Received: 6 July 2017 | Accepted: 4 November 2017 DOI: 10.1111/zsc.12266

ORIGINAL ARTICLE

Evolutionary history of spiny-­tailed lizards (Agamidae: Uromastyx) from the Saharo-­Arabian region

Karin Tamar1 | Margarita Metallinou1† | Thomas Wilms2 | Andreas Schmitz3 | Pierre-André Crochet4 | Philippe Geniez5 | Salvador Carranza1

1Institute of Evolutionary Biology (CSIC- Universitat Pompeu Fabra), Barcelona, The subfamily Uromastycinae within the Agamidae is comprised of 18 species: three Spain within the genus Saara and 15 within Uromastyx. Uromastyx is distributed in the 2Allwetterzoo Münster, Münster, Germany desert areas of North Africa and across the Arabian Peninsula towards Iran. The 3Department of Herpetology & systematics of this genus has been previously revised, although incomplete taxo- Ichthyology, Natural History Museum of nomic sampling or weakly supported topologies resulted in inconclusive relation- Geneva (MHNG), Geneva, Switzerland ships. Biogeographic assessments of Uromastycinae mostly agree on the direction of 4CNRS-UMR 5175, Centre d’Écologie Fonctionnelle et Évolutive (CEFE), dispersal from Asia to Africa, although the timeframe of the cladogenesis events has Montpellier, France never been fully explored. In this study, we analysed 129 Uromastyx specimens from 5 EPHE, CNRS, UM, SupAgro, IRD, across the entire distribution range of the genus. We included all but one of the rec- INRA, UMR 5175 Centre d’Écologie Fonctionnelle et Évolutive (CEFE), PSL ognized taxa of the genus and sequenced them for three mitochondrial and three Research University, Montpellier, France nuclear markers. This enabled us to obtain a comprehensive multilocus time-­ calibrated phylogeny of the genus, using the concatenated data and species trees. We Correspondence Karin Tamar, Institute of Evolutionary also applied coalescent-­based species delimitation methods, phylogenetic network Biology (CSIC-Universitat Pompeu Fabra), analyses and model-testing­ approaches to biogeographic inferences. Our results re- Barcelona, Spain. vealed Uromastyx as a monophyletic genus comprised of five groups and 14 inde- Email: [email protected] pendently evolving lineages, corresponding to the 14 currently recognized species Funding information Uromastyx Secretaria d’Universitats i Recerca del sampled. The onset of diversification is estimated to have occurred in Departament d’Economia i Coneixement de south-­west Asia during the Middle Miocene with a later radiation in North Africa. la Generalitat de Catalunya, Grant/Award During its Saharo-Arabian­ colonization, Uromastyx underwent multiple vicariance Number: 2014-SGR-1532; Ministerio de Economía y Competitividad, Spain and dispersal events, hypothesized to be derived from tectonic movements and habi- (cofunded by FEDER), Grant/Award tat fragmentation due to the active continental separation of Arabia from Africa and Number: CGL2015-70390-P the expansion and contraction of arid areas in the region.

KEYWORDS agamids, Arabia, biogeography, multilocus phylogeny, reptiles, systematics

1 | INTRODUCTION two genera, Saara Gray, 1845 (three species; Irano-­Turanian region; Iraq, Iran, Afghanistan, Pakistan, and India) and The Uromastycinae Theobald, 1868 is a subfamily within Uromastyx Merrem, 1820 (15 species; Saharo-­Arabian re- Agamidae, distributed in the desert belt of the Old World, gion; from the Atlantic coast of north-­west Africa to Iran) and is phylogenetically the sister subfamily to the rest of the (Sindaco & Jeremčenko, 2008; Uetz, Freed, & Hzrošek, Agamid taxa (Macey et al., 2000; Pyron, Burbrink, & Wiens, 2017; Wilms, 2005; Wilms, Böhme, Wagner, Lutzmann, 2013; Townsend et al., 2011). This subfamily is comprised of & Schmitz, 2009). Uromastycinae members are commonly called spiny-tailed­ lizards due to the shape of their tail cov- †Deceased July 2015. ered by spiny scales arranged in distinct whorls. The two

Zoologica Scripta. 2018;47:159–173. wileyonlinelibrary.com/journal/zsc © 2017 Royal Swedish Academy of Sciences | 159 160 | TAMAR et al. genera, Saara and Uromastyx, are differentiated by the pres- partially established in the previously mentioned studies, ence or absence of intercalaries between the tail whorls, re- although incomplete taxonomic sampling or several weakly spectively (Wilms, 2005; Wilms et al., 2009). Spiny-­tailed supported topologies resulted in inconclusive relationships. lizards are ground dwelling or saxicolous, predominantly The biogeographic history of Uromastycinae in general herbivorous, characterized by their medium to large size, and that of Uromastyx in particular was evaluated in several their spiny whorled tail and a distinctive diagnostic denti- studies, suggesting a general dispersal from east to west (e.g., tion (Moody, 1980; Wilms, 2005). These lizards have a stout Amer & Kumazawa, 2005a; Moody, 1980; Wilms et al., depressed habitus with stubby limbs, and their body is usu- 2009). From central or southern Asia, Uromastycinae dis- ally covered with small homogeneous scales, although some persed westwards into south-western­ Asia, Arabia and North members have additional scattered tubercular scales (Wilms, Africa, most likely during the Eocene–Oligocene onwards, 2005; Wilms & Böhme, 2001). Uromastycinae members with the progression of suitable arid habitats in these regions. have long been a part of the reptile pet trade, with reports Although the direction of this divergence from Asia to Africa dating to the 19th century (e.g., von Fischer, 1885). These liz- is agreed upon by most studies, the timeframe of these cladoge- ards are registered in appendix II of CITES (www.cites.org) netic events has never been fully explored. Divergence-time­ due to their extensive collection for food, medicine, and local estimates targeting the Uromastycinae members have only and international pet trade (Ching & Chng, 2016; Knapp, been assessed by two prior studies (i.e., Amer & Kumazawa, 2004; Mahmood, Shah, Rais, & Nadeem, 2011; Pechmann, 2005a; Joger, 1986), based on ND2-tRNAs amino acid and Scott, Semlisch, Caldwell, & Vitt, 2005; Robinson, Griffiths, nucleotide distances and on immunological distance data, John, & Roberts, 2015). In the IUCN Red List of Threatened respectively. These two studies suggested that the species Species (http://www.iucnredlist.org), of the nine listed spe- now classified within Saara and Uromastyx started diverg- cies of the subfamily, three are listed as Near Threatened and ing during the Oligocene, approximately 25–30 million years two as Vulnerable. ago (Mya). Amer and Kumazawa (2005a) hypothesized that Uromastyx, the largest genus within the Uromastycinae, an initial stage of radiation probably occurred in the eastern inhabits desert areas and ranges across North Africa, in- Middle East, prior to the connection between Africa and cluding the Sahel and the Horn of Africa, eastwards to Eurasia ca. 18 Mya (i.e., the Gomphotherium land bridge; Iran through the Arabian Peninsula and northwards to cen- Rögl, 1998), and that the ancestor of Uromastyx most likely tral Syria and Iraq (Figure 1; Wilms, 2005; Sindaco & derived from this region. According to their estimates, Jeremčenko, 2008; Wilms & Schmitz, 2007; Uetz et al., the Uromastyx radiation during the Middle Miocene ca. 2017). Uromastyx mainly occurs in deserts and semi-­desert 11–15 Mya may have occurred due to an aridification pro- habitats of compacted ground (they do not occur on sand cess in the area, which facilitated migration and cladogenesis dunes), covered with rocks, scattered stones, gravel and between and within Arabia and Africa. sparse vegetation (Arnold, 1980; Wilms, 2005). The tax- The Saharo-­Arabian region, spanning across North Africa onomy of Uromastyx has changed through the years, with and Arabia, is a unique region for evolutionary and biogeo- four species and three subspecies described since 1980 (see graphic research. The region has a long and complex geo- Uetz et al., 2017). Morphological revisions of Uromastyx logical history of suturing and rifting—it covers both the (e.g., Mateo, Geniez, Lopez-Jurado,­ & Bons, 1999; Wilms, active continental separation of Arabia from Africa at the 2001; Wilms & Böhme, 2000a, 2000b, 2001, 2007; Wilms & Red Sea and the collision zone of the African-­Arabian plates Schmitz, 2007; Wilms et al., 2009) and molecular phyloge- with the Eurasian landmass at its northern edge (Bohannon netic studies (e.g., Amer & Kumazawa, 2005a, 2009; Harris, 1989; Girdler, 1991; Ghebreab, 1998; Popov et al., 2004; Vaconcelos, & Brito, 2007; Wilms & Schmitz, 2007; Wilms Bosworth, Huchon, & McClay, 2005). This tectonically ac- et al., 2009; Amin & Amer, 2011; Amer, Ahmed, Wilms, tive region has undergone drastic climatic changes with pro- Shobrak, & Kumazawa, 2012) have contributed greatly to found aridification processes followed by hyperarid areas our understanding of the intra-­ and interspecific relationships alternately expanding and contracting (Le Houérou, 1992, within the genus. Uromastyx taxa are currently divided into 1997). Periodic terrestrial connectivity between Africa and the following five groups: U. acanthinura group (African; Arabia through the Red Sea, and between Afro-­Arabia and five species), U. aegyptia (Arabian; one species), U. ocellata Asia (through the Gomphotherium land bridge), coupled group (Arabian; five species), U. princeps group (African; with climatic oscillations are hypothesized to have enabled two species) and U. thomasi (Arabian; one species). The multiple vicariance and dispersal events, and phases of fau- phylogenetic relationships among the Uromastyx taxa were nal exchanges between the regions. These processes have

FIGURE 1 Distribution ranges and maximum-­likelihood concatenated tree of Uromastyx. Ranges were modified from Wilms (2005) and Sindaco and Jeremčenko (2008). The tree was reconstructed from the complete concatenated data, with support values indicated near the nodes (bootstrap/Bayesian posterior probabilities). Sample codes correlate to specimens in Table S1 [Colour figure can be viewed at wileyonlinelibrary.com] TAMAR et al. | 161 162 | TAMAR et al. created an admixture of evolutionary histories and biogeo- gene fragments: melano-­cortin 1 receptor (MC1R; 663 bp), graphic patterns for the regional reptile fauna (e.g., Carranza acetylcholine receptor M4 (ACM4; 429 bp) and neurotroph- & Arnold, 2012; Kapli et al., 2015; Metallinou et al., 2012, in-­3 (NTF3; 645 bp). Data on the primers, PCR conditions 2015; Papenfuss et al., 2009; Pook, Joger, Stümpel, & and source references are listed in Table S2. Wüster, 2009; Portik & Papenfuss, 2012; Šmíd et al., 2013; Tamar, Carranza, Sindaco, Moravec, & Meiri, 2014; Tamar, et al., 2015; Tamar, Carranza, et al., 2016; Tamar, Scholz, 2.2 | Sequence alignment and et al., 2016). phylogenetic analyses Due to its continuous distribution on both sides of the Chromatographs were checked manually, assembled and Red Sea, Uromastyx is of particular interest to elucidate the edited using Geneious v.7.1.9 (Biomatter Ltd.). For the nu- different diversification processes affecting the evolutionary clear genes (MC1R, ACM4, NTF3), heterozygous positions history of Saharo-­Arabian reptiles. In this study, we estimate were identified and coded according to the IUPAC ambiguity the phylogenetic relationships and biogeographic history of codes. We tested for the occurrence of recombination in the Uromastyx taxa using a comprehensive sampling and novel phased nuclear genes using the Pairwise Homoplasy Index multilocus data. We reconstructed concatenated trees and (PhiTest; Bruen, Hervé, & Bryant, 2006) as implemented in species trees, and conducted species delimitation analyses splitstree v.4.14.5 (Huson & Bryant, 2006) and no recombi- to identify the different taxonomic units within the genus nation was detected (p > .18 for each gene). Sequences were compared to the current taxonomy. We reconstructed these aligned, for each gene independently, using the online ap- relationships within a time-calibrated­ species tree, which en- plication of mafft v.7.3 (Katoh & Standley, 2013) with de- abled us to evaluate the biogeographic history of this genus, fault parameters, except for the 16S and tRNAs fragments to with the aim to improve our understanding on the environ- which we applied the Q-INS-­ ­i strategy that considers the sec- mental processes that influenced diversification in Africa and ondary structure of RNA. Poorly aligned gap regions of 16S Arabia. and tRNAs were eliminated with Gblocks (Castresana, 2000) using low stringency options (Talavera & Castresana, 2007). Protein-­coding genes (cytb, ND4, MC1R, ACM4, NTF3) were 2 | MATERIALS AND METHODS translated into amino acids, and no stop codons were de- tected. Inter- ­and intraspecific uncorrected p-­distances with 2.1 | Taxon sampling and DNA sequencing pairwise deletion for the mitochondrial fragments, and the Our sampling includes 129 specimens representing 20 recog- number of variable (V) and parsimony informative (Pi) sites nized taxa of Uromastyx (i.e., 14 species and six subspecies) for all the markers were calculated in mega v.7.0.14 (Kumar, from their entire distribution range (Table S1; Uromastyx Stecher, & Tamura, 2016). The data sets for the different occidentalis was not sampled; sequences retrieved from analyses were partitioned as specified by partitionfinder GenBank are from Amer & Kumazawa, 2009; Wilms & v.1.1.1 (Lanfear, Calcott, Ho, & Guindon, 2012), with the Schmitz, 2007; Wilms et al., 2009). The monophyly and phy- following parameters: linked branch length; BEAST models; logenetic position of Uromastyx within the Agamidae have BIC model selection; greedy schemes search algorithm; sin- been established in previous studies (Amer & Kumazawa, gle partition of the non-­coding 16S and tRNAs, and by codons 2005a; Joger, 1986, 1991; Macey et al., 2000; Pyron for the protein-coding­ markers cytb, ND4, MC1R, ACM4 and et al., 2013; Tonini, Beard, Ferreira, Jetz, & Pyron, 2016; NTF3. A summary of DNA partitions, with the best fit model Townsend et al., 2011; Wilms et al., 2009). We therefore in- of nucleotide substitution for each partition, is presented in cluded as outgroups eight specimens of its phylogenetically Table S3. closely related genus Saara. Sample codes, vouchers, locali- Concatenated phylogenetic analyses were performed ties and GenBank accession numbers are given in Table S1. under maximum likelihood (ML) and Bayesian inference (BI) Distribution ranges of each species are presented in Figure 1. frameworks. We treated alignment gaps as missing data, and The DNA of alcohol-­preserved muscle, fingers or liver the nuclear gene sequences were not phased. The ML anal- tissue samples was extracted using the SpeedTools Tissue yses were conducted in raxml v.7.4.2 (Stamatakis, 2006) as DNA Extraction kit (Biotools, Madrid, Spain). For each indi- implemented in raxmlgui v.1.3 (Silvestro & Michalak, 2012). vidual, up to six markers were PCR amplified and sequenced All ML analyses were performed with the GTR+G model of for both strands. The mitochondrial data set (1,696 bp) in- sequence evolution and 100 inferences. Each inference was cluded three gene fragments: the ribosomal 16S rRNA (16S; initiated with a random starting tree, and nodal support was 502 bp) and the protein-coding­ cytochrome b (cytb; 306 bp) assessed with 1,000 bootstrap replicates. The BI analysis and NADH dehydrogenase subunit 4 (ND4; 708 bp) with the was conducted with mrbayes v.3.2.6 (Ronquist et al., 2012). adjacent histidine, serine and leucine tRNAs (tRNAs; 180 bp). Nucleotide substitution model parameters were unlinked The nuclear data set (1,737 bp) included three protein-coding­ across partitions and the different partitions were allowed TAMAR et al. | 163 to evolve at different rates. Two simultaneous parallel runs for each marker using a likelihood ratio test implemented in were performed with four chains per run (three heated, one mega), Yule process species tree prior, random starting trees, cold) for 107 generations with sampling frequency of every ploidy type (mitochondrial for the mtDNA tree), GTR base 1,000 generations. We examined the standard deviation of substitution prior uniform (0, 100) and alpha prior uniform (0, the split frequencies between the two runs and the Potential 10). Three individual runs were performed for 4 × 108 gen- 4 Scale Reduction Factor (PSRF) diagnostic; convergence was erations with a sampling frequency of 4 × 10 . For all *beast assessed by confirming that all parameters had reached sta- analyses, we assessed stationarity with tracer v.1.6, and tionarity and had sufficient effective sample sizes (>200) LogCombiner and TreeAnnotator (in the beast package) were using tracer v.1.6 (Rambaut, Suchard, Xie, & Drummond, used to infer the ultrametric tree after discarding 10% as burn- 2014). We conservatively discarded the first 25% of trees as ­in. All *beast analyses were carried out in CIPRES Science burn-­in. Nodes were considered as well supported if they re- Gateway (Miller, Pfeiffer, & Schwartz, 2010). ceived ML bootstrap values ≥70% and posterior probability We performed a nuclear multilocus Bayesian coalescent (pp) support values ≥.95. species delimitation and species tree analyses conducted with Haplotype networks were constructed for the three nu- Bayesian Phylogenetics and Phylogeography (bp&p v.3.3; clear genes: MC1R, ACM4 and NTF3. To resolve haplotype Yang & Rannala, 2010, 2014; Rannala & Yang, 2013) with phase when multiple heterozygous sites were present, the on- the full phased data set of the three nuclear loci (MC1R, line web tool SeqPHASE (Flot, 2010) was used to convert ACM4, NTF3). We carried out two analytical approaches the input files for each gene independently, and the software using the 13 recognized species within Uromastyx (see phase v.2.1.1 (Stephens & Scheet, 2005; Stephens, Smith, Results; excluding U. princeps due to incomplete data set): & Donnelly, 2001) to resolve haplotypes, with a probability (i) conducting Bayesian species delimitation analyses using threshold set to .5 for each of the three markers. The phased a fixed guide tree (i.e., the 13 ‘species’ species tree recov- nuclear sequences were used to generate median-­joining net- ered from *beast; see above). (ii) conducting joint analyses works using networks v.5 (Bandelt, Forster, & Röhl, 1999). of Bayesian species delimitation while estimating the spe- cies tree (Yang, 2015). For both approaches, algorithms 0 and 1 were used, assigning each species delimitation model 2.3 | Species delimitation and species equal prior probability. As prior distributions on the ances- tree analyses tral population size (θ) and root age (τ) can affect the pos- To evaluate the relationships and species boundaries within terior probabilities for models (Yang & Rannala, 2010), we Uromastyx, we applied two approaches for species delimita- tested four different combinations of priors following the tion, assuming no prior knowledge for species designations. study of Leaché and Fujita (2010): θ = G(1,10), τ = G(1,10); To objectively identify divergent lineages within Uromastyx, θ = G(2,2000), τ = G(2,2000); θ = G(1,10), τ = G(2,2000); putative species boundaries were first tested using the multi- θ = G(2,2000), τ = G(1,10). The locus rate parameter that rate Poisson Tree Processes (mPTP; Kapli et al., 2016) model, allows variable mutation rates among loci was estimated with using a web server (http://mptp.h-its.org/). As this analysis a Dirichlet prior (α = 2). As our data set was autosomal only, relies on single locus data, we reconstructed and used a ML the heredity parameter that allows θ to vary among loci was haplotype mitochondrial phylogenetic tree as specified above set as default. We ran each of the rjMCMC analysis twice to (i.e., same mitochondrial partitions and analysis parameters). confirm consistency between runs, each run for 5 × 105 gen- We then reconstructed a multilocus species-tree­ using *beast erations with 10% discarded as burn-­in. (v.1.8.2; Drummond, Suchard, Xie, & Rambaut, 2012; Heled & Drummond, 2010). We defined lineages based on the re- sults obtained from the mPTP analysis. Outgroups were ex- 2.4 | Estimating a temporal framework cluded, and only linages with a full set of genes were included for divergence (thus excluding U. princeps from this analysis; see Table S1). Divergence times were estimated in beast v.1.8.2 with one rep- The nuclear loci were phased, and the site models, clock mod- resentative of each independent mPTP lineage of Uromastyx els and gene trees were unlinked across loci (tree model linked (the nuclear genes unphased; for representatives see Table for the mtDNA partitions). The Bayesian information crite- S1 and Figure S1). We performed three different calibration rion (BIC), as implemented in jmodeltest v.2.1.7 (Darriba, analyses using the concatenated data to cross-validate­ diver- Taboada, Doallo, & Posada, 2012; Guindon & Gascuel, gence times. For each of the three analyses, three individual 2003), was used to select the best model of nucleotide sub- runs were performed for 5 × 107 generations with a sampling stitution for each partition: 16S (GTR+G), ND4 (TrN+I+G), frequency of 5 × 103. Other prior settings were as detailed for ACM4 (TrN+G), MC1R (TrN+I) and cytb, tRNA, NTF3 the *beast species tree, apart from ploidy type. A summary of (HKY+G). Other prior settings were as follows (otherwise DNA partitions, with the best fit model of nucleotide substitu- by default): models as listed above, strict clock prior (tested tion for each partition, is presented in Table S3. 164 | TAMAR et al. The three analyses were as follows: (i) applying one cali- set using the Uromastyx europaeus fossil as described in the bration point, using the Uromastycinae data set alone (Saara divergence-­time estimations analyses (see above; data set and Uromastyx), based on the agamid fossil Uromastyx eu- comprised of one representative of each species and subspe- ropaeus (De Stefano, 1903) dated to the Early Oligocene cies for wider geographic sampling). The likelihood-based­ (Augé, 1988; Moody, 1980; Rage & Augé, 2015). This cal- analysis was performed with the R-­package BioGeoBEARS ibration point was applied at the crown of Uromastycinae (Matzke, 2013). This method implements six biogeographic (Saara and Uromastyx; gamma distribution, α = .9, β = 8, models: DEC (dispersal–extinction–cladogenesis; Ree, 28–56 Mya); (ii) applying seven calibration points related to Moore, Webb, & Donoghue, 2005; Ree & Smith, 2008), other members of the family Agamidae, as previously esti- DIVA (dispersal–vicariance analysis; Ronquist, 1997) and mated or used in other studies (see below; Table S1); (iii) use BayArea (Landis, Matzke, Moore, & Huelsenbeck, 2013); of the same data set as in analysis (ii), with the incorporation and the parameter (J), considered for each model, which al- of the Uromastyx europaeus fossil calibration (i.e., eight cal- lows founder effect speciation events (Matzke, 2013). The ibration points). Bayesian approach was performed using BSSVS (Lemey, The seven agamid calibrations used for the calibration Rambaut, Drummond, & Suchard, 2009), the discrete phy- analyses were as follows: (i) the divergence of Hydrosaurinae logeographic model implemented in beast. Partitions and from Amphibolurinae, Agaminae and Draconinae during models of nucleotide substitution are detailed in Table S3. the Late Cretaceous (normal distribution, mean 70, SD 3; The prior settings, MCMC chain length and sampling strategy Townsend et al., 2011); (ii) the divergence of Amphibolurinae were the same as in the divergence-time­ estimations analy- from Agaminae and Draconinae during the Late Cretaceous sis, with additional specification of symmetric discrete trait (normal distribution, mean 68, SD 3.5; Amer & Kumazawa, substitution model and an exponential prior for the discrete 2005b; Townsend et al., 2011); (iii) the divergence between location state rate. Agaminae and Draconinae during the Early Paleocene (nor- The Uromastycinae taxa were assigned to four discrete mal distribution, mean 61, SD 2; Amer & Kumazawa, 2005b; biogeographic areas based on their modern day distributions: Wiens, Brandley, & Reeder, 2006; Townsend et al., 2011); (i) Asia-Iran­ to India; (ii) Arabia-Iraq­ to the Sinai Peninsula; (iv) the divergence between Phrynocephalus and Trapelus (iii) North Africa-Egypt­ to Morocco; (iv) Horn of Africa-­ during the Middle Eocene (normal distribution, mean 41, SD Eritrea to Somalia. 1.5; Townsend et al., 2011; Leaché et al., 2014); (v) the diver- gence between Calotes and Acanthosaura during the Middle Oligocene (normal distribution, mean 27, SD 1.5; Amer & 3 | RESULTS Kumazawa, 2005b; Townsend et al., 2011); (vi) the fossil agamid Physignathus sp. (21 Mya; Covacevich, Couper, 3.1 | Sampling and genetic diversity Molnar, Witten, & Young, 1990) from the Early Miocene The data set for the phylogenetic analyses comprised 137 indi- was used to calibrate the divergence of Intellagama lesueurii viduals of Uromastycinae, with 129 specimens of Uromastyx (lognormal distribution, offset 18, mean 1.3, SD 1.4; Hugall, and eight specimens of Saara (Table S1). The data set to- Foster, Hutchinson, & Lee, 2008; Townsend et al., 2011); talling 3,433 bp comprised mitochondrial gene fragments (vii) the divergence between Ctenophorus and Pogona during of 16S (V = 164; Pi = 139), cytb (V = 124; Pi = 117), ND4 the Middle Miocene (normal distribution, mean 18, SD 1.5; (V = 288; Pi = 280) and tRNAs (V = 91; Pi = 89), and nu- Hugall et al., 2008; Townsend et al., 2011). clear gene fragments of MC1R (V = 33; Pi = 29), ACM4 In addition, a time-calibrated­ species tree of Uromastyx (V = 30; Pi = 29) and NTF3 (V = 28; Pi = 20). The uncor- was estimated using *beast, including its closest relative rected p-­distances of the 16S, cytb and ND4 mitochondrial genus Saara. As the three calibration approaches mentioned gene fragments between and within each species are sum- above provided almost identical dates (see Results), we cali- marized in Table S4. brated the species tree using the Uromastyx europaeus fossil. Three individual runs were performed for 8 × 108 genera- tions with a sampling frequency of 8 × 104. Calibration set- 3.2 | Phylogenetic inference tings were as specified above and other priors as detailed for The concatenated analyses resulted in identical topologies the previous species tree. with high bootstrap support (ML) and posterior probabilities (BI) for all lineages, yet with several less supported nodes among them (Figure 1). The separation between the two rec- 2.5 | Ancestral range reconstruction ognized genera of Uromastycinae is strongly supported, re- To infer the phylogeographic history and estimate the ances- covering both Uromastyx and Saara as monophyletic. The tral ranges of Uromastyx, we performed both likelihood and 17 species sampled within the subfamily were all recovered Bayesian analyses on the concatenated Uromastycinae data as monophyletic. TAMAR et al. | 165 The 14 lineages recovered in the concatenated analyses genetic differentiation within U. aegyptia is extremely low within Uromastyx are distinct, well supported, and they mostly (16S: .2%; cytb: .8%; ND4: .2%; Table S4). Uromastyx benti correspond to current taxonomic classifications (Figure 1; from Oman and the Yemeni U. shobraki and U. yemenen- Table S1). Genetic distances (p-­distance) appear to be low sis form a well-­supported clade, although the relationships within each lineage (16S: 0%–1.4%; cytb: 0%–1.5%; ND4: among these three taxa are not supported in any of the 0%–2%; Table S4). The lowest genetic divergence among spe- analyses carried out. Uromastyx ocellata from Egypt and cies in the cytb and ND4 markers was found between U. geyri Sudan and U. ornata from Egypt and Saudi Arabia form a and U. alfredschmidti (16S: 2.03%; cytb: 3.5%; ND4: 4.8%), well-supported­ clade with both species reciprocally mono- whereas in the 16S marker, the distances among U. acanthin- phyletic. The latter species comprises two monophyletic ura, U. nigriventris and U. dispar are the lowest (16S: 1.1%– subspecies, U. o. ornata from Egypt and U. o. philbyi from 1.5%; cytb: 4.6%–6.4%; ND4: 6.4%–7%). The haplotype Saudi Arabia. The two strongly supported species of the networks inferred for the phased full length nuclear markers U. princeps group from the Horn of Africa region, U. prin- are presented in Figure 2. The three networks show similar ceps and U. macfadyeni, form a well-supported­ clade (the patterns and closely agree with the phylogenetic trees, as most U. princeps group), sister to the U. acanthinura group, of the observed polymorphism contributes to the differentia- strongly supported in the concatenated analyses, but not tion of specimens assigned to the 14 lineages/species. In each in the species trees. The five North African species of the network, alleles are mostly shared among the African species. U. acanthinura group—U. geyri, U. alfredschmidti, U. dis- The subspecies of U. dispar share alleles in all three networks, par, U. acanthinura and U. nigriventris—are all monophy- but those of U. ornata share alleles only in the NTF3 network. letic mostly with strong support, apart from the relationship Interestingly, the U. geyri specimen M83 from Tassili N’Ajjer between the two latter species, which is not supported in in Algeria, an area of sympatry with the phylogenetically both the concatenated and species trees analyses. The four closely related U. alfredschmidti (samples M23 and M24), subspecies of the widespread North African species U. dis- shares alleles with this species in the three networks. par (i.e., U. d. dispar, U. d. flavifasciata, U. d. hodhensis The mPTP species delimitation analysis recovered 14 de- and U. d. maliensis), sampled at both eastern and western limited lineages (Figure S1) corresponding to the 14 recog- edges of its distribution range, cluster together without a nized species sampled. The multilocus species trees inferred resolved phylogenetic structure. The genetic differenti- using *beast and the bp&p analyses were performed by ation within U. dispar is extremely low (16S: .2%; cytb: treating each of the 14 mPTP delimited entities as a separate .6%; ND4: .2%; Table S4). The speciation event between putative species resulting in 13 species (excluding U. prin- U. geyri and U. alfredschmidti was not supported by the ceps due to its incomplete data set; Figure S1). The results bp&p species delimitation analyses. of the species trees strongly support most of the interspe- cific relationships in the concatenated analyses, except the weak support for the phylogenetic positions of U. aegyptia, 3.3 | Divergence-­time estimations and biogeographic inference U. macfadyeni and U. thomasi. The results of the bp&p spe- cies delimitation analyses yielded 12 putative species with Estimated divergence times based on the three calibration consistent results regardless of the analytical approach, the approaches and the concatenated data sets, using one mPTP rjMCMC algorithm, and the θ and τ priors. The sole specia- representative of each lineage of Uromastyx, are presented tion event that was unsupported in both approaches and in all in Figure S2 and Table S5. The three calibration approaches combinations of priors was between U. geyri and U. alfred- concurred extremely well presenting nearly identical dates. schmidti (<.3 for all combinations of priors). We therefore calibrated the multilocus species tree with the Based on the different phylogenetic analyses, Uromastyx Uromastyx europaeus fossil (Figures 2 and S3; Table S5) and taxa are divided into five groups (Figures 1–2 and S1). The refer to these ages. Uromastyx started diverging during the phylogenetic position of U. thomasi from Oman is not sup- Middle Miocene, approximately 16 Mya (12.8–20.9 Mya, ported in any of the analyses carried out. The widely spread 95% highest posterior densities [HPD]). Speciation between Arabian species, U. aegyptia, was recovered as a sister the groups appears to have occurred during the Middle–Late taxon to the U. ocellata group with strong support in the Miocene and between species mostly during the Pliocene. concatenated analyses, although this support is much lower Uromastyx princeps, which was excluded from the species in the species trees, and in the calibrations and the bio- tree due to its incomplete data set, diverged from U. macfady- geographic analyses. In the concatenated analyses, within eni approximately 10–12 Mya according to the concatenated U. aegyptia, the subspecies U. a. aegyptia from Egypt was analyses (around the same time U. macfadyeni diverged in recovered as monophyletic, sister taxon to the clade formed the species tree; Figure S2; Table S5). by the reciprocally monophyletic subspecies U. a. leptieni The BI and ML approaches used to estimate ances- and U. a. microlepis from the Arabian Peninsula. The tral ranges (i.e., BSSVS and BioGeoBEARS, respectively) 166 | TAMAR et al.

FIGURE 2 Unrooted haplotype nuclear networks (top) and a time-calibrated multilocus species tree (bottom) of Uromastyx. Circle size in the networks is proportional to the number of alleles with codes correlating to the two alleles (i.e., a and b) of specimens listed in Table S1. The multilocus species tree was calibrated with the Uromastyx europaeus fossil (see Material and Methods; Uromastyx princeps was excluded due to incomplete data set). Mean age estimates with the 95% highest posterior densities (in brackets) are indicated near the nodes (see Figure S3 and Table S5). White circles represent nodes with posterior probability values ≥.95 [Colour figure can be viewed at wileyonlinelibrary.com] produced similar estimates of ancestral areas and are sum- each model). The biogeographic origin of Uromastyx was marized in Figure 3. In the ancestral area estimations using most likely confined to Arabia (i.e., south-west­ Asia) with BioGeoBEARS, DIVALIKE+J was identified as the best-­ later radiations in North Africa and the Horn of Africa re- fitting model (Table S6; see Figure S4 for the results of gion. This origin follows a western dispersal from Asia as TAMAR et al. | 167

FIGURE 3 Ancestral area reconstructions of Uromastyx estimated using the concatenated data with BioGeoBEARS (left) and BSSVS (right). A pie chart describing the probability of each inferred area is presented near the major nodes (ranges visualized in the lower left map). For the BSSVS analysis, branch colours indicate inferred ancestral range and posterior probabilities values are indicated near the nodes [Colour figure can be viewed at wileyonlinelibrary.com] the biogeographic distribution of Saara, the sister genus to (Arabian Peninsula and Egypt), U. ocellata group (Arabian Uromastyx, is Asian. Peninsula and west of the Red Sea), U. princeps group (Horn of Africa) and the U. acanthinura group (North Africa). With few exceptions, both the concatenated anal- 4 | DISCUSSION yses and the multilocus species trees were consistent with most taxonomic classifications within Uromastyx. We thus This study provides a comprehensive phylogenetic recon- retain the status of most recognized species and subspecies struction and assessment of the inter- ­and intraspecific rela- (Figures 1–2): U. acanthinura, U. aegyptia (and its three tionships, diversity and historical biogeography of the genus subspecies: U. a. aegyptia, U. a. leptieni and U. a. micro- Uromastyx. The data presented feature the largest taxon lepis), U. benti, U. dispar, U. geyri, U. macfadyeni, U. ni- sampling to date, with representatives of all but one (U. occi- griventris, U. ocellata, U. ornata (and its two subspecies: dentalis) presently recognized species and subspecies of the U. o. ornata and U. o. philbyi), U. princeps, U. shobraki, genus. Specimens throughout the species’ distribution ranges U. thomasi and U. yemenensis. were incorporated, and several phylogenetic and coalescent-­ Morphological studies have previously suggested that based methods were applied to generate concatenated trees, U. thomasi may be phylogenetically closely related to the species trees and ancestral area reconstructions. African species U. princeps based on their exceptionally short tail length (Moody, 1987; Wilms, 2001, 2005; Wilms & Böhme, 2007). This notion was refuted in Wilms et al. 4.1 | Phylogenetic relationships and (2009) suggesting that this is an example of evolutionary con- systematic implications vergence. The phylogenetic position of U. thomasi remains The inferred topologies in our study were mostly congru- unresolved in our phylogenetic analyses (as in Wilms et al., ent across analyses and generally support those of Joger 2009), although Wilms (2005) suggested, based on external (1986), Amer and Kumazawa (2005a), Harris et al. (2007) morphology, that it may be sister to its remaining congeners. and Wilms et al. (2009). The broader sampling in our study The polytypic species U. aegyptia comprises three sub- present the Uromastyx taxa as phylogenetically divided species: U. a. aegyptia, U. a. leptieni and U. a. microlepis. into five main well-­supported groupings (similar to Wilms The taxonomic status of these subspecies was often debated et al., 2009): U. thomasi (Arabian Peninsula), U. aegyptia (e.g., Arnold, 1980; Joger, 1986; Moody, 1987; Wilms, 2005; 168 | TAMAR et al. Wilms & Böhme, 2000a, 2000b, 2007). The three subspe- supported by the genetic results in this study (Figures 1–2; cies are reciprocally monophyletic, present a low genetic Table S4). The sympatry of U. geyri and U. alfredschmidti variability among them (Table S4; see also Wilms et al., with U. dispar, their distinct morphology and their separa- 2009) and have different morphology (Wilms, 2005; Wilms tion in each of the genetic analyses are a strong evidence of & Böhme, 2000a, 2000b; Wilms et al., 2009). We thus val- their separated species status. Within the subgroup of U. dis- idate their subspecific status. Interestingly, a single sample par, U. acanthinura and U. nigriventris, the genetic results of U. aegyptia ssp. from the Dhofar Governorate in southern and the species delimitation analyses support their distinct Oman clusters with two samples of U. a. leptieni from the status, although the phylogenetic relationships among the UAE (Table S1; Figure 1). This result may indicate a possible taxa are less supported in the concatenated analyses and range extension for this subspecies (Sindaco & Jeremčenko, species trees. In the nuclear networks of ACM4 and NTF3, 2008; Wilms, 2005; Wilms & Böhme, 2000a, 2000b; Wilms U. acanthinura and U. nigriventris do not share alleles, but et al., 2009), although further data are necessary to confirm do so in the MC1R network. Without further data from their this hypothesis. contact zones, and no evidence of the contrary, we retain The well-­supported U. ocellata group consists of five them as valid species. Nonetheless, future studies with addi- closely related species and subdivided into two subgroups: tional samples from the contact zones of these three species one is comprised of U. benti, U. shobraki and U. yemenen- will allow to further investigate hypotheses concerning their sis from the southern Arabian Peninsula; the other comprises diversification and phylogenetic relationships. U. ocellata and U. ornata from both sides of the Red Sea. Our results highlight two unexpected discrepancies from The monophyly of each species and the relationships recov- the known taxonomy of the African U. acanthinura group. ered are supported in this study as suggested by previous First, the divergence between two species, U. geyri and U. al- morphological examinations and phylogenetic works using fredschmidti, is not supported by the bp&p species delimita- mitochondrial data only (Wilms & Schmitz, 2007; Wilms tion analyses, contrary to some expectations derived from et al., 2009). Both U. ocellata and U. ornata are distinct in morphological and taxonomic studies (Sindaco, Wilms, & every analysis, and they do not share alleles in the nuclear Venchi, 2012; Wilms & Böhme, 2001; Wilms et al., 2009). networks, supporting their specific status. The two subspe- The genetic divergence of these two taxa is also among the cies of the latter taxon (i.e., U. o. ornata and U. o. philbyi) lowest in the genus, and they share alleles in each nuclear also do not share alleles in the ACM4 and MC1R networks. network, even between samples from distant localities, not Within the southern Arabian subgroup, although the phylo- presenting any geographic structure. These unexpected re- genetic relationships are not well supported among the taxa, sults may stem from a recent speciation event (Figure 2), thus U. shobraki does not share alleles in the nuclear networks and the lack of substantial time to accumulate genetic divergence. is divergent in all analyses, supporting its taxonomic and spe- Additionally, the two species are morphologically distinct, cific distinctiveness from its previously conspecific U. yeme- even though they are sympatric in the Tassili N’Ajjer area in nensis, as suggested in Wilms et al. (2009). Algeria (samples M23 and M24 of U. alfredschmidti and M83 The U. princeps group includes the two species from and M84 of U. geyri). We thus retain them as valid species and the Horn of Africa region, U. princeps and U. macfadyeni. advocate for further taxonomic scrutiny with other sources of These two species are clearly distinct in their morphology data to fully evaluate the status of these two taxa and the pos- (Moody, 1987; Wilms et al., 2009) and were previously af- sible presence of gene flow between their sympatric popula- filiated with different groups (i.e., U. princeps with U. thom- tions. The second discrepancy found in our molecular results asi and U. macfadyeni with the U. ocellata group; Moody, is the admixture of samples identified as the four subspecies of 1987; Wilms & Böhme, 2000a, 2000b; Wilms, 2005). The U. dispar (Figure 1). Samples of U. d. dispar from the eastern genetic results herein confirm the phylogenetic relationships edge of the distribution range (i.e., Egypt, Sudan and Chad) presented in Wilms et al. (2009) and in Wilms and Schmitz are phylogenetically exceptionally close to samples of U. d. (2007), although these genetic results conflict with the dis- flavifasciata from the western edge (i.e., Algeria, Morocco tinct morphology of the species. and Mauritania) displaying an extremely low genetic diver- The phylogenetic structure of the U. acanthinura group sity (Table S4). Unfortunately, due to the low representation of is similar to the topology shown in Amer and Kumazawa two subspecies, U. d. maliensis and U. d. hodhensis, and lack (2005a), but differs from that in Harris et al. (2007) and of samples from the contact zones of all four subspecies, we Wilms et al. (2009). The three taxa, U. acanthinura, U. dis- are unable to fully account for their systematic status. par and U. nigriventris, form a subgroup, and U. geyri and U. alfredschmidti form another. The morphological dif- ferentiation and the mitochondrial differentiation among 4.2 | Historical biogeography the members of this group have been previously evaluated Time-­calibrated phylogenies of Uromastyx have been pre- (Wilms & Böhme, 2001; Wilms et al., 2009) and are mostly sented in two studies using immunological distance data TAMAR et al. | 169 (Joger, 1986) and gamma-­corrected distances of the ND2 Afro-­Arabian rift system, causing seismic activity, periodic amino acid sequences and of the nucleotide sequences be- volcanism and mountain ridges uplifting (Bohannon 1989; tween tRNAGln and tRNATyr genes (Amer & Kumazawa, Girdler, 1991; Bosworth et al., 2005; Kusky, Robinson, & 2005a). In this study, using the Uromastyx europaeus fos- El-­Baz, 2005; Edgell, 2006). These changing landscapes sil, supported by seven other agamid calibration points, we and habitats are hypothesized to have facilitated the diver- provide further insights into the timeframe of cladogenesis gence within other reptile genera such as the agamid genus of Uromastyx. The general pattern of the Uromastycinae di- Pseudotrapelus (Tamar, Scholz, et al., 2016), and within versity elucidated in this study resembles some hypotheses Hemidactylus geckos (Šmíd et al., 2013). Within the U. ocel- derived from phylogeographic and biogeographic studies on lata group, the African species U. ocellata diverged from its the genera, presenting an Asia to Africa dispersal (Amer & close relative, U. ornata, approximately 6 Mya (Figure 2). Kumazawa, 2005a; Joger, 1986; Moody, 1980, 1987; Wilms Originating from the Arabian U. ocellata group, it is clear et al., 2009). The results of the ancestral area reconstructions that U. ocellata attained its current African range from are in accordance with previous studies by suggesting that Arabia, although it is not entirely clear whether its African Uromastyx most likely originated in Arabia (i.e., northern range was obtained through vicariance or via dispersal. Both Arabia, south-west­ Asia) during the Middle Miocene with U. ocellata and U. ornata occur in Egypt, at the northern later radiations in North Africa. edge of their distribution ranges, thus hypothesizing disper- Divergence between the Asian Saara and the Afro-­ sal through this northern route is a likely scenario. On the Arabian Uromastyx is estimated to have occurred during the other hand, both species also occur near the Bab-el-­ ­Mandeb Middle Oligocene (Figures S2–S3; Table S5). This estimate strait in their southern range. The confidence interval of our predates a known Arabian-­Eurasian land connection, which time estimate (95% HPD: 3.8–8 Mya) does not rule out the leads us to agree with the hypothesis postulated by Amer and reopening of the Bab-­el-­Mandeb strait as a vicariant event at Kumazawa (2005a). They speculated that an initial stage of around ~5 Mya (Bosworth et al., 2005; Girdler, 1984). radiation occurred in south-­west Asia before the formation of The separation of the U. princeps group distributed across a land bridge/connection between Asia and Arabia, with the the Horn of Africa region from the North African U. acanthi- ancestor of Uromastyx derived from one of these diversified nura group is hypothesized to result from the tectonic and sub- lineages. Uromastyx taxa started diverging during the Middle sequent geological activity of the Afar mantle plume (similar Miocene according to our estimates, approximately 16 Mya to that suggested by Amer & Kumazawa, 2005a). The U. prin- (95% HPD: 12.8–20.9 Mya). After a temporary period of dis- ceps group is distributed at the southern edge of the Afar zone, connection of the Gomphotherium land bridge (~18–16 Mya) the East African Rift Valley and the Ethiopian Highlands, connecting Eurasia and Afro-­Arabia, a terrestrial land bridge whereas the U. acanthinura group ranges north-west­ of them, was continuously present since ca. 15 Mya (Harzhauser in the arid region of North Africa (Figure 1). The volcanism, et al., 2007; Rögl, 1998; Steininger & Wessely, 2000). The the formation of the East African Rift Valley and the uplift- Gomphotherium land bridge and the later connection enabled ing of mountain ridges associated with the tectonic movement faunal exchange from Asia to Afro-­Arabia and vice versa, in- of the Arabian plate separating from Africa (Bosworth et al., cluding the possible western/southern dispersal of Uromastyx 2005; Girdler, 1991) may have created terrestrial barriers and into Arabia. Uromastyx cladogenesis was most likely facili- habitat fragmentation, and the consequent separation of the tated by the global climate change during the Miocene and U. princeps group from its North African relatives. the subsequent aridification process that greatly altered the The radiation within the North African U. acanthinura landscapes of the Saharo-­Arabian region (Flower & Kennett, group is estimated to have occurred during the Pliocene and 1994; Griffin, 2002; Hsü et al., 1977; Le Houérou, 1992, Middle Pleistocene (~0.23–4.1 Mya). Although we provide 1997; Ruddiman, Raymo, Martinson, Clement, & Backman, different ages, this timeframe resembles the period suggested 1989; Zachos, Pagani, Sloan, Thomas, & Billups, 2001). The in Joger (1986) and Amer and Kumazawa (2005a). We agree aridification process in Arabia and North Africa has proba- with the hypothesis suggested by the latter study regarding the bly contributed to the dispersal of Uromastyx to new suitable climatic effect on the cladogenesis within the group. During habitats. These conditions may have also facilitated the diver- the Quaternary (~2.5–0 Mya), North Africa underwent sev- gence of U. aegyptia and U. thomasi (Figures 2–3). eral dry-­wet climatic cycles, leading to the expansion and The divergence within the Arabian U. ocellata group contraction of arid areas, which in turn prompted large fluc- (ca. 3.8–9.9 Mya; 95% HPD: 2.5–13 Mya) during the Late tuations in floral and faunal distributions (Le Houérou, 1997; Miocene and the Pliocene is hypothesized to have resulted Ruddiman et al., 1989). We hypothesize that these climatic mainly from habitat fragmentation caused by the tectonic fluctuations have facilitated divergence among Uromastyx instability around the Red Sea. This period in the south-­ populations, through the dynamic expansion and contraction west Arabia region has been characterized by tectonic and of their arid habitats, enabling contact and fragmentation of geological activity in the Arabian shield, and by the active populations, respectively. 170 | TAMAR et al. Amer, S. A., & Kumazawa, Y. (2005a). Mitochondrial DNA sequences 5 | CONCLUSIONS of the Afro-­Arabian spiny-tailed­ lizards (genus Uromastyx; family Agamidae): Phylogenetic analyses and evolution of gene arrange- In this study, we contribute to the understanding of the evo- ments. Biological Journal of the Linnaean Society, 85, 247–260. lutionary history of Uromastyx from the Saharo-­Arabian re- https://doi.org/10.1111/j.1095-8312.2005.00485.x gion. We support the status of most species using multilocus Amer, S. A., & Kumazawa, Y. (2005b). Mitochondrial genome coalescent analyses, which are generally accurately repre- of Pogona vitticepes (Reptilia; Agamidae): Control region duplica- Gene 346 sented by current taxonomy, and provide a new timeframe tion and the origin of Australasian agamids. , , 249–256. https://doi.org/10.1016/j.gene.2004.11.014 of cladogenesis and biogeographic assessments. Our results Amer, S. A., & Kumazawa, Y. (2009). Molecular affinity of Somali and Uromastyx strongly support the long-held­ hypothesis that Egyptian mastigures among the Afro-­Arabian Uromastyx. Egyptian originated from an ancestor in south-west­ Asia during the Journal of Experimental Biology, Zoology, 5, 1–7. Middle Oligocene to the Early Miocene, and radiated and Arnold, E. N. (1980). Reptiles and amphibians of Dhofar, Southern dispersed in Arabia and later in North Africa from the Middle Arabia. In S. N. Shaw-Reade, J. B. Sale, M. D. Gallagher & R. H. Daly Miocene onwards. Throughout its Saharo-­Arabian coloni- (Eds.), The scientific results of the Oman flora and fauna survey 1977 zation, occurring during an influential period in the evolu- (Dhofar) (pp. 273–332). Special Report: Journal of Oman Studies. Uromastyx europaeus tion of the regional fauna, Uromastyx underwent multiple Augé, M. (1988). Revision du lézard (Reptilia, Lacertilia) de l’Oligocène français. Analyse functionelle de l’appar- vicariance and dispersal events, hypothesized to be derived eil masticateur de genre Uromastix et implications paleoécologiques. from tectonic motions, habitat fragmentation and the chang- Revue de Paléobiologie, 7, 317–325. ing climate. Our phylogenetic and biogeographic inferences Bandelt, H. J., Forster, P., & Röhl, A. (1999). Median-joining­ networks supplement the growing body of work evaluating the effects for inferring intraspecific phylogenies. Molecular Biology and of the tectonic separation of Arabia and Africa and the cli- Evolution, 16, 37–48. https://doi.org/10.1093/oxfordjournals.mol- matic oscillations on the evolutionary history of the Saharo-­ bev.a026036 Arabian fauna. Bohannon, R. G., Naeser, C. W., Schmidt, D. L., & Zimmermann, R. A. (1989). The timing of uplift, volcanism, and rifting peripheral to the Red Sea: A case for passive rifting? Journal of Geophysical ACKNOWLEDGEMENTS Research: Solid Earth, 94, 1683–1701. https://doi.org/10.1029/ JB094iB02p01683 We wish to thank the Nature Conservation Department of Bosworth, W., Huchon, P., & McClay, K. (2005). The Red Sea and Gulf the Ministry of Environment and Climate Affairs, Oman, for of Aden basins. Journal of African Earth Sciences, 43, 334–378. their support and to the following people for providing sam- https://doi.org/10.1016/j.jafrearsci.2005.07.020 ples for this study, or for helping in the field: F. Amat, E.N. Bruen, T. C., Hervé, P., & Bryant, D. (2006). A simple and robust statis- Genetics 172 Arnold, A. Bauer, D. Donaire, Y. Gauthier, E. Gómez-Díaz,­ tical test for detecting the presence of recombination. , , 2665–2681. https://doi.org/10.1534/genetics.105.048975 D.J. Harris, P. Kodym, P. Leptien, Y. Mansier, H. Nickel, J. Carranza, S., & Arnold, E. N. (2012). A review of the geckos of the Padial, O. Peyre, J.M. Pleguezuelos, J. Renoult, M. Rodriguez genus Hemidactylus (Squamata: Gekkonidae) from Oman based on and J.F. Trape. This work was funded by grant CGL2015-­ morphology, mitochondrial and nuclear data, with descriptions of 70390-­P from the Ministerio de Economía y Competitividad, eight new species. Zootaxa, 3378, 1–95. Spain (cofunded by FEDER) and grant 2014-­SGR-­1532 Castresana, J. (2000). Selection of conserved blocks from multi- from the Secretaria d’Universitats i Recerca del Departament ple alignments for their use in phylogenetic analysis. Molecular Phylogenetics and Evolution 17 d’Economia i Coneixement de la Generalitat de Catalunya. , , 540–552. https://doi.org/10.1093/ oxfordjournals.molbev.a026334 Ching, O. O., & Chng, S. C. (2016). The use of spiny-­tailed lizards ORCID Uromastyx spp. for medicinal purposes in Peninsular Malaysia. TRAFFIC Bulletin, 28, 35. Karin Tamar http://orcid.org/0000-0003-2375-4529 Covacevich, J., Couper, P., Molnar, R. E., Witten, G., & Young, W. (1990). Miocene dragons from Riversleigh: New data on the history of the family Agamidae (Reptilia: Squamata) in Australia. Memoirs REFERENCES of the Queensland Museum, 29, 339–360. Darriba, D., Taboada, G. L., Doallo, R., & Posada, D. (2012). jModelT- Amer, S. A. (2011). Genetic variability of the Saudi Arabian Uromastyx est 2: More models, new heuristics and parallel computing. Nature aegyptia microlepis using protein and isoenzymes electrophore- Methods, 9, 772. https://doi.org/10.1038/nmeth.2109 ses. Advances in Bioscience and Biotechnology, 2, 27. https://doi. De Stefano, G. (1903). I Sauri del Quercy appartenenti alla collezione org/10.4236/abb.2011.21005 Rossignol. Atti della Società Italiana di Scienze naturali e del Museo Amer, S. A., Ahmed, M. M., Wilms, T. M., Shobrak, M., & Kumazawa, Civico di Storia naturale in Milano, 42, 382–418. Y. (2012). Mitochondrial DNA variability within Uromastyx ornata Drummond, A. J., Suchard, M. A., Xie, D., & Rambaut, A. (2012). philbyi (Agamidae: Squamata) from Southwestern Saudi Arabia. Bayesian phylogenetics with BEAUti and the BEAST 1.7. Molecular Comparative and Functional Genomics, 2012, 851379. https://doi. Biology and Evolution, 29, 1969–1973. https://doi.org/10.1093/ org/10.1155/2012/851379 molbev/mss075 TAMAR et al. | 171 Edgell, H. S. (2006). Arabian deserts: Nature, origin and evolution. Joger, U. (1991). A molecular phylogeny of agamid lizards. Copeia, Dordrecht, the Netherlands: Springer Science & Business Media. 1991, 616–622. https://doi.org/10.2307/1446389 https://doi.org/10.1007/1-4020-3970-0 Kapli, P., Lutteropp, S., Zhang, J., Kobert, K., Pavlidis, P., Stamatakis, von Fischer, J. (1885). Der veränderliche Schleuderschwanz (Uromastyx A., & Flouri, T. (2016). Multi-­rate Poisson Tree Processes for acanthinurus BELL.) in der Gefangenschaft. Der Zoologische single-­locus species delimitation under Maximum Likelihood and Garten, 26, 269–278. Markov Chain Monte Carlo. Bioinformatics, 33, 1630–1638. Flot, J. F. (2010). SeqPHASE: A web tool for interconvert- Kapli, P., Lymberakis, P., Crochet, P. A., Geniez, P., Brito, J. C., ing PHASE input/output files and FASTA sequence align- Almutairi, M., … Poulakakis, N. (2015). Historical biogeography ments. Molecular Ecology Resources, 10, 162–166. https://doi. of the lacertid lizard Mesalina in North Africa and the Middle East. org/10.1111/j.1755-0998.2009.02732.x Journal of Biogeography, 42, 267–279. https://doi.org/10.1111/ Flower, B. P., & Kennett, J. P. (1994). The middle Miocene climatic transition: jbi.12420 East Antarctic ice sheet development, deep ocean circulation and global Katoh, K., & Standley, D. M. (2013). MAFFT multiple sequence align- carbon cycling. Palaeogeography, Palaeoclimatology, Palaeoecology, ment software version 7: Improvements in performance and us- 108, 537–555. https://doi.org/10.1016/0031-0182(94)90251-8 ability. Molecular Biology and Evolution, 30, 772–780. https://doi. Ghebreab, W. (1998). Tectonics of the Red Sea region reassessed. Earth-­ org/10.1093/molbev/mst010 Science Reviews, 45, 1–44. https://doi.org/10.1016/S0012-8252(98) Knapp, A. (2004). An assessment of the international trade in Spiny- 00036-1 tailed Lizards Uromastyx with a focus on the role of the European Girdler, R. W. (1984). The evolution of the Gulf of Aden and Red Sea in Union. CITES Doc AC Inf. 13. space and time. Deep Sea Research Part A. Oceanographic Research Kumar, S., Stecher, G., & Tamura, K. (2016). MEGA7: Molecular Papers, 31, 747–762. https://doi.org/10.1016/0198-0149(84)90039-6 Evolutionary Genetics Analysis version 7.0 for bigger datasets. Girdler, R. W. (1991). The Afro-­Arabian rift system – an overview. Molecular Biology and Evolution, 33, 1870–1874. https://doi. Tectonophysics, 197, 139–153. https://doi.org/10.1016/0040-1951 org/10.1093/molbev/msw054 (91)90038-T Kusky, T., Robinson, C., & El-Baz, F. (2005). Tertiary-­Quaternary Gray, J. (1845). A synopsis of the genera of reptiles and amphibians, faulting and uplift in the northern Oman Hajar Mountains. with a description of some new species. Annual philosophy Society Journal of the Geological Society, 162, 871–888. https://doi. London (Ser. 2), 10, 193–217. org/10.1144/0016-764904-122 Griffin, D. L. (2002). Aridity and humidity: Two aspects of the Landis, M. J., Matzke, N. J., Moore, B. R., & Huelsenbeck, J. P. (2013). late Miocene climate of North Africa and the Mediterranean. Bayesian analysis of biogeography when the number of areas is Palaeogeography, Palaeoclimatology, Palaeoecology, 182, 65–91. large. Systematic Biology, 62, 789–804. https://doi.org/10.1093/ https://doi.org/10.1016/S0031-0182(01)00453-9 sysbio/syt040 Guindon, S., & Gascuel, O. (2003). A simple, fast, and accurate algorithm Lanfear, R., Calcott, B., Ho, S. Y., & Guindon, S. (2012). PartitionFinder: to estimate large phylogenies by maximum likelihood. Systematic Combined selection of partitioning schemes and substitution mod- Biology, 52, 696–704. https://doi.org/10.1080/10635150390235520 els for phylogenetic analyses. Molecular Biology and Evolution, 29, Harris, D. J., Vaconcelos, R., & Brito, J. C. (2007). Genetic variation 1695–1701. https://doi.org/10.1093/molbev/mss020 within African spiny-­tailed lizards (Agamidae: Uromastyx) esti- Le Houérou, H. N. (1992). Outline of the biological history of the mated using mitochondrial DNA sequences. Amphibia-­Reptilia, 28, Sahara. Journal of Arid Environments, 22, 3–30. 1–6. https://doi.org/10.1163/156853807779799144 Le Houérou, H. N. (1997). Climate, flora and fauna changes in the Sahara Harzhauser, M., Kroh, A., Mandic, O., Piller, W. E., Göhlich, U., Reuter, over the past 500 million years. Journal of Arid Environments, 37, M., & Berning, B. (2007). Biogeographic responses to geodynam- 619–647. https://doi.org/10.1006/jare.1997.0315 ics: A key study all around the Oligo-Miocene­ Tethyan Seaway. Leaché, A. D., & Fujita, M. K. (2010). Bayesian species delimitation in Zoologischer Anzeiger, 246, 241–256. https://doi.org/10.1016/j. West African forest geckos (Hemidactylus fasciatus). Proceedings jcz.2007.05.001 of the Royal Society B, 277, 3071–3077. https://doi.org/10.1098/ Heled, J., & Drummond, A. J. (2010). Bayesian inference of species rspb.2010.0662 trees from multilocus data. Molecular Biology and Evolution, 27, Leaché, A. D., Wagner, P., Linkem, C. W., Böehme, W., Papenfuss, T. 570–580. https://doi.org/10.1093/molbev/msp274 J., Chong, R. A., … Burbrink, F. T. (2014). A hybrid phylogenetic-­ Hsü, K. J., Montadert, L., Bernoulli, D., Cita, M. B., Erickson, phylogenomic approach for species tree estimation in African A., Garrison, R. E., … Wright, R. (1977). History of the Agama lizards with applications to biogeography, character evolu- Mediterranean salinity crisis. Nature, 267, 399–403. https://doi. tion, and diversification. Molecular Phylogenetics and Evolution, org/10.1038/267399a0 79, 215–230. https://doi.org/10.1016/j.ympev.2014.06.013 Hugall, A. F., Foster, R., Hutchinson, M., & Lee, M. S. (2008). Phylogeny Lemey, P., Rambaut, A., Drummond, A., & Suchard, M. (2009). of Australasian agamid lizards based on nuclear and mitochondrial Bayesian phylogeography finds its roots. PLoS Computational genes: Implications for morphological evolution and biogeography. Biology, 5, e1000520. Biological Journal of the Linnean Society, 93, 343–358. https://doi. Macey, J. R., Schulte, J. A., Larson, A., Ananjeva, N. B., Wang, Y., org/10.1111/j.1095-8312.2007.00911.x Pethiyagoda, R., … Papenfuss, T. J. (2000). Evaluating trans-­ Huson, D. H., & Bryant, D. (2006). Application of phylogenetic net- Tethys migration: An example using acrodont lizard phylogenet- works in evolutionary studies. Molecular Biology Evolution, 23, ics. Systematic Biology, 49, 233–256. https://doi.org/10.1093/ 254–267. https://doi.org/10.1093/molbev/msj030 sysbio/49.2.233 Joger, U. (1986). Phylogenetic analysis of Uromastyx lizards, based on Mahmood, T., Shah, S. M. A., Rais, M., & Nadeem, M. S. (2011). An albumin immunological distances. Studies in Herpetology (pp. 187– investigation of animal species trade at pet shops of Rawalpindi and 192). Prague, Czech Republic: Charles University. Multan cities. The Journal of Animal and Plant Science, 21, 822–929. 172 | TAMAR et al. Mateo, J. A., Geniez, P., Lopez-Jurado, L. F., & Bons, J. (1999). lizards and snakes. BMC Evolutionary Biology, 13, 93. https://doi. Chorological analysis and morphological variation of Saurians of org/10.1186/1471-2148-13-93 the genus Uromastyx (Reptilia, Agamidae) in the West of the Sahara: Rage, J. C., & Augé, M. (2015). Valbro: A new site of vertebrates from Description of two new taxa. Revista Española de Herpetológia, 12, the early Oligocene (MP 22) of France (Quercy). III-­Amphibians 97–109. and squamates. Annales de Paleontologie, 101, 29–41. https://doi. Matzke, N. J. (2013). Probabilistic historical biogeography: New models org/10.1016/j.annpal.2014.10.002 for founder-event­ speciation, imperfect detection, and fossils allow Rambaut, A., Suchard, M. A., Xie, D., & Drummond, A. J. (2014). improved accuracy and model-testing.­ Frontiers of Biogeography, Tracer v1.6. Available from http://beast.bio.ed.ac.uk/Tracer. 5, 242–248. Rannala, B., & Yang, Z. (2013). Improved reversible jump algorithms Merrem, B. (1820). Versuch eines Systems der Amphibien. Marburg, for Bayesian species delimitation. Genetics, 194, 245–253. Germany: Krieger. https://doi.org/10.5962/bhl.title.5037 Ree, R. H., Moore, B. R., Webb, C. O., & Donoghue, M. J. (2005). Metallinou, M., Arnold, E. N., Crochet, P. A., Geniez, P., Brito, J. C., A likelihood framework for inferring the evolution of geographic Lymberakis, P., … Carranza, S. (2012). Conquering the Sahara and range on phylogenetic trees. Evolution, 59, 2299–2311. https://doi. Arabian deserts: Systematics and biogeography of Stenodactylus org/10.1111/j.0014-3820.2005.tb00940.x geckos (Reptilia: Gekkonidae). BMC Evolutionary Biology, 12, 258. Ree, R. H., & Smith, S. A. (2008). Maximum likelihood infer- https://doi.org/10.1186/1471-2148-12-258 ence of geographic range evolution by dispersal, local extinc- Metallinou, M., Červenka, J., Crochet, P. A., Kratochvíl, L., Wilms, tion, and cladogenesis. Systematic Biology, 57, 4–14. https://doi. T., Geniez, P., … Carranza, S. (2015). Species on the rocks: org/10.1080/10635150701883881 Systematics and biogeography of the rock-­dwelling Ptyodactylus Robinson, J. E., Griffiths, R. A., John, F. A. S., & Roberts, D. L. (2015). geckos (Squamata: Phyllodactylidae) in North Africa and Arabia. Dynamics of the global trade in live reptiles: Shifting trends in pro- Molecular Phylogenetics and Evolution, 85, 208–220. https://doi. duction and consequences for sustainability. Biological Conservation, org/10.1016/j.ympev.2015.02.010 184, 42–50. https://doi.org/10.1016/j.biocon.2014.12.019 Miller, M., Pfeiffer, W., & Schwartz, T. (2010). Creating the CIPRES Rögl, F. (1998). Palaeogeographic considerations for Mediterranean Science Gateway for inference of large phylogenetic trees. Gateway and Paratethys seaways (Oligocene to Miocene). Annalen des Computing Environments Workshop (GCE) (pp. 1–8). New Orleans, Naturhistorischen Museums in Wien, 99, 279–310. LA: IEEE. Ronquist, F. (1997). Dispersal-­vicariance analysis: A new approach to Moody, S. (1980). Phylogenetic and Historical Biogeographical the quantification of historical biogeography. Systematic Biology, Relationships of the Genera in the Family Agamidae (Reptilia 46, 195–203. https://doi.org/10.1093/sysbio/46.1.195 Lacertilia).Unpublished PhD thesis, University of Ann Arbor, Ann Ronquist, F., Teslenko, M., Mark, P., van der Ayres, D. L., Darling, A., Arbor, MI. Höhna, S., … Huelsenbeck, J. P. (2012). MrBayes 3.2: Efficient Moody, S. M. (1987). A preliminary cladistic study of the lizard genus Bayesian phylogenetic inference and model choice across a large Uromastyx (Agamidae, sensu lato), with a checklist and diag- model space. Systematic Biology, 61, 1–4. nostic key to the species. In J. J. van Gelder, H. Strijbosch & P. Ruddiman, W. F., Raymo, M., Martinson, D. G., Clement, B. M., & J. M. Bergers (Eds.), Proceedings of the Fourth Ordinary General Backman, J. (1989). Pleistocene evolution: Northern hemisphere ice Meeting of the Societas Europaea Herpetologica (pp. 285–288). sheets and North Atlantic Ocean. Paleoceanography, 4, 353–412. Holland, the Netherlands: Nijmegen. https://doi.org/10.1029/PA004i004p00353 Papenfuss, T. J., Jackman, T., Bauer, A., Stuart, B. L., Robinson, M. D., Silvestro, D., & Michalak, I. (2012). raxmlGUI: A graphical front-­end & Parham, J. F. (2009). Phylogenetic relationships among species for RAxML. Organisms Diversity and Evolution, 12, 335–337. in the sphaerodactylid lizard genus Pristurus. Proceedings of the https://doi.org/10.1007/s13127-011-0056-0 California Academy of Sciences, 60, 675. Sindaco, R., & Jeremčenko, V. K. (2008). The reptiles of the Western Pechmann, J., Scott, D., Semlisch, R., Caldwell, J., & Vitt, L. (2005). Palearctic. 1. Annotated checklist and distributional atlas of the West-­Africa, Madagascar, Central-­and South-­America: Main ori- turtles, crocodiles, amphisbaenians and lizards of Europe, North gins of the CITES-­listed lizard pet market in France. Herpetological Africa, Middle East and Central Asia. Edizioni Belvedere Latina, Review, 36, 133–137. Monografie della Societas Herpetologica Italica. Pook, C. E., Joger, U., Stümpel, N., & Wüster, W. (2009). When con- Sindaco, R., Wilms, T. M., & Venchi, A. (2012). On the distribution tinents collide: Phylogeny, historical biogeography and systematics of Uromastyx alfredschmidti Wilms and Böhme, 2000 (Squamata: of the medically important viper genus Echis (Squamata: Serpentes: Agamidae: Uromastycinae). Acta Herpetologica, 7, 23–28. Viperidae). Molecular Phylogenetics and Evolution, 53, 792–807. Šmíd, J., Carranza, S., Kratochvíl, L., Gvoždík, V., Nasher, A. K., & https://doi.org/10.1016/j.ympev.2009.08.002 Moravec, J. (2013). Out of Arabia: A complex biogeographic his- Popov, S. V., Rögl, F., Rozanov, A. Y., Steininger, F. F., Shcherba, tory of multiple vicariance and dispersal events in the gecko genus I. G., & Kovac, M. (2004). Lithological-­Paleogeographic Hemidactylus (Reptilia: Gekkonidae). PLoS One, 8, e64018. maps of Paratethys.10 Maps Late Eocene to Pliocene. Courier Stamatakis, A. (2006). RAxML-­VI-­HPC: Maximum likelihood-­ Forschungsinstitut Senckenberg, 250, 1–46. based phylogenetic analyses with thousands of taxa and mixed Portik, D. M., & Papenfuss, T. J. (2012). Monitors cross the Red Sea: models. Bioinformatics, 22, 2688–2690. https://doi.org/10.1093/ The biogeographic history of Varanus yemenensis. Molecular bioinformatics/btl446 Phylogenetics and Evolution, 62, 561–565. https://doi.org/10.1016/j. Steininger, F. F., & Wessely, G. (2000). From the Tethyan Ocean to ympev.2011.09.024 the Paratethys Sea: Oligocene to Neogene stratigraphy, paleoge- Pyron, R. A., Burbrink, F. T., & Wiens, J. J. (2013). A phylogeny ography and paleobiogeography of the circum-Mediterranean­ and revised classification of Squamata, including 4161 species of region and the Oligocene to Neogene basin evolution in Austria. TAMAR et al. | 173 Mitteilungen der Österreichischen Geologischen Gesellschaft, 92, Wilms, T. (2001). Dornschwanzagamen. Lebensweise, Pflege und 95–116. Zucht. Offenbach, Germany: Herpeton-Verlag. Stephens, M., & Scheet, P. (2005). Accounting for decay of linkage Wilms, T. (2005). Uromastyx – Natural History, Captive Care, Breeding. disequilibrium in haplotype inference and missing-data­ imputation. Offenbach, Germany: Herpeton. The American Journal of Human Genetics, 76, 449–462. https://doi. Wilms, T., & Böhme, W. (2000a). A new Uromastyx species from south-­ org/10.1086/428594 eastern Arabia, with comments on the taxonomy of Uromastyx ae- Stephens, M., Smith, N. J., & Donnelly, P. (2001). A new statistical gyptia (Forskål, 1775) (Squamata: Sauria: Agamidae). Herpetozoa, method for haplotype reconstruction from population data. The 13, 133–148. American Journal of Human Genetics, 68(4), 978–989. https://doi. Wilms, T., & Böhme, W. (2000b). Zur Taxonomie und Verbreitung org/10.1086/319501 der Arten der Uromastyx-ocellata–Gruppe (Sauria: Agamidae: Talavera, G., & Castresana, J. (2007). Improvement of phylogenies after Leiolepidinae). Zoology in the Middle East, 21, 55–76. https://doi.or removing divergent and ambiguously aligned blocks from protein g/10.1080/09397140.2000.10637834 sequence alignments. Systematic Biology, 56, 564–577. https://doi. Wilms, T., & Böhme, W. (2001). Revision der Uromastyx-acanthinura­ -­ org/10.1080/10635150701472164 Artengruppe, mit Beschreibung einer neuen Art aus der Zentralsahara Tamar, K., Carranza, S., In den Bosch, H., Sindaco, R., Moravec, J., (Reptilia: Sauria: Agamidae). Zoologische Abhandlungen Staatliches & Meiri, S. (2015). Hidden relationships and genetic diversity: Museum für Tierkunde, Dresden, 51, 73–104. Molecular phylogeny and phylogeography of the Levantine lizards Wilms, T., & Böhme, W. (2007). Review of the taxonomy of the of the genus Phoenicolacerta (Squamata: Lacertidae). Molecular spiny-­tailed lizards of Arabia (Reptilia: Agamidae: Leiolepidinae: Phylogenetics and Evolution, 91, 86–97. https://doi.org/10.1016/j. Uromastyx). Fauna of Arabia, 23, 435–468. ympev.2015.05.002 Wilms, T. M., Böhme, W., Wagner, P., Lutzmann, N., & Schmitz, A. Tamar, K., Carranza, S., Sindaco, R., Moravec, J., & Meiri, S. (2014). (2009). On the phylogeny and taxonomy of the genus Uromastyx Systematics and phylogeography of Acanthodactylus schreiberi Merrem, 1820 (Reptilia: Squamata: Agamidae: Uromastycinae): and its relationships with Acanthodactylus boskianus (Reptilia: Resurrection of the genus Saara Gray, 1845. Bonner Zoologische Squamata: Lacertidae). Zoological Journal of the Linnean Society, Beiträge, 56, 55–99. 172, 720–739. https://doi.org/10.1111/zoj.12170 Wilms, T., & Schmitz, A. (2007). A new polytypic species of the Tamar, K., Carranza, S., Sindaco, R., Moravec, J., Trape, J. F., & Meiri, S. genus Uromastyx MERREM 1820 (Reptilia: Squamata: Agamidae: (2016). Out of Africa: Phylogeny and biogeography of the widespread Leiolepidinae) from southwestern Arabia. Zootaxa, 1394, 1–23. genus Acanthodactylus (Reptilia: Lacertidae). Molecular Phylogenetics https://doi.org/10.11646/zootaxa.1394.1.1 and Evolution, 103, 6–18. https://doi.org/10.1016/j.ympev.2016.07.003 Yang, Z. (2015). The BPP program for species tree estimation and spe- Tamar, K., Scholz, S., Crochet, P.-A., Geniez, P., Meiri, S., Schmitz, cies delimitation and species delimitation. Current Zoology, 61, A., … Carranza, S. (2016). Evolution around the Red Sea: 854–865. https://doi.org/10.1093/czoolo/61.5.854 Systematics and biogeography of the agamid genus Pseudotrapelus Yang, Z., & Rannala, B. (2010). Bayesian species delimitation using (Squamata: Agamidae) from North Africa and Arabia. Molecular multilocus sequence data. Proceedings of the National Academy of Phylogenetics and Evolution, 97, 55–68. https://doi.org/10.1016/j. Sciences of the United States of America, 107, 9264–9269. https:// ympev.2015.12.021 doi.org/10.1073/pnas.0913022107 Theobald, W. (1868). Catalogue of the Reptiles of British Birma, Yang, Z., & Rannala, B. (2014). Unguided species delimitation using embracing the Provinces of Pegu, Martaban, and Tenasserim; DNA sequence data from multiple loci. Molecular Biology and with descriptions of new or little known species. Journal of Evolution, 31, 3125–3135. https://doi.org/10.1093/molbev/msu279 the Linnean Society of London, Zoology, 10, 4–67. https://doi. Zachos, J., Pagani, M., Sloan, L., Thomas, E., & Billups, K. (2001). org/10.1111/j.1096-3642.1868.tb02007.x Trends, rhythms, and aberrations in global climate 65 Ma to present. Tonini, J. F. R., Beard, K. H., Ferreira, R. B., Jetz, W., & Pyron, R. A. Science, 292, 686–693. https://doi.org/10.1126/science.1059412 (2016). Fully-­sampled phylogenies of squamates reveal evolution- ary patterns in threat status. Biological Conservation, 204, 23–31. https://doi.org/10.1016/j.biocon.2016.03.039 SUPPORTING INFORMATION Townsend, T. M., Mulcahy, D. G., Noonan, B. P., Sites, J. W., Kuczynski, C. A., Wiens, J. J., & Reeder, T. W. (2011). Phylogeny of iguanian Additional Supporting Information may be found online in lizards inferred from 29 nuclear loci, and a comparison of concat- the supporting information tab for this article. enated and species-­tree approaches for an ancient, rapid radiation. Molecular Phylogenetics and Evolution, 61, 363–380. https://doi. org/10.1016/j.ympev.2011.07.008 How to cite this article: Tamar K, Metallinou M, Uetz, P., Freed, P., & Hzrošek, J. (2017). The reptile database. Retrieved Wilms T, et al. Evolutionary history of spiny-­tailed from http://www.reptile-database.org. lizards (Agamidae: Uromastyx) from the Saharo-­ Wiens, J. J., Brandley, M. C., & Reeder, T. W. (2006). Why does a trait Arabian region. Zool Scr. 2018;47:159–173. evolve multiple times within a clade? Repeated evolution of snake- https://doi.org/10.1111/zsc.12266 like body form in squamate reptiles. Evolution, 60, 123–141. SUPPLEMENTARY MATERIAL

Evolutionary history of spiny-tailed lizards (Agamidae: Uromastyx) from the Saharo-Arabian region

KARIN TAMAR, MARGARITA METALLINOU, THOMAS WILMS, ANDREAS SCHMITZ, PIERRE-ANDRÉ CROCHET, PHILIPPE GENIEZ, SALVADOR

CARRANZA

Table S1. Data on the specimens used in this study and related GenBank accession numbers. (*) Haplotypes used for the mPTP species delimitation analysis (n=99); (#) Representatives of each mPTP cluster used for the divergence time estimations (n=18); ($) Representatives for the biogeographical analyses (n=24).

Code Sample code Voucher code1 Species Country Locality 16S cytb ND4-tRNA MC1R ACM4 NTF3 M1 E107.15 Uromastyx acanthinura Tunisia \ FJ639595 MF960539 MF993161 MF960340 MF960229 MF960440 M2 * # $ ZFMK 83816 ZFMK83816 Uromastyx acanthinura Tunisia \ FJ639592 MF960614 MF993233 MF960400 MF960300 MF960503 M3 * ZFMK83817 ZFMK83817 Uromastyx acanthinura Tunisia \ FJ639593 - MF993234 MF960401 MF960301 - M4 * ZFMK83818 ZFMK83818 Uromastyx acanthinura Tunisia \ FJ639594 MF960615 MF993235 MF960402 MF960302 MF960504 M5 * $ NSMT-H4667 NSMT-H4667 Uromastyx aegyptia aegyptia Egypt \ AB116943 AB116944 - - - - M6 * ZFMK83792 ZFMK83792 Uromastyx aegyptia aegyptia Egypt Sinai Peninsula FJ639619 - - - - - M7 * E106.27 Uromastyx aegyptia leptieni UAE Rimah-Al-Kaznah FJ639622 - - - - - M8 * $ ZFMK52398 ZFMK52398 Uromastyx aegyptia leptieni UAE Wadi Siji FJ639623 MF960595 - - - - M17 * S7349 Uromastyx aegyptia ssp. Oman Road to Madrakah, 5 km from crossroad MF980195 MF960569 MF993190 MF960368 MF960259 MF960470 M9 * BEV.10052 BEV.10052 Uromastyx aegyptia microlepis Kuwait 13 km NNE of Jahra MF980154 MF960517 MF993140 - - - M10 * # $ BEV.10053 BEV.10053 Uromastyx aegyptia microlepis Kuwait 20 km NW of Abdali MF980155 MF960518 MF993141 MF960321 MF960210 MF960421 M11 BEV.T1497 Uromastyx aegyptia microlepis Kuwait 7 km N of Al Wafrah MF980160 MF960523 MF993146 MF960326 MF960215 MF960426 M12 * BEV.T1498 Uromastyx aegyptia microlepis Kuwait 13 km NNE of Jahra MF980161 MF960524 - - - - M13 * BEV.T1499 Uromastyx aegyptia microlepis Kuwait Sabah Al-Ahmad Reserve MF980162 MF960525 MF993147 MF960327 MF960216 MF960427 M14 BEV.T1500 Uromastyx aegyptia microlepis Kuwait 4 km E of Abdali MF980163 MF960526 MF993148 MF960328 MF960217 MF960428 M15 BEV.T1508 Uromastyx aegyptia microlepis Kuwait 70 km E of Jahra MF980164 MF960527 MF993149 MF960329 MF960218 MF960429 M16 BEV.T1510 Uromastyx aegyptia microlepis Kuwait 70 km E of Jahra MF980165 MF960528 MF993150 MF960330 MF960219 MF960430 Code Sample code Voucher code1 Species Country Locality 16S cytb ND4-tRNA MC1R ACM4 NTF3 M18 * SPM001689 Uromastyx aegyptia microlepis UAE Jebel Gaddah MF980196 MF960570 MF993191 MF960369 MF960260 MF960471 M19 * SPM003103 Uromastyx aegyptia microlepis Kuwait Iraqi border, E Kuwait MF980199 MF960573 - - MF960263 - M20 TW1167 TW1167 Uromastyx aegyptia microlepis Saudi Arabia Mahazat as-Sayd MF980211 MF960585 MF993204 MF960382 MF960274 MF960484 M21 * ZFMK86567 ZFMK86567 Uromastyx aegyptia microlepis Saudi Arabia Mahazat as Sayd FJ639621 MF960630 MF993249 MF960418 MF960318 MF960514 M22 * ZFMK86573 ZFMK86573 Uromastyx aegyptia microlepis Saudi Arabia Mahazat as Sayd FJ639620 MF960631 MF993250 MF960419 MF960319 MF960515 M23* # $ BEV.10184 BEV.10184 Uromastyx alfredschmidti Algeria Tassili n'Ajjer, 13 km S of Iherir MF980156 MF960519 MF993142 MF960322 MF960211 MF960422 M24 * BEV.T2976 Uromastyx alfredschmidti Algeria Tassili n'Ajjer, 7 km NE of Tin Taghirt MF980166 MF960529 MF993151 MF960331 MF960220 MF960431 M25 * BEV.T2996 Uromastyx alfredschmidti Libya Wâdi Illalen MF980167 MF960530 MF993152 MF960332 MF960221 MF960432 M26 * BEV.T3671 Uromastyx alfredschmidti Libya 110 km NNW of Ghat, Wadi I-n-Ana MF980171 MF960534 MF993156 MF960336 MF960225 MF960436 M27 * BEV.T5533 Uromastyx alfredschmidti Libya Libyan part of the Tassili-n-Azjer MF980175 MF960538 MF993160 MF960339 MF960228 MF960439 M28 * ZFMK73680 ZFMK73680 Uromastyx benti Oman Vicinity of Mirbat EF081057 MF960601 MF993218 - - - M29 * ZFMK73681 ZFMK73681 Uromastyx benti Oman Vicinity of Mirbat EF081055 MF960602 MF993219 - MF960287 MF960495 M30 * # $ ZFMK83347 ZFMK83347 Uromastyx benti Oman Vicinity of Mirbat EF081056 MF960603 MF993220 MF960393 MF960288 MF960496 M31 * ZFMK83801 ZFMK83801 Uromastyx benti Oman Vicinity of Mirbat EF081054 - MF993226 MF960395 MF960293 - M33 * NSMT-H4682 NSMT-H4682 Uromastyx dispar dispar Sudan \ AB116939 AB116940 - - - - M34 * RIM059 Uromastyx dispar flavifasciata Mauritania 65Km S of Atar (Adrar) MF980176 MF960550 - - MF960240 MF960451 M35 RIM061 Uromastyx dispar flavifasciata Mauritania 65Km S of Atar (Adrar) MF980177 MF960551 MF993172 MF960350 MF960241 MF960452 M36 RIM062 Uromastyx dispar flavifasciata Mauritania 65Km S of Atar (Adrar) MF980178 MF960552 MF993173 MF960351 MF960242 MF960453 M37 * RIM068 Uromastyx dispar flavifasciata Mauritania Terjit (Adrar) MF980179 MF960553 MF993174 MF960352 MF960243 MF960454 M38 RIM069 Uromastyx dispar flavifasciata Mauritania Oued Seguelil (Adrar) MF980180 MF960554 MF993175 MF960353 MF960244 MF960455 M39 * RIM089 Uromastyx dispar flavifasciata Mauritania Between Guelb Er Richat and El Beyyed (Adrar) MF980181 MF960555 MF993176 MF960354 MF960245 MF960456 M40 * RIM090 Uromastyx dispar flavifasciata Mauritania Between El Beyed and Atar (Adrar) MF980182 MF960556 MF993177 MF960355 MF960246 MF960457 M41 * RIM101 Uromastyx dispar flavifasciata Mauritania Oued Choum (Adrar) MF980183 MF960557 MF993178 MF960356 MF960247 MF960458 M42 * RIM108 Uromastyx dispar flavifasciata Mauritania Zouerat (Tiris Zemmour) MF980184 MF960558 MF993179 MF960357 MF960248 MF960459 M43 RIM115 Uromastyx dispar flavifasciata Mauritania Oued Choum (Adrar) MF980185 MF960559 MF993180 MF960358 MF960249 MF960460 M44 * RIM136 Uromastyx dispar flavifasciata Mauritania Boudarga MF980186 MF960560 MF993181 MF960359 MF960250 MF960461 M45 * RIM153 Uromastyx dispar flavifasciata Mauritania Between Aghoueyyt and Inal MF980187 MF960561 MF993182 MF960360 MF960251 MF960462 M46 RIM154 Uromastyx dispar flavifasciata Mauritania Between Aghoueyyt and Inal MF980188 MF960562 MF993183 MF960361 MF960252 MF960463 M47 RIM155 Uromastyx dispar flavifasciata Mauritania Between Aghoueyyt and Inal MF980189 MF960563 MF993184 MF960362 MF960253 MF960464 M48 RIM157 Uromastyx dispar flavifasciata Mauritania 4 km SW of Choum MF980190 MF960564 MF993185 MF960363 MF960254 MF960465 M49 * RIM160 Uromastyx dispar flavifasciata Mauritania Dahr Chinguetti, between Atar and Tidjikja MF980191 MF960565 MF993186 MF960364 MF960255 MF960466 M50 RIM161 Uromastyx dispar flavifasciata Mauritania Dahr Chinguetti, between Atar and Tidjikja MF980192 MF960566 MF993187 MF960365 MF960256 MF960467 M51 * RIM223 Uromastyx dispar flavifasciata Mauritania Oualata MF980193 MF960567 MF993188 MF960366 MF960257 MF960468 M52 * $ S11164 Uromastyx dispar dispar Egypt SW Egypt MF980194 MF960568 MF993189 MF960367 MF960258 MF960469 M53 * TW1174 TW1174 Uromastyx dispar dispar Chad Zouar MF980215 MF960589 MF993208 MF960386 MF960278 MF960488 Code Sample code Voucher code1 Species Country Locality 16S cytb ND4-tRNA MC1R ACM4 NTF3 M54 * TW1175 TW1175 Uromastyx dispar dispar Chad Fada MF980216 MF960590 MF993209 MF960387 MF960279 MF960489 M55 TW1177 TW1177 Uromastyx dispar dispar Chad Zouar MF980218 MF960592 MF993211 MF960389 MF960281 MF960490 M56 ZFMK84437 ZFMK84437 Uromastyx dispar dispar Chad Zouar, Tibesti Mountains FJ639600 MF960623 MF993241 - - - M57 * ZFMK84800 ZFMK84800 Uromastyx dispar dispar Chad Zouar, Tibesti Mountains FJ639600 - - MF960414 MF960314 - M77 * BEV.10840 BEV.10840 Uromastyx dispar flavifasciata Western Sahara 9 km S of Awsard MF980157 MF960520 MF993143 MF960323 MF960212 MF960423 M78 * # $ BEV.9144 BEV.9144 Uromastyx dispar flavifasciata Mauritania Atar-Choum MF980158 MF960521 MF993144 MF960324 MF960213 MF960424 M79 * BEV.T1207 Uromastyx dispar flavifasciata Mauritania 97 km SE of Pozo Bu Lanuar MF980159 MF960522 MF993145 MF960325 MF960214 MF960425 M80 * BEV.T346 Uromastyx dispar flavifasciata Mauritania 56 km WSW of Ouadane (Adrar) MF980169 MF960532 MF993154 MF960334 MF960223 MF960434 M81 * BEV.T347 Uromastyx dispar flavifasciata Mauritania 12 km N of Atar (Adrar) MF980170 MF960533 MF993155 MF960335 MF960224 MF960435 M82 BEV.T3676 Uromastyx dispar flavifasciata Western Sahara 7.6 km S of Awsard MF980172 MF960535 MF993157 - - - M58 E133.10 Uromastyx dispar flavifasciata Mauritania Atar-Choum FJ639615 MF960541 MF993163 MF960341 MF960231 MF960442 M59 E133.11 Uromastyx dispar flavifasciata Mauritania 26 km NW of Atar FJ639611 MF960542 MF993164 MF960342 MF960232 MF960443 M60 E133.2 Uromastyx dispar flavifasciata Mauritania 33 km SW of Choum FJ639607 MF960543 MF993165 MF960343 MF960233 MF960444 M61 * E133.3 Uromastyx dispar flavifasciata Mauritania Aghmakoum-El Beyed FJ639608 MF960544 MF993166 MF960344 MF960234 MF960445 M62 * E133.6 Uromastyx dispar flavifasciata Mauritania S of Choum FJ639612 MF960545 MF993167 MF960345 MF960235 MF960446 M63 * E133.7 Uromastyx dispar flavifasciata Mauritania S of Choum FJ639613 MF960546 MF993168 MF960346 MF960236 MF960447 M64 E133.8 Uromastyx dispar flavifasciata Mauritania 33 km SW of Choum FJ639614 MF960547 MF993169 MF960347 MF960237 MF960448 M65 E133.9 Uromastyx dispar flavifasciata Mauritania 26 km NW of Atar FJ639609 MF960548 MF993170 MF960348 MF960238 MF960449 M66 * SPM002896 Uromastyx dispar flavifasciata Algeria Tindouf MF980198 MF960572 MF993193 MF960371 MF960262 MF960471 M67 TW1158 TW1158 Uromastyx dispar flavifasciata Mauritania Adrar Mountains MF980203 MF960577 MF993196 MF960374 MF960266 MF960476 M68 ZFMK73500 ZFMK73500 Uromastyx dispar flavifasciata Mauritania Atar FJ639602 MF960598 - - - - M69 ZFMK83824 ZFMK83824 Uromastyx dispar flavifasciata Mauritania Captive bred (Atar- Akjoujt) FJ639601 MF960618 MF993238 MF960407 MF960306 MF960507 M70 ZFMK84261 ZFMK84261 Uromastyx dispar flavifasciata Algeria Tindouf FJ639603 MF960621 MF993240 MF960409 - - M71 * ZFMK84262 ZFMK84262 Uromastyx dispar flavifasciata Algeria Tindouf FJ639604 MF960622 - - - - M72 * ZFMK85163 ZFMK85163 Uromastyx dispar flavifasciata Mauritania Captive bred (Atar- Akjoujt) FJ639605 MF960627 MF993246 MF960415 MF960315 MF960511 M73 * ZFMK86473 ZFMK86473 Uromastyx dispar flavifasciata Mauritania Vicinity of Atar (Adrar) FJ639606 MF960628 MF993247 MF960416 MF960316 MF960512 M74 * ZFMK86474 ZFMK86474 Uromastyx dispar flavifasciata Mauritania Northern Mauritania FJ639610 MF960629 MF993248 MF960417 MF960317 MF960513 M75 * $ TR2284 TR2284 Uromastyx dispar hodhensis Mauritania \ MF980201 MF960575 - - - - M76 * $ ZFMK71647 ZFMK71647 Uromastyx dispar maliensis Mali \ FJ639616 MF960597 - MF960391 MF960285 MF960493 M83 * # $ BEV.T4132 Uromastyx geyri Algeria Oued Tahar MF980173 MF960536 MF993158 MF960337 MF960226 MF960437 M84 BEV.T4133 Uromastyx geyri Algeria Oued Tahar MF980174 MF960537 MF993159 MF960338 MF960227 MF960438 M85 * NSMT-H4677 NSMT-H4677 Uromastyx geyri Mali \ AB474754 AB474755 - - - - M86 * ZFMK83821 ZFMK83821 Uromastyx geyri Niger Kafadek, near Agadez FJ639617 - MF993237 MF960405 MF960305 - M87 * ZFMK83822 ZFMK83822 Uromastyx geyri Niger Kafadek, near Agadez FJ639618 MF960617 - MF960406 - MF960506 88 * NSMT-H4675 NSMT-H4675 Uromastyx macfadyeni Somalia \ AB116945 AB116946 - - - - Code Sample code Voucher code1 Species Country Locality 16S cytb ND4-tRNA MC1R ACM4 NTF3 M89 * # $ ZFMK84440 ZFMK84440 Uromastyx macfadyeni Somalia North Somalia EF081043 MF960625 MF993243 MF960411 MF960311 MF960509 M90 * ZFMK84441 ZFMK84441 Uromastyx macfadyeni Somalia North Somalia EF081042 - MF993244 MF960412 MF960312 - M91 * 14022012B Uromastyx nigriventris Morocco Timiright MF980153 MF960516 MF993139 MF960320 MF960209 MF960420 M92 * SPM004950 Uromastyx nigriventris Morocco 30 km E Tata MF980200 MF960574 MF993194 MF960372 MF960264 MF960474 M93 * TW1178 TW1178 Uromastyx nigriventris Morocco Izilf MF980219 MF960593 MF993212 MF960390 MF960282 MF960492 M94 * ZFMK83819 ZFMK83819 Uromastyx nigriventris Morocco Guelmin FJ639598 MF960616 MF993236 MF960403 MF960303 MF960505 M95 * ZFMK83820 ZFMK83820 Uromastyx nigriventris Morocco \ FJ639597 - - MF960404 MF960304 - M96 * # $ ZFMK84438 ZFMK84438 Uromastyx nigriventris Morocco Guelmin FJ639599 MF960624 MF993242 MF960410 MF960310 MF960508 M97 * # $ BEV.T3076 Uromastyx ocellata Egypt Wadi el Rada, 16 km E of Hamata MF980168 MF960531 MF993153 MF960333 MF960222 MF960433 M98 * NSMT303 NSMT DNA 303 Uromastyx ocellata Egypt \ AB116947 AB116948 - - - - M99 * TW1165 TW1165 Uromastyx ocellata \ Pet trade MF980210 MF960584 MF993203 MF960381 MF960273 MF960483 M100 * ZFMK83798 ZFMK83798 Uromastyx ocellata Sudan \ EF081044 - MF993224 MF960394 MF960291 - M101 * ZFMK83799 ZFMK83799 Uromastyx ocellata Sudan \ EF081045 MF960608 MF993225 - MF960292 MF960497 M102 * TW1164 TW1164 Uromastyx ornata ornata \ Pet trade MF980209 MF960583 MF993202 MF960380 MF960272 MF960482 M103 * ZFMK83812 ZFMK83812 Uromastyx ornata ornata Egypt Sinai Peninsula EF081052 MF960612 MF993230 - MF960297 MF960501 M104 * $ ZFMK83813 ZFMK83813 Uromastyx ornata ornata Egypt Sinai Peninsula EF081053 MF960613 MF993231 MF960398 MF960298 MF960502 M105 * ZFMK83815 ZFMK83815 Uromastyx ornata ornata Egypt Sinai Peninsula EF081051 - MF993232 MF960399 MF960299 - M106 * # $ TW1159 TW1159 Uromastyx ornata philbyi Saudi Arabia El-Olubah MF980204 MF960578 MF993197 MF960375 MF960267 MF960477 M107 * TW1160 TW1160 Uromastyx ornata philbyi Saudi Arabia El-Olubah MF980205 MF960579 MF993198 MF960376 MF960268 MF960478 M108 * TW1161 TW1161 Uromastyx ornata philbyi Saudi Arabia El-Olubah MF980206 MF960580 MF993199 MF960377 MF960269 MF960479 M109 * TW1162 TW1162 Uromastyx ornata philbyi Saudi Arabia El-Olubah MF980207 MF960581 MF993200 MF960378 MF960270 MF960480 M110 TW1163 TW1163 Uromastyx ornata philbyi Saudi Arabia El-Olubah MF980208 MF960582 MF993201 MF960379 MF960271 MF960481 M111 TW1168 TW1168 Uromastyx ornata philbyi Saudi Arabia El-Olubah MF980212 MF960586 MF993205 MF960383 MF960275 MF960485 M112 TW1169 TW1169 Uromastyx ornata philbyi Saudi Arabia El-Olubah MF980213 MF960587 MF993206 MF960384 MF960276 MF960486 M113 * TW1173 TW1173 Uromastyx ornata philbyi Saudi Arabia El-Olubah MF980214 MF960588 MF993207 MF960385 MF960277 MF960487 M114 * ZFMK84442 ZFMK84442 Uromastyx ornata philbyi Saudi Arabia Tihama EF081046 MF960626 MF993245 MF960413 MF960313 MF960510 M115 * # $ ZFMK58048 ZFMK58048 Uromastyx princeps Somalia Bossasso FJ639625 MF960596 MF993213 - MF960284 - M116 * ZFMK58985 ZFMK58985 Uromastyx princeps Somalia Bossasso FJ639624 - MF993214 - - - M117 * ZFMK48681 ZFMK48681 Uromastyx shobraki Yemen Between Mafraq and Mocca EF081067 MF960594 - - MF960283 - M118 * # $ ZFMK73675 ZFMK73675 Uromastyx shobraki Yemen Mokka EF081068 MF960599 MF993215 MF960392 MF960286 MF960494 M119 * ZFMK73676 ZFMK73676 Uromastyx shobraki Yemen Mocca EF081066 MF960600 MF993216 - - - M120 * ZFMK73677 ZFMK73677 Uromastyx shobraki Yemen Mocca EF081065 - MF993217 - - - M121 * # $ TW1157 TW1157 Uromastyx thomasi Oman Masirah Island MF980202 MF960576 MF993195 MF960373 MF960265 MF960475 M122 * TW1176 TW1176 Uromastyx thomasi Oman Masirah Island MF980217 MF960591 MF993210 MF960388 MF960280 MF960490 M123 * ZFMK83830 ZFMK83830 Uromastyx thomasi Oman Vicinity of Ras Hilf, Masirah Island FJ639626 - MF993239 MF960408 MF960307 - Code Sample code Voucher code1 Species Country Locality 16S cytb ND4-tRNA MC1R ACM4 NTF3 M124 * ZFMK83837 ZFMK83837 Uromastyx thomasi Oman Vicinity of Ras Hilf, Masirah Island FJ639627 MF960619 - - MF960308 - M125 * ZFMK83838 ZFMK83838 Uromastyx thomasi Oman Vicinity of Ras Hilf, Masirah Island FJ639628 MF960620 - - MF960309 - M32 * NSMT-H4670 NSMT-H4670 Uromastyx yemenensis Yemen \ AB114447 AB114447 AB114447 - - - M126 * ZFMK47861 ZFMK47861 Uromastyx yemenensis Yemen Abian EF081058 - - - - - M127 * ZFMK83805 ZFMK83805 Uromastyx yemenensis Yemen \ EF081059 MF960609 MF993227 - MF960294 MF960498 M128 * ZFMK83806 ZFMK83806 Uromastyx yemenensis Yemen \ EF081060 MF960610 MF993228 MF960396 MF960295 MF960499 M129 * # $ ZFMK83807 ZFMK83807 Uromastyx yemenensis Yemen \ EF081061 MF960611 MF993229 MF960397 MF960296 MF960500 M130 # $ NMP6V 73519 NMP6V 73519 Saara asmussi Iran \ FJ639585 MF960549 MF993171 MF960349 MF960239 MF960450 M131 # $ E112.2 Saara hardwickii \ \ FJ639591 MF960540 MF993162 - MF960230 MF960441 M132 # $ SPM002104 Saara hardwickii India/Pakistan \ MF980197 MF960571 MF993192 MF960370 MF960261 MF960472 M133 ZFMK83794 ZFMK83794 Saara hardwickii \ \ FJ639589 MF960604 MF993221 - MF960289 - M134 ZFMK83795 ZFMK83795 Saara hardwickii \ \ FJ639588 MF960605 MF993222 - MF960290 - M135 ZFMK83796 ZFMK83796 Saara hardwickii \ \ FJ639590 MF960606 MF993223 - - - M136 ZFMK83797 ZFMK83797 Saara hardwickii \ \ FJ639587 MF960607 - - - - M137 # $ ZFMK87396 ZFMK87396 Saara loricata Iran \ FJ639586 MF960632 MF993251 - - - Acanthosaura lepidogaster KR092427 KR092427 KR092427 - - JF804531 Calotes versicolor AB183287 AB183287 AB183287 - - JX839246 Chamaeleo calyptratus NC_012420 NC_012420 NC_012420 - - GU456003 Ctenophorus adelaidensis - - - - - JF804566 Ctenophorus isolepis - - - - - JF804543 Hydrosaurus amboinensis AB475096 AB475096 AB475096 - - JF804549 Intellagama lesueurii AB031991 - - - - JF804562 Leiolepis belliana AB537554 AB537554 AB537554 - - JF804552 Phrynocephalus mystaceus KC578685 KC578685 KC578685 - - JF804558 Pogona vitticeps AB166795 AB166795 AB166795 - - JF804563 Trapelus boehmei JX668221 - JX857619 KU097647 - JX839250

1 Voucher code abbreviations: [BEV] Laboratoire de Biogéographie et Écologie des Vertébrés de l'École Pratique des Hautes Etudes, Centre d’Écologie Fonctionnelle et Évolutive, Montpellier, France; [NMP6V] National Museum (Natural History), Prague, Czech Republic; [NSMT] National Science Museum of Tokyo, Japan (from Amer & Kumazawa, 2009); [TR] Private collection of Jean-François Trape, Dakar, Senegal; [TW] Private collection of Thomas Wilms, Münster, Germany; [ZFMK] Zoologisches Forschungsmuseum Alexander Koenig, Bonn, Germany. Table S2. Data on the gene fragments used in this study, including the primers used, with their orientation, sequences, references and PCR conditions.

Gene Primer Sequence (5’-3’) Reference PCR Conditions

16Sa F: CGCCTGTTTATCAAAAACAT 16S Palumbi et al. (1991) 94°C (5’), [94°C (30’’), 48°C (45’’), 72°C (70’’)] x35, 72°C (5’) 16Sb R: CCGGTCTGAACTCAGATCACGT Cytb1 F: TCCAACATCTCAGCATGATGAAA cytb Kocher et al. (1989) 94°C (5’), [94°C (30’’), 50°C (45’’), 72°C (1’)] x34, 72°C (5’) Cytb2 R: CCCTCAGAATGATATTTGTCCTCA ND4 F: CACCTATGACTACCAAAAGCTCATGTAGAAGC ND4+tRNA Arévalo et al. (1994) 94°C (5’), [94°C (30’’), 52°C (45’’), 72°C (70’’)] x34, 72°C (5’) Leu R: CATTACTTTTACTTGGATTTGCACCA MC1RF F: AGGCNGCCATYGTCAAGAACCGGAACC MC1R Pinho et al. (2009) 94°C (5’), [94°C (30’’), 52°C (45’’), 72°C (80’’)] x40, 72°C (5’) MC1RR R: CTCCGRAAGGCRTAAATGATGGGGTCCAC Tg-F F: CAAGCCTGAGAGCAARAAGG ACM4 Gamble et al. (2008) 94°C (5’), [94°C (30’’), 54°C (45’’), 72°C (80’’)] x40, 72°C (5’) Tg-R R: ACYTGACTCCTGGCAATGCT NTF3_f1 F:ATGTCCATCTTGTTTTATGTGATATTT NTF3 Townsend et al. (2008) 94°C (5’), [94°C (30’’), 50°C (45’’), 72°C (80’’)] x40, 72°C (5’) NTF3_r1 R:ACRAGTTTRTTGTTYTCTGAAGTC

References Arevalo, E., Davis, S.K. & Sites, J.W. (1994). Mitochondrial DNA sequence divergence and phylogenetic relationships among eight chromosome races of the Sceloporus Grammicus complex (Phrynosomatidae) in Central Mexico. Systematic Biology, 43, 387–418. Gamble, T., Bauer, A.M., Greenbaum, E. & Jackman, T.R. (2008). Evidence of Gondwanan vicariance in an ancient clade of geckos. Journal of Biogeography, 35, 88–104. Kocher, T.D., Thomas, W.K., Meyer, A., Edwards, S.V., Pääbo, S., Villablanca, F.X. & Wilson, A.C. (1989). Dynamics of mitochondrial DNA evolution in animals: amplification and sequencing with conserved primers. Proceedings of the National Academy of Sciences of the United States of America, 86, 6196–6200. Palumbi, S.R., Martin, A., Romano, S., McMillan, W.S., Stice, S. & Grabowski, G. (1991). The Simple Fool’s Guide to PCR. University of Hawaii Press, Honolulu. Pinho, C., Rocha, S., Carvalho, B.M., Lopes, S., Mourao, S., Vallinoto, M., Brunes, T.O., Haddad, C.F.B., Goncalves, H., Sequeira, F. & Ferrand, N. (2009(. New primers for the amplification and sequencing of nuclear loci in a taxonomically wide set of reptiles and amphibians. Conservation Genetics Resources, 2(S1), 181–185. Townsend, T.M., Alegre, E., Kelley, S.T., Wiens, J.J. & Reeder, T.W. )2008(. Rapid development of multiple nuclear loci for phylogenetic analysis using genomic resources: an example from squamate reptiles. Molecular Phylogenetics and Evolution, 47, 129–142.

Table S3. Partitions and models selected by PartitionFinder for the different concatenated Bayesian analyses.

Models Partition Phylogenetic Divergence time estimates Divergence time estimates BSSVS analyses (including other agamids) (Uromastycinae only) (Uromastycinae only) 16S, cytb_1st, ND4_1st, tRNAs GTR+G GTR+G GTR+G GTR+G cytb_2nd, ND4_2nd HKY+I GTR+G HKY+I HKY+I cytb_3rd, ND4_3rd GTR+G GTR+G GTR+G GTR+G ACM4_1st+2nd, MC1R_1st, NTF3_1st+2nd HKY+I HKY+G HKY+G HKY+I MC1R _2nd HKY HKY HKY HKY MC1R _3rd GTR+I TrN GTR+I GTR+I ACM4 _3rd, NTF3_3rd K80+G K80+G K80+G K80+G

Table S4. Pairwise uncorrected mitochondrial sequence divergence (p-distance). (A) Among and within Uromastyx taxa. Values derived from the mitochondrial genes fragments of 16S (above the diagonal) and cytb/ND4 (below the diagonal); and within each taxon (in bold; 16S/cytb/ND4). (B) Within the taxa U. aegyptia and U. ornata (16S, above the diagonal; cytb/ND4, below the diagonal).

(A) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 1. U. acanthinura 0.1/0/0 8.2 2.7 7.7 1.4 2.7 7.3 1.5 9.2 8.7 7.8 8.4 9.1 8.8 2. U. aegyptia 15.6/14.2 0.2/0.8/0.2 9.3 9.7 7.9 8.4 11.3 8.2 10.7 10.1 10.8 9.8 9.9 11.1 3. U. alfredschmidti 7.6/9.3 14.7/14.5 0.1/0.1/0.3 8.9 3.2 2 8 2.5 9.7 9.7 8.5 9.2 9.9 9.4 4. U. benti 15/15.3 14.6/13.6 12.4/16.8 0.2/0/0.1 7.9 8.4 9.5 8 8.2 7.3 11.2 2.5 10.5 3 5. U. dispar 6.3/6.4 14.8/12.8 8.4/8.5 14.1/15.2 0.2/0.6/0.2 2.7 7.6 1.1 9.3 8.4 7.6 8.2 9 8.8 6. U. geyri 8 /9.4 14.9/12.7 3.5/4.8 13.2/15 9.1/8 1.4/0.2/0 8.1 2.4 9.8 9.4 8 8.9 9.9 9.5 7. U. macfadyeni 12.2/15.6 16.1/14.6 12.2/16.2 14/18.1 15/15.9 11.2/15.8 0.2/0.4/0 7.4 11.2 11.3 8.6 9.5 9.6 9.9 8. U. nigriventris 4.6/7 16.2/13 8.2/10 14.8/15 6.4/6.9 8.5/8.9 13.7/16.3 0.2/0.5/0.3 9 8.5 7.6 8.5 8.8 8.8 9. U. ocellata 15.9/14.3 15.3/10.6 15.6/15.7 11.6/13 16.4/13.5 14.6/14.8 15.3/15.9 16.1/15 0.1/0.2/0.3 5.3 12.9 8.1 11.1 8.4 10. U. ornata 16.5/14.4 13.4/12.4 14.6/15.4 11/12.6 16.3/13.6 14.1/15 13.6/16 15.6/14.2 9.2/9.7 0.9/1.5/2 12 7.6 10.5 7.5 11. U. princeps 12.7/15.6 16.6/14.5 14.1/15.5 16/15.5 14.8/14.1 13.2/15.3 9.3/14.3 13.5/15.2 16/14.3 15.9/14.9 0.2/ NC/0.7 11.5 11 11.7 12. U. shobraki 14.9/13.9 16/12.6 12.9/15.5 7.7/6 15.2/13.4 13.6/14.1 15.6/17.6 16/13.6 11.4/11.6 12.6/11.7 17.9/14 0/0.4/0.1 11 2.1 13. U. thomasi 13.1/15.2 18.5/13.4 15.1/16.7 17.3/14.1 14.8/15.7 15.5/15.9 13.1/17.5 14.3/15.9 16.9/13.4 16.4/13.7 14.7/16.1 17.9/15.5 0.1/0/0.1 10.9 14. U. yemenensis 16.1/15.1 16.8/11.8 14.7/15.3 7.6/5.8 17.5/14.2 15/14.1 14.6/16.6 17.1/14.1 11.9/11.8 13.4/12.4 16.7/13.9 6.8/5.9 16.7/14.6 0.2/0.2/0.2

(B) U. aegyptia aegyptia U. aegyptia leptieni U. aegyptia microlepis U. ornata ornata U. ornata philbyi U. aegyptia aegyptia --- 0.9 0.3 U. ornata ornata --- 1.6 U. aegyptia leptieni 2.3/- --- 0.5 U. ornata philbyi 3/3.8 --- U. aegyptia microlepis 1.6/- 2.4/- ---

Table S5. Divergence time estimations for the Uromastycinae taxa based on the different calibrations (see Material and Methods; estimated node ages and the 95% highest posterior densities; see Figs. S2–S3).

Multilocus species-tree Concatenated data Concatenated data Concatenated data Node (Uromastyx europaeus fossil) (Uromastyx europaeus fossil) (7 calibration points) (8 calibration points) Median 95% HPD Median Median 95% HPD Median 95% HPD Median 95% HPD Uromastycinae root 29.6 28–35.9 Middle Oligocene 29.4 28–35.2 30.3 26.5–34.3 30.1 28–33.2 Saara root 16.6 12.4–22 Middle Miocene 17.2 13.9–21.7 18.6 15.8–21.8 18.6 16–21.5 S. asmussi-S. loricata ------5.4 3.7–7.3 6.1 4.6–7.7 6 4.7–7.6 S. hardwickii ------2.4 1.6–3.4 2.8 2–3.7 2.8 2–3.7 Uromastyx root (U. thomasi) 16.3 12.8–20.9 Middle Miocene 16.3 13.2–20.2 18.1 15.9–20.5 18 16–20.1 U. aegyptia 14.3 11–18.2 Middle Miocene 13.9 11.1–17.4 15.7 13.5–17.9 15.6 13.7–17.8 U. ocellata group root 9.9 7.4–13 Late Miocene 10.4 8.2–13.2 11.9 10.1–13.8 11.9 10.3–13.7 U. ocellata-U. ornata 5.8 3.8–8 Late Miocene 6.2 4.5–8 7.2 5.9–8.7 7.2 5.9–8.6 U. shobraki-U. benti-U. yemenensis 3.8 2.5–5.3 Pliocene 3.8 2.7–5 4.1 3.3–5.1 4.1 3.3–5 U. princeps-U. macfadyeni ------10.3 7.7–13.2 11.7 9.6–14.1 11.7 9.7–14 U. acanthinura group root 4.1 2.4–5.9 Pliocene 4.5 3.3–5.8 5.3 4.3–6.4 5.3 4.3–6.4 U. dispar 2.8 1.8–4 Pliocene 2.9 2.1–3.9 3.4 2.7–4.2 3.4 2.7–4.2 U. acanthinura-U. nigriventris 2.4 1.3–3.6 Pleistocene 2.5 1.7–3.4 2.9 2.2–3.7 2.9 2.2–3.6 U. geyri-U. alfredschmidti 0.23 0.05–0.5 Pleistocene 1.6 1–2.3 1.9 1.4–2.6 1.9 1.4–2.6

Table S6. BioGeoBEARS results of the competing models (DEC; DIVA; BayArea) of ancestral-area estimation for the concatenated data of Uromastycinae. The best model is in bold. Results of each analysis are presented in Fig. S4.

Relative probability Model LnL No. of parameters (n) Rate of dispersal (d) Rate of Extinction (e) AIC AIC_wt AICc AICc_wt of founder-event speciation (j) DEC -21.46 2 0.0036 1.0e-12 0 46.92 0.016 47.49 0.022 DEC+J -17.42 3 1.0e-12 1.0e-12 0.0335 40.84 0.34 42.04 0.34 DIVALIKE -20.99 2 0.0060 1.0e-12 0 45.98 0.026 46.55 0.035 DIVALIKE+J -16.92 3 1.0e-12 1.0e-12 0.0388 39.83 0.57 41.03 0.56 BAYAREALIKE -32.09 2 0.0019 0.0477 0 68.18 4.0e-07 68.75 5.3e-07 BAYAREALIKE+J -19.34 3 1.0e-07 1.0e-07 0.0472 44.68 0.050 45.88 0.049

M6 - U. aegyptia aegyptia - Egypt M5 - U. aegyptia aegyptia - Egypt M17 - U. aegyptia leptieni - Oman M8 - U. aegyptia leptieni - UAE M7 - U. aegyptia leptieni - UAE M22 - U. aegyptia microlepis - Saudi Arabia M18 - U. aegyptia microlepis - UAE U. aegyptia M10 - U. aegyptia microlepis - Kuwait M9 - U. aegyptia microlepis - Kuwait * M13 - U. aegyptia microlepis - Kuwait M12 - U. aegyptia microlepis - Kuwait M19 - U. aegyptia microlepis - Kuwait U. thomasi M21 - U. aegyptia microlepis - Saudi Arabia U. thomasi M30 - U. benti - Oman * M29 - U. benti - Oman U. aegyptia M31 - U. benti - Oman U. benti U. aegyptia M28 - U. benti - Oman M119 - U. shobraki - Yemen M117 - U. shobraki - Yemen 0.82 U. benti M120 - U. shobraki - Yemen U. shobraki 1 1 M118 - U. shobraki - Yemen * M126 - U. yemenensis - Yemen 0.83 U. shobraki M32 - U. yemenensis - Yemen U. ocellata M129 - U. yemenensis - Yemen 1 M127 - U. yemenensis - Yemen * U. yemenensis U. yemenensis M128 - U. yemenensis - Yemen group M98 - U. ocellata - Egypt U. ocellata M97 - U. ocellata - Egypt * 0.39 1 M100 - U. ocellata - Sudan U. ocellata M99 - U. ocellata U. ornata M101 - U. ocellata - Sudan M103 - U. ornata ornata - Egypt M105 - U. ornata ornata U. princeps M104 - U. ornata ornata - Egypt U. macfadyeni group M102 - U. ornata ornata - Egypt M114 - U. ornata philbyi - Saudi Arabia M113 - U. ornata philbyi - Saudi Arabia U. ornata 0.93 1 U. geyri M109 - U. ornata philbyi - Saudi Arabia M106 - U. ornata philbyi - Saudi Arabia M107 - U. ornata philbyi - Saudi Arabia * U. alfredschmidti M108 - U. ornata philbyi - Saudi Arabia 1 M123 - U. thomasi - Oman U. acanthinura M122 - U. thomasi - Oman 0.66 U. acanthinura group M125 - U. thomasi - Oman U. thomasi M121 - U. thomasi - Oman 0.95 M124 - U. thomasi - Oman * U. nigriventris M115 - U. princeps - Somalia M116 - U. princeps - Somalia * U. princeps M88 - U. macfadyeni - Somalia 0.02 U. dispar M90 - U. macfadyeni - Somalia U. macfadyeni M89 - U. macfadyeni - Somalia * M87 - U. geyri - Niger M85 - U. geyri - Mali M86 - U. geyri - Niger U. geyri M83 - U. geyri - Algeria * M24 - U. alfredschmidti - Algeria M27 - U. alfredschmidti - Libya M23 - U. alfredschmidti - Algeria U. alfredschmidti M26 - U. alfredschmidti - Libya * M25 - U. alfredschmidti - Libya M3 - U. acanthinura - Tunisia M2 - U. acanthinura - Tunisia U. acanthinura M4 - U. acanthinura - Tunisia * M92 - U. nigriventris - Morocco M93 - U. nigriventris - Morocco M95 - U. nigriventris - Morocco M91 - U. nigriventris - Morocco U. nigriventris M94 - U. nigriventris - Morocco M96 - U. nigriventris - Morocco M75 - U. dispar hodhensis - Mauritania* M51 - U. dispar avifasciata - Mauritania M61 - U. dispar avifasciata - Mauritania M40 - U. dispar avifasciata - Mauritania M39 - U. dispar avifasciata - Mauritania M62 - U. dispar avifasciata - Mauritania M66 - U. dispar avifasciata - Algeria M71 - U. dispar avifasciata - Algeria M42 - U. dispar avifasciata - Mauritania M76 - U. dispar maliensis - Mali M52 - U. dispar dispar - Egypt M54 - U. dispar dispar - Chad Figure S1. mPTP results (left) and *BEAST species-tree (right) of Uromastyx. M57 - U. dispar dispar - Chad M53 - U. dispar dispar - Chad M33 - U. dispar dispar - Sudan The mPTP results were inferred from the concatenated mitochondrial haplotype M79 - U. dispar avifasciata - Mauritania U. dispar M45 - U. dispar avifasciata - Mauritania M44 - U. dispar avifasciata - Mauritania dataset. Asterisks represent specimens used for the divergence time estimation M34 - U. dispar avifasciata - Mauritania M77 - U. dispar avifasciata - Morocco analyses. Sample codes and colours correlate to specimens in Table S1 and Figs. 1–2. M37 - U. dispar avifasciata - Mauritania M74 - U. dispar avifasciata - Mauritania M49 - U. dispar avifasciata - Mauritania The species-tree is based on the mPTP putative species (Uromastyx princeps was M41 - U. dispar avifasciata - Mauritania M63 - U. dispar avifasciata - Mauritania M80 - U. dispar avifasciata - Mauritania excluded due to incomplete dataset). Posterior probability values are indicated M73 - U. dispar avifasciata - Mauritania M72 - U. dispar avifasciata - Mauritania M81 - U. dispar avifasciata - Mauritania near the nodes. M78 - U. dispar avifasciata - Mauritania * Chamaeleo calyptratus 2.8 M131 - Saara hardwickii 18.6 2.8 M132 - Saara hardwickii 2.4 18.6 6 M130 - Saara asmussi 17.2 6.1 M137 - Saara loricata 30.1 5.4 M121 - U. thomasi 30.3 85.1 29.4 M10 - U. aegyptia 85.2 15.6 M118 - U. shobraki 18 4.1 15.7 3.8 4.1 M30 - U. benti 18.1 13.9 16.3 11.9 3.3 M129 - U. yemenensis 11.9 3.3 3 10.4 7.2 M97 - U. ocellata 17.3 7.2 M106 - U. ornata 17.4 6.2 15.6 11.7 M115 - U. princeps 80.1 11.7 M89 - U. macfadyeni 80.2 10.3 15.7 1.9 M83 - U. geyri 15.7 1.9 13.9 M23 - U. alfredschmidti 5.3 1.6 2.9 5.3 2.9 M2 - U. acanthinura 4.5 2.5 M96 - U. nigriventris 3.4 3.4 2.9 M78 - U. dispar Leiolepis belliana 75 Hydrosaurus amboinensis 5 75.1 29.6 Calotes versicolor 67 1 3 62.4 29.6 Acanthosaura lepidogaster 67.1 4 2 62.4 39.5 Phrynocephalus mystaceus 65.2 39.6 Trapelus boehmei 65.3 Intellagama lesueurii 19.5 6 Pogona vitticeps 19.5 17.5 7 11.1 Ctenophorus adelaidensis 9.0 17.6 11.1 Ctenophorus isolepis 100 90 80 70 60 50 40 30 20 10 0 Mya

Upper Paleocene Eocene Oligocene Miocene Pliocene Pleistocene Cretaceous

Figure S2. Time-calibrated Bayesian inference concatenated tree of Agamidae. Mean age estimates are provided near the nodes with horizontal bars representing the 95% highest posterior densities based on the analysis of eight calibration points (black dates; calibration points are denoted by arrows and numbers; see Material and Methods; Table S5). Additional dates are based on the analysis of seven calibration points (blue) and on the Uromastyx europaeus fossil only (red) (see Table S5). White circles represent nodes with posterior probability values ≥0.95. Sample codes correlate to specimens in Table S1. Saara hardwickii 16.6 Saara asmussi

U. thomasi 29.6 U. aegyptia

U. benti 14.3 3.8 16.3 U. shobraki 3 9.9 U. yemenensis

U. ocellata 5.8 15.3 U. ornata

U. macfadyeni

U. geyri 12.4 0.23 U. alfredschmidti

4.1 U. acanthinura 2.4

2.8 U. nigriventris 3.0 U. dispar 40 35 30 25 20 15 10 5 0 Mya Pleistocene Eocene Oligocene Miocene Pliocene

Figure S3. Time-calibrated multilocus species-tree of Uromastyx based on the Uromastyx europaeus fossil calibration (see Material and Methods). Mean age estimates are provided above the nodes with horizontal bars representing the 95% highest posterior densities (see Table S5). White circles represent nodes with posterior probability values ≥0.95. BioGeoBEARS DIVALIKE on Uromastyx concatenated tree: BioGeoBEARS DEC on Uromastyx concatenated tree: BioGeoBEARS BAYAREALIKE on Uromastyx concatenated tree: global optim, 4 areas max. d=0.006; e=0; j=0; LnL=−20.99 global optim, 4 areas max. d=0.0036; e=0; j=0; LnL=−21.46 global optim, 4 areas max. d=0.0019; e=0.0477; j=0; LnL=−32.09

Af S11164 Af S11164 Af S11164

Af ZFMK71647 Af ZFMK71647 Af ZFMK71647

Af BEV.9144 Af BEV.9144 Af BEV.9144

Af TR2284 Af TR2284 Af TR2284

Af ZFMK84438 Af ZFMK84438 Af ZFMK84438

Af ZFMK83816 Af ZFMK83816 Af ZFMK83816

Af BEV.10184 Af BEV.10184 Af BEV.10184

Af BEV.T4132 Af BEV.T4132 Af BEV.T4132

H ZFMK84440 H ZFMK84440 H ZFMK84440

H ZFMK58048 H ZFMK58048 H ZFMK58048

Ar ZFMK83807 Ar ZFMK83807 Ar ZFMK83807

Ar ZFMK73675 Ar ZFMK73675 Ar ZFMK73675

Ar ZFMK83347 Ar ZFMK83347 Ar ZFMK83347

Ar ZFMK83813 Ar ZFMK83813 Ar ZFMK83813

Ar TW1159 Ar TW1159 Ar TW1159

Af BEV.T3076 Af BEV.T3076 Af BEV.T3076

Ar ZFMK52398 Ar ZFMK52398 Ar ZFMK52398

Ar BEV.10053 Ar BEV.10053 Ar BEV.10053

Af NSMTH4667 Af NSMTH4667 Af NSMTH4667

Ar TW1157 Ar TW1157 Ar TW1157

As E112.2 As E112.2 As E112.2

As SPM002104 As SPM002104 As SPM002104

As NMP6V73519 As NMP6V73519 As NMP6V73519

As ZFMK87396 As ZFMK87396 As ZFMK87396

30 25 20 15 10 5 0 30 25 20 15 10 5 0 30 25 20 15 10 5 0 Millions of years ago Millions of years ago Millions of years ago

BioGeoBEARS DIVALIKE+J on Uromastyx concatenated tree: BioGeoBEARS DEC+J on Uromastyx concatenated tree: BioGeoBEARS BAYAREALIKE+J on Uromastyx concatenated tree: global optim, 4 areas max. d=0; e=0; j=0.0388; LnL=−16.92 global optim, 4 areas max. d=0; e=0; j=0.0335; LnL=−17.42 global optim, 4 areas max. d=0; e=0; j=0.0472; LnL=−19.34

Af S11164 Af S11164 Af S11164

Af ZFMK71647 Af ZFMK71647 Af ZFMK71647

Af BEV.9144 Af BEV.9144 Af BEV.9144

Af TR2284 Af TR2284 Af TR2284

Af ZFMK84438 Af ZFMK84438 Af ZFMK84438

Af ZFMK83816 Af ZFMK83816 Af ZFMK83816

Af BEV.10184 Af BEV.10184 Af BEV.10184

Af BEV.T4132 Af BEV.T4132 Af BEV.T4132

H ZFMK84440 H ZFMK84440 H ZFMK84440

H ZFMK58048 H ZFMK58048 H ZFMK58048

Ar ZFMK83807 Ar ZFMK83807 Ar ZFMK83807

Ar ZFMK73675 Ar ZFMK73675 Ar ZFMK73675

Ar ZFMK83347 Ar ZFMK83347 Ar ZFMK83347

Ar ZFMK83813 Ar ZFMK83813 Ar ZFMK83813

Ar TW1159 Ar TW1159 Ar TW1159

Af BEV.T3076 Af BEV.T3076 Af BEV.T3076

Ar ZFMK52398 Ar ZFMK52398 Ar ZFMK52398

Ar BEV.10053 Ar BEV.10053 Ar BEV.10053

Af NSMTH4667 Af NSMTH4667 Af NSMTH4667

Ar TW1157 Ar TW1157 Ar TW1157

As E112.2 As E112.2 As E112.2

As SPM002104 As SPM002104 As SPM002104

As NMP6V73519 As NMP6V73519 As NMP6V73519

As ZFMK87396 As ZFMK87396 As ZFMK87396

30 25 20 15 10 5 0 30 25 20 15 10 5 0 30 25 20 15 10 5 0 Millions of years ago Millions of years ago Millions of years ago Figure S4. BioGeoBEARS results of the competing models (DEC; DIVA; BayArea) of ancestral-area estimation for the concatenated data of Uromastycinae. A pie chart describing the probability of each inferred area is presented at the major nodes: Africa (yellow), Horn of Africa (red), Arabia (green), Asia (blue). Sample codes correlate to specimens in Table S1.