Supplementary information Overview Supplementary Materials and methods Supplementary Table S1: Cell characteristics and phenotypes of MM cell lines. Supplementary Table S2: Characteristics of patients with newly diagnosed MM in Figure 1H. Supplementary Table S3: Primer and shRNA sequence. Supplementary Table S4: Four hundred four genes differentially expressed in MM cell lines treated with or without POM. Supplementary Figure S1: Antitumor effect of LEN and POM on MM cell lines, MOSTI-1, U266, MM.1S, KMS-18, KMS-27 and RPMI8226. Supplementary Figure S2: Relationship of POM sensitivity with CRBN expression. Supplementary Figure S3: DNA copy numbers of PD-L1 in MM cell lines. Supplementary Figure S4: The level of cell-surface expression of PD-L2 when MM cells were cultured with 10 µmol/L LEN or 1 µmol/L POM for 3 days. Supplementary Figure S5: Cell-surface expression of BCMA and TACI on MM cell lines treated with IMiDs. Supplementary Figure S6: Enrichment plots for the gene sets of the MAPK/ERK pathway that were significantly upregulated in POM-treated MM cells compared with untreated cells. Supplementary Figure S7: In vivo analysis using a murine xenograft model of human myeloma MM.1S cells inoculated into the flanks of NOG mice. Supplementary Figure S8: PD-L1 mRNA expression in CRBN-knockout and Ikaros- and Aiolos-knockdown cells after 3-day cultivation with 10 µmol/L LEN or 1 µmol/L POM. Supplementary Figure S9: Ikaros binding sites in the promoter of the PD-L1 gene. Supplementary Figure S10: Cell proliferation and T-cell activation of CD8+ T cells on day 4 when co-cultivation of T cells with untreated or LEN-pretreated U266 cells was treated with durvalumab and LEN. Supplementary Figure S11: APRIL protein and mRNA expression in CRBN-knockout and Ikaros- and Aiolos-knockdown MOSTI-1 cells after 3-day cultivation with 1 µmol/L LEN or 10 µmol/L POM. 1 Supplementary Materials and methods Reagents THAL, LEN, and POM were purchased from Selleck Chemicals, reconstituted in dimethyl sulfoxide (DMSO), and stored at –20°C until use. Recombinant human APRIL was from PeproTech. Recombinant human transmembrane activator and CAML interactor (TACI), BCMA and PD-1 Fc chimera protein, and anti-human TACI and anti-human BCMA antibody were all from R&D Systems and used as blocking agents. Durvalumab was provided by Celgene. Anti-CD138 (clone MI15; FITC), anti-CD38 (HIT2; Brilliant Violet 421), anti-CD3 (UCHT1; Brilliant Violet 421), anti-CD14 (M5E2; Brilliant Violet 510), anti-CD45 (HI30; APC), anti-CD45RO (UCHL1; PE) and anti-CD25 (BC96; PE-Cy7; BioLegend), anti-CD4 (SK3; Brilliant Ultraviolet 395) and anti-CD8 (RPA-T8; APC; BD Biosciences), and anti-PD-L1 (MIH1; PE; Thermo Fisher Scientific) were used as FCM antibodies. Horseradish peroxidase (HRP)-conjugated anti-PD-L1 (#51296) and anti-β-actin (#5125), anti-CRBN (#71810), anti-Ikaros (#14859), anti-Aiolos (#15103), anti-Akt (#9272) and anti-phosho-Akt (#4060; Cell Signaling Technology Inc.), and anti-APRIL (ab200836; Abcam) were used as Western blotting antibodies. Promoter constructs and reporter assay DNA fragments of the PD-L1 promoter were amplified from human genomic DNA of MM cell lines using the primers shown in Supplementary Table S1. The amplified DNA products were cloned into the pGL3 firefly luciferase reporter vectors (Promega). The pGL3 promoter and pRL Renilla luciferase control reporter (Promega) vectors were transduced into HeLa cells by electroporation using the Neon transfection system (Thermo Fisher Scientific), and 24 h after transfection, the cells were treated with LEN or POM for 3 days, respectively. Firefly and Renilla luciferase activities were measured using the Dual-Glo luciferase assay system (Promega) according to the manufacturer’s instructions with an Imark microplate reader (Bio-Rad). Firefly luminescence from the pGL3 promoter vector was normalized to Renilla luciferase luminescence from the pRL vector to control for transfection efficiency. 2 Analysis of differential gene expression SurePrint G3 Human GE v3 8x60K microarrays (Agilent), which contained 62,972 probe sets (28,950 mRNAs), were used for mRNA expression profiling of untreated vs POM-treated U266 and MOSTI-1 cells. Then, 29,113 probes were filtrated with at least one present flag in 4 samples each from 62,972 probes, and additionally a total of 404 genes differentially expressed more than 2-fold between the two groups were identified as described in Supplementary Table S4. To perform gene ontology (GO) and pathway analyses, data of the 404 genes were analyzed using the online tool, PANTHER (http://geneontology.org/). Heatmaps were generated using Multiple Experiment Viewer software (MeV). Mixed lymphocyte–myeloma reaction CD3+ T cells were purified from PBMCs from healthy volunteers using the MojoSort human CD3 T cell isolation kit (BioLegend) according to the manufacturer’s instructions and then labeled with carboxyfluorescein diacetate succinimidyl ester (CFSE; BioLegend). The purity of the isolated cells was higher than 95% as determined in FCM. MM cell lines were pretreated with 1 µmol/L of POM for 3 days and subsequently irradiated with 20,000 rad. Then 1 × 105 CD3+ T cells were co-cultured with POM-treated or untreated MM cells in 96-well flat-bottomed plates with immobilized anti-CD3 plus 2 µg/mL anti-CD28 antibody (BioLegend) in the presence of POM. In some cultures, durvalumab was added to block the PD-1–PD-L1 pathway. IFN-γ production at 24 h post co-culture was confirmed using human IFN-γ-specific enzyme-linked immunosorbent assay (ELISA) kit (BioLegend). After 4 days, the CFSE-based proliferation assay and the expression assay of the T-cell activation marker was performed in CD4+ and CD8+ T cells using FCM. 3 Supplementary Table S1: Cell characteristics and phenotypes of MM cell lines. Cell lines MOSTI-1 U266 MM.1S KMS-18 KMS-27 RPMI 8226 OPM2 Tissue BM PB PB PB PB PB PB Ag 56 53 42 58 52 61 56 Gender M M F M M M F Ig Type IgG-λ IgE-λ IgA-λ IgA-λ to BJP-λ BJP-κ IgG-λ IgG-λ Chromosomal t(4;14) － t(14;16) t(14;16) t(11;14) － t(4;14) abnormalities t(6;14) Overexpressed MMSET MMSET Cyclin D3 Cyclin D3 Cyclin D2 Cyclin D1 Cyclin D2 genes Cyclin D3 Cyclin D3 HLA Aw19, B15, CD38+ CD138+ CD25+ CD28+ CD38+ B37, Cw2 CD138+ CD138+ CD38+ CD38+ CD38+ CD19- CD19- CD38+ Cell surface CD19- CD19- CD52+ CD19- CD54+ CD20- CD19- marker (CD) CD20- CD20- CD59+ CD20- CD7+ CD28+ CD20- CD34- CD34- CD56+ CD38+ CD34- CD56- HLA-DR+ CD49e+ HLA-DR- BM, bone marrow; PB, peripheral blood; M, male; F, female. 4 Supplementary Table S2: Characteristics of patients with newly diagnosed MM and MGUS in Figure 1G and 1H. MM/MGUS patients MM Pt#1 MM Pt#2 MM Pt#3 MM Pt#4 MM Pt#5 MGUS Gender F M F M F F Age 85 77 55 68 90 48 Diagnosis symptomatic symptomatic asymptomatic asymptomatic symptomatic asymptomatic ISS III - I II III I R-ISS II - I II III - DS II III I III II I Ig Type IgG-λ IgG-λ IgG-κ IgG-κ IgA-λ, BJP-λ IgA-λ Chromosomal aberration - - - - - - First-line Therapy BD Rd Rd→VRd→KRd Observation BD Observation Therapeutic response SD SD SD→SD→PR - VGPR - Plasma cells in BM (%) 25 49.2 20 10.8 16.7 4.9 PD-L1 expression (%)* 31.1 95.6 63.7 97.7 69.2 7 *PD-L1 expression at BM sample collection. ISS, International Staging System; R-ISS, Revised ISS; DS, Durie-Salmon stage; BD, bortezomib plus dexamethasone; Rd, lenalidomide plus dexamethasone; VRd, bortezomib, lenalidomide and dexamethasone; KRd, carfilzomib, lenalidomide and dexamethasone; SD, stable disease; PR, partial response; VGPR, very good partial response; BM, bone marrow. 5 Supplementary Table S3: Primer and shRNA sequence Gene Primer sequence (5'–3') Accession no. symbol Forward (upper)/reverse (lower) ACTB TGGCACCCAGCACAATGAA NM_001101.3 Real-time (β-actin) CTAAGTCATAGTCCGCCTAGAAGCA PCR GCTTTTCAATGTGACCAGCA NM_014143.4 PD-L1 TGGCTCCCAGAATTACCAAG GTATCCCTGGCAGAGTCTCC NM_003808.3 APRIL GAGGTGGCGTTAATGGGAAC Location of PD-L1 promoter PD-L1 TAGGTACCCCAATGCAAGGGCTATCTCA (–1013 to +1) promoter TCTCTCGAGCCCAAAGAA AGGGTGTAG Location of PD-L1 promoter PD-L1 CTGGTACCTCTGATAAAGGTTAAGGGGT Cloning (–353 to +1) promoter TCTCTCGAGCCCAAAGAA AGGGTGTAG GGATCCATGGATGCTGATGAGGGTCA NM_006060.6 IKZF1 GCGAATTCTTAGCTCATGTGGAAGCGGT shRNA target gene shRNA sequence (5'–3') CRBN AAGTGCCAGATATTTCCTTCA shRNA Ikaros GCTATCAATCATTAAGGTCAT Aiolos CGCCTAACAGATTGCTCTCAA 6 Supplementary Table S4: Four hundred four genes differentially expressed in MM cell lines treated with or without POM. A total of 404 genes differentially expressed more than 2-fold between POM-treated and untreated cells in both U266 cells and MOSTI-1 cell lines. Positive and negative values of the fold change indicate up-regulation and down-regulation, respectively, in POM-treated MM cells compared with untreated cells. U266 MOSTI-1 U266 MOSTI-1 No. Probe ID Accession no. Gene symbol Fold Fold No. Probe ID Accession no. Gene symbol Fold Fold change change change change 1 A_24_P945113 NM_000020 ACVRL1 40.1 25.2 51 A_23_P59261 NM_006670 TPBG 6.2 7.5 2 A_23_P103256 NM_021023 CFHR3 26.5 41.0 52 A_33_P3638471 BC027954 TRGV7 6.1 13.4 3 A_23_P137665 NM_001276 CHI3L1 21.2 27.5 53 A_32_P54274 NM_000798 DRD5 6.1 10.6 4 A_24_P190472 NM_003064 SLPI 18.6 103.8 54 A_33_P3405424 NM_152899 IL4I1 6.1 6.1 5 A_33_P3391915 NM_001080466 BTBD17 18.2 20.6 55 A_23_P135061 NM_003389 CORO2A 6.1 11.5 6 A_33_P3280845 NM_006288 THY1 18.1 5.8 56 A_24_P365322 NM_152601 ZNF709 5.9 2.3 7 A_23_P46356 NM_024575 TNFAIP8L2 17.6 2.3 57 A_23_P329375 NM_002702 POU6F1 5.9 6.2 8 A_33_P3312242 NM_005624 CCL25 16.5 7.1 58 A_33_P3281795 NM_007283 MGLL 5.9 7.3