1 Supplementary Information Overview Supplementary Materials and Methods Supplementary Table S1: Cell Characteristics and Phenot

Supplementary information

Overview

Supplementary Materials and methods Supplementary Table S1: Cell characteristics and phenotypes of MM cell lines. Supplementary Table S2: Characteristics of patients with newly diagnosed MM in Figure 1H. Supplementary Table S3: Primer and shRNA sequence. Supplementary Table S4: Four hundred four genes differentially expressed in MM cell lines treated with or without POM. Supplementary Figure S1: Antitumor effect of LEN and POM on MM cell lines, MOSTI-1, U266, MM.1S, KMS-18, KMS-27 and RPMI8226. Supplementary Figure S2: Relationship of POM sensitivity with CRBN expression. Supplementary Figure S3: DNA copy numbers of PD-L1 in MM cell lines. Supplementary Figure S4: The level of cell-surface expression of PD-L2 when MM cells were cultured with 10 µmol/L LEN or 1 µmol/L POM for 3 days. Supplementary Figure S5: Cell-surface expression of BCMA and TACI on MM cell lines treated with IMiDs. Supplementary Figure S6: Enrichment plots for the gene sets of the MAPK/ERK pathway that were significantly upregulated in POM-treated MM cells compared with untreated cells. Supplementary Figure S7: In vivo analysis using a murine xenograft model of human myeloma MM.1S cells inoculated into the flanks of NOG mice. Supplementary Figure S8: PD-L1 mRNA expression in CRBN-knockout and Ikaros- and Aiolos-knockdown cells after 3-day cultivation with 10 µmol/L LEN or 1 µmol/L POM. Supplementary Figure S9: Ikaros binding sites in the promoter of the PD-L1 gene. Supplementary Figure S10: Cell proliferation and T-cell activation of CD8+ T cells on day 4 when co-cultivation of T cells with untreated or LEN-pretreated U266 cells was treated with durvalumab and LEN. Supplementary Figure S11: APRIL protein and mRNA expression in CRBN-knockout and Ikaros- and Aiolos-knockdown MOSTI-1 cells after 3-day cultivation with 1 µmol/L LEN or 10 µmol/L POM.

1 Supplementary Materials and methods Reagents THAL, LEN, and POM were purchased from Selleck Chemicals, reconstituted in dimethyl sulfoxide (DMSO), and stored at –20°C until use. Recombinant human APRIL was from PeproTech. Recombinant human transmembrane activator and CAML interactor (TACI), BCMA and PD-1 Fc chimera protein, and anti-human TACI and anti-human BCMA antibody were all from R&D Systems and used as blocking agents. Durvalumab was provided by Celgene. Anti-CD138 (clone MI15; FITC), anti-CD38 (HIT2; Brilliant Violet 421), anti-CD3

(UCHT1; Brilliant Violet 421), anti-CD14 (M5E2; Brilliant Violet 510), anti-CD45 (HI30; APC), anti-CD45RO (UCHL1; PE) and anti-CD25 (BC96; PE-Cy7; BioLegend), anti-CD4 (SK3; Brilliant Ultraviolet 395) and anti-CD8 (RPA-T8; APC; BD Biosciences), and anti-PD-L1 (MIH1; PE; Thermo Fisher Scientific) were used as FCM antibodies. Horseradish peroxidase (HRP)-conjugated anti-PD-L1 (#51296) and anti-β-actin (#5125), anti-CRBN (#71810), anti-Ikaros (#14859), anti-Aiolos (#15103), anti-Akt (#9272) and anti-phosho-Akt (#4060; Cell Signaling Technology Inc.), and anti-APRIL (ab200836; Abcam) were used as Western blotting antibodies.

Promoter constructs and reporter assay DNA fragments of the PD-L1 promoter were amplified from human genomic DNA of MM cell lines using the primers shown in Supplementary Table S1. The amplified DNA products were cloned into the pGL3 firefly luciferase reporter vectors (Promega). The pGL3 promoter and pRL Renilla luciferase control reporter (Promega) vectors were transduced into HeLa cells by electroporation using the Neon transfection system (Thermo Fisher Scientific), and 24 h after transfection, the cells were treated with LEN or POM for 3 days, respectively. Firefly and Renilla luciferase activities were measured using the Dual-Glo luciferase assay system (Promega) according to the manufacturer’s instructions with an Imark microplate reader (Bio-Rad). Firefly luminescence from the pGL3 promoter vector was normalized to Renilla luciferase luminescence from the pRL vector to control for transfection efficiency.

Analysis of differential gene expression SurePrint G3 Human GE v3 8x60K microarrays (Agilent), which contained 62,972 probe sets (28,950 mRNAs), were used for mRNA expression profiling of untreated vs POM-treated U266 and MOSTI-1 cells. Then, 29,113 probes were filtrated with at least one present flag in 4 samples each from 62,972 probes, and additionally a total of 404 genes differentially expressed more than 2-fold between the two groups were identified as described in Supplementary Table S4. To perform gene ontology (GO) and pathway analyses, data of the 404 genes were analyzed using the online tool, PANTHER (http://geneontology.org/). Heatmaps were generated using Multiple Experiment Viewer software (MeV).

Mixed lymphocyte–myeloma reaction CD3+ T cells were purified from PBMCs from healthy volunteers using the MojoSort human CD3 T cell isolation kit (BioLegend) according to the manufacturer’s instructions and then labeled with carboxyfluorescein diacetate succinimidyl ester (CFSE; BioLegend). The purity of the isolated cells was higher than 95% as determined in FCM. MM cell lines were pretreated with 1 µmol/L of POM for 3 days and subsequently irradiated with 20,000 rad. Then 1 × 105 CD3+ T cells were co-cultured with POM-treated or untreated MM cells in 96-well flat-bottomed plates with immobilized anti-CD3 plus 2 µg/mL anti-CD28 antibody (BioLegend) in the presence of POM. In some cultures, durvalumab was added to block the PD-1–PD-L1 pathway. IFN-γ production at 24 h post co-culture was confirmed using human IFN-γ-specific enzyme-linked immunosorbent assay (ELISA) kit (BioLegend). After 4 days, the CFSE-based proliferation assay and the expression assay of the T-cell activation marker was performed in CD4+ and CD8+ T cells using FCM.

3 Supplementary Table S1: Cell characteristics and phenotypes of MM cell lines.

Cell lines MOSTI-1 U266 MM.1S KMS-18 KMS-27 RPMI 8226 OPM2

Tissue BM PB PB PB PB PB PB

Ag 56 53 42 58 52 61 56

Gender M M F M M M F

Ig Type IgG-λ IgE-λ IgA-λ IgA-λ to BJP-λ BJP-κ IgG-λ IgG-λ

Chromosomal t(4;14) － t(14;16) t(14;16) t(11;14) － t(4;14) abnormalities t(6;14)

Overexpressed MMSET MMSET Cyclin D3 Cyclin D3 Cyclin D2 Cyclin D1 Cyclin D2 genes Cyclin D3 Cyclin D3

HLA Aw19, B15, CD38+ CD138+ CD25+ CD28+ CD38+ B37, Cw2 CD138+ CD138+ CD38+ CD38+ CD38+ CD19- CD19- CD38+ Cell surface CD19- CD19- CD52+ CD19- CD54+ CD20- CD19- marker (CD) CD20- CD20- CD59+ CD20- CD7+ CD28+ CD20- CD34- CD34- CD56+ CD38+ CD34- CD56- HLA-DR+ CD49e+ HLA-DR-

BM, bone marrow; PB, peripheral blood; M, male; F, female.

4 Supplementary Table S2: Characteristics of patients with newly diagnosed MM and MGUS in Figure 1G and 1H.

MM/MGUS patients MM Pt#1 MM Pt#2 MM Pt#3 MM Pt#4 MM Pt#5 MGUS

Gender F M F M F F Age 85 77 55 68 90 48 Diagnosis symptomatic symptomatic asymptomatic asymptomatic symptomatic asymptomatic ISS III - I II III I R-ISS II - I II III - DS II III I III II I Ig Type IgG-λ IgG-λ IgG-κ IgG-κ IgA-λ, BJP-λ IgA-λ Chromosomal aberration ------First-line Therapy BD Rd Rd→VRd→KRd Observation BD Observation Therapeutic response SD SD SD→SD→PR - VGPR - Plasma cells in BM (%) 25 49.2 20 10.8 16.7 4.9 PD-L1 expression (%)* 31.1 95.6 63.7 97.7 69.2 7

*PD-L1 expression at BM sample collection. ISS, International Staging System; R-ISS, Revised ISS; DS, Durie-Salmon stage; BD, bortezomib plus dexamethasone; Rd, lenalidomide plus dexamethasone; VRd, bortezomib, lenalidomide and dexamethasone; KRd, carfilzomib, lenalidomide and dexamethasone; SD, stable disease; PR, partial response; VGPR, very good partial response; BM, bone marrow.

5 Supplementary Table S3: Primer and shRNA sequence

Gene Primer sequence (5'–3') Accession no. symbol Forward (upper)/reverse (lower) ACTB TGGCACCCAGCACAATGAA NM_001101.3 Real-time (β-actin) CTAAGTCATAGTCCGCCTAGAAGCA PCR GCTTTTCAATGTGACCAGCA NM_014143.4 PD-L1 TGGCTCCCAGAATTACCAAG GTATCCCTGGCAGAGTCTCC NM_003808.3 APRIL GAGGTGGCGTTAATGGGAAC

Location of PD-L1 promoter PD-L1 TAGGTACCCCAATGCAAGGGCTATCTCA (–1013 to +1) promoter TCTCTCGAGCCCAAAGAA AGGGTGTAG

Location of PD-L1 promoter PD-L1 CTGGTACCTCTGATAAAGGTTAAGGGGT Cloning (–353 to +1) promoter TCTCTCGAGCCCAAAGAA AGGGTGTAG

GGATCCATGGATGCTGATGAGGGTCA NM_006060.6 IKZF1 GCGAATTCTTAGCTCATGTGGAAGCGGT

shRNA target gene shRNA sequence (5'–3')

CRBN AAGTGCCAGATATTTCCTTCA shRNA Ikaros GCTATCAATCATTAAGGTCAT

Aiolos CGCCTAACAGATTGCTCTCAA

6 Supplementary Table S4: Four hundred four genes differentially expressed in MM cell lines treated with or without POM. A total of 404 genes differentially expressed more than 2-fold between POM-treated and untreated cells in both U266 cells and MOSTI-1 cell lines. Positive and negative values of the fold change indicate up-regulation and down-regulation, respectively, in POM-treated MM cells compared with untreated cells.

U266 MOSTI-1 U266 MOSTI-1 No. Probe ID Accession no. Gene symbol Fold Fold No. Probe ID Accession no. Gene symbol Fold Fold change change change change 1 A_24_P945113 NM_000020 ACVRL1 40.1 25.2 51 A_23_P59261 NM_006670 TPBG 6.2 7.5 2 A_23_P103256 NM_021023 CFHR3 26.5 41.0 52 A_33_P3638471 BC027954 TRGV7 6.1 13.4 3 A_23_P137665 NM_001276 CHI3L1 21.2 27.5 53 A_32_P54274 NM_000798 DRD5 6.1 10.6 4 A_24_P190472 NM_003064 SLPI 18.6 103.8 54 A_33_P3405424 NM_152899 IL4I1 6.1 6.1 5 A_33_P3391915 NM_001080466 BTBD17 18.2 20.6 55 A_23_P135061 NM_003389 CORO2A 6.1 11.5 6 A_33_P3280845 NM_006288 THY1 18.1 5.8 56 A_24_P365322 NM_152601 ZNF709 5.9 2.3 7 A_23_P46356 NM_024575 TNFAIP8L2 17.6 2.3 57 A_23_P329375 NM_002702 POU6F1 5.9 6.2 8 A_33_P3312242 NM_005624 CCL25 16.5 7.1 58 A_33_P3281795 NM_007283 MGLL 5.9 7.3 9 A_23_P137856 NM_002456 MUC1 15.5 6.2 59 A_33_P3338121 NM_001017402 LAMB3 5.7 6.8 10 A_21_P0000015 NM_001146106 PARP9 15.0 6.4 60 A_23_P42282 NM_001002029 C4B 5.7 2.8 11 A_24_P270460 NM_005532 IFI27 14.7 16.4 61 A_23_P148737 NM_004997 MYBPH 5.7 8.4 12 A_33_P3362311 NM_001010903 C6orf222 13.9 13.9 62 A_32_P181297 NR_002330 ST7-AS1 5.6 7.1 13 A_23_P30603 NM_003649 DDO 12.3 5.8 63 A_33_P3405213 NM_000442 PECAM1 5.6 2.4 14 A_33_P3303649 NM_203377 MB 10.9 25.2 64 A_33_P3397865 NM_001291774 TNNT1 5.5 13.6 15 A_24_P270728 NM_001042483 NUPR1 10.9 16.6 65 A_23_P108280 NM_023944 CYP4F12 5.3 2.3 16 A_22_P00017968 NR_126560 KCNMB2-AS1 10.6 10.2 66 A_23_P112026 NM_002164 IDO1 5.2 4.8 17 A_22_P00023623 NR_109894 CTB-178M22.2 10.1 16.7 67 A_23_P132159 NM_017414 USP18 5.2 10.6 18 A_33_P3407880 NM_144590 ANKRD22 9.4 9.6 68 A_33_P3257182 NM_004533 MYBPC2 5.2 5.2 19 A_23_P74068 NM_002440 MSH4 9.1 3.7 69 A_23_P54996 NM_198393 TEX14 5.2 7.3 20 A_24_P79403 NM_002619 PF4 9.0 2.2 70 A_24_P382319 NM_001712 CEACAM1 5.1 3.5 21 A_33_P3260430 NM_005988 SPRR2A 8.9 11.2 71 A_23_P34375 NM_003196 TCEA3 5.1 2.5 22 A_23_P131676 NM_020311 ACKR3 8.4 29.5 72 A_33_P3242798 NM_001875 CPS1 5.1 2.1 23 A_23_P148609 NM_021796 PLAC1 8.4 8.8 73 A_23_P78782 NM_001217 CA11 5.0 15.5 24 A_23_P354387 NM_013451 MYOF 8.4 10.2 74 A_33_P3361422 NM_000784 CYP27A1 4.9 5.8 25 A_23_P34644 NM_004001 FCGR2B 8.2 7.2 75 A_23_P7503 NM_138379 TIMD4 4.9 4.5 26 A_23_P94501 NM_000700 ANXA1 8.2 5.5 76 A_23_P322625 NM_005683 GPR55 4.8 5.3 27 A_24_P557479 NM_017523 XAF1 8.1 7.2 77 A_23_P250413 NM_022141 PARVG 4.7 6.3 28 A_23_P94397 NM_005014 OMD 7.9 2.7 78 A_23_P22565 NM_033085 FATE1 4.7 7.2 29 A_23_P18452 NM_002416 CXCL9 7.6 30.2 79 A_23_P16866 NM_007127 VIL1 4.6 6.6 30 A_23_P52266 NM_001548 IFIT1 7.5 45.5 80 A_23_P139146 NM_031457 MS4A8 4.6 9.2 31 A_23_P201248 NM_052934 SLC26A9 7.5 17.0 81 A_33_P3403942 NM_080721 OCSTAMP 4.6 4.4 32 A_23_P259251 NM_012281 KCND2 7.4 3.3 82 A_24_P304071 NM_001547 IFIT2 4.6 6.5 33 A_23_P24004 NM_001547 IFIT2 7.4 56.4 83 A_23_P32078 NM_022127 SLC28A3 4.5 5.0 34 A_23_P45751 NM_012128 CLCA4 7.4 2.1 84 A_32_P351968 NM_002118 HLA-DMB 4.5 4.6 35 A_24_P876522 NM_001008397 GPX8 7.4 7.4 85 A_23_P310274 NR_001296 PRSS3P2 4.5 3.7 36 A_23_P50508 NM_003706 PLA2G4C 7.3 7.9 86 A_33_P3350858 NR_046005 TMCO5B 4.4 5.7 37 A_23_P139786 NM_003733 OASL 7.2 22.2 87 A_23_P95790 NM_017625 ITLN1 4.3 3.6 38 A_24_P160413 NR_026850 MTMR9LP 7.1 2.4 88 A_33_P3393170 NM_004055 CAPN5 4.3 8.7 39 A_33_P3692756 NR_027374 LHFPL3-AS2 7.1 11.2 89 A_32_P356316 NM_002119 HLA-DOA 4.3 10.4 40 A_24_P3005 NM_002977 SCN9A 7.0 6.9 90 A_23_P360302 NM_001522 GUCY2F 4.2 6.2 41 A_23_P123853 NM_006274 CCL19 7.0 2.8 91 A_33_P3228460 NM_001136007 FXYD3 4.2 3.2 42 A_24_P33982 NM_001291317 MILR1 7.0 8.0 92 A_24_P280113 NM_001560 IL13RA1 4.2 5.1 43 A_23_P114740 NM_000186 CFH 6.7 9.0 93 A_24_P49260 NM_018327 SPTLC3 4.2 2.3 44 A_23_P41470 NM_017631 DDX60 6.6 24.4 94 A_23_P357284 NM_005282 GPR4 4.2 18.5 45 A_23_P374082 NM_033274 ADAM19 6.5 11.8 95 A_23_P50638 NM_052972 LRG1 4.2 4.4 46 A_23_P129133 NM_000275 OCA2 6.5 7.2 96 A_23_P135257 NM_002771 PRSS3 4.2 3.2 47 A_23_P380754 NM_002769 PRSS1 6.5 6.8 97 A_23_P121695 NM_006419 CXCL13 4.1 2.5 48 A_33_P3283611 NM_001289758 IFIT3 6.4 25.0 98 A_24_P862886 NM_000798 DRD5 4.1 5.7 49 A_23_P23074 NM_006417 IFI44 6.4 3.2 99 A_23_P120103 NM_002252 KCNS3 4.1 4.0 50 A_23_P81898 NM_006398 UBD 6.2 11.3 100 A_23_P330788 NM_015075 IQSEC2 4.1 10.4

7 continued

U266 MOSTI-1 U266 MOSTI-1 No. Probe ID Accession no. Gene symbol Fold Fold No. Probe ID Accession no. Gene symbol Fold Fold change change change change 101 A_24_P370472 NM_021983 HLA-DRB4 4.0 3.9 161 A_23_P373724 NM_003622 PPFIBP1 3.2 3.2 102 A_23_P109322 NM_006198 PCP4 4.0 9.3 162 A_23_P28948 NM_014012 REM1 3.1 3.3 103 A_23_P412515 NM_012129 CLDN12 3.9 2.6 163 A_23_P106194 NM_005252 FOS 3.1 2.9 104 A_24_P287043 NM_006435 IFITM2 3.9 4.3 164 A_23_P201459 NM_022873 IFI6 3.1 3.2 105 A_23_P124108 NM_000632 ITGAM 3.9 3.9 165 A_23_P19510 NM_001198858 HLA-DQB2 3.1 2.9 106 A_33_P3241204 NM_001129742 CALHM3 3.9 3.2 166 A_24_P941912 NM_138287 DTX3L 3.1 6.6 107 A_23_P6263 NM_002463 MX2 3.9 4.1 167 A_22_P00006736 NM_080546 SLC44A1 3.1 3.2 108 A_33_P3368750 NM_001104554 PAQR5 3.9 4.3 168 A_33_P3884230 NM_002501 NFIX 3.1 3.3 109 A_23_P8981 NM_000349 STAR 3.9 4.8 169 A_23_P42306 NM_006120 HLA-DMA 3.1 2.7 110 A_33_P3224710 NM_012252 TFEC 3.9 7.5 170 A_33_P3222451 NM_001278160 AKT1S1 3.1 10.8 111 A_33_P3307495 NM_001199042 STRA6 3.8 5.0 171 A_32_P62863 NM_014575 SCHIP1 3.1 3.7 112 A_23_P255444 NM_014395 DAPP1 3.8 6.6 172 A_23_P63379 NM_012113 CA14 3.1 4.0 113 A_23_P382188 NM_001013841 STAP2 3.8 3.7 173 A_32_P100830 NM_153209 KIF19 3.1 12.1 114 A_23_P61371 NM_198282 TMEM173 3.8 5.6 174 A_33_P3357530 NM_006598 SLC12A7 3.1 2.1 115 A_32_P179740 NM_020725 ATXN7L1 3.7 6.9 175 A_33_P3712008 AL512720 DKFZp547J222 3.0 2.3 116 A_32_P200238 NR_015379 UCA1 3.7 7.1 176 A_32_P19716 NM_001080470 ZNF697 3.0 5.3 117 A_32_P223017 NM_004672 MAP3K6 3.7 3.8 177 A_23_P259901 NM_012253 TKTL1 3.0 2.4 118 A_23_P23924 NM_001748 CAPN2 3.7 3.3 178 A_33_P3322804 NM_001291937 NTRK2 3.0 2.9 119 A_33_P3250820 NM_207361 FREM2 3.7 2.3 179 A_24_P329795 NM_007021 C10orf10 3.0 2.9 120 A_33_P3253234 NM_001243197 IQSEC2 3.7 29.3 180 A_23_P99642 NM_001126106 SLC7A7 3.0 2.3 121 A_32_P87697 NM_019111 HLA-DRA 3.7 3.6 181 A_24_P320103 NM_004991 MECOM 3.0 2.3 122 A_23_P60146 NM_006207 PDGFRL 3.6 4.9 182 A_24_P53215 NM_199242 UNC13D 3.0 2.0 123 A_33_P3358213 NM_207421 PADI6 3.6 3.5 183 A_23_P303833 NM_174934 SCN4B 3.0 4.7 124 A_23_P1782 NM_002231 CD82 3.6 5.0 184 A_23_P380208 NM_024621 VEPH1 2.9 4.4 125 A_24_P343233 NM_002124 HLA-DRB1 3.6 3.6 185 A_23_P94552 NM_013390 TMEM2 2.9 2.7 126 A_23_P62890 NM_002053 GBP1 3.6 5.8 186 A_33_P3400273 NM_000655 SELL 2.9 3.7 127 A_23_P93311 NM_013993 DDR1 3.6 4.2 187 A_24_P28722 NM_080657 RSAD2 2.9 11.2 128 A_23_P158708 NM_005215 DCC 3.6 3.3 188 A_24_P89891 NM_005658 TRAF1 2.9 2.9 129 A_23_P157299 NM_001129 AEBP1 3.6 4.7 189 A_33_P3271635 NM_002121 HLA-DPB1 2.8 3.3 130 A_23_P45099 NM_002125 HLA-DRB5 3.6 3.4 190 A_23_P256312 NM_002447 MST1R 2.8 2.5 131 A_24_P852756 NM_020056 HLA-DQA2 3.6 2.7 191 A_23_P13822 NM_018423 STYK1 2.8 5.6 132 A_33_P3383912 NM_022555 HLA-DRB3 3.5 3.7 192 A_33_P3418170 NM_014314 DDX58 2.8 3.5 133 A_33_P3360684 NM_001018070 CORO1B 3.5 3.2 193 A_23_P392476 NM_001145128 AK9 2.8 3.9 134 A_24_P45446 NM_052941 GBP4 3.5 2.5 194 A_23_P84576 NM_053034 ANTXR1 2.8 2.5 135 A_33_P3357573 NM_018717 MAML3 3.5 2.0 195 A_23_P140290 NM_021136 RTN1 2.8 2.1 136 A_23_P24716 NM_017870 TMEM132A 3.5 5.9 196 A_23_P112798 NM_001312 CRIP2 2.8 2.0 137 A_24_P303420 NR_026938 ADCY10P1 3.5 2.0 197 A_24_P342829 NM_152527 SLC16A14 2.8 4.0 138 A_23_P360316 NM_000149 FUT3 3.5 2.4 198 A_23_P57961 NM_002673 PLXNB1 2.8 2.0 139 A_23_P312150 NM_001956 EDN2 3.5 13.0 199 A_23_P49060 NM_181642 SPINT1 2.8 2.4 140 A_23_P12554 NM_016112 PKD2L1 3.5 5.5 200 A_24_P161018 NM_017554 PARP14 2.8 3.1 141 A_33_P3293049 NM_002122 HLA-DQA1 3.5 2.8 201 A_24_P148717 NM_001295 CCR1 2.8 7.8 142 A_23_P13772 NM_016569 TBX3 3.5 2.7 202 A_32_P47754 NM_001286233 SLC2A14 2.7 5.0 143 A_23_P136683 NM_001243961 HLA-DQB1 3.4 3.5 203 A_23_P422724 NM_000943 PPIC 2.7 4.0 144 A_33_P3355247 NM_015621 CCDC69 3.4 2.2 204 A_33_P3422968 NM_001370 DNAH6 2.7 3.8 145 A_23_P318420 NM_018704 CTTNBP2NL 3.4 2.4 205 A_24_P101651 NR_073432 CSAG4 2.7 2.3 146 A_23_P35349 NM_021738 SVIL 3.4 3.0 206 A_24_P169013 NR_001298 HLA-DRB6 2.7 4.2 147 A_23_P10194 NM_201575 SEZ6L2 3.4 12.5 207 A_23_P205370 NM_016150 ASB2 2.7 2.5 148 A_33_P3290343 NM_000104 CYP1B1 3.4 7.7 208 A_24_P17870 NR_040662 HCP5 2.7 4.3 149 A_33_P3344831 NM_018004 TMEM45A 3.3 4.5 209 A_23_P149189 NM_021186 ZP4 2.7 3.7 150 A_23_P331928 NM_133493 CD109 3.3 6.8 210 A_23_P112774 NM_032611 PTP4A3 2.6 2.5 151 A_23_P114299 NM_001504 CXCR3 3.3 2.3 211 A_33_P3309734 NM_152389 CCDC108 2.6 2.3 152 A_33_P3403576 NM_201563 FCGR2C 3.3 3.2 212 A_24_P11061 NM_153478 CSAG1 2.6 2.2 153 A_24_P288836 NR_001435 HLA-DPB2 3.3 3.5 213 A_23_P85240 NM_016562 TLR7 2.6 5.9 154 A_33_P3329013 NM_001050 SSTR2 3.3 3.4 214 A_23_P85716 NM_021642 FCGR2A 2.6 3.8 155 A_23_P380614 NM_006045 ATP9A 3.3 3.2 215 A_24_P340066 NM_001421 ELF4 2.6 3.7 156 A_33_P3372727 NM_003966 SEMA5A 3.3 5.1 216 A_23_P148879 NM_000702 ATP1A2 2.6 2.1 157 A_23_P73114 NM_000313 PROS1 3.3 4.3 217 A_23_P40174 NM_004994 MMP9 2.6 3.1 158 A_23_P30913 NM_033554 HLA-DPA1 3.2 3.4 218 A_23_P24784 NM_003282 TNNI2 2.6 2.9 159 A_23_P208866 NM_004877 GMFG 3.2 2.6 219 A_23_P155052 NM_030641 APOL6 2.6 2.3 160 A_23_P65918 NM_002220 ITPKA 3.2 2.8 220 A_33_P3347291 NM_001199219 INMT 2.6 2.6

8 continued

U266 MOSTI-1 U266 MOSTI-1 No. Probe ID Accession no. Gene symbol Fold Fold No. Probe ID Accession no. Gene symbol Fold Fold change change change change 221 A_23_P89902 NM_005619 RTN2 2.6 3.4 281 A_21_P0000044 NM_001164460 STEAP1B 2.2 2.8 222 A_23_P79221 NM_001105 ACVR1 2.6 5.1 282 A_23_P140648 NM_014608 CYFIP1 2.2 2.2 223 A_32_P166693 NM_020733 HEG1 2.6 2.3 283 A_23_P10025 NM_006159 NELL2 2.2 3.1 224 A_23_P413862 NM_020869 DCDC5 2.6 2.0 284 A_23_P500130 NM_153186 KANK1 2.2 4.3 225 A_33_P3351150 NM_022068 PIEZO2 2.6 2.1 285 A_23_P101564 NM_019113 FGF21 2.2 3.4 226 A_33_P3375145 NM_203403 LURAP1L 2.5 3.3 286 A_24_P301063 NM_018173 PLEKHG6 2.2 2.7 227 A_33_P3395008 NM_001142807 ACOXL 2.5 4.4 287 A_33_P3401826 NM_207315 CMPK2 2.2 2.4 228 A_33_P3346826 NM_001012633 IL32 2.5 3.5 288 A_24_P659836 NM_001123225 SYCE3 2.2 2.6 229 A_23_P157793 NM_001216 CA9 2.5 5.4 289 A_23_P430728 NM_000704 ATP4A 2.2 7.3 230 A_23_P8754 NM_005763 AASS 2.5 2.4 290 A_33_P3379967 NM_001098478 HLA-F 2.2 2.1 231 A_23_P160025 NM_005531 IFI16 2.5 2.0 291 A_24_P406334 NM_012449 STEAP1 2.2 3.2 232 A_33_P3315949 NM_001258397 CCDC103 2.5 2.0 292 A_33_P3393341 NM_001301860 LPIN3 2.2 4.1 233 A_23_P160318 NM_001856 COL16A1 2.5 3.3 293 A_23_P323761 NM_025228 TRAF3IP3 2.2 3.3 234 A_23_P312851 NM_006928 PMEL 2.5 2.4 294 A_23_P132378 NM_014246 CELSR1 2.2 3.1 235 A_33_P3339625 NM_013278 IL17C 2.5 3.1 295 A_23_P62115 NM_003254 TIMP1 2.2 3.1 236 A_23_P150018 NM_004419 DUSP5 2.5 2.3 296 A_23_P114057 NM_017789 SEMA4C 2.2 2.2 237 A_23_P9711 NM_006040 HS3ST4 2.5 2.4 297 A_33_P3227472 NM_138432 SDSL 2.2 2.5 238 A_23_P434398 NM_153235 TXLNB 2.5 2.4 298 A_23_P315571 NM_015150 RFTN1 2.2 3.4 239 A_23_P166775 NM_153461 IL17RC 2.5 3.0 299 A_32_P10396 NM_014991 WDFY3 2.2 2.6 240 A_23_P207564 NM_001291470 CCL4L2 2.5 2.2 300 A_23_P383986 NM_015892 CHST15 2.2 3.5 241 A_32_P48134 NR_002793 TPTE2P3 2.4 2.4 301 A_32_P181222 NM_002247 KCNMA1 2.2 2.8 242 A_23_P32805 NM_017551 GRID1 2.4 2.9 302 A_24_P20120 NM_018084 CCDC88A 2.2 2.2 243 A_33_P3279610 NM_005205 COX6A2 2.4 2.3 303 A_23_P407614 NM_152901 PYDC1 2.2 2.3 244 A_33_P3280147 NR_028337 FLJ45079 2.4 2.4 304 A_33_P3221253 NM_005578 LPP 2.2 3.1 245 A_23_P112187 NM_032843 FIBCD1 2.4 2.0 305 A_23_P16976 NM_001153 ANXA4 2.2 2.2 246 A_23_P83347 NM_145051 RNF183 2.4 2.7 306 A_23_P379649 NM_001003940 BMF 2.2 3.2 247 A_23_P202004 NM_020200 PRTFDC1 2.4 4.3 307 A_23_P119943 NM_000597 IGFBP2 2.2 3.1 248 A_23_P82929 NM_002514 NOV 2.4 3.1 308 A_24_P795371 NR_102743 NR2F2-AS1 2.2 3.5 249 A_23_P170733 NM_058172 ANTXR2 2.4 3.6 309 A_23_P206359 NM_004360 CDH1 2.1 2.5 250 A_23_P31064 NM_015529 MOXD1 2.4 2.3 310 A_23_P88069 NM_005780 LHFP 2.1 17.3 251 A_23_P413641 NM_020820 PREX1 2.4 4.9 311 A_23_P154235 NM_004688 NMI 2.1 2.1 252 A_23_P76529 NM_000889 ITGB7 2.4 2.0 312 A_23_P138725 NM_031484 MARVELD1 2.1 3.0 253 A_32_P209960 NM_000246 CIITA 2.4 2.3 313 A_23_P78595 NM_033543 CEACAM21 2.1 5.0 254 A_33_P3286278 NM_002087 GRN 2.4 2.7 314 A_24_P117147 NM_013289 KIR3DL1 2.1 2.2 255 A_23_P304682 NM_001424 EMP2 2.4 4.4 315 A_33_P3250083 NM_001136022 NFATC4 2.1 2.2 256 A_33_P3423365 NM_001127663 GSN 2.3 3.0 316 A_23_P257478 NM_000500 CYP21A2 2.1 2.3 257 A_33_P3229107 NM_001104548 MIR205HG 2.3 2.7 317 A_33_P3229918 NM_001243168 PTCRA 2.1 18.7 258 A_33_P3397763 NM_003811 TNFSF9 2.3 2.1 318 A_23_P41487 NM_015130 TBC1D9 2.1 2.3 259 A_23_P163820 NM_001080417 ZNF629 2.3 2.7 319 A_24_P79808 NM_020524 PBXIP1 2.1 2.7 260 A_24_P105391 NM_001017922 ERMAP 2.3 2.0 320 A_33_P3345011 NM_178525 ACTL9 2.1 2.4 261 A_33_P3305758 NM_001256140 CAPG 2.3 2.1 321 A_23_P166459 NM_002305 LGALS1 2.1 2.4 262 A_33_P3392892 NM_017886 ULK4 2.3 3.7 322 A_32_P123255 NM_001105576 SOWAHD 2.1 2.0 263 A_33_P3389286 NM_006142 SFN 2.3 2.2 323 A_33_P3345389 NM_001009984 C20orf194 2.1 2.0 264 A_33_P3353360 AK290580 BRK1 2.3 4.2 324 A_23_P34537 NM_000120 EPHX1 2.1 4.0 265 A_33_P3381666 NM_001130088 ABLIM2 2.3 2.3 325 A_23_P120822 NM_016327 UPB1 2.1 3.7 266 A_23_P38346 NM_024119 DHX58 2.3 2.5 326 A_33_P3355014 NM_182526 TMEM229B 2.1 2.0 267 A_23_P406025 NM_015225 PRUNE2 2.3 2.4 327 A_33_P3412975 NM_175875 SIX5 2.1 2.2 268 A_23_P135722 NM_001729 BTC 2.3 2.4 328 A_33_P3244784 NM_173600 MUC19 2.1 3.1 269 A_19_P00811178 NR_024607 MIR503HG 2.3 2.0 329 A_23_P207911 NM_016113 TRPV2 2.1 4.1 270 A_23_P85693 NM_004120 GBP2 2.3 6.6 330 A_33_P3413038 NM_001163257 PLXNB3 2.1 2.5 271 A_23_P70095 NM_001025158 CD74 2.3 2.2 331 A_24_P319647 NM_030764 FCRL2 2.1 5.1 272 A_23_P152620 NM_172088 TNFSF13 2.3 5.2 332 A_23_P19030 NM_001012301 ARSI 2.1 4.1 273 A_24_P280684 NM_016298 FBXO40 2.3 2.1 333 A_23_P157628 NM_004942 DEFB4A 2.1 2.0 274 A_23_P163455 NM_002373 MAP1A 2.3 4.6 334 A_23_P98410 NM_000073 CD3G 2.1 2.1 275 A_33_P3264042 NM_001144933 EFCAB3 2.3 2.2 335 A_23_P115064 NM_001878 CRABP2 2.0 4.3 276 A_24_P10233 NM_014326 DAPK2 2.3 5.2 336 A_33_P3247205 NM_022746 MARC1 2.0 2.5 277 A_33_P3237634 NM_004089 TSC22D3 2.3 2.7 337 A_23_P141992 NM_198706 HSD11B1L 2.0 2.1 278 A_23_P303548 NM_001256798 NOL4L 2.3 2.6 338 A_23_P76901 NM_015549 PLEKHG3 2.0 2.1 279 A_23_P16116 NM_016154 RAB4B 2.3 2.4 339 A_23_P146922 NM_000820 GAS6 2.0 2.1 280 A_23_P25615 NM_017826 SOHLH2 2.3 7.8 340 A_24_P40626 NM_022469 GREM2 2.0 2.1

9 continued

U266 MOSTI-1 U266 MOSTI-1 No. Probe ID Accession no. Gene symbol Fold Fold No. Probe ID Accession no. Gene symbol Fold Fold change change change change 341 A_33_P3237201 NM_001135805 SYT1 2.0 2.2 373 A_33_P3256510 NM_022055 KCNK12 -2.1 -2.2 342 A_23_P15357 NM_005567 LGALS3BP 2.0 3.0 374 A_33_P3315390 NM_001145399 MPPED2 -2.1 -5.2 343 A_23_P204751 NM_020039 ASIC1 2.0 3.6 375 A_23_P83838 NM_004056 CA8 -2.2 -2.4 344 A_23_P329870 NM_024599 RHBDF2 2.0 2.5 376 A_33_P3209025 NM_001082480 ZNF623 -2.2 -2.9 345 A_23_P204016 NM_000725 CACNB3 2.0 4.2 377 A_23_P107483 NM_012373 OR3A3 -2.2 -5.0 346 A_24_P109214 NM_001645 APOC1 2.0 2.7 378 A_23_P12884 NM_005308 GRK5 -2.2 -2.0 347 A_23_P52121 NM_002614 PDZK1 2.0 2.3 379 A_33_P3221114 NM_144720 JAKMIP1 -2.2 -2.3 348 A_33_P3301514 NM_001193582 NRCAM 2.0 2.0 380 A_33_P3423585 NM_001080534 UNC13C -2.2 -2.7 349 A_23_P355517 NM_024875 SYNPO2L 2.0 4.3 381 A_23_P69293 NM_018397 CHDH -2.3 -2.2 350 A_33_P3381092 NM_207374 OR10W1 2.0 2.3 382 A_23_P95536 NM_014269 ADAM29 -2.3 -3.1 351 A_33_P3240946 NM_001280544 DPF3 2.0 2.3 383 A_23_P154875 NM_012105 BACE2 -2.3 -2.6 352 A_23_P379054 NM_148960 CLDN19 2.0 4.8 384 A_24_P876408 NM_001144936 C11orf95 -2.3 -2.0 353 A_24_P8109 NM_001012302 ANO9 2.0 3.4 385 A_23_P74701 NM_152890 COL24A1 -2.4 -3.3 354 A_23_P29663 NM_015896 ZMYND10 2.0 2.5 386 A_33_P3220352 NM_001103176 CNPY1 -2.5 -2.3 355 A_23_P206371 NM_003946 NOL3 2.0 2.1 387 A_23_P156390 NM_014790 JAKMIP2 -2.5 -2.4 356 A_21_P0014085 NR_110154 ID2-AS1 2.0 2.6 388 A_33_P3321657 NM_001291860 HSPG2 -2.5 -3.3 357 A_33_P3269203 NM_001207014 SERPINH1 2.0 2.2 389 A_21_P0013271 NM_001195243 SMKR1 -2.5 -2.1 358 A_23_P140434 NM_018728 MYO5C 2.0 4.9 390 A_23_P150693 NM_014344 FJX1 -2.7 -3.9 359 A_21_P0012439 NM_014831 TRANK1 2.0 2.7 391 A_23_P1173 NM_004132 HABP2 -2.7 -2.1 360 A_33_P3380529 NM_001282786 PRTFDC1 2.0 2.5 392 A_23_P157338 NM_198570 VWC2 -2.9 -2.5 361 A_33_P3254380 NM_001257291 SLC9A7 2.0 2.1 393 A_33_P3320563 NM_001080489 GLOD5 -2.9 -3.0 362 A_23_P50907 NM_002210 ITGAV 2.0 2.5 394 A_33_P3285470 NM_001702 BAI1 -3.0 -4.3 363 A_24_P295590 NM_032023 RASSF4 2.0 3.5 395 A_23_P17130 NM_001042519 C2orf88 -3.3 -6.5 364 A_21_P0006580 NM_001257291 SLC9A7 2.0 2.4 396 A_23_P329768 NM_014668 GREB1 -3.6 -2.7 365 A_23_P359277 NM_024930 ELOVL7 2.0 2.2 397 A_23_P77000 NM_014909 VASH1 -3.6 -4.1 366 A_22_P00004542 NR_108043 PARD3-AS1 2.0 2.4 398 A_23_P171107 NM_033031 CCNB3 -4.1 -2.2 367 A_23_P121533 NM_012445 SPON2 -2.0 -2.1 399 A_21_P0003097 NR_108075 ITPR1-AS1 -4.2 -29.5 368 A_33_P3281985 NM_001006658 CR2 -2.0 -3.4 400 A_21_P0000023 NM_001159749 RIOK2 -4.4 -3.4 369 A_33_P3375467 NM_001503 GPLD1 -2.0 -4.8 401 A_33_P3246553 NM_000831 GRIK3 -5.4 -2.1 370 A_22_P00003277 NR_120496 CALML3-AS1 -2.1 -2.8 402 A_23_P19182 NM_016606 REEP2 -6.1 -5.0 371 A_24_P144377 NM_014015 DEXI -2.1 -3.5 403 A_23_P169351 NM_003026 SH3GL2 -9.1 -5.9 372 A_23_P67299 NM_020812 DOCK6 -2.1 -2.9 404 A_23_P320846 NM_153325 DEFB125 -10.2 -16.0

Supplementary Figure S1: Antitumor effect of LEN and POM on MM cell lines, MOSTI-1, U266, MM.1S, KMS-18, KMS-27 and RPMI8226 (A). Data are expressed as mean ± standard deviation of triplicate experiments. B, The IC50 values of LEN and POM in these MM cell lines were calculated using nonlinear regression.

Supplementary Figure S2: Relationship of POM sensitivity with CRBN expression. A, Protein expression of CRBN in MOSTI-1, U266, MM.1S, KMS-18, KMS-27 and RPMI8226 cells was analyzed by Western blot analysis. B, Correlation between PD-L1 induction by

POM and IC50 of POM in these MM cells. The x-axis represents the relative intensity of the

CRBN protein and the y-axis the IC50 of POM shown in Supplementary Fig. S1B. The relative intensity of CRBN to β-actin was calculated based on the signals of these proteins. Data on CRBN expression shown are representative of duplicate experiments.

Supplementary Figure S3: DNA copy numbers of PD-L1 in MM cell lines. Genomic DNA (gDNA) samples were extracted from MM cell lines. Copy numbers were detected by 2xTaqman Genotyping Master Mix in the human PD-L1 copy number assay (Hs00268713_cn), human RNase P and TaqMan Copy Number Reference Assay (#4403326; Thermo Fisher Scientific) performed using the ABI7500 Fast Real-Time PCR System (Thermo Fisher Scientific). The relative copy number of PD-L1 was normalized to RNase P, as a reference for known copy numbers. Data are expressed as mean ± standard deviation of duplicate experiments.

Supplementary Figure S4: The level of cell-surface expression of PD-L2 when MM cells were cultured with 10 µmol/L LEN or 1 µmol/L POM for 3 days. The upper panel represents the percentage of PD-L1-expressing MM cells, and the lower panel shows the relative MFI. Data are expressed as mean ± standard deviation of duplicate experiments.

Supplementary Figure S5: Cell-surface expression of BCMA and TACI on MOSTI-1 (A) and U266 cells (B) after 3-day cultivation with 1 µmol/L POM. Data are expressed as mean ± standard deviation of duplicate experiments.

Supplementary Figure S6: Enrichment plots for the gene sets of the MAPK/ERK pathway that were significantly upregulated in POM-treated MM cells compared with untreated cells. The probes differentially expressing more than 1.5 fold were analyzed using gene set enrichment analysis (GSEA) performed with the GSEA software (http://www.broadinsti tute.org/gsea). NOM, normal; FDR, false discovery rate; NES, normalized enrichment score.

Supplementary Figure S7: In vivo analysis using a murine xenograft model of human myeloma MM.1S cells inoculated into the flanks of NOG mice. When the tumor volume reached approximately 1,000 mm3 at day 38, NOG mice were received either vehicle (20% DMSO), 25 mg/kg of LEN orally daily for 12 days (blue arrows), or the combination of LEN with 100 µg anti-BCMA antibody intraperitoneally every 4 days (bule and red arrows).

Supplementary Figure S8: PD-L1 mRNA expression in CRBN-knockout and Ikaros- and Aiolos-knockdown cells after 3-day cultivation with 10 µmol/L LEN or 1 µmol/L POM. A, CRBN knockout in OPM2 cells (CRBN KO) was established by transfection with pX330 vector containing Cas9 gene and guide RNA of CRBN. Protein expression of CRBN (left panel) and mRNA of PD-L1 (right graph) are shown. B and C, mRNA expression of Ikaros/Aiolos (right figure) and PD-L1 (left graph) in Ikaros- (B) and Aiolos-knockdown (C) U266 cells (Ikaros.sh and Aiolos.sh, respectively).

Supplementary Figure S9: Ikaros binding sites in the promoter of the PD-L1 gene. A, Analysis of Ikaros binding in the human B cell line GM12878 by ChIP-seq from the ENCODE project. The mapping track of sequence reads at the PD-L1 locus is shown. Ikaros binding peaks in the upstream promoter region of PD-L1 are shown in the lower panel. Putative binding sites of Ikaros (A/GGGAA) are shown in the upper panel. B, Nucleotide sequence of the promoter region of human PD-L1 gene (350 bp upstream). The arrow indicates the translation start site. Underlined sequences are possible transcription factor-binding sites, and the yellow-highlighted sequence is a high-affinity Ikaros-binding site.

Supplementary Figure S10: Cell proliferation (A) and T-cell activation (B) of CD8+ T cells on day 4 when co-cultivation of T cells with untreated or LEN-pretreated U266 cells (U266 and U266LEN, respectively) was treated with durvalumab and LEN. A, Representative CFSE histograms of CD8+ T cells are shown in left. The right graph shows the percentage of cells divided into CD8+ T cells. B, Representative flow plots of CD45RO and CD25 expression, which are activation markers in CD8+ T cells (left). The right graph shows the percentage of double-positive CD45RO and CD25 in CD8+T cells. Data are expressed as mean ± standard deviation of triplicate experiments. *P<0.05; ** P<0.01.

Supplementary Figure S11: APRIL protein (upper panels) and mRNA expression (lower graphs) in CRBN-knockout and Ikaros- and Aiolos-knockdown MOSTI-1 cells (A, B, and C respectively) after 3-day cultivation with 1 µmol/L LEN or 10 µmol/L POM.