DOCSLIB.ORG

Strong Correlation Between Air-Liquid Interface Cultures and in Vivo Transcriptomics of Nasal Brush Biopsy

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Strong Correlation Between Air-Liquid Interface Cultures and in Vivo Transcriptomics of Nasal Brush Biopsy Am J Physiol Lung Cell Mol Physiol 318: L1056–L1062, 2020. First published April 1, 2020; doi:10.1152/ajplung.00050.2020. RAPID REPORT Translational Physiology Strong correlation between air-liquid interface cultures and in vivo transcriptomics of nasal brush biopsy X Baishakhi Ghosh,1 Bongsoo Park,1 Debarshi Bhowmik,2 Kristine Nishida,3 Molly Lauver,3 Nirupama Putcha,3 Peisong Gao,4 Murugappan Ramanathan, Jr.,5 Nadia Hansel,3 Shyam Biswal,1 and Venkataramana K. Sidhaye1,3 1Department of Environmental Health and Engineering, Johns Hopkins Bloomberg School of Public Health, Baltimore, Maryland; 2Department of Biology, Johns Hopkins University, Baltimore, Maryland; 3Department of Pulmonary and Critical Care Medicine, Johns Hopkins School of Medicine, Baltimore, Maryland; 4Division of Allergy and Clinical Immunology, Johns Hopkins School of Medicine, Baltimore, Maryland; and 5Department of Otolaryngology-Head and Neck Surgery, Johns Hopkins School of Medicine, Baltimore, Maryland Submitted 18 February 2020; accepted in final form 24 March 2020 Ghosh B, Park B, Bhowmik D, Nishida K, Lauver M, Putcha N, RNA sequencing to determine the correlation between ALI- Gao P, Ramanathan M Jr, Hansel N, Biswal S, Sidhaye VK. cultured epithelial cells and epithelial cells obtained from nasal Strong correlation between air-liquid interface cultures and in vivo brushing and identify differences that may arise as a result of transcriptomics of nasal brush biopsy. Am J Physiol Lung Cell Mol redifferentiation. Physiol 318: L1056–L1062, 2020. First published April 1, 2020; doi:10.1152/ajplung.00050.2020.—Air-liquid interface (ALI) cultures METHODS are ex vivo models that are used extensively to study the epithelium of patients with chronic respiratory diseases. However, the in vitro Human subjects. Five former smokers with COPD were enrolled in conditions impose a milieu different from that encountered in the the study. The research protocol was approved by the Institutional patient in vivo, and the degree to which this alters gene expression Review Board of Johns Hopkins University, and all the patients gave remains unclear. In this study we employed RNA sequencing to signed informed consent. The diagnosis of COPD was established compare the transcriptome of fresh brushings of nasal epithelial cells using the Global Initiative for Chronic Obstructive Lung Disease with that of ALI-cultured epithelial cells from the same patients. We (GOLD)-2015 criteria, including Ն10-pack-yr smoking history, ratio observed a strong correlation between cells cultured at the ALI and of postbronchodilator forced expiratory volume in 1 s (FEV1)to Ͻ Ͻ cells obtained from the brushed nasal epithelia: 96% of expressed forced vital capacity 70%, and FEV1 80% predicted. Participants genes showed similar expression profiles, although there was greater were former smokers as defined by self-report of no smoking in the similarity between the brushed samples. We observed that while the last 6 mo and exhaled carbon monoxide Ͻ6 ppm. Demographic ALI model provides an excellent representation of the in vivo airway characteristics of patients with COPD are summarized in Table 1. No epithelial transcriptome for mechanistic studies, several pathways are known nasal or sinus comorbidities were observed in these patients affected by the change in milieu. with COPD. Sinonasal brushing sampling. Two samples were obtained from the air-liquid interface; cell culture; nasal brushing; nasal epithelia; inferior turbinate using a sterile cytology brush (Microvasive, Mil- transcriptome ford, MA); no topical anesthetic was used. The first brush head was ejected into a vial containing RNA stabilization reagent (RNAlater, Qiagen, MA) and stored at Ϫ80°C. The second brush head was suspended in 1ϫ Dulbecco’s phosphate-buffered saline (DPBS; BACKGROUND Thermo Fisher Scientific, CA) and immediately processed for cell culture. Air-liquid interface (ALI) cultures are ex vivo models used Culturing sinonasal epithelia at ALI. The cell suspension was extensively to study the epithelium of patients with allergies, centrifuged at 1,500 rpm for 10 min to remove 1ϫ DPBS. The pellet asthma, chronic obstructive pulmonary disease (COPD), and was resuspended in PneumaCult-Ex Plus medium (StemCell Tech- chronic rhinosinusitis (1, 3, 9, 11, 12). This model establishes nologies, Vancouver, BC, Canada) and amplified on rat tail collagen a differentiated epithelium, as seen in vivo, that is useful in I (Corning, NY)-coated flasks. Cells were passaged at 80–90% confluency. At subconfluency, cells were plated at 4 ϫ 105 per well performing mechanistic studies of respiratory epithelia, testing ␮ drug formulations, and studying the toxicity of inhaled sub- onto rat tail collagen I-coated 0.4- m-pore polyethylene terephthalate clear-membrane 12-mm-diameter Transwell inserts (Corning, NY) stances, both infectious and noninfectious, none of which can with PneumaCult-Ex Plus medium at ALI. At 100% confluency, the be performed in brushed cells. However, the in vitro conditions inserts were placed in basolateral PneumaCult-ALI medium (Stem- impose a milieu different from that encountered in the patient Cell Technologies). Cells were differentiated for 6 wk at ALI to obtain in vivo, and the degree to which this alters gene expression a fully differentiated pseudostratified epithelium. To ensure that the remains unclear. In this study we compared the transcriptome ALI cultures were fully differentiated, we confirmed that the mono- of fresh brushings of nasal epithelial cells with that of ALI- layer established a barrier as measured by transepithelial electrical cultured epithelial cells from the same patients. We employed resistance [380–600 ⍀·cm2 (average 470 ⍀·cm2)] and confirmed the presence of cilia by measuring the percentage of moving pixels [39–53% (average 45.37%)] and ciliary beat frequency [6.8–15.8 Hz Correspondence: V. K. Sidhaye ([email protected]). (average 8.95 Hz)] based on microscopy, as we reported previously L1056 1040-0605/20 Copyright © 2020 the American Physiological Society http://www.ajplung.org Downloaded from journals.physiology.org/journal/ajplung at US EPA Main Lib (134.067.029.089) on January 7, 2021. CULTURED EPITHELIA REPRESENTS THE IN VIVO AIRWAY EPITHELIA L1057 Table 1. Demographic characteristics of recruited subjects Patient No. 12345 Age, yr 62 68 61 79 75 Sex Female Male Female Male Female BMI, kg/m2 35.31 29.79 24.93 22.31 35.19 Postbronchodilator FVC, %predicted 84 77 59 99 79 FEV1, %predicted 36 65 36 57 58 FEV1/FVC 0.34 0.64 0.47 0.40 0.57 BMI, body mass index; FEV1, forced expiratory volume in 1 s; FVC, forced vital capacity. (6, 7). These values are consistent with those reported by others in a few upregulated genes in brushed nasal epithelia [fatty acid-binding well-differentiated nasal epithelial culture (10, 11). protein 5 (FABP5), 2=-5=-oligoadenylate synthetase 1 (OAS1), and Total RNA preparation and sequencing. Total RNA was extracted aldehyde dehydrogenase 3 family member A1 (ALDH3A1)] and from ALI-cultured nasal epithelia and brushed nasal epithelia using cultured airway epithelia [ERBB receptor feedback inhibitor 1 (ER- the Invitrogen PureLink RNA Mini Kit (Thermo Fisher Scientific) RFI1), transglutaminase 2 (TGM2), and caveolin 1 (CAV1)]. Forward supplemented with the proteinase K (Qiagen, Germany) and RNase- primers, reverse primers, and product lengths for the genes are as free DNase set (Qiagen). follows: CTTCCCATCCCACTCCTGATG (forward), CCACAGCT- RNA quantity was assessed by VICTOR X2 fluorometry (Perkin GATGGCAGAAAA (reverse), and 83 bp for FABP1; AGGAA- Elmer, MA) using the Quant-iT RiboGreen RNA assay kit (Thermo AGGTGCTTCCGAGGTAG (forward), GGACTGAGGAAGACAA- Fisher Scientific). The integrity was checked by the Agilent Technol- CCAGGT (reverse), and 127 bp for OAS1; GGGAGAGGCTGTGT- ogies 4200 TapeStation System with an RNA integrity number Ն7. CAAAGG (forward), GCTCCGAGTGGATGTAGAGC (reverse), cDNA libraries were generated from 500 ng of total RNA using the and 334 bp for ALDH3A1; TGAGGAAGACCTACTGGAGCAG TruSeq Stranded Total RNA LT Sample Prep Kit (human/mouse/rat) (Illumina, CA). The quality of the cDNA library was assessed by (forward), GTATTAGGCGCTCCTGAGCAGA (reverse), and 111 bp Quant-iT PicoGreen dsDNA assay kit (Thermo Fisher Scientific, MA) for ERRFI1; TAAGAGATGCTGTGGAGGAG (forward), CGAGC- and D1000 screen tape analysis. CCTGGTAGATAAA (reverse), and 278 bp for TGM2; CCA- Quantitative RT-PCR. cDNA (500 ng/␮L) was obtained using a AGGAGATCGACCTGGTCAA (forward), GCCGTCAAAACTGT- high-capacity cDNA reverse transcription kit (Applied Biosystems, GTGTCCCT (reverse), and 113 bp for CAV1; and GTCTCCTCT- Thermo Fisher Scientific Baltics, Lithuania), and the absence of DNA GACTTCAACAGCG (forward), ACCACCCTGTTGCTGTAGC- contamination was verified by exclusion of RT from subsequent CAA (reverse), and 131 bp for GAPDH. PCRs. Each PCR was carried out as follows: initial denaturation at 94°C cDNA was subjected to PCR using SYBR green PCR master mix for 15 min, 45 cycles of 94°C for 35 s, 60°C for 1 min, and 72°C for (Applied Biosystems, Thermo Fisher Scientific, UK) to amplify the 1 min 15 s, followed by a final extension at 72°C for 2 min. Based on Fig. 1. Overall gene expression of nasal brushing (NBR) and cultured nasal epithelial (CU) samples. A and B: pair-wise sample (A) and pooled (B) correlation analysis using Pearson’s correlation analysis and log2-transformed count per million reads (CPM) between CU and NBR. C: principal component (PC) analysis of nasal brushing and cultured nasal epithelial
Load more

Recommended publications
  • Identification and Developmental Expression of the Full Complement Of
    Goldstone et al. BMC Genomics 2010, 11:643 http://www.biomedcentral.com/1471-2164/11/643 RESEARCH ARTICLE Open Access Identification and developmental expression of the full complement of Cytochrome P450 genes in Zebrafish Jared V Goldstone1, Andrew G McArthur2, Akira Kubota1, Juliano Zanette1,3, Thiago Parente1,4, Maria E Jönsson1,5, David R Nelson6, John J Stegeman1* Abstract Background: Increasing use of zebrafish in drug discovery and mechanistic toxicology demands knowledge of cytochrome P450 (CYP) gene regulation and function. CYP enzymes catalyze oxidative transformation leading to activation or inactivation of many endogenous and exogenous chemicals, with consequences for normal physiology and disease processes. Many CYPs potentially have roles in developmental specification, and many chemicals that cause developmental abnormalities are substrates for CYPs. Here we identify and annotate the full suite of CYP genes in zebrafish, compare these to the human CYP gene complement, and determine the expression of CYP genes during normal development. Results: Zebrafish have a total of 94 CYP genes, distributed among 18 gene families found also in mammals. There are 32 genes in CYP families 5 to 51, most of which are direct orthologs of human CYPs that are involved in endogenous functions including synthesis or inactivation of regulatory molecules. The high degree of sequence similarity suggests conservation of enzyme activities for these CYPs, confirmed in reports for some steroidogenic enzymes (e.g. CYP19, aromatase; CYP11A, P450scc; CYP17, steroid 17a-hydroxylase), and the CYP26 retinoic acid hydroxylases. Complexity is much greater in gene families 1, 2, and 3, which include CYPs prominent in metabolism of drugs and pollutants, as well as of endogenous substrates.
    [Show full text]
  • Defining Functional Interactions During Biogenesis of Epithelial Junctions
    ARTICLE Received 11 Dec 2015 | Accepted 13 Oct 2016 | Published 6 Dec 2016 | Updated 5 Jan 2017 DOI: 10.1038/ncomms13542 OPEN Defining functional interactions during biogenesis of epithelial junctions J.C. Erasmus1,*, S. Bruche1,*,w, L. Pizarro1,2,*, N. Maimari1,3,*, T. Poggioli1,w, C. Tomlinson4,J.Lees5, I. Zalivina1,w, A. Wheeler1,w, A. Alberts6, A. Russo2 & V.M.M. Braga1 In spite of extensive recent progress, a comprehensive understanding of how actin cytoskeleton remodelling supports stable junctions remains to be established. Here we design a platform that integrates actin functions with optimized phenotypic clustering and identify new cytoskeletal proteins, their functional hierarchy and pathways that modulate E-cadherin adhesion. Depletion of EEF1A, an actin bundling protein, increases E-cadherin levels at junctions without a corresponding reinforcement of cell–cell contacts. This unexpected result reflects a more dynamic and mobile junctional actin in EEF1A-depleted cells. A partner for EEF1A in cadherin contact maintenance is the formin DIAPH2, which interacts with EEF1A. In contrast, depletion of either the endocytic regulator TRIP10 or the Rho GTPase activator VAV2 reduces E-cadherin levels at junctions. TRIP10 binds to and requires VAV2 function for its junctional localization. Overall, we present new conceptual insights on junction stabilization, which integrate known and novel pathways with impact for epithelial morphogenesis, homeostasis and diseases. 1 National Heart and Lung Institute, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK. 2 Computing Department, Imperial College London, London SW7 2AZ, UK. 3 Bioengineering Department, Faculty of Engineering, Imperial College London, London SW7 2AZ, UK. 4 Department of Surgery & Cancer, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK.
    [Show full text]
  • Analysis of the Human Serum Proteome
    Cedarville University DigitalCommons@Cedarville Pharmaceutical Sciences Faculty Publications Department of Pharmaceutical Sciences 6-2004 Analysis of the Human Serum Proteome King C. Chan David A. Lucas Denise Hise Carl F. Schaefer Zhen Xiao See next page for additional authors Follow this and additional works at: https://digitalcommons.cedarville.edu/ pharmaceutical_sciences_publications Part of the Pharmacy and Pharmaceutical Sciences Commons This Article is brought to you for free and open access by DigitalCommons@Cedarville, a service of the Centennial Library. It has been accepted for inclusion in Pharmaceutical Sciences Faculty Publications by an authorized administrator of DigitalCommons@Cedarville. For more information, please contact [email protected]. Authors King C. Chan, David A. Lucas, Denise Hise, Carl F. Schaefer, Zhen Xiao, George M. Janini, Kenneth H. Buetow, Haleem J. Issaq, Timothy D. Veenstra, and Thomas P. Conrads Clinical Proteomics Journal Copyright ©Humana Press Inc. All rights of any nature whatsoever are reserved. ISSN 1542-6416/04/01:101–225/$25.00 Serum/Plasma Proteome Analysis of the Human Serum Proteome King C. Chan,1,† David A. Lucas,1,† Denise Hise,2 Carl F. Schaefer,2 Zhen Xiao,1 George M. Janini,1 Kenneth H. Buetow,2 Haleem J. Issaq,1 Timothy D.Veenstra,1 and Thomas P. Conrads1,* 1Laboratory of Proteomics and Analytical Technologies, National Cancer Institute at Frederick, SAIC-Frederick, Inc, PO Box B, Frederick, MD 21702 2Center for Bioinformatics, National Cancer Institute, Bethesda, MD 20892 †These authors contributed equally to this work. each of which was analyzed by microcapillary Abstract reversed-phase liquid chromatography coupled Changes in serum proteins that signal online with MS/MS analysis.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Synonymous Single Nucleotide Polymorphisms in Human Cytochrome
    DMD Fast Forward. Published on February 9, 2009 as doi:10.1124/dmd.108.026047 DMD #26047 TITLE PAGE: A BIOINFORMATICS APPROACH FOR THE PHENOTYPE PREDICTION OF NON- SYNONYMOUS SINGLE NUCLEOTIDE POLYMORPHISMS IN HUMAN CYTOCHROME P450S LIN-LIN WANG, YONG LI, SHU-FENG ZHOU Department of Nutrition and Food Hygiene, School of Public Health, Peking University, Beijing 100191, P. R. China (LL Wang & Y Li) Discipline of Chinese Medicine, School of Health Sciences, RMIT University, Bundoora, Victoria 3083, Australia (LL Wang & SF Zhou). 1 Copyright 2009 by the American Society for Pharmacology and Experimental Therapeutics. DMD #26047 RUNNING TITLE PAGE: a) Running title: Prediction of phenotype of human CYPs. b) Author for correspondence: A/Prof. Shu-Feng Zhou, MD, PhD Discipline of Chinese Medicine, School of Health Sciences, RMIT University, WHO Collaborating Center for Traditional Medicine, Bundoora, Victoria 3083, Australia. Tel: + 61 3 9925 7794; fax: +61 3 9925 7178. Email: [email protected] c) Number of text pages: 21 Number of tables: 10 Number of figures: 2 Number of references: 40 Number of words in Abstract: 249 Number of words in Introduction: 749 Number of words in Discussion: 1459 d) Non-standard abbreviations: CYP, cytochrome P450; nsSNP, non-synonymous single nucleotide polymorphism. 2 DMD #26047 ABSTRACT Non-synonymous single nucleotide polymorphisms (nsSNPs) in coding regions that can lead to amino acid changes may cause alteration of protein function and account for susceptivity to disease. Identification of deleterious nsSNPs from tolerant nsSNPs is important for characterizing the genetic basis of human disease, assessing individual susceptibility to disease, understanding the pathogenesis of disease, identifying molecular targets for drug treatment and conducting individualized pharmacotherapy.
    [Show full text]
  • Supplemental Tables4.Pdf
    Yano_Supplemental_Table_S4 Gene ontology – Biological process 1 of 9 Fold List Pop Pop GO Term Count % PValue Bonferroni Benjamini FDR Genes Total Hits Total Enrichment DLC1, CADM1, NELL2, CLSTN1, PCDHGA8, CTNNB1, NRCAM, APP, CNTNAP2, FERT2, RAPGEF1, PTPRM, MPDZ, SDK1, PCDH9, PTPRS, VEZT, NRXN1, MYH9, GO:0007155~cell CTNNA2, NCAM1, NCAM2, DDR1, LSAMP, CNTN1, 50 5.61 2.14E-08 510 311 7436 2.34 4.50E-05 4.50E-05 3.70E-05 adhesion ROR2, VCAN, DST, LIMS1, TNC, ASTN1, CTNND2, CTNND1, CDH2, NEO1, CDH4, CD24A, FAT3, PVRL3, TRO, TTYH1, MLLT4, LPP, NLGN1, PCDH19, LAMA1, ITGA9, CDH13, CDON, PSPC1 DLC1, CADM1, NELL2, CLSTN1, PCDHGA8, CTNNB1, NRCAM, APP, CNTNAP2, FERT2, RAPGEF1, PTPRM, MPDZ, SDK1, PCDH9, PTPRS, VEZT, NRXN1, MYH9, GO:0022610~biological CTNNA2, NCAM1, NCAM2, DDR1, LSAMP, CNTN1, 50 5.61 2.14E-08 510 311 7436 2.34 4.50E-05 4.50E-05 3.70E-05 adhesion ROR2, VCAN, DST, LIMS1, TNC, ASTN1, CTNND2, CTNND1, CDH2, NEO1, CDH4, CD24A, FAT3, PVRL3, TRO, TTYH1, MLLT4, LPP, NLGN1, PCDH19, LAMA1, ITGA9, CDH13, CDON, PSPC1 DCC, ENAH, PLXNA2, CAPZA2, ATP5B, ASTN1, PAX6, ZEB2, CDH2, CDH4, GLI3, CD24A, EPHB1, NRCAM, GO:0006928~cell CTTNBP2, EDNRB, APP, PTK2, ETV1, CLASP2, STRBP, 36 4.04 3.46E-07 510 205 7436 2.56 7.28E-04 3.64E-04 5.98E-04 motion NRG1, DCLK1, PLAT, SGPL1, TGFBR1, EVL, MYH9, YWHAE, NCKAP1, CTNNA2, SEMA6A, EPHA4, NDEL1, FYN, LRP6 PLXNA2, ADCY5, PAX6, GLI3, CTNNB1, LPHN2, EDNRB, LPHN3, APP, CSNK2A1, GPR45, NRG1, RAPGEF1, WWOX, SGPL1, TLE4, SPEN, NCAM1, DDR1, GRB10, GRM3, GNAQ, HIPK1, GNB1, HIPK2, PYGO1, GO:0007166~cell RNF138, ROR2, CNTN1,
    [Show full text]
  • Serum Albumin OS=Homo Sapiens
    Protein Name Cluster of Glial fibrillary acidic protein OS=Homo sapiens GN=GFAP PE=1 SV=1 (P14136) Serum albumin OS=Homo sapiens GN=ALB PE=1 SV=2 Cluster of Isoform 3 of Plectin OS=Homo sapiens GN=PLEC (Q15149-3) Cluster of Hemoglobin subunit beta OS=Homo sapiens GN=HBB PE=1 SV=2 (P68871) Vimentin OS=Homo sapiens GN=VIM PE=1 SV=4 Cluster of Tubulin beta-3 chain OS=Homo sapiens GN=TUBB3 PE=1 SV=2 (Q13509) Cluster of Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 (P60709) Cluster of Tubulin alpha-1B chain OS=Homo sapiens GN=TUBA1B PE=1 SV=1 (P68363) Cluster of Isoform 2 of Spectrin alpha chain, non-erythrocytic 1 OS=Homo sapiens GN=SPTAN1 (Q13813-2) Hemoglobin subunit alpha OS=Homo sapiens GN=HBA1 PE=1 SV=2 Cluster of Spectrin beta chain, non-erythrocytic 1 OS=Homo sapiens GN=SPTBN1 PE=1 SV=2 (Q01082) Cluster of Pyruvate kinase isozymes M1/M2 OS=Homo sapiens GN=PKM PE=1 SV=4 (P14618) Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 Clathrin heavy chain 1 OS=Homo sapiens GN=CLTC PE=1 SV=5 Filamin-A OS=Homo sapiens GN=FLNA PE=1 SV=4 Cytoplasmic dynein 1 heavy chain 1 OS=Homo sapiens GN=DYNC1H1 PE=1 SV=5 Cluster of ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide OS=Homo sapiens GN=ATP1A2 PE=3 SV=1 (B1AKY9) Fibrinogen beta chain OS=Homo sapiens GN=FGB PE=1 SV=2 Fibrinogen alpha chain OS=Homo sapiens GN=FGA PE=1 SV=2 Dihydropyrimidinase-related protein 2 OS=Homo sapiens GN=DPYSL2 PE=1 SV=1 Cluster of Alpha-actinin-1 OS=Homo sapiens GN=ACTN1 PE=1 SV=2 (P12814) 60 kDa heat shock protein, mitochondrial OS=Homo
    [Show full text]
  • Identification of Potential Key Genes and Pathway Linked with Sporadic Creutzfeldt-Jakob Disease Based on Integrated Bioinformatics Analyses
    medRxiv preprint doi: https://doi.org/10.1101/2020.12.21.20248688; this version posted December 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Identification of potential key genes and pathway linked with sporadic Creutzfeldt-Jakob disease based on integrated bioinformatics analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. medRxiv preprint doi: https://doi.org/10.1101/2020.12.21.20248688; this version posted December 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Abstract Sporadic Creutzfeldt-Jakob disease (sCJD) is neurodegenerative disease also called prion disease linked with poor prognosis. The aim of the current study was to illuminate the underlying molecular mechanisms of sCJD. The mRNA microarray dataset GSE124571 was downloaded from the Gene Expression Omnibus database. Differentially expressed genes (DEGs) were screened.
    [Show full text]
  • MYO5A Rabbit Pab
    Leader in Biomolecular Solutions for Life Science MYO5A Rabbit pAb Catalog No.: A9830 Basic Information Background Catalog No. This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene A9830 superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The Observed MW protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in 240kDa this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively Calculated MW spliced transcript variants encoding different isoforms have been reported, but the full- 212kDa/215kDa/218kDa length nature of some variants has not been determined. Category Primary antibody Applications WB,IHC,IF Cross-Reactivity Human, Mouse, Rat Recommended Dilutions Immunogen Information WB 1:500 - 1:2000 Gene ID Swiss Prot 4644 Q9Y4I1 IHC 1:50 - 1:100 Immunogen 1:50 - 1:100 IF Recombinant fusion protein containing a sequence corresponding to amino acids 950-1150 of human MYO5A (NP_000250.3). Synonyms MYO5A;GS1;MYH12;MYO5;MYR12;myosin VA Contact Product Information www.abclonal.com Source Isotype Purification Rabbit IgG Affinity purification Storage Store at -20℃. Avoid freeze / thaw cycles. Buffer: PBS with 0.02% sodium azide,50% glycerol,pH7.3. Validation Data Western blot analysis of extracts of various cell lines, using MYO5A antibody (A9830) at 1:1000 dilution. Secondary antibody: HRP Goat Anti-Rabbit IgG (H+L) (AS014) at 1:10000 dilution. Lysates/proteins: 25ug per lane. Blocking buffer: 3% nonfat dry milk in TBST.
    [Show full text]
  • The Kinesin-2 Family Member KIF3C Regulates Microtubule Dynamics and Is Required for Axon Growth and Regeneration
    The Journal of Neuroscience, July 10, 2013 • 33(28):11329–11345 • 11329 Development/Plasticity/Repair The Kinesin-2 Family Member KIF3C Regulates Microtubule Dynamics and Is Required for Axon Growth and Regeneration Laura F. Gumy,1,2 Daniel J. Chew,1 Elena Tortosa,2 Eugene A. Katrukha,2 Lukas C. Kapitein,2 Aviva M. Tolkovsky,1 Casper C. Hoogenraad,2 and James W. Fawcett1 1Centre for Brain Repair, University of Cambridge, Cambridge CB2 0PY, United Kingdom, and 2Division of Cell Biology, Faculty of Science, University of Utrecht, 3584CH Utrecht, The Netherlands Axonregenerationafterinjuryrequirestheextensivereconstruction,reorganization,andstabilizationofthemicrotubulecytoskeletonin the growth cones. Here, we identify KIF3C as a key regulator of axonal growth and regeneration by controlling microtubule dynamics and organization in the growth cone. KIF3C is developmentally regulated. Rat embryonic sensory axons and growth cones contain undetect- able levels of KIF3C protein that is locally translated immediately after injury. In adult neurons, KIF3C is axonally transported from the cell body and is enriched at the growth cone where it preferentially binds to tyrosinated microtubules. Functionally, the interaction of KIF3CwithEB3isnecessaryforitslocalizationatthemicrotubuleplus-endsinthegrowthcone.DepletionofKIF3Cinadultneuronsleads to an increase in stable, overgrown and looped microtubules because of a strong decrease in the microtubule frequency of catastrophes, suggesting that KIF3C functions as a microtubule-destabilizing factor. Adult axons lacking KIF3C, by RNA interference or KIF3C gene knock-out, display an impaired axonal outgrowth in vitro and a delayed regeneration after injury both in vitro and in vivo. Murine KIF3C knock-out embryonic axons grow normally but do not regenerate after injury because they are unable to locally translate KIF3C. These data show that KIF3C is an injury-specific kinesin that contributes to axon growth and regeneration by regulating and organizing the microtubule cytoskeleton in the growth cone.
    [Show full text]
  • CYP2F1 (NM 000774) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC223097 CYP2F1 (NM_000774) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: CYP2F1 (NM_000774) Human Tagged ORF Clone Tag: Myc-DDK Symbol: CYP2F1 Synonyms: C2F1; CYP2F; CYPIIF1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 CYP2F1 (NM_000774) Human Tagged ORF Clone – RC223097 ORF Nucleotide >RC223097 representing NM_000774 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGACAGCATAAGCACAGCCATCTTACTCCTGCTCCTGGCTCTCGTCTGTCTGCTCCTGACCCTAAGCT CAAGAGATAAGGGAAAGCTGCCTCCGGGACCCAGACCCCTCTCAATCCTGGGAAACCTGCTGCTGCTTTG CTCCCAAGACATGCTGACTTCTCTCACTAAGCTGAGCAAGGAGTATGGCTCCATGTACACAGTGCACCTG GGACCCAGGCGGGTGGTGGTCCTCAGCGGGTACCAAGCTGTGAAGGAGGCCCTGGTGGACCAGGGAGAGG AGTTTAGTGGCCGCGGTGACTACCCTGCCTTTTTCAACTTTACCAAGGGCAATGGCATCGCCTTCTCCAG TGGGGATCGATGGAAGGTCCTGAGACAGTTCTCTATCCAGATTCTACGGAATTTCGGGATGGGGAAGAGA AGCATTGAGGAGCGAATCCTAGAGGAGGGCAGCTTCCTGCTGGCGGAGCTGCGGAAAACTGAAGGCGAGC CCTTTGACCCCACGTTTGTGCTGAGTCGCTCAGTGTCCAACATTATCTGTTCCGTGCTCTTCGGCAGCCG CTTCGACTATGATGATGAGCGTCTGCTCACCATTATCCGCCTTATCAATGACAACTTCCAAATCATGAGC
    [Show full text]
  • Comprehensive Analysis of Expression, Prognosis and Immune Infltrates for Kinesin Superfamily Members in Human Pancreatic Adenocarcinoma
    Comprehensive Analysis of Expression, Prognosis and Immune Inltrates for Kinesin Superfamily Members in Human Pancreatic Adenocarcinoma Zehao Chen ( [email protected] ) Wuhan University https://orcid.org/0000-0001-9440-0782 Jie Wang Wuhan University Jian Xu Wuhan University Wenjie Zhu Wuhan University Jianxin Jiang Wuhan University Research Keywords: Kinesin superfamily, Pancreatic Adenocarcinoma, Expression, Prognostic value, Immune Inltrates Posted Date: June 16th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-550619/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/26 Abstract Background Kinesin superfamily (KIFs) has a long-reported signicant inuence on the initiation, development, and progress of pancreatic adenocarcinoma (PAAD). However, the expression level of different KIFs in PAAD and its relationship with the prognosis and immune inltration in patients with PAAD have not been fully elucidated. Methods Comprehensive bioinformatics analyses were done using data from UCSC XENA data hubs, TCGA databaseOncomine databases, GEO datasets, GEPIA, GTEx, The human protein atlas, Kaplan Meier plotter, cBioPortal, STRING and KEGG database. Then, the relationship between KIFs expression and tumor immune inltrates was studied by using the TIMER database. Results A total of 24 differentially expressed KIFs at transcriptional levels were identied between tumor tissues and normal tissues with 1 (KIF1A) downregulated and 23 (KIF2A, KIF2C, KIF3A, KIF3B, KIF3C, KIF4A, KIF5B, KIF7, KIF9, KIF10, KIF11, KIF13A, KIF13B, KIF15, KIF16B, KIF18B, KIF20A, KIF20B, KIF21B, KIF22, KIF23, KIF26B, KIFC1) overexpressed by GEPIA. The protein expression level of KIF3A, KIF3B, KIF4A, KIF5B, KIF7, KIF9, CENPE, KIF11, KIF13A, KIF13B, KIF15, KIF16B, KIF18B, KIF20A, KIF20B, KIF21B, KIF22, KIF23, KIF26B, KIFC1 are higher in PAAD tissues than in the adjacent tissues, which is almost the same as the results of KIFs at transcriptional levels in PAAD.
    [Show full text]