DOCSLIB.ORG

Processing Epitope Precursor Recognition and Analogue Provides

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Processing Epitope Precursor Recognition and Analogue Provides The Journal of Immunology Crystal Structure of Insulin-Regulated Aminopeptidase with Bound Substrate Analogue Provides Insight on Antigenic Epitope Precursor Recognition and Processing Anastasia Mpakali,* Emmanuel Saridakis,* Karl Harlos,† Yuguang Zhao,† Athanasios Papakyriakou,* Paraskevi Kokkala,*,‡ Dimitris Georgiadis,‡ and Efstratios Stratikos* Aminopeptidases that generate antigenic peptides influence immunodominance and adaptive cytotoxic immune responses. The mechanisms that allow these enzymes to efficiently process a vast number of different long peptide substrates are poorly understood. In this work, we report the structure of insulin-regulated aminopeptidase, an enzyme that prepares antigenic epitopes for cross- presentation in dendritic cells, in complex with an antigenic peptide precursor analog. Insulin-regulated aminopeptidase is found in a semiclosed conformation with an extended internal cavity with limited access to the solvent. The N-terminal moiety of the peptide is located at the active site, positioned optimally for catalysis, whereas the C-terminal moiety of the peptide is stabilized along the extended internal cavity lodged between domains II and IV. Hydrophobic interactions and shape complementarity enhance peptide affinity beyond the catalytic site and support a limited selectivity model for antigenic peptide selection that may underlie the generation of complex immunopeptidomes. The Journal of Immunology, 2015, 195: 2842–2851. ytotoxic adaptive immune responses rely on the recogni- process, and present external Ags onto MHCI to allow cross-priming tion on the cell surface of complexes of MHC class I of naive CD8+ T cells (2). The cross-presentation pathway is key for C molecules (MHCI) with antigenic peptides. These peptides the immune defense against many viruses, bacteria, and tumors and are generated inside the cell by proteolytic digestion that often can help the immune system avoid immune evasion strategies. Fur- includesthetrimmingofoneormoreaminoacidsfromtheNterminus thermore, cross-presentation is important for inducing cytotoxic re- of antigenic peptide precursors to generate the mature antigenic sponses through vaccination, especially against tumors (3, 4). peptides (1). This trimming is performed by specialized intracellular Insulin-regulated aminopeptidase (IRAP; EC 3.4.11.3) is a aminopeptidases that generate or destroy MHCI peptide ligands and transmembrane enzyme localized in intracellular vesicles, which can therefore influence the generation of cytotoxic responses. In has been shown to generate antigenic peptides for MHCI for cross- conventional Ag presentation, somatic cells degrade intracellular presentation (5, 6). IRAP (also known as placental leucine amino- proteins and present derived antigenic peptides. In cross-presentation, peptidase and oxytocinase) also has other important biological specialized professional APCs such as dendritic cells (DCs) take up, functions, including the regulation of trafficking of the glucose transporter type 4, the control of oxytocin levels in pregnancy, and the regulation of brain oxytocin and vasopressin levels (7). The *National Center for Scientific Research Demokritos, Agia Paraskevi, Athens 15310, Greece; †Division of Structural Biology, Wellcome Trust Centre for Human Genetics, soluble domain of IRAP carries the aminopeptidase enzymatic ac- Oxford University, Oxford OX3 7BN, United Kingdom; and ‡Department of Chem- tivity and is highly homologous to two other intracellular amino- istry, University of Athens, Athens 15771, Greece peptidases that are important for Ag processing, namely endoplasmic ORCID: 0000-0002-3566-2309 (E.S.). reticulum aminopeptidase (ERAP)1 and ERAP2. The three ami- Received for publication May 13, 2015. Accepted for publication July 13, 2015. nopeptidases have been recently classified under the oxytocinase This work was supported by the European Union (European Social Fund) and Greek subfamily of M1 aminopeptidases and characterized to be primarily national funds through the Operational Program “Education and Lifelong Learning” responsible for antigenic peptide N-terminal trimming in the cell of the National Strategic Reference Framework: Research Funding Program of the General Secretariat for Research & Technology (Grant ERC-14). The research lead- (8). ERAP1 has been shown to be a critical editor of antigenic ing to these results has received support from the European Community’s Seventh peptides and its activity to influence the immunopeptidome and Framework Programme (FP7/2007-2013) under BioStruct-X (Grant Agreement N˚283570). K.H. was supported by the Medical Research Council, and the Wellcome concomitant cellular cytotoxic responses, as well as immunodo- Trust provided administrative support (Grant 075491/Z/04). minance (9, 10). Similarly, IRAP can generate correct-length an- The atomic coordinates and structure factors presented in this article have been tigenic peptides from precursors in vitro, but in distinct patterns submitted to the Protein Data Bank under accession numbers 4Z7I and 5C97 for compared with ERAP1, suggesting differences in specificity and the ligand-bound and ligand-free structure, respectively. mechanism (11). Several studies have suggested that Ag processing Address correspondence and reprint requests to Efstratios Stratikos, National Center can vary significantly between cells and inflammatory states, for Scientific Research Demokritos, Agia Paraskevi, Athens 15310, Greece. E-mail address: [email protected] or [email protected] complicating vaccine design (12–14). As a result, understanding The online version of this article contains supplemental material. the mechanism of antigenic peptide recognition by intracellular Abbreviations used in this article: DC, dendritic cell; ERAP, endoplasmic reticulum aminopeptidases is of great importance. ERAP1 and ERAP2 have aminopeptidase; hPhe, homophenylalanine; IRAP, insulin-regulated aminopeptidase; been shown to be polymorphic, and several single nucleotide PDB, Protein Data Bank; PEG, polyethylene glycol; SNP, single nucleotide poly- polymorphisms (SNPs) in these enzymes have been associated with morphism; TFA, trifluoroacetic acid. predisposition to disease, ranging from viral infections and cancer Copyright Ó 2015 by The American Association of Immunologists, Inc. 0022-1767/15/$25.00 to autoimmunity. These SNPs have been shown to affect enzymatic www.jimmunol.org/cgi/doi/10.4049/jimmunol.1501103 The Journal of Immunology 2843 activity, Ag generation, and cytotoxic responses [reviewed in (15– purification of the expressed protein. All DNA purifications were performed 17)] and to form specific disease-associated functionally distinct with electroelution and phenol/chloroform extraction and precipitated with allotypes (18, 19). Recently, two SNPs in IRAP have also been ethanol/sodium acetate. reported to associate with psoriasis and ankylosing spondylitis, Site-directed mutagenesis suggesting that IRAP polymorphic variation may also contribute to the pathogenesis of autoimmunity (20, 21). Mutagenesis reactions to generate the two SNPs in IRAP (A609Tand I166M) were performed using the Quickchange II kit (Agilent Technologies), To gain insight on the mechanism and determinants of Ag se- according to the manufacturer’s instructions. Primers were designed with the lection in cross-presentation by IRAP, we crystallized IRAP in the Quickchange PrimerDesigntool(http://www.genomics.agilent.com) and were absence and presence of a model antigenic peptide and solved the HPLC purified. The sequences of primers were (59-39) as follows: A609T structures to 3.4A˚ and 3.3A˚ , respectively. The peptide model was FW,GAAATGAGAACCATACTACACCCATCACCGAAGC; A609T REV, built on electron density extending from the catalytic site of the GCTTCGGTGATGGGTGTAGTATGGTTCTCATTTC; I166M FW, GTT- TCCATGGGCACAGATGAGGCTTCCCACTG; and I166M REV, CAGT- enzyme, along the central cavity toward the base of domain IV. The GGGAAGCCTCATCTGTGCCCATGGAAAC. overall conformation of IRAP, compared with the known structures of the homologous ERAP1, represents a semiclosed state, which Stable cell line generation and protein expression in forms an internal cavity with limited external solvent access. The mammalian cells peptide N terminus is anchored at the catalytic site, and its Stable cell lines were created with the help of construct pURD_hsIRAP, C-terminal half is lodged between domains II and IV, primarily because pURD is a stable cell line generation vector (23). Briefly, HEK 293S through hydrophobic interactions and space complementarity. GnTI(2) cells (23, 24) were cotransfected with pURD_hsPLPAP and Structural and biochemical analysis provide insight on the substrate a PhiC31 integrase expression vector (pgk-phic31). The polyclonal cell specificity of IRAP and on the mechanism by which it can process population resulting from puromycin (2 mg/ml) selection was used for the protein production. The secreted protein has additional amino acids from the a very large variety of peptide sequences, but also highlight signif- cloning vector, as follows: N-terminal ETG and C-terminal RTETSQVAPA icant mechanistic differences from ERAP1, a finding that may un- sequences (last nine residues are Rhodopsin 1D4 tag). For protein purifica- derlie differences in Ag processing in different cells. Structural tion, the conditioned media were passed through the anti-1D4 tag Ab (Uni- mapping and functional analysis of two disease-associated IRAP versity of British Columbia) covalently linked to Sepharose beads at 4˚C
Load more

Recommended publications
  • Costimulation of T-Cell Activation and Virus Production by B7 Antigen on Activated CD4+ T Cells from Human Immunodeficiency Virus Type 1-Infected Donors OMAR K
    Proc. Natl. Acad. Sci. USA Vol. 90, pp. 11094-11098, December 1993 Immunology Costimulation of T-cell activation and virus production by B7 antigen on activated CD4+ T cells from human immunodeficiency virus type 1-infected donors OMAR K. HAFFAR, MOLLY D. SMITHGALL, JEFFREY BRADSHAW, BILL BRADY, NITIN K. DAMLE*, AND PETER S. LINSLEY Bristol-Myers Squibb Pharmaceutical Research Institute, Seattle, WA 98121 Communicated by Leon E. Rosenberg, August 3, 1993 (receivedfor review April 29, 1993) ABSTRACT Infection with the human immunodeficiency sequence (CTLA-4) (34), a protein structurally related to virus type 1 (HIV-1) requires T-cefl activation. Recent studies CD28 but only expressed on T cells after activation (12). have shown that interactions of the T-lymphocyte receptors CTLA-4 acts cooperatively with CD28 to bind B7 and deliver CD28 and CTLA-4 with their counter receptor, B7, on antigen- T-cell costimulatory signals (13). presenting cells are required for optimal T-cell activation. Here Because of the importance of the CD28/CTLA-4 and B7 we show that HIV-1 infection is associated with decreased interactions in immune responses, it is likely that these expression of CD28 and increased expression of B7 on CD4+ interactions are also important during HIV-1 infection. Stud- T-cell lines generated from seropositive donors by afloantigen ies with anti-CD28 monoclonal antibodies (mAbs) suggested stimulation. Loss of CD28 expression was not seen on CD4+ a role for CD28 in up-regulating HIV-1 long terminal repeat- T-ceU lines from seronegative donors, but up-regulation of B7 driven transcription of a reporter gene in leukemic cell lines expression was observed upon more prolonged culture.
    [Show full text]
  • Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse
    Welcome to More Choice CD Marker Handbook For more information, please visit: Human bdbiosciences.com/eu/go/humancdmarkers Mouse bdbiosciences.com/eu/go/mousecdmarkers Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse CD3 CD3 CD (cluster of differentiation) molecules are cell surface markers T Cell CD4 CD4 useful for the identification and characterization of leukocytes. The CD CD8 CD8 nomenclature was developed and is maintained through the HLDA (Human Leukocyte Differentiation Antigens) workshop started in 1982. CD45R/B220 CD19 CD19 The goal is to provide standardization of monoclonal antibodies to B Cell CD20 CD22 (B cell activation marker) human antigens across laboratories. To characterize or “workshop” the antibodies, multiple laboratories carry out blind analyses of antibodies. These results independently validate antibody specificity. CD11c CD11c Dendritic Cell CD123 CD123 While the CD nomenclature has been developed for use with human antigens, it is applied to corresponding mouse antigens as well as antigens from other species. However, the mouse and other species NK Cell CD56 CD335 (NKp46) antibodies are not tested by HLDA. Human CD markers were reviewed by the HLDA. New CD markers Stem Cell/ CD34 CD34 were established at the HLDA9 meeting held in Barcelona in 2010. For Precursor hematopoetic stem cell only hematopoetic stem cell only additional information and CD markers please visit www.hcdm.org. Macrophage/ CD14 CD11b/ Mac-1 Monocyte CD33 Ly-71 (F4/80) CD66b Granulocyte CD66b Gr-1/Ly6G Ly6C CD41 CD41 CD61 (Integrin b3) CD61 Platelet CD9 CD62 CD62P (activated platelets) CD235a CD235a Erythrocyte Ter-119 CD146 MECA-32 CD106 CD146 Endothelial Cell CD31 CD62E (activated endothelial cells) Epithelial Cell CD236 CD326 (EPCAM1) For Research Use Only.
    [Show full text]
  • Papers J Clin Pathol: First Published As 10.1136/Jcp.49.7.539 on 1 July 1996
    Clin Pathol 1996;49:539-544 539 Papers J Clin Pathol: first published as 10.1136/jcp.49.7.539 on 1 July 1996. Downloaded from Differential expression of T cell antigens in normal peripheral blood lymphocytes: a quantitative analysis by flow cytometry L Ginaldi, N Farahat, E Matutes, M De Martinis, R Morilla, D Catovsky Abstract diagnosis by comparison with findings in Aims-To obtain reference values of the normal counterparts. level of expression of T cell antigens on ( Clin Pathol 1996;49:539-544) normal lymphocyte subsets in order to disclose differences which could reflect Keywords: flow cytometry, T cell antigens, peripheral their function or maturation stages, or blood lymphocytes. both. Methods-Peripheral blood from 15 healthy donors was processed by flow The most common use of flow cytometry is to cytometry with triple colour analysis. For determine the percent of "positive" or "nega- each sample phycoerythrin (PE) conju- tive" cells for each antigen in different cell gated CD2, CD4, CD5, CD8, and CD56 populations. However, valuable information is monoclonal antibodies were combined lost when the relative intensities of the positive with Cy5-R-phycoerythrin (TC) conju- cells, reflecting antigenic densities, are not considered. A cell population with a well gated CD3 and fluorescein isothiocyanate http://jcp.bmj.com/ (FITC) conjugated CD7; CD2- and defined phenotype, positive for one antigen, CD7-PE were also combined with might be heterogeneous with regard to its level CD3-TC and CD4-FITC. Standard mi- of expression. This may reflect different crobeads with different capacities to bind functional or maturational states, or both, or mouse immunoglobulins were used to identify subpopulations on the basis of the dif- convert the mean fluorescence intensity ferent numbers of molecules of antigen per cell.
    [Show full text]
  • CD18) in a Patient with Leukocyte Adhesion Molecule (Leu-CAM) Deficiency
    Point mutations impairing cell surface expression of the common beta subunit (CD18) in a patient with leukocyte adhesion molecule (Leu-CAM) deficiency. M A Arnaout, … , D G Tenen, D M Fathallah J Clin Invest. 1990;85(3):977-981. https://doi.org/10.1172/JCI114529. Research Article The leukocyte adhesion molecules CD11a/CD18, CD11b/CD18, and CD11c/CD18 (Leu-CAM) are members of the integrin receptor family and mediate crucial adhesion-dependent functions in leukocytes. The molecular basis for their deficient cell surface expression was sought in a patient suffering from severe and recurrent bacterial infections. Previous studies revealed that impaired cell surface expression of Leu-CAM is secondary to heterogeneous structural defects in the common beta subunit (CD18). Cloning and sequencing of complementary DNA encoding for CD18 in this patient revealed two mutant alleles, each representing a point mutation in the coding region of CD18 and resulting in an amino acid substitution. Each mutant allele results in impaired CD18 expression on the cell surface membrane of transfected COS M6 cells. One substitution involves an arginine residue (Arg593----cysteine) that is conserved in the highly homologous fourth cysteine-rich repeats of other mammalian integrin subfamilies. The other substitution involves a lysine residue (Lys196----threonine) located within another highly conserved region in integrins. These data identify crucial residues and regions necessary for normal cell surface expression of CD18 and possibly other integrin beta subunits and define a molecular basis for impaired cell surface expression of CD18 in this patient. Find the latest version: https://jci.me/114529/pdf Rapid Publication Point Mutations Impairing Cell Surface Expression of the Common ,B Subunit (CD18) in a Patient with Leukocyte Adhesion Molecule (Leu-CAM) Deficiency M.
    [Show full text]
  • The Immunological Synapse and CD28-CD80 Interactions Shannon K
    © 2001 Nature Publishing Group http://immunol.nature.com ARTICLES The immunological synapse and CD28-CD80 interactions Shannon K. Bromley1,Andrea Iaboni2, Simon J. Davis2,Adrian Whitty3, Jonathan M. Green4, Andrey S. Shaw1,ArthurWeiss5 and Michael L. Dustin5,6 Published online: 19 November 2001, DOI: 10.1038/ni737 According to the two-signal model of T cell activation, costimulatory molecules augment T cell receptor (TCR) signaling, whereas adhesion molecules enhance TCR–MHC-peptide recognition.The structure and binding properties of CD28 imply that it may perform both functions, blurring the distinction between adhesion and costimulatory molecules. Our results show that CD28 on naïve T cells does not support adhesion and has little or no capacity for directly enhancing TCR–MHC- peptide interactions. Instead of being dependent on costimulatory signaling, we propose that a key function of the immunological synapse is to generate a cellular microenvironment that favors the interactions of potent secondary signaling molecules, such as CD28. The T cell receptor (TCR) interaction with complexes of peptide and as CD2 and CD48, which suggests that CD28 might have a dual role as major histocompatibility complex (pMHC) is central to the T cell an adhesion and a signaling molecule4. Coengagement of CD28 with response. However, efficient T cell activation also requires the partici- the TCR has a number of effects on T cell activation; these include pation of additional cell-surface receptors that engage nonpolymorphic increasing sensitivity to TCR stimulation and increasing the survival of ligands on antigen-presenting cells (APCs). Some of these molecules T cells after stimulation5. CD80-transfected APCs have been used to are involved in the “physical embrace” between T cells and APCs and assess the temporal relationship of TCR and CD28 signaling, as initiat- are characterized as adhesion molecules.
    [Show full text]
  • (12) United States Patent (405
    USOO6291239B1 (12) United States Patent (10) Patent No.: US 6,291,239 B1 Prodinger et al. (45) Date of Patent: Sep. 18, 2001 (54) MONOCLONAL ANTIBODY Recess Formed Between SCR1 and SCR 2 of Complement Receptor Type Two', Prodinger. (76) Inventors: Wolfgang Prodinger, Kirschentalgasse Immunopharmacology, vol. 38, No. 1-2, Dec., 1997, pp. 16, A-6020 Innsbruck; Michael 141-148, XP002089604, “Expression in Insect Cells of the Schwendinger, Semmelweisgasse 4, Functional Domain of CD21 (Complement Receptor Type A-7100 Neusiedl/See, both of (AT) Two) as a Truncated... ", Prodinger. Journal of Immunology, vol. 156, No. 7 Apr. 1, 1996, pp. (*) Notice: Subject to any disclaimer, the term of this 2580–2584, XP002089605, “Ligation of the Functional patent is extended or adjusted under 35 Domain of Complement Receptor Type 2 (CR2, CD21) is U.S.C. 154(b) by 0 days. Relevant for Complex . , Prodinger. Journal of Immunology, vol. 154, No. 10, May 15, 1995, pp. (21) Appl. No.: 09/276,296 5426–5435, XP002089606, “Characterization of a Comple (22) Filed: Mar. 25, 1999 ment Receptor 2 (CR2, CD21) Ligand Binding Site for C3”, H. Molina et al. (51) Int. Cl. ............................... C12N 5/06; C12O 1/70; Journal of Immunology, vol. 161, Nov. 1, 1998, pp. G01N 33/53; CO7K 16/00; A61K 39/395 4604–4610, XP002089607, “Characterization of C3dg Binding to a Recess Formed Between Short Consensus (52) U.S. Cl. ............................ 435/339.1; 435/5; 435/7.1; Repeats 1 and 2 ... ', Prodinger. 435/334; 530/388.1; 530/388.35; 424/141.1; 424/143.1; 424/159.1 Primary Examiner Hankyel T.
    [Show full text]
  • CD20-Positive Peripheral T-Cell Lymphoma: Report of a Case After Nodular Sclerosis Hodgkin’S Disease and Review of the Literature Renee L
    CD20-Positive Peripheral T-Cell Lymphoma: Report of a Case after Nodular Sclerosis Hodgkin’s Disease and Review of the Literature Renee L. Mohrmann, M.D., Daniel A. Arber, M.D. Division of Pathology, City of Hope National Medical Center, Duarte, California CASE REPORT We present a case of peripheral T-cell lymphoma co-expressing CD3 and CD20, as well as demon- A 47-year-old man presented in 1993 with a brief strating T-cell receptor gene rearrangement, in a history of right axillary lymph node enlargement patient who had been diagnosed with nodular scle- and mild fatigue. Biopsy showed nodular sclerosis rosis Hodgkin’s disease 5 years previously. Although Hodgkin’s disease. He was treated with six courses 15 cases of CD20-positive T-cell neoplasms have of mechlorethamine, vincristine, procarbazine, been previously reported in the literature, this is the prednisone/doxorubicin, bleomycin, vinblastine first report of CD20-positive T-cell lymphoma oc- chemotherapy over a period of 6 months. Clinical curring subsequent to treatment of Hodgkin’s dis- remission was achieved for 5 years. In early 1998, the patient noticed enlargement of lymph nodes in ease. The current case affords an opportunity to the posterior cervical region, which were followed review the rarely reported expression of CD20 in clinically for several months. Weight loss of 15 lbs., T-cell neoplasms as well as the relationship between fatigue, and flu-like symptoms ensued. The lymph Hodgkin’s disease and subsequently occurring non- nodes became firmer to palpation and were biop- Hodgkin’s lymphomas. In addition, the identifica- sied, showing peripheral T-cell lymphoma, diffuse tion of this case supports the suggestion that the use large-cell type.
    [Show full text]
  • Immunological Synapse Formation Licenses CD40-CD40L Accumulations at T-APC Contact Sites1
    The Journal of Immunology Immunological Synapse Formation Licenses CD40-CD40L Accumulations at T-APC Contact Sites1 Judie Boisvert, Samuel Edmondson, and Matthew F. Krummel2 The maintenance of tolerance is likely to rely on the ability of a T cell to polarize surface molecules providing “help” to only specific APCs. The formation of a mature immunological synapse leads to concentration of the TCR at the APC interface. In this study, we show that the CD40-CD154 receptor-ligand pair is also highly concentrated into a central region of the synapse on mouse lymphocytes only after the formation of the TCR/CD3 c-SMAC. Concentration of this ligand was strictly dependent on TCR recognition, the binding of ICAM-1 to T cell integrins and the presence of an intact cytoskeleton in the T cells. This may provide a novel explanation for the specificity of T cell help directing the help signal to the site of Ag receptor signal. It may also serve as a site for these molecular aggregates to coassociate and/or internalize alongside other signaling receptors. The Journal of Im- munology, 2004, 173: 3647–3652. uring the onset and propagation of immune responses, T Interactions of T cells with Ag-bearing APCs is associated with cells send and receive signals via Ag-dependent and Ag- a coalescence of TCRs, other related receptors such as CD2, CD4, independent ligands. Whereas peptide-class II MHC CD28, and signaling molecules such as p56lck, fyn, linker for ac- D ϩ complexes on APC are recognized by the TCR on CD4 helper T tivation of T cells, and protein kinase C␪ into the central portion of cells, separate cell surface receptors modulate T cell-APC inter- an “immunological synapse” (15–23).
    [Show full text]
  • Efficient Generation of Human Natural Killer Cell Lines by Viral Transformation
    Letters to the Editor 192 2 Department of Immunology, Erasmus MC, Erasmus University selected children with hypoplastic refractory cytopenia. Haematologica 2007; 92: Medical Center, Rotterdam, The Netherlands; 397–400. 3Department of Pediatrics and Adolescent Medicine, Division of 4 Dunn DE, Tanawattanacharoen P, Boccuni P, Nagakura S, Green SW, Kirby MR Pediatric Hematology and Oncology, University of Freiburg, et al. Paroxysmal nocturnal hemoglobinuria cells in patients with bone marrow Freiburg, Germany; failure syndromes. Ann Intern Med 1999; 131: 401–408. 4Department of Pathology, Clinical Centre South West, Bo¨blingen 5 Maciejewski JP, Follmann D, Nakamura R, Saunthararajah Y, Rivera CE, Simonis T et al. Increased frequency of HLA-DR2 in patients with paroxysmal nocturnal Clinics, Bo¨blingen, Germany; 5 hemoglobinuria and the PNH/aplastic anemia syndrome. Blood 2001; 98: Department of Clinical Genetics, Erasmus MC, Erasmus University 3513–3519. Medical Center, Rotterdam, The Netherlands; 6 Wang H, Chuhjo T, Yasue S, Omine M, Nakao S. Clinical significance of a minor 6 St. Anna Children’s Hospital and Children’s Cancer Research Institute, population of paroxysmal nocturnal hemoglobinuria-type cells in bone marrow Department of Pediatrics, Medical University of Vienna, failure syndrome. Blood 2002; 100: 3897–3902. Vienna, Austria; 7 Yoshida N, Yagasaki H, Takahashi Y, Yamamoto T, Liang J, Wang Y et al. 7Department of Pediatrics, Aarhus University Hospital Skejby, Clinical impact of HLA-DR15, a minor population of paroxysmal Aarhus, Denmark; nocturnal haemoglobinuria-type cells, and an aplastic anaemia-associated auto- 8Department of Pediatric Hematology-Oncology, IRCCS Ospedale antibody in children with acquired aplastic anaemia. Br J Haematol 2008; 142: 427–435.
    [Show full text]
  • And CD28 (T P44) Induces Autocrine Interleukin 2/Interleukin 2 Receptor-Mediated Cell Proliferation
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by PubMed Central A NOVEL ACTIVATION PATHWAY FOR MATURE THYMOCYTES Costimulation of CD2 (T,p50) and CD28 (T p44) Induces Autocrine Interleukin 2/Interleukin 2 Receptor-mediated Cell Proliferation By SOO YOUNG YANG, STEPHEN M. DENNING,' SHINICHI MIZUNO, BO DUPONT, AND BARTON F. HAYNES* From the Laboratories of Human and Biochemical Immunogenetics, Sloan-Kettering Institute for Cancer Research, New York, New York 10021; and the "Department of Medicine, Division of Rheumatology, Immunology, and Cardiology, Duke University School of Medicine, Durham, North Carolina 27710 Bone marrrow-derived T progenitor cells undergo proliferation and maturation under the influence of the thymic microenvironment (1). Only a small fraction of thymocytes are selected to account for self tolerance, as well as self restriction, and become immunocompetent T cells (2). The molecular and cellular mechanisms for the growth and maturation of thymocytes are poorly understood. Cell surface phenotype analyses have shown that thymocytes are composed ofhighly heterogeneous populations. Based on cell surface expression of the TCR accessory molecules CD4 and CD8, thymocytes can be divided into three major subpopula- tions, which generally are thought to relate to maturation stages. They are the CD2+CD1 - CD4- 8- (double-negative) cells, CD2'CD1'CD4'8' (double-positive) cells, and CD2' CDl - CD4' 8- or CD2' CDl - CD4- 8' (single-positive) mature thymocytes. Both double-negative and double-positive thymocytes are immature cells located in the cortical compartment of human thymus (3). Mature thymocytes do not express the cortical specific marker CD1 but express TCRA and B chain subunits associated with the CD3 complex and reside predominantly in the medullary com- partment (4) .
    [Show full text]
  • Integrins As Therapeutic Targets: Successes and Cancers
    cancers Review Integrins as Therapeutic Targets: Successes and Cancers Sabine Raab-Westphal 1, John F. Marshall 2 and Simon L. Goodman 3,* 1 Translational In Vivo Pharmacology, Translational Innovation Platform Oncology, Merck KGaA, Frankfurter Str. 250, 64293 Darmstadt, Germany; [email protected] 2 Barts Cancer Institute, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK; [email protected] 3 Translational and Biomarkers Research, Translational Innovation Platform Oncology, Merck KGaA, 64293 Darmstadt, Germany * Correspondence: [email protected]; Tel.: +49-6155-831931 Academic Editor: Helen M. Sheldrake Received: 22 July 2017; Accepted: 14 August 2017; Published: 23 August 2017 Abstract: Integrins are transmembrane receptors that are central to the biology of many human pathologies. Classically mediating cell-extracellular matrix and cell-cell interaction, and with an emerging role as local activators of TGFβ, they influence cancer, fibrosis, thrombosis and inflammation. Their ligand binding and some regulatory sites are extracellular and sensitive to pharmacological intervention, as proven by the clinical success of seven drugs targeting them. The six drugs on the market in 2016 generated revenues of some US$3.5 billion, mainly from inhibitors of α4-series integrins. In this review we examine the current developments in integrin therapeutics, especially in cancer, and comment on the health economic implications of these developments. Keywords: integrin; therapy; clinical trial; efficacy; health care economics 1. Introduction Integrins are heterodimeric cell-surface adhesion molecules found on all nucleated cells. They integrate processes in the intracellular compartment with the extracellular environment. The 18 α- and 8 β-subunits form 24 different heterodimers each having functional and tissue specificity (reviewed in [1,2]).
    [Show full text]
  • Role of the Cd40-Cd40 Ligand Interaction in Cd4(+) T Cell Activation of Monocyte Interleukin-1 Synthesis David H
    East Tennessee State University Digital Commons @ East Tennessee State University Electronic Theses and Dissertations Student Works December 1994 Role of the Cd40-cd40 Ligand Interaction in Cd4(+) T Cell Activation of Monocyte Interleukin-1 Synthesis David H. Wagner East Tennessee State University Follow this and additional works at: https://dc.etsu.edu/etd Part of the Immunology and Infectious Disease Commons Recommended Citation Wagner, David H., "Role of the Cd40-cd40 Ligand Interaction in Cd4(+) T Cell Activation of Monocyte Interleukin-1 Synthesis" (1994). Electronic Theses and Dissertations. Paper 2816. https://dc.etsu.edu/etd/2816 This Dissertation - Open Access is brought to you for free and open access by the Student Works at Digital Commons @ East Tennessee State University. It has been accepted for inclusion in Electronic Theses and Dissertations by an authorized administrator of Digital Commons @ East Tennessee State University. For more information, please contact [email protected]. INFORMATION TO USERS This manuscript has been reproduced from the microfilm master. UMI films the text directly from the original or copy submined. Thus, some thesis and dissertation copies are in typewriter face, while others may be from any type of computer printer. Hie quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleed through, substandard margins, and improper alignment can adversely afreet reproduction. In the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion.
    [Show full text]