lines. For the leaf area, previous results showed that KO lines looks like having a larger leaf area than the OE, but detailed experiments were needed to confirm this phenotype. The average of the cell size depends on the balance between division and expansion rates (Green, 1976). The TPPB KO lines have more cells per leaf than the OE lines, which suggest that T6P is more involved in processes of cell division than cell expansion. Previously it was described that mature stomata are indicators of the end of the proliferative activity (De Veylder et al, 2001).

Discussion

Leaves with many stomata indicate that the cell has less cell divisions and more cell expansion. We discovered that the TPPB OE lines have more stomata per centimeter than the knockout line, this also suggest that the T6P is more relevant for cell division than for cell expansion. Analysis of TPPB mutant lines thus show that the T6P is needed for the growth of the root and that its function is more related to cell division than cell expansion for the leaf development.

4.3 EFFECTS OF DAY LENGTH ON THE ROOT GROWTH OF TPP KNOCKOUT AND OVEREXPRESSION LINES Light and sugars regulate the growth activities by coordinated modulation of gene expression and enzyme activities in both carbohydrate-exporting (source) and carbohydrate-importing (sink) tissue (Rolland et al, 2002). This means that under more light the plant will have a higher amount of energy produced by photosynthesis allowing the plant to grow more. By looking at different light conditions we investigated whether TPP KO and OE plants have different growth under different day length conditions. The continuous light and the 16-8h conditions showed no clear difference between the mutant lines and the wild type (Figure results). The 12h-12h conditions gives the plant less light than in nature, this indicated that this conditions are may be starvation conditions. We saw here that the OE lines of TPPD and TPPG a better root density has. This indicates that maybe more trehalose helps the plant to survive in starvation conditions, these depends of KIN10.

4.4 THE EFFECT OF TREHALOSE ON THE PLANT GROWTH OF KNOCKOUT AND OVEREXPRESSION TPP LINES We investigated the effects of exogenous trehalose on the development of TPP mutants. The TPP overexpression lines have a higher level of trehalose while knockout lines have less. The KO lines can not synthesize trehalose. Therefore these KO plant are sensitive to trehalose. For that reason we investigated whether these plants show improved growth when treated with exogenous trehalose When trehalose is taken up, it inhibits root elongation in a concentration-dependent manner in wild type plants. Wild type plants show a strong inhibition of root-elongation (Wingler et al, 2000). The treatments with ValidamycinA allow to distinguish the effects of trehalose as a carbon source and as a potential signal molecule. Our data do not show any difference between the control and the trehalose treatment in root length (Figure27). It is possible that this is caused by the lower concentration of exogenous trehalose we used (10mM) whereas used 25mM exogenous trehalose (Wingler et al, 2000. If we compared the effect of trehalose between the knockout and overexpression lines, we even see that high concentration of trehalose can be toxic for the plant, because the TPPD and TPPH has longer roots in the knockout line than in the overexpression line. The Val A treatment (a trehalase inhibitor) indeed shows a strong reduction in root length for the trehalose (Figure 26). However also the plants in the osmotic control conditions show reduced root length. The later is probably due to an error in the set-up with the trehalase inhibitor.

Discussion

To draw further conclusions about the exogenous trehalose treatment, we need to repeat this experiment taking into account both concentration (25mM and 10mM) and we also look to the growth-effect after adding sucrose to the media like is done by Wingler et al, 2000.

4.5 EFFECT OF SUCROSE ON PLANT GROWTH IN DIFFERENT TPP KNOCKOUT AND OVEREXPRESSION LINES There is a support regulatory role for the T6P in plant growth and development (Schluepmann et al, 2003). Schluepmann and coworkers suggest that the cleavage of T6P rather than the synthesis of the end-products is responsible for the large pale leaf phenotype of the adult plants. To know if T6P regulates the carbohydrate utilization, we compared the relative shoot biomass of plants grown in with or without sucrose. The plants grown without sucrose showed many differences between the mutants lines (Figure 28A). But for the 1% sucrose treatment the knockout lines have roughly the same biomass as the wild type. Different overexpression lines of TPP like TPPD and TPPG, can show up to a 50% reduction in shoot relative biomass. This suggest indeed that the T6P could regulate the carbohydrate utilization during growth. This suggest indeed that the T6P could regulate the carbohydrate utilization during growth.

4.6 EFFECT OF DROUGHT ON THE GROWTH OF THE TPP MUTANT LINES Drought stress causes reduced plant growth (Boyer, 1982). To look at the effect of drought stress on TPP mutants the growth of arabidopsis is studied under mild osmotic stress conditions like 25mM mannitol (Skirycz et al, 2010), who concluded that the early leaf development, cell number and size is reduced by stress. We wanted to know if trehalose or T6P have some influence on the reduced growth during this mild osmotic stress. The results showed a high reduction of biomass for TPPB, TPPD, TPPF and TPPJ overexpression lines, whereas the knockout lines are the same as the wild type. This would suggest that plants with low T6P levels or in the other hand accumulating trehalose are sensitive to drought stress, while Romero et al, 1997 showed that the trehalose-accumulating tobacco plants have multiple phenotypic alterations like the improved drought tolerance. This could be because we use mild osmotic stress conditions during the whole cycle of the plants, while in the experiments of Romero et al., tobacco plants are grown on soil under normal watering conditions, subjected to a period of drought and watered again to record the recovery of the plants. This could mean that trehalose accumulation is more important for conditions of extreme drought followed by rewatering than in conditions of mild stress. To confirm the effect of drought stress by trehalose or T6P, we need to do a repeat. And we could do it may be by using two different concentration of mannitol to see if the mild or high osmotic stress also has some influence on the growth of the mutant TPP lines .What we also can do in the future is just a drought dewatering on soil like Romero et al, described for tobacco.

Discussion

4.7 THE EFFECTS OF NITROGEN STARVATION ON ROOT/SHOOT BIOMASS IN KNOCKOUT AND OVEREXPRESSION LINES Wang et al, 2003 has looked at the effect of nitrate by using microarray analysis. This showed that the nitrate response is stronger in the roots than in the shoots. And it revealed also that the effect of nitrate on gene expression is substantial and affect many genes involved in carbon and nutrient metabolism. This artikel suggest that nitrate could altered the T6P level, this affect then the glycolysis and behaves in plants as it does in yeast. The ammonium was reported to be superior to nitrate for growth of some plant types (Guo et al, 2007). And that the effects of ammonium supply on the plant growth results from its effects on regulatory processes by which plants adjust their metabolism to nitrogen assimilation. The different nitrogen forms affects the dry matter distribution and carbohydrate consumption, and it has been shown that ammonium inhibits the root growth. Our data showed that the knockout lines have higher ratio than the wild type for the control, NA and NN treatment, the NN-NA treatment have the opposite. Wang et al, 2003 showed that the TPPB is most sensitive to the nitrogen starvation and there is less difference for the TPPI. Our finding showed the same, the TPPB showed clear difference in the different treatments, while the TPPJ and TPPH stays almost the same during the nitrogen stress conditions. This suggest that the overexpression lines or more sensitive to the stress conditions than the knockout lines. The genevestigator data (Zimmermann et al, 2004) will give us an idea of what we could expect from the qPCR reaction (figure 34). Upregulated genes has a green expression while the downregulated are red. The genevestigator meta-Analyzer program screens all available microarray data for a gene of interest (Zimmermann et al, 2004). For the nitrate starvation Figure 34: Nitrate starvation expression according to genevestigator. We looked to conditions, we saw that only the TPP B gene is different genes: the AMT1.1, the NRT2.1, upregulated and the AMT1.1 has no up or TPP B, TPP D, TPP H, TPP I and TPP J. downregulation, the other genes are all downregulated (Figure 33). However this is not visible in the Q-PCR output. This output only shows that indeed the nitrogen starvation media works if we looked to the NRT2.1 primer who got a high expression in the low ammonium data. 4.8 CONCLUSION In summary we support the expression pattern of the TPP genes in the root. This showed that the TPPA and TPPG has expression in the epidermis, the TPPB is expressed during the LR formation and in specific root cell like the pericycle. The TPPD and the TPPH are expressed in the vasculature of the root, the TPPI is expressed in the root tip and the cortex and the TPPJ has only a weak expression in the rootcap. Considering the effect of T6P on the growth and development of the root, then we see that T6P is necessary for growth and that T6P shows more relation to cell division than to cell expansion. The T6P is relating carbohydrate utilization, namely, available sugars coming from photosynthesis or exogenous sources, to the growth of the plants, as well as is important for the growth of plants under stress conditions as drought and low nitrogen.

Material and methods

5 MATERIAL AND METHODS

5.1 TPP-GUS/GFP MARKERLINES Generated by cloning 2kb of the promoter or each TPP gene into the gateway vector pHGWFS7.0 (Karimi et al, 2002) which has gus and gfp marker genes and hygromycin resistance gene-. Three homozygous and single insertion lines were generated and one representative line was used for the coupes. 5.2 TPP KNOCK-OUT AND OVEREXPRESSION LINES Available T-DNA lines were used to get knock-out or know-down lines of each TPP gene (Table 5). Overexpression lines were generated by fusing the CDS of each TPP gene to Cv35S promoter in the pK7WG2 (Karimi et al, 2002) destination vector which has a kanamycin resistance gene. Three homozygous lines were generated and evaluated by qPCR to check the overexpression of the corresponding TPP gene, one selected line was used for the experiments. Table 5: different T-DNA insertion lines TPP gene T-DNA insertion Percentage of TPP gene expression by line qPCR AtTPPA Gabi-KAT_016E11 AtTPPB Salk_037324 0% Sail_191_F08 12%

AtTPPD Salk_120962 0% AtTPPF Salk_034415 0% AtTPPG Salk_078443 27% AtTPPH Salk_039655 0% AtTPPI Sail_354_D09 0% AtTPPJ Salk_093981 0% Salk or sail collection

Material and methods

5.3 PLANT MATERIALS AND GENERAL GROWTH CONDITIONS The medium for the plant growth is ½ MS (Murashige and Skoog) without sucrose, which contain for one liter 2.154g MS (Duschefa Biochemics, Haarlem, the Netherlands), 0.1g myo- inositol (Sigma-Aldrich, Steinheim, Germany), 0.5g MES (Duschefa Biochemics, Haarlem, the Netherlands), pH5.7 with 1M KOH and 8g plant agar. The seeds were sterilized two minutes in 70% ethanol, 15 minutes in NaClO and washed five times with water. After sterilization for two days kept in 4°C and then moved to the growth chamber at 21°. The plants were grown under continuous light, 16h light and 8h dark or 12h light and 12h dark light conditions. The square plates were orientated vertically to ease the observation of intact roots or horizontally for shoot related experiments.

5.3.1 SUCROSE (ACROS-ORGANICS, GEEL, BELGIUM) MW (sucrose) = 342.46 g/L, for 40% sucrose: 40g/100mL 1% sucrose = 29.2mM media: added 25mL [40% sucrose] for 1L media Or for the normal media with 1% sucrose, there is added 10g of sucrose to the ½ MS before autoclaving

5.3.2 TREHALOSE (SIGMA-ALDRICH, STEINHEIM, GERMANY) This sugar is added after autoclaved the 1MS media without sucrose: for 1L: 4.312g MS (Duschefa Biochemics, Haarlem, the Netherlands), 0.2g myo-inositol (Sigma-Aldrich, Steinheim, Germany), 1g MES (Duschefa Biochemics, Haarlem, the Netherlands), pH5.7 with 1M KOH and 8g plant agar. The plants were grown under 12h light and 12h dark conditions at 21°C for 14DAG in square plates. MW (Trehalose) = 378.33g/L, for 0.5M: 37.83g/200mL 10mM trehalose media: added 10nL for 1L media

5.3.3 VALIDAMYCIN A This inhibitor is added to the media after autoclaved the media with or without sucrose. MW (ValA) = 497.5g/L, stock (10mM): 4.97g/L 10µM ValA: 0.0497g/10mL stock [10mM], added 1mL for 1L media.

5.3.4 SORBITOL This osmoticum is added to the media after that it is autoclaved. And depending on the experiment, the plants are grown is different light conditions. MW (Sorbitol) = 182.17g/L, for 0.5M: 18.217g/L, for 40% sorbitol: 40g/100mL 10mM sorbitol media: added 10nL for 1L media 29.9mM sorbitol media: added 5.32g or 13.3mL [40% sorbitol] for 1L media

5.3.5 NITROGEN This media is prepared like described in (Wang et al, 2003).

Material and methods

5.4 EXPRESSION AND LOCALIZATION ANALYSIS Gus staining: For localization of GUS activity, GUS staining was performed as follows: tissue fixed for 30 minutes in 90% aceton at 4°C. Tissues were than washed in NT-buffer (100mM Tris/50mM NaCl). For staining first plant incubated in ferricyanide solution (0.32g K3[Fe(CN)6] in 10mL NT buffer, then 1mL of this solution in 49mL NT buffer) at 37°C for 30 minutes, then replaced with an assay solution (0.0261g x-gluc in 500µL DMSO, then 0.5mL of this solution in 24.5mL ferricyanide solution) for incubation overnight at 37°C. To stop the reaction, the plants were washed with NT buffer. The roots were putted on glass microscope slides in a lactic acid. Root sectioning: To make longitudinal and transversal coupes 5DAG GUS stained seedling were placed in fixative (4g p-formaldehyde in 100ml phosphate buffer (13.799g Na2PO4.H2O in 1liter MilliQ water and adjust the pH solution till 7.2)) for 1 till 30 days. Plants were washed two times with phosphate buffer pH7.2. Then the plants were dehydrated for two hours each in 30%, 50%, 70%, 85% and overnight in 94% at 4°C. The next day, the plants were pre-infiltrated for two hours in 30%, 50% and 70% Technovit-solution (1g Harderner in Technovit 7100 (Heraeaus Kulzer, Wehrheim, Germany),). Then the plants were infiltrated for 2 hours in 100% technovit solution and they were embedded in micas with Technovit solution with Hardener II (15mL technovit solution with 1mL Harderner II technovit 7100 (Heraeaus Kulzer, Wehrheim, Germany),) overnight. Pieces of root were cut out and put in moldswith histoblocks (Heraeaus Kulzer, Wehrheim, Germany) for longitudinal sections or insafe-lock tube eppendorfs for transversal sections. Samples were sectioned (5um) in a microtome and put on slides to dry out in a hotplate at 40°C. The sections on the slides were stained with Ruthenium Red (5g (NH3)5RuORu(NH3)4Oru(NH3)5 (Sigma-Aldrich, Steinheim, Germany) in 100mL MilliQ water) for 10 minutes washed two times with water. Coverslides were putted on the slides by using DepeX mouting medium. Microscopy was done by DIC (differential interference contrast) microscope, Olympus BX51 (Hamburg, Germany) with Nikon digital Sight (40x objectif). Images were processed in Adobe Photoshop 6.0 (Adobe Inc., San Jose, California).

5.5 PHENOTYPING OF THE LATERAL ROOT AND THE ROOT Staiging of lateral root primordia: The stages of LR development (described in (Malamy & Benfey, 1997)) where observed by DIC microscopy, Olympus BX51 (Hamburg, Germany) with Nikon digital Sight after clearing roots. Clearing of roots: To clear roots (Malamy & Benfey, 1997), the plants were transferred to small Petri dishes containing 0.24 N HCl in 20% methanol and incubated on a 57°C for 15 minutes. This solution was replaced with 7% NaOH, 7% hydroxylamine-HCl in 60% ethanol for 15 minutes at room temperature. (The hydroxylamine can be omitted with no decreased in effective clearing). Roots were then rehydrated for five minutes each in 40%. 20% and 10% ethanol, and infiltrated for 15 minutes in 5% ethanol, 25% glycerol. Roots were mounted in 50% glycerol on glass microscope slides. The root length was estimated by taking a picture of the roots that have been used for staiging with Binocular (Leica, Wetzlar, Germany) with Nikon digital Sight and the analysis is done by Image J (National Institutes of Health, http://rsb.info.nih.gov/ij) by measuring the main root from the hypocotyls till the root tip. To determinate the root density the number of LR roots were divided by the root length.

Material and methods

For counting of lateral roots, roots grown on vertical petri dishes were observed under a Binocular, lateral roots per plant were counted and scored on the plates which were later scanned in a Epson scanner (longbeach, CA). Main root was measured with Image J (National Institutes of Health, http://rsb.info.nih.gov/ij) and root density number was determined as explained before. 5.6 PHENOTYPING OF LEAF DEVELOPMENT The plants are grown on horizontal plates for 21DAG in 16-8 light conditions on ½ MS media supplemented with 1% of sucrose. Leaf 1 and 2 were harvested from 6 plants 21DAG, leaves were cleared in 100% etanol:acetone 9:1 V/V ON and transferred to lactic acid for 12h, leaves were put on slides with lactic acid and pictures of the abaxial side were taken with a Nikon camera adapted to a DIC microscope, Olympus BX51(Hamburg, Germany) at 20x. Images were analyzed with ImageJ (National Institutes of Health, http://rsb.info.nih.gov/ij), a leaf area was measured and cells and stomata were counted. For the total leaf area pictures of the every leaf were taken with a Nikon camera adapted to a binocular (Leica, Wetzlar, Germany), each leaf was drawn and the leaf area was measured using ImageJ (National Institutes of Health, http://rsb.info.nih.gov/ij).

5.7 PHENOTYPING OF THE BIOMASS Empty eppendorfs were weighted the shoots or roots, depending on the experiment, were put in each eppendorf, samples were dried out at 60°C overnight and weighted next day to get the biomass. 5.8 RNA EXTRACTION, CDNA SYNTHESIS AND Q-PCR RNA extraction was performed with RNAeasy mini kit (Qiagen, Hilden, Germany) according to manufacturer instructions with some modifications. RNA was DNA cleaned up with RQ1 RNAse free-DNAse (Promega, Madison, Wisconsin, USA) according to manufacturer instructions. cDNA synthesis was done with iScript cDNA synthesis kit (Bio-Rad, Hercules, USA) according to manufacturer instructions. Quantitative real time PCR reactions was done using SYBR Green Master Mix kit (Applied Biosytems™ by life technologies™, Carlsbad, CA, VS). The qPCR reactions were done in a LightCycler480 (Roche, Basel, Switzserland). The reaction protocol were performed as following: pre-incubation (95°C 10 minutes), amplification (95°C for 10 seconds; 60°C for15 seconds; 72°C for 15 seconds), 45 times melting curves (95°C for 1 second; 65°C for 1 second; 97°C continuous) and cool down (40°C 10 seconds). The analysis of the data were done by qBase. 5.9 STATISTICAL MEASUREMENTS All the unpaired T-test in all the experiments were done by GraphPadPrism 5. And we looked to three different signification levels: P >0.05, P >0.01 and P > 0.001.

References

6 REFERENCES

(2000) Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408: 796-815

Avonce N, Leyman B, Mascorro-Gallardo JO, Van Dijck P, Thevelein JM, Iturriaga G (2004) The Arabidopsis trehalose-6-P synthase AtTPS1 gene is a regulator of glucose, abscisic acid, and stress signaling. Plant Physiol 136: 3649-3659

Avonce N, Mendoza-Vargas A, Morett E, Iturriaga G (2006) Insights on the evolution of trehalose biosynthesis. BMC Evol Biol 6: 109

Baena-Gonzalez E (2010) Energy Signaling in the Regulation of Gene Expression during Stress. Mol Plant 3: 300-313

Baena-Gonzalez E, Rolland F, Thevelein JM, Sheen J (2007) A central integrator of transcription networks in plant stress and energy signalling. Nature 448: 938-942

Baena-Gonzalez E, Sheen J (2008) Convergent energy and stress signaling. Trends in Plant Science 13: 474-482

Beemster GT, Fiorani F, Inze D (2003) Cell cycle: the key to plant growth control? Trends Plant Sci 8: 154-158

Bell W, Sun W, Hohmann S, Wera S, Reinders A, De Virgilio C, Wiemken A, Thevelein JM (1998) Composition and functional analysis of the Saccharomyces cerevisiae trehalose synthase complex. J Biol Chem 273: 33311-33319

Belocopitow E, Marechal LR (1970) Trehalose phosphorylase from Euglena gracilis. Biochim Biophys Acta 198: 151-154

Benkova E, Michniewicz M, Sauer M, Teichmann T, Seifertova D, Jurgens G, Friml J (2003) Local, efflux- dependent auxin gradients as a common module for plant organ formation. Cell 115: 591-602

Burroughs AM, Allen KN, Dunaway-Mariano D, Aravind L (2006) Evolutionary genomics of the HAD superfamily: understanding the structural adaptations and catalytic diversity in a superfamily of phosphoesterases and allied enzymes. J Mol Biol 361: 1003-1034

Colaco C, Kampinga J, Roser B (1995) Amorphous stability and trehalose. Science 268: 788

Cortina C, Culianez-Macia FA (2005) Tomato abiotic stress enhanced tolerance by trehalose biosynthesis. Plant Sci 169: 75-82

De Smet I, Tetsumura T, De Rybel B, Frey NF, Laplaze L, Casimiro I, Swarup R, Naudts M, Vanneste S, Audenaert D, Inze D, Bennett MJ, Beeckman T (2007) Auxin-dependent regulation of lateral root positioning in the basal meristem of Arabidopsis. Development 134: 681-690

References

De Smet I, Vanneste S, Inze D, Beeckman T (2006) Lateral root initiation or the birth of a new meristem. Plant Mol Biol 60: 871-887

De Veylder L, Joubes J, Inze D (2003) Plant cell cycle transitions. Curr Opin Plant Biol 6: 536-543

Devirgilio C, Burckert N, Bell W, Jeno P, Boller T, Wiemken A (1993) Disruption of Tps2, the Gene Encoding the 100-Kda Subunit of the Trehalose-6-Phosphate Synthase Phosphatase Complex in Saccharomyces- Cerevisiae, Causes Accumulation of Trehalose-6-Phosphate and Loss of Trehalose-6-Phosphate Phosphatase- Activity. Eur J Biochem 212: 315-323

Dewitte W, Murray JA (2003) The plant cell cycle. Annu Rev Plant Biol 54: 235-264

Dubrovsky JG, Rost TL, Colon-Carmona A, Doerner P (2001) Early primordium morphogenesis during lateral root initiation in Arabidopsis thaliana. Planta 214: 30-36

Eastmond PJ, van Dijken AJ, Spielman M, Kerr A, Tissier AF, Dickinson HG, Jones JD, Smeekens SC, Graham IA (2002) Trehalose-6-phosphate synthase 1, which catalyses the first step in trehalose synthesis, is essential for Arabidopsis embryo maturation. Plant J 29: 225-235

Elbein AD, Pan YT, Pastuszak I, Carroll D (2003) New insights on trehalose: a multifunctional molecule. Glycobiology 13: 17R-27R

Frison M, Parrou JL, Guillaumot D, Masquelier D, Francois J, Chaumont F, Batoko H (2007) The Arabidopsis thaliana trehalase is a plasma membrane-bound enzyme with extracellular activity. Febs Lett 581: 4010-4016

Garg AK, Kim JK, Owens TG, Ranwala AP, Choi YD, Kochian LV, Wu RJ (2002) Trehalose accumulation in rice plants confers high tolerance levels to different abiotic stresses. Proc Natl Acad Sci U S A 99: 15898-15903

Goddijn OJ, van Dun K (1999) Trehalose metabolism in plants. Trends Plant Sci 4: 315-319

Goddijn OJ, Verwoerd TC, Voogd E, Krutwagen RW, de Graaf PT, van Dun K, Poels J, Ponstein AS, Damm B, Pen J (1997) Inhibition of trehalase activity enhances trehalose accumulation in transgenic plants. Plant Physiol 113: 181-190

Gomez LD, Baud S, Gilday A, Li Y, Graham IA (2006) Delayed embryo development in the ARABIDOPSIS TREHALOSE-6-PHOSPHATE SYNTHASE 1 mutant is associated with altered cell wall structure, decreased cell division and starch accumulation. Plant J 46: 69-84

Gutierrez C, Ramirez-Parra E, Castellano MM, del Pozo JC (2002) G(1) to S transition: more than a cell cycle engine switch. Curr Opin Plant Biol 5: 480-486

Holmstrom KO, Welin B, Mandal A, Kristiansdottir I, Teeri TH, Lamark T, Strom AR, Palva ET (1994) Production of the Escherichia-Coli Betaine-Aldehyde Dehydrogenase, an Enzyme Required for the Synthesis of the Osmoprotectant Glycine Betaine, in Transgenic Plants. Plant Journal 6: 749-758

References

Inze D, De Veylder L (2006) Cell cycle regulation in plant development. Annu Rev Genet 40: 77-105

Iordachescu M, Imai R (2008) Trehalose biosynthesis in response to abiotic stresses. J Integr Plant Biol 50: 1223-1229

Iturriaga G, Suarez R, Nova-Franco B (2009) Trehalose metabolism: from osmoprotection to signaling. Int J Mol Sci 10: 3793-3810

Iwahashi H, Obuchi K, Fujii S, Komatsu Y (1995) The correlative evidence suggesting that trehalose stabilizes membrane structure in the yeast Saccharomyces cerevisiae. Cell Mol Biol (Noisy-le-grand) 41: 763-769

Kaasen I, McDougall J, Strom AR (1994) Analysis of the otsBA operon for osmoregulatory trehalose synthesis in Escherichia coli and homology of the OtsA and OtsB proteins to the yeast trehalose-6-phosphate synthase/phosphatase complex. Gene 145: 9-15

Kameda Y, Asano N, Yamaguchi T, Matsui K (1987) Validoxylamines as trehalase inhibitors. J Antibiot (Tokyo) 40: 563-565

Klutts S, Pastuszak I, Edavana VK, Thampi P, Pan YT, Abraham EC, Carroll JD, Elbein AD (2003) Purification, cloning, expression, and properties of mycobacterial trehalose-phosphate phosphatase. J Biol Chem 278: 2093- 2100

Koch KE (1996) Carbohydrate-Modulated Gene Expression in Plants. Annu Rev Plant Physiol Plant Mol Biol 47: 509-540

Kolbe A, Tiessen A, Schluepmann H, Paul M, Ulrich S, Geigenberger P (2005) Trehalose 6-phosphate regulates starch synthesis via posttranslational redox activation of ADP-glucose pyrophosphorylase. Proc Natl Acad Sci U S A 102: 11118-11123

Leyman B, Van Dijck P, Thevelein JM (2001) An unexpected plethora of trehalose biosynthesis genes in Arabidopsis thaliana. Trends Plant Sci 6: 510-513

Lunn JE, Feil R, Hendriks JH, Gibon Y, Morcuende R, Osuna D, Scheible WR, Carillo P, Hajirezaei MR, Stitt M (2006) Sugar-induced increases in trehalose 6-phosphate are correlated with redox activation of ADPglucose pyrophosphorylase and higher rates of starch synthesis in Arabidopsis thaliana. Biochem J 397: 139-148

Lunn JE, Furbank RT (1999) Sucrose biosynthesis in C-4 plants. New Phytol 143: 221-237

Lunn JE, MacRae E (2003) New complexities in the synthesis of sucrose. Curr Opin Plant Biol 6: 208-214

Mackenzie KF, Singh KK, Brown AD (1988) Water stress plating hypersensitivity of yeasts: protective role of trehalose in Saccharomyces cerevisiae. J Gen Microbiol 134: 1661-1666

Malamy JE, Benfey PN (1997) Organization and cell differentiation in lateral roots of Arabidopsis thaliana. Development 124: 33-44

References

Maruta K, Hattori K, Nakada T, Kubota M, Sugimoto T, Kurimoto M (1996a) Cloning and sequencing of trehalose biosynthesis genes from Arthrobacter sp. Q36. Biochim Biophys Acta 1289: 10-13

Maruta K, Hattori K, Nakada T, Kubota M, Sugimoto T, Kurimoto M (1996b) Cloning and sequencing of trehalose biosynthesis genes from Rhizobium sp. M-11. Biosci Biotechnol Biochem 60: 717-720

Muller J, Aeschbacher RA, Wingler A, Boller T, Wiemken A (2001) Trehalose and trehalase in Arabidopsis. Plant Physiol 125: 1086-1093

Nibau C, Gibbs DJ, Coates JC (2008) Branching out in new directions: the control of root architecture by lateral root formation. New Phytol 179: 595-614

Paul MJ (2008) Trehalose 6-phosphate: a signal of sucrose status. Biochem J 412: e1-2

Paul MJ, Primavesi LF, Jhurreea D, Zhang Y (2008) Trehalose metabolism and signaling. Annu Rev Plant Biol 59: 417-441

Pellny TK, Ghannoum O, Conroy JP, Schluepmann H, Smeekens S, Andralojc J, Krause KP, Goddijn O, Paul MJ (2004) Genetic modification of photosynthesis with E. coli genes for trehalose synthesis. Plant Biotechnol J 2: 71-82

Peret B, De Rybel B, Casimiro I, Benkova E, Swarup R, Laplaze L, Beeckman T, Bennett MJ (2009) Arabidopsis lateral root development: an emerging story. Trends Plant Sci 14: 399-408

Pilon-Smits EAH, Terry N, Sears T, Kim H, Zayed A, Hwang SB, van Dun K, Voogd E, Verwoerd TC, Krutwagen RWHH, Goddijn OJM (1998) Trehalose-producing transgenic tobacco plants show improved growth performance under drought stress. J Plant Physiol 152: 525-532

Qu Q, Lee SJ, Boos W (2004) TreT, a novel trehalose glycosyltransferring synthase of the hyperthermophilic archaeon Thermococcus litoralis. J Biol Chem 279: 47890-47897

Ramon M, Rolland F (2007) Plant development: introducing trehalose metabolism. Trends Plant Sci 12: 185- 188

Rolland F, Moore B, Sheen J (2002) Sugar sensing and signaling in plants. Plant Cell 14 Suppl: S185-205

Romero C, Belles JM, Vaya JL, Serrano R, Culianez-Macia FA (1997) Expression of the yeast trehalose-6- phosphate synthase gene in transgenic tobacco plants: pleiotropic phenotypes include drought tolerance. Planta 201: 293-297

Ryu SI, Park CS, Cha J, Woo EJ, Lee SB (2005) A novel trehalose-synthesizing glycosyltransferase from Pyrococcus horikoshii: molecular cloning and characterization. Biochem Biophys Res Commun 329: 429-436

Satoh-Nagasawa N, Nagasawa N, Malcomber S, Sakai H, Jackson D (2006) A trehalose metabolic enzyme controls inflorescence architecture in maize. Nature 441: 227-230

References

Schluepmann H, Pellny T, van Dijken A, Smeekens S, Paul M (2003) Trehalose 6-phosphate is indispensable for carbohydrate utilization and growth in Arabidopsis thaliana. Proc Natl Acad Sci U S A 100: 6849-6854

Schluepmann H, van Dijken A, Aghdasi M, Wobbes B, Paul M, Smeekens S (2004) Trehalose mediated growth inhibition of Arabidopsis seedlings is due to trehalose-6-phosphate accumulation. Plant Physiol 135: 879-890

Schmitz G, Theres K (2005) Shoot and inflorescence branching. Curr Opin Plant Biol 8: 506-511

Sheen J (1999) C4 Gene Expression. Annu Rev Plant Physiol Plant Mol Biol 50: 187-217

Smeekens S (2000) Sugar-Induced Signal Transduction in Plants. Annu Rev Plant Physiol Plant Mol Biol 51: 49- 81

Skirycz A, De Bodt S, Obata T, De Clercq I, Claeys H, De Rycke R, Andriankaja M, Van Aken O, Van Breusegem F, Fernie AR, Inze D (2010) Developmental Stage Specificity and the Role of Mitochondrial Metabolism in the Response of Arabidopsis Leaves to Prolonged Mild Osmotic Stress. Plant Physiology 152: 226-244

Thaller MC, Schippa S, Rossolini GM (1998) Conserved sequence motifs among bacterial, eukaryotic, and archaeal phosphatases that define a new phosphohydrolase superfamily. Protein Sci 7: 1647-1652

Tiessen A, Prescha K, Branscheid A, Palacios N, McKibbin R, Halford NG, Geigenberger P (2003) Evidence that SNF1-related kinase and hexokinase are involved in separate sugar-signalling pathways modulating posttranslational redox activation of ADP-glucose pyrophosphorylase in potato tubers. Plant J 35: 490-500

Toroser D, Plaut Z, Huber SC (2000) Regulation of a plant SNF1-related protein kinase by glucose-6-phosphate. Plant Physiology 123: 403-411

Tsusaki K, Nishimoto T, Nakada T, Kubota M, Chaen H, Sugimoto T, Kurimoto M (1996) Cloning and sequencing of trehalose synthase gene from Pimelobacter sp. R48. Biochim Biophys Acta 1290: 1-3 van Dijken AJ, Schluepmann H, Smeekens SC (2004) Arabidopsis trehalose-6-phosphate synthase 1 is essential for normal vegetative growth and transition to flowering. Plant Physiol 135: 969-977

Vogel G, Aeschbacher RA, Muller J, Boller T, Wiemken A (1998) Trehalose-6-phosphate phosphatases from Arabidopsis thaliana: identification by functional complementation of the yeast tps2 mutant. Plant J 13: 673-683

Vollbrecht E, Springer PS, Goh L, Buckler ESt, Martienssen R (2005) Architecture of floral branch systems in maize and related grasses. Nature 436: 1119-1126

Wannet WJ, Hermans JH, van Der Drift C, Op Den Camp HJ (2000) HPLC detection of soluble carbohydrates involved in mannitol and trehalose metabolism in the edible mushroom Agaricus bisporus. J Agric Food Chem 48: 287-291

Ward SP, Leyser O (2004) Shoot branching. Curr Opin Plant Biol 7: 73-78

References

Wiemken A (1990) Trehalose in yeast, stress protectant rather than reserve carbohydrate. Antonie Van Leeuwenhoek 58: 209-217

Wingler A, Fritzius T, Wiemken A, Boller T, Aeschbacher RA (2000) Trehalose induces the ADP-glucose pyrophosphorylase gene, ApL3, and starch synthesis in Arabidopsis. Plant Physiol 124: 105-114

Yeo ET, Kwon HB, Han SE, Lee JT, Ryu JC, Byun MO (2000) Genetic engineering of drought resistant potato plants by introduction of the trehalose-6-phosphate synthase (TPS1) gene from Saccharomyces cerevisiae. Mol Cells 10: 263-268

Zhang YH, Primavesi LF, Jhurreea D, Andralojc PJ, Mitchell RAC, Powers SJ, Schluepmann H, Delatte T, Wingler A, Paul MJ (2009) Inhibition of SNF1-Related Protein Kinase1 Activity and Regulation of Metabolic Pathways by Trehalose-6-Phosphate. Plant Physiology 149: 1860-1871

Acknowledgement

7 ADDENDUM

7.1 STERILISATION SEEDS 1. 70% ethanol for 2 minutes 2. NaOCl for 15 minutes (3.85ml stock 38.5%NaOCl + 5µl tween20 + 6.10mlH2O) 3. Wash 5 times with H2O for 5 minutes 4. For 2 days by 4°C

7.2 GROWTH MEDIA: ½ MS

7.3 GUS STAINING

References 7.4 CLEARING ROOTS BY (MALAMY & BENFEY, 1997) 1. 0.24N HCl in 20%methanol (solution 1), 57°C for 15 minutes (in the hood) 2. 7% NaOH, 7% hydroxylamine-HCl in 60% ethanol (solution 2), room temperatuur for 15 minutes (in the hood) 3. 40% ethanol for 5 minutes 4. 20% ethanol for 5 minutes 5. 10% ethanol for 5 minutes 6. 5% ethanol + 25% glycerol for 15 minutes 7. 50% glycerol 8. On slides in 50% glycerol Solution 1: 0.24N HCl in 20%methanol 0.24N HCl = 8.75g/l Solution 2: 7%NaOH in 60% ethanol For 200ml:120ml [100%] ethanol + 80ml H2O + 14g NaOH

7.5 EMBEDDING PLANT MATERIAL

Protocol Embbeding Method for Arabidopsis Root Specimens Root Development PSB VIB Ugent-Prof. Dr. Tom Beeckman-Maria Njo Based on (De Smet et al, 2004)

Fixation After GUS staining, Arabidopsis plants/roots are fixed in 1% G + 4% F 1 Plants can be keept in this fixative for about 1 month at 4ºC.

1. Dehydration First plant specimens have to be washed with phosphate buffer ph 7,2 2 two times. Followed by a dehydration series. 30% ETOH for about 2 hours. 50% ETOH for about 2 hours. 70% ETOH for about 2 hours, overnight or keep it for a longer time (maximum. 2 week) in refrigerator. 85% ETOH for about 2 hours. 94% ETOH for about 2 hours or overnight in refrigerator.

1 1% G + 4% F = 4 grams p-formaldehyde in 100 ml phosphate buffer pH 7.2, warm it out in microwave about 1 min then mix it with 4 ml glutaraldehyde (from solution Glutaraldehyde 25%)

2 phosphate buffer ph 7,2 = 13,799 g NaH2PO4.H2O in 1 l MilliQwater adjust the ph solution till 7.2

References 2. Infitration Make first Technovit solution3

Picture1. Technovit 7100 with hardener1bag. Technovit solution after are mixed. Keep it cool and protect it from light.

After the last deyhydration step, the specimens are transferred to a pre-infiltration and an infiltration series.

Pre-infiltration series. 30% Technovit solution + 70% ETOH 94% for about 2 hours. 50% Technovit solution + 50% ETOH 94% for about 2 hours. 70% Technovit solution + 30% ETOH 94% for about 2 hours or overnight in refrigerator.

Infiltration 100% Technovit solution for about 1-2 hours. 100% Technovit solution for about 1-2 hours or overnight in refrigerator if specimen has strong GUS expression.

Picture2. Transparent sheets stick with double-sided tape, Mica, Technovit 7100 hardenerII.

3 Technovit solution = 1 gram harderner 1 mix in 100 ml Technovit 7100, protect it from light and save it in refrigerator (See: Picture1).

References

3. Pre-Embedding in moulds/micas Make first moulds/micas4 Prepare Technovit solution with hardenerII5. Remove the protecting paper strip from the tape of one side mica, stick it in with transparent piece then remove also the other side protecting paper strip of mica (See: Picture 2, Picture3). Pipette 1 drop of Technovit solution in the middle of it. Put the plant or piece of root in it and cover it with another transparent piece. Do it carefully because the air bubbles can easily be formed (See: Picture3). Let it polymerize overnight at room temperature.

Picture3. Embedding with mica.

5. Embedding in larger moulds After the material is embedded in micas, it needs to be re-embedded in larger moulds to be able to make longitudinal or transerse sections. Longitudinal Sectioning Take larger moulds6, cut the double-sided tapes in form/size of holes then stick it to the bottom of the moulds (See: picture4).

4moulds/micas = take transparent sheet then stick it with double-sided tape (25mm x 33m Letraset) on both sides, cut it 2x5 cm then make a hole in it. Also the transparent pieces 2x5 cm use as cover on top and beneath (See: Picture2).

5 Technovit solution with hardenerII = take 15 ml Technovit solution then mix it with 1 ml hardener II Tecnovit 7100 Kulzer. Keep it cool, take ice put it in izomo box and put the solution (in tube) between it. (See: Picture2)

References

Picture4. Moulds made from telfon, Histobloc. Cut out a desirable piece of pre-embedded root tip. Stick this Put the this piece to the bottom of the mould, push it gently, then pipette 1 ml of Technovit solution with hardenerII in the moulds. Close it gently with a piece of plastic and be careful to avoid air bubbles. Let it polymerize overnight at room temperature. Take off the plastic piece, put Histobloc7 (See: picture4) on it. . Make solution of yellow resin Technovit 30408 (See: Picture5). Mix it with glass/wooden spatulas then wait for about 30 seconds untill a still fuid paste is obtained and it immediately into the Histobloc.

Picture5. Resin Technovit 3040, Specimen with silica gels in plastic tin.

Let it polymerize for ½ day then pull it out. Keep specimen bloc in plastic tin with silica gel (See: Picture5).

Transverse sectioning Take 0,5ml safe-lock tube/eppendorf. Cut desirable part of the pre-embedded plant (for example. root part with GUS- staining) in trapezoid shape. The piece is cut about at the same size with eppendorf, to orientate the piece. Pipette Technovit solution with hardenerII in eppendorf containing piece of specimen.

6 Larger moulds = telfon embedding mold with 10 capacity Histoform S (See: Picture4)

7 Histobloc = plastic bloc holder for resin embedded specimen (See: Picture4)

8 Technovit 3040 solution = mixing 2 component-resins 2 powder: 1 liquid

References Let it polymerize vertically overnight at room temperature. Keep it in Petri-Dish (See: picture5)

Picture6. Specimens in eppendorf are keep in petridish.

7.6 MICROTOME USE Protocol Microtomy

Root Development PSB VIB Ugent-Prof. Dr. Tom Beeckman–Maria Njo

To make longitudinal sections we use steel knives9. To make transverse sections with a rotary microtome10, we need to first to make glass-knives by using the glass-knife maker11 (See: Picture1).

Clamping Handle

Score selector Scoring shaft

Breaking handle

Picture1. Knife maker. Put one long piece of the stock glass in the middle (the rough side underneath). Pull the clamping handle in forward direction ↓. Choose the score selector and pull the scoring shaft.

9 Superlab Knives (Adamas Instrumenten,The Netherlands) or other metal knifes which are suitable to cut hard materials can be used as well.

10 Reichert-Jung

11 Reichert Leica

References Turn the breaking handle to the right →. Make little pieces □ quadrangle glasses. Firm one of quadrangle glass in the middle in this position ◊. Pull the clamping handle. Choose the score selector and pull the scoring shaft. Break the glass by turning the breaking handle. Then we have triangle glass pieces, the nice pieces can be used as knives. Protect it from the dust before use.

Before making a section, the embedded specimens have to be cut and trimmed12 to obtain a nice quadrangle shape.

Cut and Trim unnecessary rest

Picture2. Cut and trimmed

Hot plate Besides the microtome, we also need a hot plate13, turn it on. Don‟t use too high temperatures because tissue may become damaged. 20-40°© (2-4) is normally use.

Picture3. Hot plate Microtome

12 quadrangle shape is easy to cut to compare with round shape and the trimming is necessary to make the section smooth and not broken at the middle.

13 Gerhardt

References

Binocular

Rotation handle

Thickness section selector Object/specimens remover Object/specimens holders

Glass knife holders

Picture4. Rotary Microtome (This one used for transversal sectioning)

Choose the right specimen and knife holders and knife. Attach the knife, specimens and look through the binocular to positions specimens, parallel with the knife. Sections can be cut from 0.3 µm thick. Write name of specimen on object glass with a pencil. Use microscope slides with ground edges. Put some drops of water (sterile MilliQ water) on object glass coated with vectabond14 or use glass which is ready coated from the factory15. Take nice piece of section with tweezers and put it directly into the drop water. Place the object glass on the hotplate. Let it dry. Staining Make solution of Ruthenium red16. Keep it cool and protect it from light. Put the object glasses with section in rack. Soak it for 10 minutes in the Solution of Ruthenium red Rinse with water once. Dry the object glasses one by one on tissue paper.

14 To coat object glasses with vectabond; - 5 minutes in acetone - 5 minutes in 350 ml acetone + 7 ml vectabond - rinse in H2O - Let it dry, protect it from dust - Mark it with V

15 Thermo Scientific MENZEL GLÄSER Superforst®plus

16 Mix 0.05 g Ruthenium Red with 100 ml MilliQ water.

References Let dry at room temperature or on the hotplate. Mounting medium After drying, the permanent slides are made by adding Depex17. Put the coverslips gently on it to avoid air bubbles. Let dry under fume hood for a couple days.

Microscopy If the slice is dry, pictures can be taken taken by using a microscope eqipped with digital camera.

Picture 5. Longitudinal and Transverse sections. 7.7 MEASURE THE ROOT LENGHT Use ImageJ to measure roots

* Scan plates using a scanner or a camera (See Imaging plateform). Don't forget to have a ruler or a piece of millimeter paper on the scan to calibrate. * Open an image (shortcut = ctrl O) * Zoom in on the millimeter paper * Using the "straight line" tool, select one centimeter on the paper. * In the menu "Analyze", choose "Set scale".

17 DepeX mounting medium.

References The pixel size will appear, fill "1" (cm) for known distance field. Tick the "global" so that all the images you open next have the same scale. Don't forget to recalibrate every time you open imageJ again or when you have a serie of pictures with different scale.

* Choose a measure tool (segmented line selection or freehand line selection) * "Draw" the root with your tool * On the menu "Analyze" choose "measure" or short cut = ctrl M * Measure all the roots on the plate this way. * Go to the "results" window. In this window go to menu "edit", choose "copy all", to copy all the list of measures. * Go to Excel and paste the list of measures. * Go back to the "results" window, go to menu "edit", choose "clear results", to erase the measures before starting a new series of measures.

7.8 RNA EXTRATION PROTOCOL Grind plant material in liquid N2 (2balls 4mm/2mL epies) Add 1mL Trizol (hood) 5 minutes at room temperature (hood) + 0.2mL chloroform (shake for 15seconds) spin down 12000 rcf for 15minutes at 4°C The upper part to a pink colom of the RNeasy® Micro kit (Qiagen, Hilden, Germany) + 0.5mL isopropanol 10 minutes at room temperature On RNeasy column (max 700µl if more 2x) Centrifuge 15 seconds at ≥ 10000rpm and remove flow through + 700µL RWI, spin down 15 seconds at ≥ 10000rpm and remove flow through + 500µL RWI, spin down 15 seconds at ≥ 10000rpm and remove flow through + 500µL RWI, spin down 2 minutes at ≥ 10000rpm and remove flow through Dry out for 1minute and spin down 1 minutes at ≥ 10000rpm New tubes Elute 40µL H2O (DECP) spin down 1 minutes at ≥ 10000rpm on ice measure the RNA concentration

7.9 RNA CLEAN-UP RNase-free DNase from Promega, Madison, Wisconsin, USA. Reaction mix: RNA 10ng DNase 10µL Buffer 10µL Water ?µL Total volume 100µL For 30 minutes at 37°C

References Then 10µL stop reaction

By the RNeasy® Micro kit (Qiagen, Hilden, Germany): 350µL RLT and mix well 250µL ethanol (100%) and mix well Transfer to pink colomn and spin down Remove supernatants Add 500µL RPE, spin down 15seconds by >10000rpm Remove supernatants Add 500µL RPE, spin down 2minutes by >10000rpm Remove supernatants Dry out, spin down 1minute by >10000rpm Column to new epie, add 20µL H2O Maximum speed for 1minute Putted on ice 7.10 CDNA SYNTHESIS iScript™ cDNA Synthesis Kit (Bio-Rad, Hercules, USA) Reaction set-up: 5x iScript™ Reaction mix 4µL iScript™ reverse transcriptase 1µL nuclease-free water 5µL RNA template 10µL Total volume 20µL

Reaction protocol: Incubate complete reaction mix 5 minutes at 25°C 30 minutes at 42°C 5 minutes at 85°C Hold at (optional) 4°C

7.11 QPCR

References LightCycler 480-Roche, Basel Switzerland Reaction set-up: Primers (1µM; forward and reverse) 2µL SYBR Green I master mix 2.5µL cDNA 0.5µL Total volume 5µL

Reaction protocol: Pre-incubation 95°C 10 minutes Amplification 95°C 10 seconds 60°C 15 seconds 72°C 15 seconds x45 Meltingcurves 95°C 1 second 65°C 1 second 97°C continuous Cool down 40°C 10 seconds 7.12 QPCR PRIMERS

Table 6: primer sequences for the nitrogen starvation conditions, the TPP genes and the housekeeping genes gene Primer sequence for qPCR AtAMT1.1 Forward GGTCGTCTCTCACTGGTTCTG reverse CAAGGACAACAAGTGACGACC AtNRT2.1 forward CAGGACTTGGATCTTCGTTC reverse CCACAACCTCCCTCTCATCC AtNRT2.1 forward CGACCTCACATTCACAACTG reverse GCTTCTCCTGCTCATTCCAC TPPB forward GATGAGAAGAGATGGCCTGC reverse CCCTTGTCCCATTTGATTGT

TPPD forward AGCTCTCGAGTTCTTGCTCG reverse ACCTTGAAAGCATCCTCGTC

TPPH forward TTGTACCGACGTTTTCCCTC reverse AGACGCGCTAGTCTCCTTTG

TPPI forward GAAGAAATGGAGCGAACTGG

References reverse CGTCACCAATATAAACCGGG

TPPJ

Forward CCGACTGCTCCTGGTTACAT reverse TGATGGATGTCGTTTGATCC

UBQ forward GCTTCTGAGCTTTTGTGATGTGAT reverse GAAACCAAACCAGGTGAAGATCTC cDKA forward ATTGCGTATTGCCACTCTCATAGG reverse TCCTGACAGGGATACCGAATGC

EEF forward CTGGAGGTTTTGAGGCTGGTAT reverse CCAAGGGTGAAAGCAAGAAGA

(Gansel et al, 2001) for the N marker genes Vector NTI™ and Beacon designer