Am J Physiol Lung Cell Mol Physiol 318: L1056–L1062, 2020. First published April 1, 2020; doi:10.1152/ajplung.00050.2020. RAPID REPORT Translational Physiology Strong correlation between air-liquid interface cultures and in vivo transcriptomics of nasal brush biopsy X Baishakhi Ghosh,1 Bongsoo Park,1 Debarshi Bhowmik,2 Kristine Nishida,3 Molly Lauver,3 Nirupama Putcha,3 Peisong Gao,4 Murugappan Ramanathan, Jr.,5 Nadia Hansel,3 Shyam Biswal,1 and Venkataramana K. Sidhaye1,3 1Department of Environmental Health and Engineering, Johns Hopkins Bloomberg School of Public Health, Baltimore, Maryland; 2Department of Biology, Johns Hopkins University, Baltimore, Maryland; 3Department of Pulmonary and Critical Care Medicine, Johns Hopkins School of Medicine, Baltimore, Maryland; 4Division of Allergy and Clinical Immunology, Johns Hopkins School of Medicine, Baltimore, Maryland; and 5Department of Otolaryngology-Head and Neck Surgery, Johns Hopkins School of Medicine, Baltimore, Maryland Submitted 18 February 2020; accepted in final form 24 March 2020 Ghosh B, Park B, Bhowmik D, Nishida K, Lauver M, Putcha N, RNA sequencing to determine the correlation between ALI- Gao P, Ramanathan M Jr, Hansel N, Biswal S, Sidhaye VK. cultured epithelial cells and epithelial cells obtained from nasal Strong correlation between air-liquid interface cultures and in vivo brushing and identify differences that may arise as a result of transcriptomics of nasal brush biopsy. Am J Physiol Lung Cell Mol redifferentiation. Physiol 318: L1056–L1062, 2020. First published April 1, 2020; doi:10.1152/ajplung.00050.2020.—Air-liquid interface (ALI) cultures METHODS are ex vivo models that are used extensively to study the epithelium of patients with chronic respiratory diseases. However, the in vitro Human subjects. Five former smokers with COPD were enrolled in conditions impose a milieu different from that encountered in the the study. The research protocol was approved by the Institutional patient in vivo, and the degree to which this alters gene expression Review Board of Johns Hopkins University, and all the patients gave remains unclear. In this study we employed RNA sequencing to signed informed consent. The diagnosis of COPD was established compare the transcriptome of fresh brushings of nasal epithelial cells using the Global Initiative for Chronic Obstructive Lung Disease with that of ALI-cultured epithelial cells from the same patients. We (GOLD)-2015 criteria, including Ն10-pack-yr smoking history, ratio observed a strong correlation between cells cultured at the ALI and of postbronchodilator forced expiratory volume in 1 s (FEV1)to Ͻ Ͻ cells obtained from the brushed nasal epithelia: 96% of expressed forced vital capacity 70%, and FEV1 80% predicted. Participants genes showed similar expression profiles, although there was greater were former smokers as defined by self-report of no smoking in the similarity between the brushed samples. We observed that while the last 6 mo and exhaled carbon monoxide Ͻ6 ppm. Demographic ALI model provides an excellent representation of the in vivo airway characteristics of patients with COPD are summarized in Table 1. No epithelial transcriptome for mechanistic studies, several pathways are known nasal or sinus comorbidities were observed in these patients affected by the change in milieu. with COPD. Sinonasal brushing sampling. Two samples were obtained from the air-liquid interface; cell culture; nasal brushing; nasal epithelia; inferior turbinate using a sterile cytology brush (Microvasive, Mil- transcriptome ford, MA); no topical anesthetic was used. The first brush head was ejected into a vial containing RNA stabilization reagent (RNAlater, Qiagen, MA) and stored at Ϫ80°C. The second brush head was suspended in 1ϫ Dulbecco’s phosphate-buffered saline (DPBS; BACKGROUND Thermo Fisher Scientific, CA) and immediately processed for cell culture. Air-liquid interface (ALI) cultures are ex vivo models used Culturing sinonasal epithelia at ALI. The cell suspension was extensively to study the epithelium of patients with allergies, centrifuged at 1,500 rpm for 10 min to remove 1ϫ DPBS. The pellet asthma, chronic obstructive pulmonary disease (COPD), and was resuspended in PneumaCult-Ex Plus medium (StemCell Tech- chronic rhinosinusitis (1, 3, 9, 11, 12). This model establishes nologies, Vancouver, BC, Canada) and amplified on rat tail collagen a differentiated epithelium, as seen in vivo, that is useful in I (Corning, NY)-coated flasks. Cells were passaged at 80–90% confluency. At subconfluency, cells were plated at 4 ϫ 105 per well performing mechanistic studies of respiratory epithelia, testing ␮ drug formulations, and studying the toxicity of inhaled sub- onto rat tail collagen I-coated 0.4- m-pore polyethylene terephthalate clear-membrane 12-mm-diameter Transwell inserts (Corning, NY) stances, both infectious and noninfectious, none of which can with PneumaCult-Ex Plus medium at ALI. At 100% confluency, the be performed in brushed cells. However, the in vitro conditions inserts were placed in basolateral PneumaCult-ALI medium (Stem- impose a milieu different from that encountered in the patient Cell Technologies). Cells were differentiated for 6 wk at ALI to obtain in vivo, and the degree to which this alters gene expression a fully differentiated pseudostratified epithelium. To ensure that the remains unclear. In this study we compared the transcriptome ALI cultures were fully differentiated, we confirmed that the mono- of fresh brushings of nasal epithelial cells with that of ALI- layer established a barrier as measured by transepithelial electrical cultured epithelial cells from the same patients. We employed resistance [380–600 ⍀·cm2 (average 470 ⍀·cm2)] and confirmed the presence of cilia by measuring the percentage of moving pixels [39–53% (average 45.37%)] and ciliary beat frequency [6.8–15.8 Hz Correspondence: V. K. Sidhaye ([email protected]). (average 8.95 Hz)] based on microscopy, as we reported previously L1056 1040-0605/20 Copyright © 2020 the American Physiological Society http://www.ajplung.org Downloaded from journals.physiology.org/journal/ajplung at US EPA Main Lib (134.067.029.089) on January 7, 2021. CULTURED EPITHELIA REPRESENTS THE IN VIVO AIRWAY EPITHELIA L1057 Table 1. Demographic characteristics of recruited subjects Patient No. 12345 Age, yr 62 68 61 79 75 Sex Female Male Female Male Female BMI, kg/m2 35.31 29.79 24.93 22.31 35.19 Postbronchodilator FVC, %predicted 84 77 59 99 79 FEV1, %predicted 36 65 36 57 58 FEV1/FVC 0.34 0.64 0.47 0.40 0.57 BMI, body mass index; FEV1, forced expiratory volume in 1 s; FVC, forced vital capacity. (6, 7). These values are consistent with those reported by others in a few upregulated genes in brushed nasal epithelia [fatty acid-binding well-differentiated nasal epithelial culture (10, 11). protein 5 (FABP5), 2=-5=-oligoadenylate synthetase 1 (OAS1), and Total RNA preparation and sequencing. Total RNA was extracted aldehyde dehydrogenase 3 family member A1 (ALDH3A1)] and from ALI-cultured nasal epithelia and brushed nasal epithelia using cultured airway epithelia [ERBB receptor feedback inhibitor 1 (ER- the Invitrogen PureLink RNA Mini Kit (Thermo Fisher Scientific) RFI1), transglutaminase 2 (TGM2), and caveolin 1 (CAV1)]. Forward supplemented with the proteinase K (Qiagen, Germany) and RNase- primers, reverse primers, and product lengths for the genes are as free DNase set (Qiagen). follows: CTTCCCATCCCACTCCTGATG (forward), CCACAGCT- RNA quantity was assessed by VICTOR X2 fluorometry (Perkin GATGGCAGAAAA (reverse), and 83 bp for FABP1; AGGAA- Elmer, MA) using the Quant-iT RiboGreen RNA assay kit (Thermo AGGTGCTTCCGAGGTAG (forward), GGACTGAGGAAGACAA- Fisher Scientific). The integrity was checked by the Agilent Technol- CCAGGT (reverse), and 127 bp for OAS1; GGGAGAGGCTGTGT- ogies 4200 TapeStation System with an RNA integrity number Ն7. CAAAGG (forward), GCTCCGAGTGGATGTAGAGC (reverse), cDNA libraries were generated from 500 ng of total RNA using the and 334 bp for ALDH3A1; TGAGGAAGACCTACTGGAGCAG TruSeq Stranded Total RNA LT Sample Prep Kit (human/mouse/rat) (Illumina, CA). The quality of the cDNA library was assessed by (forward), GTATTAGGCGCTCCTGAGCAGA (reverse), and 111 bp Quant-iT PicoGreen dsDNA assay kit (Thermo Fisher Scientific, MA) for ERRFI1; TAAGAGATGCTGTGGAGGAG (forward), CGAGC- and D1000 screen tape analysis. CCTGGTAGATAAA (reverse), and 278 bp for TGM2; CCA- Quantitative RT-PCR. cDNA (500 ng/␮L) was obtained using a AGGAGATCGACCTGGTCAA (forward), GCCGTCAAAACTGT- high-capacity cDNA reverse transcription kit (Applied Biosystems, GTGTCCCT (reverse), and 113 bp for CAV1; and GTCTCCTCT- Thermo Fisher Scientific Baltics, Lithuania), and the absence of DNA GACTTCAACAGCG (forward), ACCACCCTGTTGCTGTAGC- contamination was verified by exclusion of RT from subsequent CAA (reverse), and 131 bp for GAPDH. PCRs. Each PCR was carried out as follows: initial denaturation at 94°C cDNA was subjected to PCR using SYBR green PCR master mix for 15 min, 45 cycles of 94°C for 35 s, 60°C for 1 min, and 72°C for (Applied Biosystems, Thermo Fisher Scientific, UK) to amplify the 1 min 15 s, followed by a final extension at 72°C for 2 min. Based on Fig. 1. Overall gene expression of nasal brushing (NBR) and cultured nasal epithelial (CU) samples. A and B: pair-wise sample (A) and pooled (B) correlation analysis using Pearson’s correlation analysis and log2-transformed count per million reads (CPM) between CU and NBR. C: principal component (PC) analysis of nasal brushing and cultured nasal epithelial