Identification of the Minus-Dominance Gene Ortholog in the Mating-Type

Identiﬁcation of the Minus-Dominance Gene Ortholog in the Mating-Type Locus of Gonium pectorale

Takashi Hamaji,*,1 Patrick J. Ferris,† Annette W. Coleman,‡ Sabine Waffenschmidt,§ Fumio Takahashi,** Ichiro Nishii†† and Hisayoshi Nozaki* *Department of Biological Sciences, Graduate School of Science, University of Tokyo, Tokyo 113-0033, Japan, †Plant Biology Laboratory, Salk Institute, La Jolla, California 92037, ‡Division of Biology and Medicine, Brown University, Providence, Rhode Island 02906, §Institute of Biochemistry, University of Cologne, Cologne 50674, Germany, **Department of Biomolecular Sciences, Graduate School of Life Sciences, Tohoku University, Sendai-shi, Miyagi 980-8577, Japan and ††Frontier Research System, RIKEN, Wako-shi, Saitama 351-0198, Japan Manuscript received August 8, 2007 Accepted for publication November 6, 2007

ABSTRACT The evolution of anisogamy/oogamy in the colonial Volvocales might have occurred in an ancestral isogamous colonial organism like Gonium pectorale. The unicellular, close relative Chlamydomonas reinhardtii has a mating-type (MT) locus harboring several mating-type-specific genes, including one involved in mating-type determination and another involved in the function of the tubular mating structure in only one of the two isogametes. In this study, as the first step in identifying the G. pectorale MT locus, we isolated from G. pectorale the ortholog of the C. reinhardtii mating-type-determining minus-dominance (CrMID)gene, which is localized only in the MT locus. 39-and59-RACE RT–PCR using degenerate primers identified a CrMID-orthologous 164-amino-acid coding gene (GpMID) containing a leucine-zipper RWP-RK domain near the C-terminal, as is the case with CrMID. Genomic Southern blot analysis showed that GpMID was coded only in the minus strain of G. pectorale. RT–PCR revealed that GpMID expression increased during nitrogen starvation. Analysis of F1 progeny suggested that GpMID and isopropylmalate dehydratase LEU1S are tightly linked, suggesting that they are harbored in a chromosomal region under recombinational suppression that is comparable to the C. reinhardtii MT locus. However, two other genes present in the C. reinhardtii MT locus are not linked to the G. pectorale LEU1S/MID, suggesting that the gene content of the volvocalean MT loci is not static over time. Inheritance of chloroplast and mitochondria genomes in G. pectorale is uniparental from the plus and minus parents, respectively, as is also the case in C. reinhardtii.

OGAMOUS reproduction, which involves anisog- 1994; Nozaki et al. 2000); second, several mating-type- O amous fusion of distinctive sperm and egg cells, specific genes have been identified in the closely re- has apparently evolved from isogamous sexual repro- lated isogamous, unicellular alga Chlamydomonas rein- duction where gametes of different mating types are hardtii (Ferris et al. 1995; Ferris and Goodenough very similar in size and appearance. Although oogamy 1997). Therefore, the volvocine algae possess unrivaled is known in animals and land plants, the origins of features for studying the evolution of sex in terms of oogamy are so ancient that there seem to be no extant molecular biology (Kirk 2005). isogamous close relatives of them (Karol et al. 2001; Gonium pectorale has flattened 16-celled colonies and Rokas et al. 2005). The volvocine or colonial volvoca- produces isogametes in sexual reproduction. Hetero- lean algae are a model lineage for studying the evolution thallic sexuality in G. pectorale with two mating types, plus of sexual reproduction for two reasons: first, they have and minus, was studied by Schreiber (1925) and Stein both isogamous (Gonium, Pandorina, and Yamagishiella) (1958). Although only one (plus) of the two conjugating and anisogamous/oogamous (Eudorina, Pleodorina, isogametes of C. reinhardtii has a tubular mating struc- and Volvox) genera, the latter forming bundles of male ture (TMS), both isogametes of G. pectorale extend a gametes (sperm) and large female gametes (eggs), which TMS toward the other (Nozaki 1984; Nozaki and Itoh are phylogenetically well studied (Nozaki and Itoh 1994). Phylogenetic analyses imply that anisogamous/ oogamous species of the colonial Volvocales evolved from an ancestral colonial species that exhibits isogamy Sequence data from this article have been deposited with the DDBJ/ as in G. pectorale (Nozaki and Itoh 1994; Nozaki et al. EMBL/GenBank Data Libraries under accession nos. AB353340, 2000). The genus Gonium is phylogenetically impor- AB353887–AB353889, AY860423, and DQ068275. tant, as it represents the most basal lineage within the 1Corresponding author: Department of Biological Science, Graduate School of Science, University of Tokyo, Tokyo 113-0033, Japan. relatively advanced volvocine algae composed of isoga- E-mail: [email protected] mous genera and anisogamous/oogamous members

Genetics 178: 283–294 ( January 2008) 284 T. Hamaji et al.

(Nozaki et al. 2000). In C. reinhardtii the mating-type were examined and compared with those in C. reinhardtii (MT ) loci—mating type plus (MT1) and mating type (Boynton et al. 1987) and in V. carteri (Adams et al. minus (MT )—consist of a 200-kb region dimorphic be- 1990). The evolutionary significance of GpMID and the tween the two mating types, referred to as the rear- uniparental inheritance of chloroplast and mitochon- ranged (R) domain, and include genes involved in drial genomes are discussed in this article. mating-type determination and in the function of the TMS, as well as housekeeping genes with alleles present in both MT loci. The dimorphism results in recombi- MATERIALS AND METHODS national suppression over a region of 1Mb(Ferris oodenough erris Experimental organisms and culture and mating methods: and G 1994; F et al. 2002). The names of the two mating types of G. pectorale (plus and The minus-dominance (MID) gene is one of the minus- minus) were assigned arbitrarily (Stein 1958), and since we specific genes in the MT locus of C. reinhardtii and was show here that the MT loci of both G. pectorale and C. demonstrated to be the master regulator in mating-type reinhardtii carry the MID gene, we have chosen to continue minus determination (CrMID:Ferris and Goodenough with this usage. Four strains of G. pectorale were used here: Kaneko3 (minus) and Kaneko4 (plus), originating from Okinawa 1997). CrMID contains an RWP-RK domain, which is a Prefecture, Japan (Yamada et al. 2006), and Mongolia 4 characteristically conserved putative DNA-binding do- (minus) and Mongolia 1 (plus). The Kaneko strains have been main observed in plants, oomycetes, and cellular slime deposited in the Microbial Culture Collection at the National molds (Schauser et al. 1999, 2005; Nozaki et al. 2006). Institute for Environmental Studies (Tsukuba, Japan; Kasai Ferris et al. (1997) identified only a single MID ortholog, et al. 2004) as NIES-1710 and -1711; the Mongolia strains are deposited in the Culture Centre of Algae and Protozoa (CCAP, CiMID,fromChlamydomonas incerta, the closest known Ambleside, Scotland; Gachon et al. 2007) as CCAP32/13 and relative to C. reinhardtii, although they attempted to find CCAP32/14. The Mongolia strains were isolated as single cells MID orthologs from other Chlamydomonas species, G. from incubated petri dishes in which a small amount of dried pectorale, and Volvox carteri by means of low-stringency mud had been rewetted with distilled water, and they were ringsheim DNA gel blot hybridization. They concluded, from com- maintained in soil-water medium (P 1946). The mud samples were collected by R. A. Lewin (University of paring divergence of housekeeping genes and MID, that California, San Diego) in October 1997. The mud came from sex-related genes evolve very rapidly (Ferris et al. 1997; two small pools of freshwater adjacent to a large hypersaline P. J. Ferris, unpublished results). Recently, however, lake (Cha-gan-nur, Hao-tong-yin) in Inner Mongolia. Mating the Pleodorina starrii minus-dominance gene ortholog types of Mongolia 4 and 1 were determined by crossing with abry (PlestMID) was obtained by reverse transcribed (RT)– Alaska 1 and 2 strains (F et al. 1998), whereas those of Kaneko3 and -4 were tested against Mongolia 4 and 1. polymerase chain reaction (PCR) from nitrogen-starved, The cultures of Kaneko3 and -4 were grown in AF-6, VTAC, sexually induced males using degenerate primers de- or standard Volvox media (SVM) (Starr 1969; Kasai et al. signed from the RWP-RK domains of C. reinhardtii and 2004) at 20°–25°, with alternating periods of 14 hr light C. incerta (Nozaki et al. 2006). This result motivated us and 10 hr dark at a light intensity of 30–200 mmol photons 2 1 to identify additional volvocine MID orthologs and, in m s provided by cool white fluorescent lamps. For crossing, cells of these strains were grown in liquid Tris– turn, the MT loci. The genomic changes accompanying acetate–phosphate (TAP) medium (Harris 1989) on a light the evolution of sex will be elucidated by a step-by-step shelf under constant illumination until growth appeared sat- analysis of the volvocine MT loci. urated (typically 4–5 days). The cells were then pelleted and The G. pectorale MT locus, by analogy with the C. resuspended in nitrogen-free SVM medium (Starr 1969). reinhardtii MT locus, is likely to be a complex, recombi- After sitting overnight, strains of opposite mating type were mixed. Flagellar agglutination could be observed just after nationally suppressed region of some hundreds of kilo- mixing. Several hours after, the mixture was transferred to 4% bases, containing a mix of housekeeping and sex-specific agar SVM plates and placed in the dark for at least 10 days. In genes, which would include the MID gene. To fully clone successful matings, the orange-colored zygotes were clearly and characterize this locus, we adopted a two-pronged visible using a dissecting microscope. The zygotes were then strategy: (1) identify the Gonium MID gene following transferred from 4 to 1.5% agar TAP plates and manipulated by hand to separate individual zygotes; germination was high, the Pleodorina example and (2) use genetics to con- but poor progeny survival obviated tetrad analysis. Conse- firm that the GpMID gene does indeed map to the sex- quently, a random progeny approach was adopted for the determining MT locus and to identify housekeeping genetic analysis. Matured zygotes on the plates were flooded genes contained within the Gonium MT locus to pro- with liquid SVM, and cells loosened with a glass hockey stick vide additional access points for a BAC-clone-based were transferred to a sterile tube and placed in a 20° freezer overnight to kill unmated cells. After thawing, the zygotes were chromosome walk. spread on a TAP plate and incubated under light until colonies Here, as the first step in characterizing the G. pectorale were visible by the naked eye. Each colony represents the MT locus, we isolated the G. pectorale ortholog of the MID surviving progeny from a single zygote. Colonies were subcl- gene (GpMID). GpMID is encoded specifically in minus oned before further characterization. strains of G. pectorale and strictly linked to certain nu- Cloning of GpMID: For isolation of the G. pectorale MID gene, 14-day-old cultures of Kaneko3 and -4 in VTAC medium clear genes, suggesting the presence of a MT locus were separately placed in petri dishes with an equal volume of that is comparable to that of C. reinhardtii. In addition, autoclaved MilliQ water. The petri dishes were then incubated modes of organellar genome inheritance in G. pectorale at 25° under a 14 hr light/10 hr dark cycle. After 2 days, both Mating-Type Locus in Gonium 285

TABLE 1 was done using LA Taq DNA polymerase with GC buffer I (TAKARA) and GeneAmp PCR system 9700 (Applied Bio- Primers newly designed in this study systems, Foster City, CA). PCR products were sequenced directly or after TA cloning, as described above. Primer name Primer sequence DNA gel blot analysis of GpMID: Southern blot analysis was done following the protocols of Nishii et al. (2003) modified dMT-dF3 RCIMRIAARGCIGAYYTIAC to use the nonradioisotope detection system outlined be- GpMidF1 AGCGCAGACATCAGTTCCTATTTCCA low. Restriction enzyme digests (6 mg) of genomic DNA were GpMidR3 AGGTACGTTGTCGAGATGCCCA separated by 1.0% agarose gel electrophoresis and transferred GpMidR1 TGGAAATAGGAACTGATGTCTGCGCT onto a Hybond-N1 membrane (GE Healthcare Bio-Sciences, GPMID5P-1F GTGATGCCGTACCCATATTGCCAC Little Chalfont, UK) (Sambrook and Russell 2001) using a GPMID3P-1R GAACCCTTGCATGTGCCACCA vacuum blotter (Bio-Rad, Hercules, CA). A probe containing GPMID_int1F AACAATCCTCGTGTTGGACGTCTT the GpMID ORF region was prepared by PCR with the primer GPMID_int4R AGCTGGCCACCTTGCGATAC pair GPMID-5P1F and GpMidR3 using Kaneko3 genomic CV_EF1A1-R2 CACGCTCGCCTGATCAACCTGCTG DNA as template. The probe was labeled with fluorescein-11- GpEF1A-INT3-R GTCCAGACCCTTGATGTTCATGCC dUTP (Gene Images random prime labeling module, GE gonact1 GTGATCTCCTTCGACATGC Healthcare Bio-Sciences) and hybridized at 68° according to gonact2 ACCATGTTCCCCGGTAAG the manufacturer’s protocol. The signals were detected with gonypt1 GGTCAACCAKGTGAMCTCC Gene Images CDP-Star detection kit (GE Healthcare Bio- gonypt2 GTGCGCTTCGCCTGAAGGG Sciences) and VersaDoc Model 5000 (Bio-Rad). The resulting pr46for AAGGTCACSTTCAAGGTNAC image was processed with a median filter (diameter: 1 pixel) in pr46rev ACCTCCTCSGCSGCGAAYTT ImageJ (National Institutes of Health, Bethesda, MD) to gac30 ACGCAGCATGGGAGCGGGTC remove random noise produced by long exposure (2 hr). Comparison of GpMID transcript level: Because the ex- gac31 TGCAGGACGTACAGCACCTG pression of MID genes from C. reinhardtii (Ferris and Good- gonleu13 CAATCTCCTGAAGCGGGTAGGTCT enough 1997; Lin and Goodenough 2007) and P. starrii gonleu14 AGGGCGAGATGAAGACCGAATACC (Nozaki et al. 2006) increased in nitrogen-starved cultures, Mong4F1 CGGTCACGGCCAGAGAGGTA expression of GpMID was examined with or without nitrogen Mong4R1 GCAGATGCGCTTCAGGTACG starvation for 18 hr; 105–106 cells of G. pectorale Kaneko3 were gonpsa1 ATACTGCTCACCACCACGTAGCAA pelleted by centrifugation and resuspended in N-free SVM gonpsa2 AGGACCATCACAAGGGAAACGGAA (SVM modified by omitting urea and replacing CaNO3 with CaCl2). Polyadenylated mRNA was extracted from algae using Dynabeads (Invitrogen) as described in the manufacturer’s cultures were largely unicellular and commenced flagellar protocol. The GpMID expression was assayed by semiquantita- agglutination within 1 hr if an aliquot from each was mixed. tive RT–PCR, using the EF1-like gene as an internal control: Such sexually activated, nonmixed cells were used for isolation GpMID sense, GPMID_int1F; GpMID antisense, GPMID_int4R; of gamete RNA. Total RNA was isolated with the RNeasy Midi EF1-like sense, CV_EF1A1-R2; and EF1-like antisense, GpEF1A- kit (QIAGEN, Hilden, Germany; protocol for heart, muscle, INT3-R. The PCR reaction was done as follows: 95° for 2 min, and skin tissue) after the cells had been homogenized with followed by 28 cycles of 95°/15 sec, 63°/30 sec, and 68°/40 sec ceramic beads and a wash brush (Nozaki et al. 1997, 2006). using KOD plus DNA polymerase (TOYOBO, Osaka, Japan) Full-length cDNA synthesis from the total RNA was carried out and GeneAmp PCR system 9700. with the CapFishing full-length cDNA premix kit (Seegene, Phylogenetic analysis of GpMID: Both the C. reinhardtii and Seoul, Korea). Nested RT–PCR using this cDNA yielded the V. carteri genome databases of the Department of Energy’s partial fragment of GpMID; the primers used in the first PCR Joint Genome Institute (JGI) (http://www.jgi.doe.gov/) were were the Seegene kit’s 39-rapid amplification of the cDNA end screened for RWP-RK domain genes by TBLASTN (NCBI) (39-RACE) primer and dMT-dF3 (primers designed in this using the CrMID protein sequence. We identified 15 and 10 study are listed in Table 1); the primers used in the second PCR predicted RWP-RK domain sequences of C. reinhardtii and were dMT-dF3 and mt-R4 (Nozaki et al. 2006). The PCR V. carteri, respectively. These numbers do not include the MID reactions were carried out using TAKARA Taq polymerase genes because the strains chosen for sequencing—plus and fe- (TAKARA, Osaka, Japan) using the cycling conditions de- male, respectively—do not possess the MID gene. The computer- scribed previously (Nozaki et al. 1995). To determine the C generated gene models associated with these RWP-RK domains terminus sequence of GpMID,39-RACE was performed with were assessed and modified or new models were created when the 39-RACE primer of the kit and GpMidF1. The N terminus necessary to ensure, for example, that the RWP-RK domain sequence was determined using the 59-RACE system (Invitro- was contained in the models that we ultimately annotated on gen, Carlsbad, CA) according to the manufacturer’s protocol; the JGI websites and to incorporate unpublished cDNA data the first antisense gene-specific primer was GpMidR3; the where available. For C. reinhardtii, the resulting models were second gene-specific primer was GpMidR1. The resulting frag- named RWP1-RWP14; the 15th gene had previously been named ments were TA subcloned using the pGEM T-easy kit (Prom- NIT2 (Schnell and Lefebvre 1993). The RWP-RK domain of ega, Madison, WI) and sequenced as described previously RWP12 is located at the N terminus; the initial methionine is (Nozaki et al. 2006). set at the seventh residue of the multiple alignment. Since it Genomic PCR and sequencing of GpMID: Genomic DNA seemed likely that the RWP-RK domain should extend farther from the four parental strains (Kaneko3 and -4; Mongolia 4 into the 59-region, the DNA sequence neighboring RWP12 was and 1) and their F1 progeny were prepared either by the analyzed by GENSCAN (Burge and Karlin 1997) with the ‘‘miniprep’’ method described by Miller et al. (1993) or using ‘‘organism’’ option as Arabidopsis, and a longer protein was the DNeasy plant mini kit (QIAGEN). For determining the used for the phylogenetic analysis. The 10 possible RWP-RK genomic sequence of GpMID from Kaneko3 and Mongolia 4, protein sequences from the V. carteri genome were also as- PCR amplification was performed with specific primers for sessed using GENSCAN. Most of the models from both species GpMID (GPMID5P-1F and GPMID3P-1R). The PCR reaction have little or no support from expressed sequence tags and so 286 T. Hamaji et al. should be viewed as tentative. The 25 gene models above, as LEU1S: Identified in the Chlamydomonas genome se- well as CrMID, CiMID, PlestMID, and GpMID, were aligned quence, the gene encoding the small subunit of isopropylma- using ClustalX (Thompsonet al. 1997) with the default option. late dehydratase (LEU1S; protein ID 126865 in the C. The 29 RWP-RK domains of 47 amino acids in length (sup- reinhardtii genome database version 3.0) is found in segment plemental Figure 1 at http://www.genetics.org/supplemental/) 4 of the sexually dimorphic R domain of the Chlamydomonas were subjected to a maximum-likelihood analysis based on the MT loci near the position of probe Pr65 in Ferris et al. (2002). Whelan and Goldman (WAG) model (Whelan and Goldman The G. pectorale LEU1S gene was cloned by screening a 2001) in PHYML online (Guindon et al. 2005). The robustness Mongolia 1 genomic EMBL3 library using as probe a 600-bp of the result was examined using a bootstrap analysis (Felsen- ClaI/HindIII fragment (roughly corresponding to the coding stein 1985) with 500 replications. On the basis of the same region) purified from a C. reinhardtii LEU1S cDNA clone alignment data, a maximum parsimony analysis was per- (provided by the Kazusa Institute; corresponds to AV388014). formed by PAUP*4.0b10 (Swofford 2003) with a bootstrap The portion of the phage insert containing the LEU1S gene analysis based on 1000 replications of the general heuristic was sequenced. To score progeny for the LEU1S marker, a PCR search using the tree-bisection-reconnection branch-swapping reaction was performed using primers gonleu13 and gon- algorithm. A neighbor-joining analysis (Saitou and Nei 1987) leu14. The resulting 1050-bp PCR product was then digested based on the Jones–Taylor–Thornton (JTT) model (Jones with MfeI and subjected to agarose gel electrophoresis, pro- et al. 1992) was also performed by MEGA 4.0 (Tamura et al. ducing different band patterns in the two alleles (in Mongolia 2007) with a bootstrap analysis based on 500 replications. 1: 470 and 580 bp; in Mongolia 4: 360 and 690 bp). Phylogenetic trees including subsets of these RWP-RK do- ALB3.1: The ALB3.1 gene, also known in the Chlamydo- mains have also been published by Nozaki et al. (2006) and monas literature as AC29,is40 kb centromere distal of Lin and Goodenough (2007). the MT locus R domain (Ferris et al. 2002). The G. pectorale Scoring of genetic markers in the F1 progeny: Mating ALB3.1 gene was cloned by screening an Alaska2 genomic phenotype: The mating type of the progeny was determined by EMBL3 library using a portion of the C. reinhardtii ALB3.1 mating tests with the two parental strains to determine with cDNA as the probe. The portion of the phage insert corre- which parent zygotes were formed. Each F1 was co-inoculated sponding to the ALB3.1 gene was sequenced. The predicted separately with both parent strains in soil–water medium tubes protein product of the G. pectorale gene was clearly more and allowed to grow up under constant illumination. If mating similar to the C. reinhardtii ALB3.1 gene linked to the mating- was abundant, a zygote pellicle could be seen after 4–5 days, type locus than to the unlinked ALB3.2 gene (Bellafiore et al. but in any case, after 5–7 days the thick-walled, orange-colored 2002). To score progeny for the ALB3.1 marker, a PCR reac- zygotes were readily identifiable by light microscopy even if tion was performed using primers gac30 and gac31, and the only a few percent of the cells had mated. A few progeny failed 350-bp PCR product was then digested with PstI, which cuts to mate with either parent. only the Mongolia 1 allele (into 240 and 110 bp), and analyzed ACT and YPT4: The actin (ACT) gene and small G-protein by agarose gel electrophoresis. gene YPT4 (Fabry et al. 1998) were chosen as controls because MID: To determine the presence or absence of the GpMID they are unlinked to MT in Chlamydomonas and because PCR gene in the genome, PCR was carried out with specific primers: primers had been designed previously by Liss et al. (1997) Mong4F1 and Mong4R1 for GpMID. As the internal control, for amplifying these two genes from Volvocales. On the JGI ACT gene-specific primers gonact1 and gonact2 were used. Chlamydomonas genome website, these two genes are anno- Organellar markers: Chloroplast and mitochondrial genomes tated as IDA5 and RABB1, respectively. from the two parents were scored by taking advantage of The A/9-59 and A/9-39 primers were used to amplify intron RFLPs. Genomic DNA (500 ng) of the parental and progeny IX of ACT by PCR from both the Mongolia 1 and 4 strains. The strains was digested with PstI, electrophoresed on a 0.75% sequences of these two PCR products were used to design agarose gel in TBE buffer, and transferred to nitrocellulose. two nondegenerate primers, gonact1 and gonact2, that PCR The blots were hybridized (Church and Gilbert 1984) se- amplify both ACT alleles. That 380-bp PCR product was quentially with the PR46a probe (see above), the mitochon- double digested with EcoRI (one site in the Mongolia 1 allele, dria probe, and the chloroplast probe, stripping the filters to yielding bands of 180 and 200 bp) and XhoI (one site in the remove the previous probe before rehybridizing. The probe Mongolia 4 allele, yielding bands of 140 and 240 bp) and for mitochondrial DNA was the 1.6-kb EcoRI/HindIII frag- analyzed by agarose gel electrophoresis. ment of the C. reinhardtii mitochondrial genome, purified The 4/6-59 and 4/6-39 primers were used to amplify intron from the P318 plasmid obtained from the Chlamydomonas VI of YPT4 by PCR from the Mongolia 1 and 4 strains. The Center. Hybridization was carried out at a reduced stringency: sequences of these two PCR products were used to design two 60° rather than the usual 65°. nondegenerate primers, gonypt1 and gonypt2, that PCR To visualize chloroplast DNA, a section of the G. pectorale amplify both YPT4 alleles. The 360-bp PCR product was psaA gene (AB044242) was PCR amplified using Alaska2 ge- then digested with HinfI and analyzed by agarose gel electro- nomic DNA as template with primers gonpsa1 and gonpsa2. phoresis to visualize the different patterns of bands in the two The 850-bp PCR product was used as probe at normal strin- strains (in Mongolia 1: 260, 70, and 30 bp; in Mongolia 4: 120, gency (65°). All probes were radiolabeled with ½a-32PdCTP by 110, 70, and 60 bp). random priming. PR46a: The PR46a gene is within segment 3 of the sexually dimorphic R domain of the C. reinhardtii MT loci (Ferris et al. RESULTS 2002). Its predicted amino acid sequence was used to design primers for amplifying the PR46a gene from G. pectorale genomic Identification and characterization of GpMID: Dif- DNA. PCR of Mongolia 4 genomic DNA using primers pr46for ferential nested RT–PCR using cDNA prepared from and pr46rev yielded an 200-bp product, which was TA ‘‘sexually activated cultures’’ of Kaneko3 (minus) and -4 subcloned using the pGEM T-easy kit. The gel-purified insert (plus) displayed a fragment of the expected length for was radiolabeled with 32P and hybridized at a reduced stringency (58°)tothePstI-digested genomic DNA Southern blots used to MID orthologs (149 bp) only in Kaneko3. The full- score chloroplast and mitochondria markers (see below). The length cDNA sequence indicated that the mRNA is 1.5– RFLP visualized in Mongolia 1 is 1.0 kb and in Mongolia 4, 1.8 kb. 1.6 kb in length. The predicted open reading frame Mating-Type Locus in Gonium 287

Figure 1.—Alignment of four MID proteins from G. pectorale (GpMID), P. starrii (PlestMID), C. reinhardtii (CrMID), and C. incerta (CiMID). Solid and shaded backgrounds indicate identity in 100% or in 75% of the sequences aligned, respectively. Five amino acids composing a leucine zipper are marked with asterisks. A line marks the RWP-RK domain of 47 amino acids used for the phylogenetic analyses (Figure 5).

encodes 164 amino acids; the hypothetical molecular introns that are present in the CrMID and CiMID genes, weight is 18 kDa; the theoretical pI is 9.25. The and all four are shared with PlestMID (Figure 2). hypothetical polypeptide sequence contains a leucine A genomic DNA gel blot analysis of restriction- zipper and an RWP-RK domain near the C terminus digested plus and minus DNA probed with a PCR frag- (Figure 1). A BLASTP search (http://www.ncbi.nih.gov/) ment of GpMID demonstrated a minus-specific single with this sequence indicated that it is similar to PlestMID band (Figure 3), indicating that GpMID is a single-copy (E ¼ 5e-46), CiMID (E ¼ 4e-28), and CrMID (E ¼ 2e-27). gene in minus (Kaneko3). The lack of hybridizing signal The percentage of identity of GpMID protein with in the plus strain (Kaneko4) suggests genomic asymme- CrMID, CiMID, and PlestMID is 38.4, 38.4, and 53.3, try between mating types. A similar result was observed respectively. A BLASTN search (http://www.ncbi.nih. with Mongolia 1 and 4 strains; the signal was detected gov/) using an expect threshold of 10 and a word size not from Mongolia 1 (plus) but from Mongolia 4 (minus; of 11 with the GpMID cDNA sequence found matches data not shown). This conclusion was confirmed when with PlestMID but none with CrMID or CiMID. The cod- specific GpMID primers were used to perform PCR with ing region is 52.9% GC and the primary transcript is DNA samples from plus and minus F1 progeny derived 51.4% GC. from Kaneko3 3 -4, consistent with their mating pheno- The genomic GpMID gene sequenced in this study types (data not shown). These results clearly suggest (1603 bp) covered nearly the entire cDNA sequence and that the mating type minus of G. pectorale correlates with demonstrated that it contains four introns, three of the presence of GpMID. which are in positions very similar to those of the three Semiquantitative RT–PCR with the GpMID cDNA- specific primers showed that GpMID transcription was upregulated in nitrogen-free culture (Figure 4). The mating reaction commenced immediately after mixing the two complementary mating types when the cells were nitrogen starved for 18 hr, whereas no mating reaction occurred within 24 hr after mixing of cells cultured in SVM. These observations suggest that expression of GpMID increased in minus gametes induced by nitrogen starvation. Phylogenetic analysis of genes containing the conserved RWP-RK domain: To confirm that GpMID is orthologous to the MID genes, a phylogenetic analysis was carried out using the alignment of four MID proteins and 25 other RWP-RK domains of C. reinhardtii and V. carteri. As shown in Figure 5, the four MID proteins Figure 2.—Exon–intron structure of MID genes from G. formed a robust monophyletic group (with 74–91% pectorale (GpMID), P. starrii (PlestMID), C. reinhardtii (CrMID), bootstrap values). Within the MID clade, GpMID and and C. incerta (CiMID). Corresponding parts of the coding regions (CDS) are interconnected by dotted lines. The line dis- PlestMID are sister to each other with 81–99% bootstrap played above GpMID indicates the region used as a probe for values. Similar results were reported by Lin and Good- the DNA gel blot analysis. enough (2007) using a smaller set of genes. 288 T. Hamaji et al.

Figure 4.—Semiquantitative RT–PCR analysis of GpMID. The Kaneko3 strain was cultured either in nitrogen-free SVM (N-free SVM) for 18 hr or in ordinary SVM. Poly(A)1 RNA from these cultures was reverse transcribed and PCR am- pliﬁed using primers for GpMID and for the EF1-like gene, which served as an internal control.

Figure 6 shows a representative DNA–DNA gel blot and AFLP analyses used to score the nuclear markers in the F1 progeny, and Figure 7 shows the genotype of the entire set of progeny. Table 3 shows, for each pair of markers, the proportion of progeny that are recombinant. As anticipated, the ACT and YPT4 genes are not linked to each other or to any other marker. However, the LEU1S gene was strictly linked to mating type. The PR46a and ALB3.1 genes are loosely linked to each other, recombining in only 12 of 77 progeny, a map Figure 3.—GpMID is present only in MT. Genomic DNA iso- distance of 16 cM (Table 3), but are not linked to mating lated from a minus strain, Kaneko3 (labeled ‘‘’’ below the gel) type. The presence of GpMID is strictly linked to having a and a plus strain, Kaneko4 (labeled ‘‘1’’), was digested with either SacII or PstI and hybridized with the GpMID probe whose minus mating phenotype; no GpMID was found in plus location is shown in Figure 2. Size standards are shown on the progeny. left. GpMID is detected as a single band only in the minus strain. Of the 20 progeny strains that showed both alleles of the ACT marker, 3 were resubcloned and proved to have Nuclear and organellar genetics: The bulk of the ge- both alleles for all nuclear markers, as well as the GpMID netic mapping data was generated using 78 progeny of a marker, and hence are likely diploid (Figure 6). All single cross between Mongolia 1 and 4 (Tables 2 and 3; three of them mated with the plus parent. Therefore, Figures 6–8). Another 20 progeny were eliminated from the dominant mating type of G. pectorale is minus. further analysis after being scored with only the ACT The direction of uniparental inheritance was tested marker because they contained both parental alleles in the F1 progeny as well. Radiolabeled probes to the and either were diploid/aneuploid or were not properly chloroplast and mitochondrial DNA were hybridized to subcloned. As shown in Table 2, recovery of the alleles Southern blots of PstI-digested DNA from parents and for some of the markers deviates from 1:1 in several progeny. The 11-kb chloroplast DNA fragment from the cases, especially YPT4. plus parent was inherited in 66 progeny (UP1), while Six nuclear genes were scored by taking advantage of only 5 progeny inherited the 2.8-kb fragment of the sequence polymorphisms between the parental strains. minus parent (Figure 8A). Seven progeny showed a band Since this is the ﬁrst G. pectorale genetic analysis and of 20 kb not present in either parent, either in con- G. pectorale is not routinely in laboratory use, it was im- junction with the 11-kb band (5 progeny, one of which is portant to ensure that the progeny were indeed products shown in Figure 8A) or as the sole band (2 progeny). of meiosis and not, for example, unmated gametes that Perhaps this represents a polymorphism that appeared had somehow survived freezing. Hence, two genes (ACT in a subpopulation of the plus parent strain after the and YPT4) that are not expected to be MT linked (Ferris DNA preparation was made. We chose to score these 7 et al. 2002) were chosen as controls to conﬁrm indepen- progeny as having inherited from the plus parent. dent segregation of unlinked markers. The remaining Seventy progeny inherited exclusively the 7-kb mito- four markers are all linked to the MT locus in C. reinhardtii chondrial DNA fragment from the minus parent (UP), (Ferris and Goodenough 1994, Ferris et al. 2002): while the 10-kb fragment from the plus parent was in- three (LEU1S, PR46a,andMID) are in the dimorphic R herited in only a single progeny (Figure 8B, top). Seven domain of the MT locus, and one (ALB3.1) is located just progeny were biparental, but the Mongolia 4 (minus)- centromere distal of the R domain. The mating phenotype band predominated (e.g., the fourth progeny in type was also scored to be either plus or minus. Figure 8B, top). Mating-Type Locus in Gonium 289

Figure 5.—Maximum-likelihood (ML) tree (based on WAG model) of four MID proteins and 25 RWP-RK domains from C. reinhardtii (Cr) and V. carteri (Vc) genome databases. Branch lengths are proportional to the estimated amino acid substitutions, which are indicated by the scale bar above the tree. Numbers to the left of branch points indicate bootstrap values of the ML, neighbor-joining (based on the JTT model), and maximum parsimonious analyses, respectively, of the same data matrix and are included only if the value is $50%. Only CrNIT2 and the MID genes are characterized.

As a control for the possibility that a replication DISCUSSION advantage of the mitochondrial DNA from the Mongo- GpMID is an ortholog of CrMID: The structure of lia 4 parent might be mistaken for uniparental inheri- GpMID is essentially consistent with that of the other tance, the single progeny (marked as P2 in both panels MID orthologs, CrMID, CiMID, and PlestMID (Ferris of Figure 8B) that was minus with a Mongolia 1 (plus)- and Goodenough 1997; Ferris et al. 1997; Nozaki et al. type mitochondrial genome was crossed with another F 1 2006). They have the homologous RWP-RK domain, the progeny (lane P1 in the bottom of Figure 8B) that was putative bZIP DNA-binding region containing the regu- plus and had inherited the Mongolia 4 mitochondrial larly repeated hydrophobic amino acids (Figure 1). DNA. All 12 progeny inherited the mitochondrial DNA Moreover, the present phylogenetic analysis clearly of the minus parent (P2), which in this cross was the demonstrates that all four MID genes form a robust Mongolia 1 allele. The 12 F progeny were also tested for 2 monophyletic group relative to other RWP-RK domain- segregation of several nuclear markers to ensure that containing genes in C. reinhardtii and V. carteri (Figure they were indeed meiotic progeny (not shown). 5). Although the GpMID protein sequence shows sim-

TABLE 2 TABLE 3 Ratio of parental alleles in the progeny for each locus Fraction of progeny recombinant for each pair of markers No. of No. of progeny progeny Mating with with ACT YPT ALB3.1 PR46a LEU1S MID type Mongolia 1 Mongolia 4 Ratio of Locus allele allele Mongolia1:Mongolia 4 ACT — 42/78 36/78 39/77 48/78 48/78 42/69 YPT — 38/78 37/77 40/78 40/78 35/69 ACT 44 34 1.3:1 ALB3.1 — 12/77 40/78 40/78 38/69 YPT4 26 52 0.5:1 PR46a — 44/77 44/77 39/68 ALB3.1 38 40 0.95:1 LEU1S — 0/78 0/69 PR46a 46 31 1.5:1 MID — 0/69 LEU1S/MID 36 42 0.86:1 Mating — Mating type 33 36 0.92:1 type 290 T. Hamaji et al.

Figure 6.—Scoring the nuclear markers in the F1 progeny. A sampling of the DNA gel blot and PCR–RFLP analyses on G. pectorale progeny strains for the six nuclear markers. Diploid strains are marked with asterisks. Parental strains were Mongolia 1 (M1) and Mongolia 4 (M4). Size markers (in base pairs) are indicated to the right. The panels do not display the same sets of progeny. The presence/absence of MID (top band) is shown with ACT as an internal control (bottom band).

ilarity to the other three MID orthologs, the present not detect any MID signal in G. pectorale by the low- analysis using the nucleotide sequence (BLASTN of stringency DNA gel blot analysis. As with CrMID and NCBI) could not find significant matches between PlestMID (Ferris and Goodenough 1997; Nozaki et al. GpMID and the two MID orthologs of Chlamydomonas, 2006), GpMID is a mating-type-specific gene that is ex- consistent with the fact that Ferris et al. (1997) could pressed in nitrogen-starved cultures of minus/male

Figure 7.—A complete representation of which alleles were inherited in the set of G. pectorale F1 progeny examined. Shaded boxes indicate inheritance of the phenotype (mating type: MT) or genotype (chlp, chloroplast; mito, mitochondria) of the plus parent ½M1 (MT1); open boxes indicate the minus parent ½M4 (MT). A circle within a square indicates that the mating phenotype was not observed, or there were no data. A half-shaded/half-open square indicates biparental transmission of mitochondrial markers. Mating-Type Locus in Gonium 291

been applied to the colonial volvocalean algae (Sizova et al. 2001; Jakobiak et al.2004;Hallmann and Wodniok 2006). This transgenic approach may be available in G. pectorale to examine the GpMID function in the plus strain. Regulation of the TMS formation might have changed in the course of evolution: In C. reinhardtii, gametes of only one of the two mating types, plus, bear TMS, but mid-1, the CrMID-defective mutant of the minus strain, forms a TMS, suggesting that CrMID directly or indi- rectly suppresses the formation of TMS (Goodenough et al. 1982; Ferris and Goodenough 1997; Lin and Goodenough 2007). However, gametes of both mating types of G. pectorale form TMS (Nozaki 1984), whereas GpMID is present only in minus genomes (Figure 3). Therefore, G. pectorale may be different from C. reinhardtii in that its MID gene (or a downstream MID responsive gene) may not suppress formation of TMS. Because G. pectorale and the anisogamous/oogamous alga P. starrii (Nozaki et al. 2006) have MID orthologs that are mating- type-specific as in C. reinhardtii (Ferris and Goodenough 1997), the mating-type-specific feature of MID orthologs seems to be conservative within the colonial Volvocales. In addition, almost all of the isogamous colonial Volvo- Figure 8.—Uniparental inheritance of organellar genomes in progeny of G. pectorale crosses. (A) Genomic DNA of the cales (Gonium, Astrephomene, Pandorina, Volvulina, and two parent strains (Mongolia 1 and 4, M1 and M4, respec- Yamagishiella) have TMS in each of the two conjugating tively) and 11 F1 progeny were digested with PstI, and the re- gametes, and this type of TMS might have evolved from sulting Southern blot was hybridized with a portion of the G. TMS as found in C. reinhardtii (Nozaki and Itoh 1994; pectorale psaA gene to visualize chloroplast DNA. (B) (Top) Ge- Nozaki et al. 2000). Therefore, the loss of suppression of nomic DNA of the two parent strains (M1 and M4) and 11 progeny were digested with PstI, and the resulting Southern TMS formation as suggested in the GpMID contol pathway blot was hybridized with a portion of the C. reinhardtii mito- might have evolved in the common ancestor of these chondrial genome to visualize mitochondrial DNA. One of members of the colonial Volvocales, possibly at an early the parents (P2) used in a second cross is indicated. (Bottom) evolutionary stage (a four- to eight-celled colonial stage) Parents and progeny of an F2 cross using F1 progeny P1 and within the colonial Volvocales (Nozaki and Itoh 1994; P2 as parents. Positions of size markers (in kilobases) are in- ozaki dicated at the right. N et al. 2000). Nuclear genetics suggests dynamic reorganization in the MT locus: On the basis of this genetic analysis of strains. In both DNA gel blot analysis and genomic PCR, G. pectorale F1 progeny, the LEU1S gene and presence/ GpMID was detected in minus strains, but not in plus absence of GpMID are strictly linked to mating pheno- (Figures 3 and 7). An increase in expression of GpMID types (Table 3; Figure 7). In contrast, the other four was detected by RT–PCR in nitrogen-starved cultures of nuclear genes (PR46a, ACT, YPT4, and ALB3.1) are gen- minus (Figure 4). PlestMID, the MID ortholog from P. etically independent of plus or minus in G. pectorale, starrii, was shown to be localized in the sperm (male although ALB3.1 and PR46a are located 16 cM apart. We gamete) nucleus by immunofluorescent microscopy suggest that GpMID and LEU1S are likely harbored in a (Nozaki et al. 2006). Therefore, GpMID is supposed chromosomal region of recombinational suppression to be functional in the nucleus of the G. pectorale minus that is comparable to the C. reinhardtii MT locus, al- gamete. though this linkage could also be explained if the two Diploid progeny from Mongolia 1 (plus) and Mongo- genes are close together—they are only 50 kb apart in lia 4 (minus) exhibited a minus phenotype. C. reinhardtii Chlamydomonas. In C. reinhardtii, two genes (ACT and diploids also exhibit this minus dominance (Ebersold YPT4) are also not MT linked (Ferris et al. 2002) 1967), which is the result of the presence of the MID whereas all four remaining markers are linked to MT in gene (Ferris and Goodenough 1997). The GpMID C. reinhardtii (Ferris and Goodenough 1994; Ferris gene presumably makes minus the dominant mating et al. 2002): one centromere distal of the R domain type in G. pectorale. Transformation of GpMID DNA into a (ALB3.1) and the remaining three (LEU1S, PR46a, and G. pectorale plus strain would confirm this point but has CrMID) in the R domain. Therefore, gene rearrange- not been performed because there is no stable trans- ment within and around the MT locus must have oc- formation method in G. pectorale. Recently, however, the curred during the evolution from the common ancestor highly efficient transgenic method in C. reinhardtii has of C. reinhardtii and G. pectorale. Whether the PR46a and 292 T. Hamaji et al.

ALB3.1 genes have relocated to another chromosome typical GC content, its noncoding sequences (introns or to a more distant location on the same chromosome plus UTRs) have a GC content of only 54% (P. J. Ferris is not yet determined. and J. Umen, unpublished results), while the G. pectorale One of the unusual features of the MID genes is the ortholog is 55.5% GC coding, and 50.2% GC noncoding relatively low GC content (GpMID: 52.9%; PlestMID: (T. Hamaji,P.J.Ferris,I.Nishii and H. Nozaki, 49.1%; CrMID: 50.5%; CiMID: 49.4%). GC content of unpublished results). The amino acid composition of coding regions is high in C. reinhardtii (68%; Merchant the C. reinhardtii MTD1 is biased toward GC-rich codons, et al. 2007) and in C. incerta (64.7%; Popescu et al. 2006) suggesting that other selection pressures on the GC and, although based only on the two gene sequences content of the coding region may obscure the effect of (ALB3.1 and LEU1S) reported here (68.5%), G. pectorale BGCGC. may be similar. The GC content of MID is low in the Organellar inheritance between isogamy and anisog- introns and UTRs as well. In Ferris et al. (2002), it was amy/oogamy might have changed: In C. reinhardtii,the suggested that the low GC content of both MID and uniparental inheritance of organellar genomes differs FUS1 (which exists only in the MT1 locus; Ferris et al. in plastids and mitochondria (Boynton et al. 1987). 1996) could result from being restricted to only one MT The plastid genome in F1 progeny is usually transmitted locus over evolutionary time periods. One possible from the plus parent whereas the mitochondrial DNA mechanism consistent with this idea is ‘‘biased gene of the progeny is from the parental minus, which has conversion toward GC’’ (BGCGC; reviewed in Marais CrMID. The mode of uniparental inheritance of plastid 2003). In the BGCGC scheme, when recombination or and mitochondrial genomes in G. pectorale is UP1 and gene conversion occurs, repair mechanisms tend to UP, respectively (Table 3), the same as that of C. replace the mismatches in the resulting DNA hetero- reinhardtii. However, both the chloroplast and mito- duplexes toward G or C; recombination rate correlates chondrial genomes are transmitted from the female with the GC content in yeast, invertebrate, and mam- parent in the oogamous V. carteri (Adams et al. 1990). malian genomes. The MID gene never undergoes re- Both V. carteri and its close relative P. starrii have the combination since it is hemizygous in the diploid stage MID ortholog (PlestMID) in the male strains (Nozaki and would escape biased conversion, accounting for the et al. 2006 and P. J. Ferris,T.Hamaji,I.Nishii and lower GC content over both coding and noncoding H. Nozaki, unpublished results), suggesting that the sequences. Since MID has been conserved throughout male in the anisogamous/oogamous volvocaleans evolved the Volvocales (being present also in the V. carteri male from the MID-containing, minus mating type of C. mating type; P. J. Ferris,T.Hamaji,I.Nishii and H. reinhardtii (Nozaki et al. 2006). Therefore, the unipa- Nozaki, unpublished results), it would have been sub- rental inheritance of the mitochondrial genome has ject to BGCGC for at least 50 MY (Kirk 2005). The lower changed at some point during the evolution of the GC content of Y-specific genes in humans has been colonial Volvocales from uniparentally from the MID- postulated to be the result of BGCGC as well (Galtier containing (minus) parent to uniparentally from the et al. 2001). female, which does not carry MID. Biased gene conversion can also explain the similarly Conclusion: This characterization of the minus- low GC content (47.7%) of FUS1; however, no orthologs specific gene GpMID and analyses of F1 progeny suggested of FUS1 have been characterized, so there is no in- that GpMID and LEU1S are harbored in a chromosomal formation on how long FUS1 has been restricted to only region under recombinational suppression that is com- one mating type. Three additional genes in the C. parable to the C. reinhardtii MT locus, which consists of reinhardtii MT loci—MTA1, EZY2, and MTD1—are a 1-Mb region of recombinational suppression and sexually dimorphic but have coding-region GC contents harbors several mating-type-specific genes (Ferris and typical for C. reinhardtii (65, 68, and 68%, respectively). Goodenough 1994; Ferris et al. 2002); the linkage of The MT1 locus-specific MTA1 appears to have been the two genes could also be explained by their close created within a recent duplication from another chro- proximity (e.g., within 50 kb in Chlamydomonas). Nozaki mosome (Ferris et al. 2002). Hence, MTA1 likely exists et al. (2006) demonstrated that PlestMID and its pseudo- only in C. reinhardtii, and there has been only limited gene PsPlestMID in the anisogamous colonial volvocalean time for BGCGC to affect this sequence. The EZY2 gene P. starrii are also mating type (male) specific and have is a tandemly repeated gene in the MT1 locus, but this is neutral GC contents that may represent suppression of also likely a recent event, with a single well-conserved recombination in the regions of the two genes. Therefore, (albeit pseudogene) copy of EZY2 still present in MT thepresenceofaMT locus under recombinational sup- (Ferris et al. 2002). In addition, BGCGC can occur via pression may be conserved within the isogamous and the mechanisms responsible for concerted evolution in anisogamous/oogamous members of the colonial Volvo- tandem arrays (Galtier et al. 2001). No orthologs of cales. However, these genetic analyses of G. pectorale dem- the EZY2 gene have been identified. Finally, MTD1 is onstrated that chromosomal rearrangement including limited to the MT locus (Ferris et al. 2002; Lin and the MT locus must have occurred during the evolution Goodenough 2007). Although its coding region has a from the common ancestor of C. reinhardtii and G. pectorale. Mating-Type Locus in Gonium 293

Genomic analyses of MT loci using BAC libraries from Goodenough, U. W., P. A. Detmers and C. Hwang, 1982 Activa- colonial Volvocales including G. pectorale and P. starrii tion for cell fusion in Chlamydomonas: analysis of wild-type gametes and nonfusing mutants. J. Cell Biol. 92: 378–386. will resolve important gene changes in the MT loci during Guindon, S., F. Lethiec,P.Duroux and O. Gascuel, 2005 PHYML the evolution of TMS and the origin of female and male Online: a web server for fast maximum likelihood-based phyloge- within this model lineage of ‘‘sex evolution.’’ netic inference. Nucleic Acids Res. 33: W557–W559. Hallmann, A., and S. Wodniok, 2006 Swapped green algal pro- We thank Linda Small for her technical support and Ursula moters: aphVIII-based gene constructs with Chlamydomonas flank- Goodenough and Jim Umen for their encouragement. The C. ing sequences work as dominant selectable markers in Volvox and reinhardtii sequence data were produced by the U. S. Department of vice versa. Plant Cell Rep. 25: 582–591. arris Energy Joint Genome Institute (http://www.jgi.doe.gov/). The V. H , E. H., 1989 The Chlamydomonas Sourcebook. Academic Press, San Diego. carteri genome sequencing work was performed by the Joint Genome Jakobiak, T., W. Mages,B.Scharf,P.Babinger,K.Stark et al., Institute under the auspices of the U. S. Department of Energy’s Office 2004 The bacterial paromomycin resistance gene, aphH,asa of Science, Biological and Environmental Research Program and the dominant selectable marker in Volvox carteri. Protist 155: 381–393. University of California, Lawrence Livermore National Laboratory, Jones, D. T., W. R. Taylor and J. M. Thornton, 1992 The rapid under contract no. W-7405-ENG-48; Lawrence Berkeley National Lab- generation of mutation data matrices from protein sequences. oratory under contract no. DE-AC03-76SF00098; and Los Alamos Comput. Appl. Biosci. 8: 275–282. National Laboratory under contract no. W-7405-ENG-36; and was Karol, K. G., R. M. McCourt,M.T.Cimino and C. F. Delwiche, provided for use in this publication only. This work was supported by a 2001 The closest living relatives of land plants. Science 294: Grant-in-Aid for Creative Scientific Research (no. 16GS0304 to H.N.); 2351–2353. asai awachi rata atanabe by a Grant-in-Aid for Scientific Research (no. 17370087 to H.N.) from K , F., M. K ,M.E and M. M. W (Editors), 2004 NIES-Collection. List of Strains. Microalgae and Protozoa, Ed. the Ministry of Education, Culture, Sports, Science and Technology, 7. National Institute for Environmental Studies, Tsukuba, Japan. Japan; by the Japan Society for the Promotion of Science (nos. S05750 Kirk, D. L., 2005 A twelve-step program for evolving multicellularity and L06701 to P.J.F.); and by the National Science Foundation (no. and a division of labor. BioEssays 27: 299–310. 9904667). Lin, H, and U. W. Goodenough, 2007 Gametogenesis in the Chla- mydomonas reinhardtii minus mating type is controlled by two genes, MID and MTD1. Genetics 176: 913–925. LITERATURE CITED Liss, M., D. L. Kirk,K.Beyser and S. Fabry, 1997 Intron sequences provide a tool for high-resolution phylogenetic analysis of volvo- Adams, C. R., K. A. Stamer,J.K.Miller,J.G.McNally,M.M.Kirk cine algae. Curr. Genet. 31: 214–227. et al., 1990 Patterns of organellar and nuclear inheritance Marais, G., 2003 Biased gene conversion: implications for genome among progeny of two geographically isolated strains of Volvox and sex evolution. Trends Genet. 19: 330–338. carteri. Curr. Genet. 18: 141–153. erchant rochnik allon arris ellafiore erris aver hre ochaix M , S. S., S. E. P ,O.V ,E.H.H ,S.J. B , S., P. F ,H.N ,V.Go¨ and J. D. R , arpowicz 2002 Loss of Albino3 leads to the specific depletion of the K et al., 2007 The Chlamydomonas genome reveals light-harvesting system. Plant Cell 14: 2303–2314. the evolution of key animal and plant functions. Science 318: oynton arris urkhart amerson 245–250. B , J. E., E. H. H ,B.D.B ,P.M.L and iller chmitt irk N. W. Gillham, 1987 Transmission of mitochondrial and chlo- M , S. M., R. S and D. L. K , 1993 Jordan, an active roplast genomes in crosses of Chlamydomonas. Proc. Natl. Acad. Volvox transposable element similar to higher plant transposons. Plant Cell 5: 1125–1138. Sci. USA 84: 2391–2395. ishii gihara irk Burge, C., and S. Karlin, 1997 Prediction of complete gene struc- N , I., S. O and D. K , 2003 A kinesin, InvA, plays an essential role in Volvox morphogenesis. Cell 113: 743–753. tures in human genomic DNA. J. Mol. Biol. 268: 78–94. ozaki Church, G. M., and W. Gilbert, 1984 Genomic sequencing. Proc. N , H., 1984 Newly found facets in the asexual and sexual re- Natl. Acad. Sci. USA 81: 1991–1995. production of Gonium pectorale (Chlorophyta, Volvocales). Jpn. J. Ebersold, W. T., 1967 Chlamydomonas reinhardi: heterozygous dip- Phycol. 32: 130–133. ozaki toh loid strains. Science 157: 447–449. N , H., and M. I , 1994 Phylogenetic relationships within Fabry, S., A. Ko¨hler and A. W. Coleman, 1998 Intraspecies analy- the colonial Volvocales (Chlorophyta) inferred from cladistic sis: comparison of ITS sequence data and gene intron sequence analysis based on morphological data. J. Phycol. 30: 353–365. ozaki toh ano chida atanabe data with breeding data for a worldwide collection of Gonium pec- N , H., M. I ,R.S ,H.U ,M.M.W et al., torale. J. Mol. Evol. 48: 94–101. 1995 Phylogenetic relationships within the colonial Volvocales Felsenstein, J., 1985 Confidence limits on phylogenies: an ap- (Chlorophyta) inferred from rbcL gene sequence data. J. Phycol. proach using the bootstrap. Evolution 39: 783–791. 31: 970–979. ozaki to atanabe akano uroiwa Ferris, P. J., and U. W. Goodenough, 1994 The mating-type locus N , H., M. I ,M.M.W ,H.T and T. K , of Chlamydomonas reinhardtii contains highly rearranged DNA se- 1997 Phylogenetic analysis of morphological species of Carteria quences. Cell 76: 1135–1145. (Volvocales, Chlorophyta) based on rbcL gene sequences. J. Phy- Ferris, P. J., and U. W. Goodenough, 1997 Mating type in Chlamy- col. 33: 864–867. domonas is specified by mid, the minus-dominance gene. Genetics Nozaki, H., K. Misawa,T.Kajita,M.Kato,S.Nohara et al., 146: 859–869. 2000 Origin and evolution of the colonial volvocales (Chloro- Ferris, P. J., J. P. Woessner and U. W. Goodenough, 1996 A sex phyceae) as inferred from multiple, chloroplast gene sequences. recognition glycoprotein is encoded by the plus mating-type gene Mol. Phylogenet. Evol. 17: 256–268. fus1 of Chlamydomonas reinhardtii. Mol. Biol. Cell 7: 1235–1248. Nozaki, H., T. Mori,O.Misumi,S.Matsunaga and T. Kuroiwa, Ferris, P. J., C. Pavlovic,S.Fabry and U. W. Goodenough, 2006 Males evolved from the dominant isogametic mating type. 1997 Rapid evolution of sex-related genes in Chlamydomonas. Curr. Biol. 16: R1018–R1020. Proc. Natl. Acad. Sci. USA 94: 8634–8639. Popescu, C. E., T. Borza,J.P.Bilawski and R. W. Lee, 2006 Evo- Ferris, P. J., E. V. Armbrust and U. W. Goodenough, 2002 Genetic lutionary rates and expression level in Chlamydomonas. Genetics structure of the mating-type locus of Chlamydomonas reinhardtii. 172: 1567–1576. Genetics 160: 181–200. Pringsheim, E. G., 1946 Pure Cultures of Algae. Cambridge University Gachon, C. M. M., J. G. Day,C.N.Campbell,T.Pro¨schold,R.J. Press, Cambridge, UK. Saxon et al., 2007 The Culture Collection of Algae and Pro- Rokas, A., D. Kru¨ger and S. B. Carroll, 2005 Animal evolution tozoa (CCAP): a biological resource for protistan genomics. and the molecular signature of radiations compressed in time. Gene 406: 51–57. Science 310: 1933–1938. Galtier, N., G. Piganeau,D.Mouchiroud and L. Duret, 2001 GC- Saitou, N., and M. Nei, 1987 The neighbor-joining method: a new content evolution in mammalian genomes: the biased gene con- method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4: version hypothesis. Genetics 159: 907–911. 406–425. 294 T. Hamaji et al.

Sambrook, J., and D. Russell, 2001 Molecular Cloning: A Laboratory Stein, J. R., 1958 A morphologic and genetic study of Gonium pector- Manual, Ed. 3. Cold Spring Harbor Laboratory Press, Cold ale. Am. J. Bot. 45: 664–672. Spring Harbor, NY. Swofford, D. L., 2003 PAUP*. Phylogenetic Analysis Using Parsimony Schauser, L., A. Roussis,J.Stiller and J. Stougaard, 1999 A (*and Other Methods), Version 4.0b10. Sinauer Associates, Sunder- plant regulator controlling development of symbiotic root nod- land, MA. ules. Nature 402: 191–195. Tamura, K., J. Dudley,M.Nei and S. Kumar, 2007 MEGA4: Molec- Schauser, L., W. Wieloch and J. Stougaard, 2005 Evolution of ular Evolutionary Genetics Analysis (MEGA) software version 4.0. NIN-like proteins in Arabidopsis, rice, and Lotus japonicus. J. Mol. Biol. Evol. 24: 1596–1599. Mol. Evol. 60: 229–237. Thompson, J. D., T. J. Gibson,F.Plewniak,F.Jeanmougin and D. G. Schnell, R. A., and P. A. Lefebvre, 1993 Isolation of the Chlamy- Higgins, 1997 The ClustalX windows interface: ﬂexible strate- domonas regulatory gene NIT2 by transposon tagging. Genetics gies for multiple sequence alignment aided by quality analysis 134: 737–747. tools. Nucleic Acids Res. 25: 4876–4882. Schreiber, E., 1925 Zur Kenntnis der Physiologie und Sexualita¨t Whelan, S., and N. Goldman, 2001 A general empirical model of ho¨herer Volvocales. Zeitschr. Bot. 17: 337–376. protein evolution derived from multiple protein families using a Sizova, I., M. Fuhrmann and P. Hegemann, 2001 A Streptomyces ri- maximum-likelihood approach. Mol. Biol. Evol. 18: 691–699. mosus aphVIII gene coding for a new type phosphotransferase Yamada, T. K., T. Nakada,K.Miyaji and H. Nozaki, 2006 Mor- provides stable antibiotic resistance to Chlamydomonas reinhardtii. phology and molecular phylogeny of Gonium multicoccum (Volvo- Gene 277: 221–229. cales, Chlorophyceae) newly found in Japan. J. Jpn. Bot. 81: Starr, R. C., 1969 Structure, reproduction, and differentiation of 139–147. Volvox carteri f. nagariensis Iyengar, strains HK 9 and 10. Arch. Pro- tistenkunde 111: 204–222. Communicating editor: S. Dutcher