DOCSLIB.ORG

1 Supplementary Information Overview Supplementary Materials and Methods Supplementary Table S1: Cell Characteristics and Phenot

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
1 Supplementary Information Overview Supplementary Materials and Methods Supplementary Table S1: Cell Characteristics and Phenot Supplementary information Overview Supplementary Materials and methods Supplementary Table S1: Cell characteristics and phenotypes of MM cell lines. Supplementary Table S2: Characteristics of patients with newly diagnosed MM in Figure 1H. Supplementary Table S3: Primer and shRNA sequence. Supplementary Table S4: Four hundred four genes differentially expressed in MM cell lines treated with or without POM. Supplementary Figure S1: Antitumor effect of LEN and POM on MM cell lines, MOSTI-1, U266, MM.1S, KMS-18, KMS-27 and RPMI8226. Supplementary Figure S2: Relationship of POM sensitivity with CRBN expression. Supplementary Figure S3: DNA copy numbers of PD-L1 in MM cell lines. Supplementary Figure S4: The level of cell-surface expression of PD-L2 when MM cells were cultured with 10 µmol/L LEN or 1 µmol/L POM for 3 days. Supplementary Figure S5: Cell-surface expression of BCMA and TACI on MM cell lines treated with IMiDs. Supplementary Figure S6: Enrichment plots for the gene sets of the MAPK/ERK pathway that were significantly upregulated in POM-treated MM cells compared with untreated cells. Supplementary Figure S7: In vivo analysis using a murine xenograft model of human myeloma MM.1S cells inoculated into the flanks of NOG mice. Supplementary Figure S8: PD-L1 mRNA expression in CRBN-knockout and Ikaros- and Aiolos-knockdown cells after 3-day cultivation with 10 µmol/L LEN or 1 µmol/L POM. Supplementary Figure S9: Ikaros binding sites in the promoter of the PD-L1 gene. Supplementary Figure S10: Cell proliferation and T-cell activation of CD8+ T cells on day 4 when co-cultivation of T cells with untreated or LEN-pretreated U266 cells was treated with durvalumab and LEN. Supplementary Figure S11: APRIL protein and mRNA expression in CRBN-knockout and Ikaros- and Aiolos-knockdown MOSTI-1 cells after 3-day cultivation with 1 µmol/L LEN or 10 µmol/L POM. 1 Supplementary Materials and methods Reagents THAL, LEN, and POM were purchased from Selleck Chemicals, reconstituted in dimethyl sulfoxide (DMSO), and stored at –20°C until use. Recombinant human APRIL was from PeproTech. Recombinant human transmembrane activator and CAML interactor (TACI), BCMA and PD-1 Fc chimera protein, and anti-human TACI and anti-human BCMA antibody were all from R&D Systems and used as blocking agents. Durvalumab was provided by Celgene. Anti-CD138 (clone MI15; FITC), anti-CD38 (HIT2; Brilliant Violet 421), anti-CD3 (UCHT1; Brilliant Violet 421), anti-CD14 (M5E2; Brilliant Violet 510), anti-CD45 (HI30; APC), anti-CD45RO (UCHL1; PE) and anti-CD25 (BC96; PE-Cy7; BioLegend), anti-CD4 (SK3; Brilliant Ultraviolet 395) and anti-CD8 (RPA-T8; APC; BD Biosciences), and anti-PD-L1 (MIH1; PE; Thermo Fisher Scientific) were used as FCM antibodies. Horseradish peroxidase (HRP)-conjugated anti-PD-L1 (#51296) and anti-β-actin (#5125), anti-CRBN (#71810), anti-Ikaros (#14859), anti-Aiolos (#15103), anti-Akt (#9272) and anti-phosho-Akt (#4060; Cell Signaling Technology Inc.), and anti-APRIL (ab200836; Abcam) were used as Western blotting antibodies. Promoter constructs and reporter assay DNA fragments of the PD-L1 promoter were amplified from human genomic DNA of MM cell lines using the primers shown in Supplementary Table S1. The amplified DNA products were cloned into the pGL3 firefly luciferase reporter vectors (Promega). The pGL3 promoter and pRL Renilla luciferase control reporter (Promega) vectors were transduced into HeLa cells by electroporation using the Neon transfection system (Thermo Fisher Scientific), and 24 h after transfection, the cells were treated with LEN or POM for 3 days, respectively. Firefly and Renilla luciferase activities were measured using the Dual-Glo luciferase assay system (Promega) according to the manufacturer’s instructions with an Imark microplate reader (Bio-Rad). Firefly luminescence from the pGL3 promoter vector was normalized to Renilla luciferase luminescence from the pRL vector to control for transfection efficiency. 2 Analysis of differential gene expression SurePrint G3 Human GE v3 8x60K microarrays (Agilent), which contained 62,972 probe sets (28,950 mRNAs), were used for mRNA expression profiling of untreated vs POM-treated U266 and MOSTI-1 cells. Then, 29,113 probes were filtrated with at least one present flag in 4 samples each from 62,972 probes, and additionally a total of 404 genes differentially expressed more than 2-fold between the two groups were identified as described in Supplementary Table S4. To perform gene ontology (GO) and pathway analyses, data of the 404 genes were analyzed using the online tool, PANTHER (http://geneontology.org/). Heatmaps were generated using Multiple Experiment Viewer software (MeV). Mixed lymphocyte–myeloma reaction CD3+ T cells were purified from PBMCs from healthy volunteers using the MojoSort human CD3 T cell isolation kit (BioLegend) according to the manufacturer’s instructions and then labeled with carboxyfluorescein diacetate succinimidyl ester (CFSE; BioLegend). The purity of the isolated cells was higher than 95% as determined in FCM. MM cell lines were pretreated with 1 µmol/L of POM for 3 days and subsequently irradiated with 20,000 rad. Then 1 × 105 CD3+ T cells were co-cultured with POM-treated or untreated MM cells in 96-well flat-bottomed plates with immobilized anti-CD3 plus 2 µg/mL anti-CD28 antibody (BioLegend) in the presence of POM. In some cultures, durvalumab was added to block the PD-1–PD-L1 pathway. IFN-γ production at 24 h post co-culture was confirmed using human IFN-γ-specific enzyme-linked immunosorbent assay (ELISA) kit (BioLegend). After 4 days, the CFSE-based proliferation assay and the expression assay of the T-cell activation marker was performed in CD4+ and CD8+ T cells using FCM. 3 Supplementary Table S1: Cell characteristics and phenotypes of MM cell lines. Cell lines MOSTI-1 U266 MM.1S KMS-18 KMS-27 RPMI 8226 OPM2 Tissue BM PB PB PB PB PB PB Ag 56 53 42 58 52 61 56 Gender M M F M M M F Ig Type IgG-λ IgE-λ IgA-λ IgA-λ to BJP-λ BJP-κ IgG-λ IgG-λ Chromosomal t(4;14) － t(14;16) t(14;16) t(11;14) － t(4;14) abnormalities t(6;14) Overexpressed MMSET MMSET Cyclin D3 Cyclin D3 Cyclin D2 Cyclin D1 Cyclin D2 genes Cyclin D3 Cyclin D3 HLA Aw19, B15, CD38+ CD138+ CD25+ CD28+ CD38+ B37, Cw2 CD138+ CD138+ CD38+ CD38+ CD38+ CD19- CD19- CD38+ Cell surface CD19- CD19- CD52+ CD19- CD54+ CD20- CD19- marker (CD) CD20- CD20- CD59+ CD20- CD7+ CD28+ CD20- CD34- CD34- CD56+ CD38+ CD34- CD56- HLA-DR+ CD49e+ HLA-DR- BM, bone marrow; PB, peripheral blood; M, male; F, female. 4 Supplementary Table S2: Characteristics of patients with newly diagnosed MM and MGUS in Figure 1G and 1H. MM/MGUS patients MM Pt#1 MM Pt#2 MM Pt#3 MM Pt#4 MM Pt#5 MGUS Gender F M F M F F Age 85 77 55 68 90 48 Diagnosis symptomatic symptomatic asymptomatic asymptomatic symptomatic asymptomatic ISS III - I II III I R-ISS II - I II III - DS II III I III II I Ig Type IgG-λ IgG-λ IgG-κ IgG-κ IgA-λ, BJP-λ IgA-λ Chromosomal aberration - - - - - - First-line Therapy BD Rd Rd→VRd→KRd Observation BD Observation Therapeutic response SD SD SD→SD→PR - VGPR - Plasma cells in BM (%) 25 49.2 20 10.8 16.7 4.9 PD-L1 expression (%)* 31.1 95.6 63.7 97.7 69.2 7 *PD-L1 expression at BM sample collection. ISS, International Staging System; R-ISS, Revised ISS; DS, Durie-Salmon stage; BD, bortezomib plus dexamethasone; Rd, lenalidomide plus dexamethasone; VRd, bortezomib, lenalidomide and dexamethasone; KRd, carfilzomib, lenalidomide and dexamethasone; SD, stable disease; PR, partial response; VGPR, very good partial response; BM, bone marrow. 5 Supplementary Table S3: Primer and shRNA sequence Gene Primer sequence (5'–3') Accession no. symbol Forward (upper)/reverse (lower) ACTB TGGCACCCAGCACAATGAA NM_001101.3 Real-time (β-actin) CTAAGTCATAGTCCGCCTAGAAGCA PCR GCTTTTCAATGTGACCAGCA NM_014143.4 PD-L1 TGGCTCCCAGAATTACCAAG GTATCCCTGGCAGAGTCTCC NM_003808.3 APRIL GAGGTGGCGTTAATGGGAAC Location of PD-L1 promoter PD-L1 TAGGTACCCCAATGCAAGGGCTATCTCA (–1013 to +1) promoter TCTCTCGAGCCCAAAGAA AGGGTGTAG Location of PD-L1 promoter PD-L1 CTGGTACCTCTGATAAAGGTTAAGGGGT Cloning (–353 to +1) promoter TCTCTCGAGCCCAAAGAA AGGGTGTAG GGATCCATGGATGCTGATGAGGGTCA NM_006060.6 IKZF1 GCGAATTCTTAGCTCATGTGGAAGCGGT shRNA target gene shRNA sequence (5'–3') CRBN AAGTGCCAGATATTTCCTTCA shRNA Ikaros GCTATCAATCATTAAGGTCAT Aiolos CGCCTAACAGATTGCTCTCAA 6 Supplementary Table S4: Four hundred four genes differentially expressed in MM cell lines treated with or without POM. A total of 404 genes differentially expressed more than 2-fold between POM-treated and untreated cells in both U266 cells and MOSTI-1 cell lines. Positive and negative values of the fold change indicate up-regulation and down-regulation, respectively, in POM-treated MM cells compared with untreated cells. U266 MOSTI-1 U266 MOSTI-1 No. Probe ID Accession no. Gene symbol Fold Fold No. Probe ID Accession no. Gene symbol Fold Fold change change change change 1 A_24_P945113 NM_000020 ACVRL1 40.1 25.2 51 A_23_P59261 NM_006670 TPBG 6.2 7.5 2 A_23_P103256 NM_021023 CFHR3 26.5 41.0 52 A_33_P3638471 BC027954 TRGV7 6.1 13.4 3 A_23_P137665 NM_001276 CHI3L1 21.2 27.5 53 A_32_P54274 NM_000798 DRD5 6.1 10.6 4 A_24_P190472 NM_003064 SLPI 18.6 103.8 54 A_33_P3405424 NM_152899 IL4I1 6.1 6.1 5 A_33_P3391915 NM_001080466 BTBD17 18.2 20.6 55 A_23_P135061 NM_003389 CORO2A 6.1 11.5 6 A_33_P3280845 NM_006288 THY1 18.1 5.8 56 A_24_P365322 NM_152601 ZNF709 5.9 2.3 7 A_23_P46356 NM_024575 TNFAIP8L2 17.6 2.3 57 A_23_P329375 NM_002702 POU6F1 5.9 6.2 8 A_33_P3312242 NM_005624 CCL25 16.5 7.1 58 A_33_P3281795 NM_007283 MGLL 5.9 7.3
Load more

Recommended publications
  • CHD7 Represses the Retinoic Acid Synthesis Enzyme ALDH1A3 During Inner Ear Development
    CHD7 represses the retinoic acid synthesis enzyme ALDH1A3 during inner ear development Hui Yao, … , Shigeki Iwase, Donna M. Martin JCI Insight. 2018;3(4):e97440. https://doi.org/10.1172/jci.insight.97440. Research Article Development Neuroscience CHD7, an ATP-dependent chromatin remodeler, is disrupted in CHARGE syndrome, an autosomal dominant disorder characterized by variably penetrant abnormalities in craniofacial, cardiac, and nervous system tissues. The inner ear is uniquely sensitive to CHD7 levels and is the most commonly affected organ in individuals with CHARGE. Interestingly, upregulation or downregulation of retinoic acid (RA) signaling during embryogenesis also leads to developmental defects similar to those in CHARGE syndrome, suggesting that CHD7 and RA may have common target genes or signaling pathways. Here, we tested three separate potential mechanisms for CHD7 and RA interaction: (a) direct binding of CHD7 with RA receptors, (b) regulation of CHD7 levels by RA, and (c) CHD7 binding and regulation of RA-related genes. We show that CHD7 directly regulates expression of Aldh1a3, the gene encoding the RA synthetic enzyme ALDH1A3 and that loss of Aldh1a3 partially rescues Chd7 mutant mouse inner ear defects. Together, these studies indicate that ALDH1A3 acts with CHD7 in a common genetic pathway to regulate inner ear development, providing insights into how CHD7 and RA regulate gene expression and morphogenesis in the developing embryo. Find the latest version: https://jci.me/97440/pdf RESEARCH ARTICLE CHD7 represses the retinoic acid synthesis enzyme ALDH1A3 during inner ear development Hui Yao,1 Sophie F. Hill,2 Jennifer M. Skidmore,1 Ethan D. Sperry,3,4 Donald L.
    [Show full text]
  • Role and Regulation of the P53-Homolog P73 in the Transformation of Normal Human Fibroblasts
    Role and regulation of the p53-homolog p73 in the transformation of normal human fibroblasts Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Bayerischen Julius-Maximilians-Universität Würzburg vorgelegt von Lars Hofmann aus Aschaffenburg Würzburg 2007 Eingereicht am Mitglieder der Promotionskommission: Vorsitzender: Prof. Dr. Dr. Martin J. Müller Gutachter: Prof. Dr. Michael P. Schön Gutachter : Prof. Dr. Georg Krohne Tag des Promotionskolloquiums: Doktorurkunde ausgehändigt am Erklärung Hiermit erkläre ich, dass ich die vorliegende Arbeit selbständig angefertigt und keine anderen als die angegebenen Hilfsmittel und Quellen verwendet habe. Diese Arbeit wurde weder in gleicher noch in ähnlicher Form in einem anderen Prüfungsverfahren vorgelegt. Ich habe früher, außer den mit dem Zulassungsgesuch urkundlichen Graden, keine weiteren akademischen Grade erworben und zu erwerben gesucht. Würzburg, Lars Hofmann Content SUMMARY ................................................................................................................ IV ZUSAMMENFASSUNG ............................................................................................. V 1. INTRODUCTION ................................................................................................. 1 1.1. Molecular basics of cancer .......................................................................................... 1 1.2. Early research on tumorigenesis ................................................................................. 3 1.3. Developing
    [Show full text]
  • Mouse Crabp2 Knockout Project (CRISPR/Cas9)
    https://www.alphaknockout.com Mouse Crabp2 Knockout Project (CRISPR/Cas9) Objective: To create a Crabp2 knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Crabp2 gene (NCBI Reference Sequence: NM_007759 ; Ensembl: ENSMUSG00000004885 ) is located on Mouse chromosome 3. 4 exons are identified, with the ATG start codon in exon 1 and the TGA stop codon in exon 4 (Transcript: ENSMUST00000005019). Exon 1~4 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Homozygotes for targeted null mutations may exhibit an additional postaxial digit, usually on a single forepaw. Penetrance is dependent on the genetic background. Exon 1 starts from about 0.24% of the coding region. Exon 1~4 covers 100.0% of the coding region. The size of effective KO region: ~4194 bp. The KO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 2 3 4 Legends Exon of mouse Crabp2 Knockout region Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section upstream of start codon is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix. The gRNA site is selected outside of these tandem repeats. Overview of the Dot Plot (down) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section downstream of stop codon is aligned with itself to determine if there are tandem repeats.
    [Show full text]
  • A New Synuclein-Transgenic Mouse Model for Early Parkinson's Reveals Molecular Features of Preclinical Disease
    bioRxiv preprint doi: https://doi.org/10.1101/2020.04.04.016642; this version posted April 5, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. A new synuclein-transgenic mouse model for early Parkinson's reveals molecular features of preclinical disease Diana M Hendrickx1,*,#, Pierre Garcia1,2,#, Amer Ashrafi1, Alessia Sciortino1, Kristopher J Schmit1, Heike Kollmus3, Nathalie Nicot4, Tony Kaoma5, Laurent Vallar6, Manuel Buttini1,*,$, Enrico Glaab1,$ 1 Luxembourg Centre for Systems Biomedicine (LCSB), University of Luxembourg, Belvaux, Luxembourg 2 Laboratoire National de Sant´e(LNS), Neuropathology Unit, Dudelange, Luxembourg 3 Department of Infection Genetics, Helmholtz Centre for Infection Research, Braunschweig, Germany 4 Quantitative Biology Unit, Luxembourg Institute of Health, Strassen, Luxembourg 5 Department of Oncology, Luxembourg Institute of Health, Strassen, Luxembourg 6 Genomics Research Unit, Luxembourg Institute of Health, Luxembourg, Luxembourg * [email protected]; [email protected] # equal contributor $ equal contributor Abstract Understanding Parkinson's disease (PD) in particular in its earliest phases is important for diagnosis and treatment. However, human brain samples are collected post-mortem, reflecting mainly end stage disease. Because brain samples of mouse models can be collected at any stage of the disease process, they are useful to investigate PD progression. Here, we compare ventral midbrain transcriptomics profiles from α-synuclein transgenic mice with a progressive, early PD-like striatum neurodegeneration across different ages using pathway, gene set and network analysis methods.
    [Show full text]
  • Retinoid X Receptor Agonists Increase Bcl2a1 Expression and Decrease Apoptosis of Naive T Lymphocytes1
    The Journal of Immunology Retinoid X Receptor Agonists Increase Bcl2a1 Expression and Decrease Apoptosis of Naive T Lymphocytes1 Reuven Rasooly,* Gertrud U. Schuster,* Jeffrey P. Gregg,† Jia-Hao Xiao,‡ Roshantha A. S. Chandraratna,‡ and Charles B. Stephensen2* Vitamin A affects many aspects of T lymphocyte development and function. The vitamin A metabolites all-trans- and 9-cis-retinoic acid regulate gene expression by binding to the retinoic acid receptor (RAR), while 9-cis-retinoic acid also binds to the retinoid X receptor (RXR). Naive DO11.10 T lymphocytes expressed mRNA and protein for RAR-␣, RXR-␣, and RXR-␤. DNA microar- ray analysis was used to identify RXR-responsive genes in naive DO11.10 T lymphocytes treated with the RXR agonist AGN194204. A total of 128 genes was differentially expressed, including 16 (15%) involved in cell growth or apoptosis. Among these was Bcl2a1, an antiapoptotic Bcl2 family member. Quantitative real-time PCR analysis confirmed this finding and demon- strated that Bcl2a1 mRNA expression was significantly greater in nonapoptotic than in apoptotic T lymphocytes. The RXR agonist 9-cis-retinoic acid also increased Bcl2a1 expression, although all-trans-retinoic acid and ligands for other RXR partner receptors did not. Treatment with AGN194204 and 9-cis-retinoic acid significantly decreased apoptosis measured by annexin V staining but did not affect expression of Bcl2 and Bcl-xL. Bcl2a1 promoter activity was examined using a luciferase promoter construct. Both AGN194204 and 9-cis-retinoic acid significantly increased luciferase activity. In summary, these data demonstrate that RXR agonists increase Bcl2a1 promoter activity and increase expression of Bcl2a1 in naive T lymphocytes but do not affect Bcl2 and Bcl-xL expression in naive T lymphocytes.
    [Show full text]
  • Table S1. 103 Ferroptosis-Related Genes Retrieved from the Genecards
    Table S1. 103 ferroptosis-related genes retrieved from the GeneCards. Gene Symbol Description Category GPX4 Glutathione Peroxidase 4 Protein Coding AIFM2 Apoptosis Inducing Factor Mitochondria Associated 2 Protein Coding TP53 Tumor Protein P53 Protein Coding ACSL4 Acyl-CoA Synthetase Long Chain Family Member 4 Protein Coding SLC7A11 Solute Carrier Family 7 Member 11 Protein Coding VDAC2 Voltage Dependent Anion Channel 2 Protein Coding VDAC3 Voltage Dependent Anion Channel 3 Protein Coding ATG5 Autophagy Related 5 Protein Coding ATG7 Autophagy Related 7 Protein Coding NCOA4 Nuclear Receptor Coactivator 4 Protein Coding HMOX1 Heme Oxygenase 1 Protein Coding SLC3A2 Solute Carrier Family 3 Member 2 Protein Coding ALOX15 Arachidonate 15-Lipoxygenase Protein Coding BECN1 Beclin 1 Protein Coding PRKAA1 Protein Kinase AMP-Activated Catalytic Subunit Alpha 1 Protein Coding SAT1 Spermidine/Spermine N1-Acetyltransferase 1 Protein Coding NF2 Neurofibromin 2 Protein Coding YAP1 Yes1 Associated Transcriptional Regulator Protein Coding FTH1 Ferritin Heavy Chain 1 Protein Coding TF Transferrin Protein Coding TFRC Transferrin Receptor Protein Coding FTL Ferritin Light Chain Protein Coding CYBB Cytochrome B-245 Beta Chain Protein Coding GSS Glutathione Synthetase Protein Coding CP Ceruloplasmin Protein Coding PRNP Prion Protein Protein Coding SLC11A2 Solute Carrier Family 11 Member 2 Protein Coding SLC40A1 Solute Carrier Family 40 Member 1 Protein Coding STEAP3 STEAP3 Metalloreductase Protein Coding ACSL1 Acyl-CoA Synthetase Long Chain Family Member 1 Protein
    [Show full text]
  • Solid Tumour Section Short Communication
    Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL INIST-CNRS Solid Tumour Section Short Communication Soft Tissues: Lipoblastoma with t(2;8)(q31;q12.1) COL3A1/PLAG1 Hideki Yoshida, Mitsuru Miyachi, Hajime Hosoi Department of Pediatrics, Graduate School of MedicalScience, Kyoto Prefectural University of Medicine, Kajii-cho Hirokoji, Kamigyo-ku, Kyoto, Japan, E-mail address: [email protected] Published in Atlas Database: October 2014 Online updated version : http://AtlasGeneticsOncology.org/Tumors/t28q31q12LipoblastID6626.html Printable original version : http://documents.irevues.inist.fr/bitstream/handle/2042/62149/10-2014-t28q31q12LipoblastID6626.pdf DOI: 10.4267/2042/62149 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2015 Atlas of Genetics and Cytogenetics in Oncology and Haematology Abstract Cytogenetics Review on translocations in lipoblastoma with Cytogenetics Morphological t(2;8)(q31;q12.1) COL3A1/PLAG1, with data on t(2;8)(q31;q12.1) clinics, genetics and cytogenetics. Identity Genes involved and proteins Phylum Soft Tissue Tumors: Benign Lipomatous: COL3A1 Lipoblastoma Location Clinics and pathology 2q31 Note Disease Mutations in this gene are associated with Ehlers- Danlos syndrome types IV, and with aortic and is a rapidly growing, benign neoplasm. arterial aneurysms. (Lee et al., 2008; Jeong et al., It is a mesenchymal tumor of fetal white fat tissue 2012) that appears most commonly in children under three years of age and affects males three times more often DNA / RNA than females (McVay et al., 2006). The COL3A1 gene, located at chromosome 2q31, It can present anywhere in the body, but is most contains 51 exons spanning 38.43 kb of genomic commonly seen in the trunk and extremities.
    [Show full text]
  • Discovery and Characterization of Novel Bioactive Peptides and a Natural Erralpha Ligand
    Discovery and Characterization of Novel Bioactive Peptides and a Natural ERRalpha Ligand The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Schwaid, Adam. 2013. Discovery and Characterization of Novel Bioactive Peptides and a Natural ERRalpha Ligand. Doctoral dissertation, Harvard University. Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:11181064 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Discovery and Characterization of Novel Bioactive Peptides and a Natural ERR α Ligand A dissertation presented by Adam Schwaid to The Department of Chemistry and Chemical Biology in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the subject of Chemistry Harvard University Cambridge, Massachusetts August, 2013 © 2013 Adam Schwaid All rights reserved. Dissertation Advisor: Professor Alan Saghatelian Adam Schwaid Discovery and Characterization of Novel Bioactive Peptides and a Natural ERR α Ligand Abstract Metabolites and peptides have a central role in biology that is often overlooked. Despite the importance of metabolites in key protein-metabolite interactions (PMIs), the extent and identity of these interactions is not known. Likewise, the extent to which short open reading frames (sORFs) in the genome are translated into peptides has also been an elusive question. This dissertation describes the development and application of methods to elucidate unknown molecules and interactions critical to understanding biology, and the subsequent characterization of the biological roles of these discoveries in cells and mice.
    [Show full text]
  • Analysis of Dynamic Changes in Retinoid-Induced Transcription and Epigenetic Profiles of Murine Hox Clusters in ES Cells
    Downloaded from genome.cshlp.org on October 1, 2021 - Published by Cold Spring Harbor Laboratory Press Resource Analysis of dynamic changes in retinoid-induced transcription and epigenetic profiles of murine Hox clusters in ES cells Bony De Kumar,1 Mark E. Parrish,1 Brian D. Slaughter,1 Jay R. Unruh,1 Madelaine Gogol,1 Christopher Seidel,1 Ariel Paulson,1 Hua Li,1 Karin Gaudenz,1 Allison Peak,1 William McDowell,1 Brian Fleharty,1 Youngwook Ahn,1 Chengqi Lin,1,3 Edwin Smith,1,4 Ali Shilatifard,1,4 and Robb Krumlauf1,2 1Stowers Institute for Medical Research, Kansas City, Missouri 64110, USA; 2Department of Anatomy and Cell Biology, Kansas University Medical Center, Kansas City, Kansas 66160, USA The clustered Hox genes, which are highly conserved across metazoans, encode homeodomain-containing transcription fac- tors that provide a blueprint for segmental identity along the body axis. Recent studies have underscored that in addition to encoding Hox genes, the homeotic clusters contain key noncoding RNA genes that play a central role in development. In this study, we have taken advantage of genome-wide approaches to provide a detailed analysis of retinoic acid (RA)-induced transcriptional and epigenetic changes within the homeotic clusters of mouse embryonic stem cells. Although there is a gen- eral colinear response, our analyses suggest a lack of strict colinearity for several genes in the HoxA and HoxB clusters. We have identified transcribed novel noncoding RNAs (ncRNAs) and their cis-regulatory elements that function in response to RA and demonstrated that the expression of these ncRNAs from both strands represent some of the most rapidly induced transcripts in ES cells.
    [Show full text]
  • Study of Urine Extracellular Vesicles-Derived Protein Biomarkers for the Non-Invasive Monitoring of Kidney-Transplanted Patients
    ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda condicionat a lʼacceptació de les condicions dʼús establertes per la següent llicència Creative Commons: http://cat.creativecommons.org/?page_id=184 ADVERTENCIA. El acceso a los contenidos de esta tesis queda condicionado a la aceptación de las condiciones de uso establecidas por la siguiente licencia Creative Commons: http://es.creativecommons.org/blog/licencias/ WARNING. The access to the contents of this doctoral thesis it is limited to the acceptance of the use conditions set by the following Creative Commons license: https://creativecommons.org/licenses/?lang=en Study of urine extracellular vesicles-derived protein biomarkers for the non-invasive monitoring of kidney- transplanted patients Laura Carreras Planella Doctoral thesis Badalona, 20th October 2020 Thesis directors: Francesc Enric Borràs Serres, PhD Maria Isabel Troya Saborido, PhD 2 PhD programme in Advanced Immunology Department of Cellular Biology, Physiology and Immunology Universitat Autònoma de Barcelona Study of urine extracellular vesicles-derived protein biomarkers for the non-invasive monitoring of kidney-transplanted patients Estudi de biomarcadors proteics derivats de vesícules extracel·lulars de la orina per la monitorització no invasiva de pacients trasplantats de ronyó Thesis presented by Laura Carreras Planella to qualify for the PhD degree in Advanced Immunology by the Universitat Autònoma de Barcelona The presented work has been performed in the ReMAR-IVECAT group at the Germans Trias i Pujol Health Sciences Research Institute (IGTP) under the supervision of Dr. Francesc Enric Borràs Serres, as tutor and co-director, and Dr. Maria Isabel Troya Saborido as co-director. 3 Laura Carreras was sponsored by the Spanish Government with an FPU grant (“Formación de Personal Universitario”, FPU17/01444) and by La Fundació Cellex during the development of the PhD project.
    [Show full text]
  • The Role of Cyclin D3 in Pancreatic Β-Cell Metabolic Fitness and Viability in a Cell Cycle-Independent Manner. Implications In
    The role of cyclin D3 in pancreatic β-cell metabolic fitness and viability in a cell cycle-independent manner. Implications in autoimmune diabetes Noemí Alejandra Saavedra Ávila Dipòsit Legal: L.854-2014 http ://hdl.handle.net/10803/272629 ADVERTIMENT. L'accés als continguts d'aquesta tesi doctoral i la seva utilització ha de respectar els drets de la persona autora. Pot ser utilitzada per a consulta o estudi personal, així com en activitats o materials d'investigació i docència en els termes establerts a l'art. 32 del Text Refós de la Llei de Propietat Intel·lectual (RDL 1/1996). Per altres utilitzacions es requereix l'autorització prèvia i expressa de la persona autora. En qualsevol cas, en la utilització dels seus continguts caldrà indicar de forma clara el nom i cognoms de la persona autora i el títol de la tesi doctoral. No s'autoritza la seva reproducció o altres formes d'explotació efectuades amb finalitats de lucre ni la seva comunicació pública des d'un lloc aliè al servei TDX. Tampoc s'autoritza la presentació del seu contingut en una finestra o marc aliè a TDX (framing). Aquesta reserva de drets afecta tant als continguts de la tesi com als seus resums i índexs. ADVERTENCIA. El acceso a los contenidos de esta tesis doctoral y su utilización debe respetar los derechos de la persona autora. Puede ser utilizada para consulta o estudio personal, así como en actividades o materiales de investigación y docencia en los términos establecidos en el art. 32 del Texto Refundido de la Ley de Propiedad Intelectual (RDL 1/1996).
    [Show full text]
  • Crabp2 Promotes Metastasis of Lung Cancer Cells Via Hur and Integrin Β1/FAK/ERK Signaling
    www.nature.com/scientificreports OPEN Crabp2 Promotes Metastasis of Lung Cancer Cells via HuR and Integrin β1/FAK/ERK Signaling Received: 18 June 2018 Jun-I Wu1,2, Yi-Pei Lin1,3, Chien-Wei Tseng1,4, Hui-Jane Chen1 & Lu-Hai Wang1,2,3,4,5 Accepted: 30 November 2018 Increased Crabp2 levels have been found in various types of cancer, and are associated with poor Published: xx xx xxxx patients’ survival. Although Crabp2 is found to be overexpressed in lung cancer, its role in metastasis of lung cancer is unclear. In this study, Crabp2 was overexpressed in high-metastatic C10F4 than low-metastatic lung cancer cells. Analysis of clinical samples revealed that high CRABP2 levels were correlated with lymph node metastases, poor overall survival, and increased recurrence. Knockdown of Crabp2 decreased migration, invasion, anoikis resistance, and in vivo metastasis. Crabp2 was co- immunoprecipitated with HuR, and overexpression of Crabp2 increased HuR levels, which promoted integrin β1/FAK/ERK signaling. Inhibition of HuR or integrin β1/FAK/ERK signaling reversed the promoting efect of Crabp2 in migration, invasion, and anoikis resistance. Knockdown of Crabp2 further inhibited the growth of cancer cells as compared with that by gemcitabine or irinotecan alone. The expression of Crabp2 in human lung tumors was correlated with stress marker CHOP. In conclusion, our fndings have identifed the promoting role of Crabp2 in anoikis resistance and metastasis. CRABP2 may serve as a prognostic marker and targeting CRABP2 may be exploited as a modality to reduce metastasis. Lung cancer causes more than one-fourth of all cancer-related deaths worldwide1.
    [Show full text]