DOCSLIB.ORG

Desmoglein 3 Anchors Telogen Hair in the Follicle

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Desmoglein 3 Anchors Telogen Hair in the Follicle Journal of Cell Science 111, 2529-2537 (1998) 2529 Printed in Great Britain © The Company of Biologists Limited 1998 JCS3800 Desmoglein 3 anchors telogen hair in the follicle Peter J. Koch, M. G. Mahoney, George Cotsarelis, Kyle Rothenberger, Robert M. Lavker and John R. Stanley* Department of Dermatology, University of Pennsylvania School of Medicine, 211 CRB, 415 Curie Blvd, Philadelphia, PA 19104, USA *Author for correspondence (e-mail: [email protected]) Accepted 6 July; published on WWW 13 August 1998 SUMMARY Little is known about the function of desmosomes in the (acantholysis) between the cells surrounding the telogen normal structure and function of hair. Therefore, it was club and the basal layer of the outer root sheath epithelium. surprising that mice without desmoglein 3 (the autoantigen Electron microscopy revealed ‘half-desmosomes’ at the in pemphigus vulgaris) not only developed mucous plasma membranes of acantholytic cells. Similar membrane and skin lesions like pemphigus patients, but acantholytic histology and ultrastructural findings have also developed hair loss. Analysis of this phenotype been previously reported in skin and mucous membrane indicated that hair was normal through the first growth lesions of DSG3−/− mice and pemphigus vulgaris patients. phase (‘follicular neogenesis’). Around day 20, however, Immunoperoxidase staining with an antibody raised when the hair follicles entered the resting phase of the hair against mouse desmoglein 3 showed intense staining on the growth cycle (telogen), mice with a targeted disruption of cell surface of keratinocytes surrounding the telogen hair the desmoglein 3 gene (DSG3−/−) lost hair in a wave-like club in normal mice. Similar staining was seen in human pattern from the head to the tail. Hair then regrew and was telogen hair with an anti-human desmoglein 3 antibody. lost again in the same pattern with the next synchronous Finally, a scalp biopsy from a pemphigus vulgaris patient hair cycle. In adults, hair was lost in patches. Gentle hair showed empty telogen hair follicles. These data pulls with adhesive tape showed that anagen (growing) demonstrate that desmoglein 3 is not only critical for cell hairs were firmly anchored in DSG3−/− mice, but telogen adhesion in the deep stratified squamous epithelium, but hairs came out in clumps compared to that of DSG3+/− and also for anchoring the telogen hair to the outer root sheath +/+ littermates in which telogen hairs were firmly of the follicle and underscore the importance of anchored. Histology of bald skin areas in DSG3−/− mice desmosomes in maintaining the normal structure and showed cystic telogen hair follicles without hair shafts. function of hair. Histology of hair follicles in early telogen, just before clinical hair loss occurred, showed loss of cell adhesion Key words: Desmoglein, Pemphigus, Desmosome, Hair INTRODUCTION There are two major types of pemphigus, pemphigus vulgaris (PV) and pemphigus foliaceus (PF) (reviewed by Desmoglein 3 (Dsg3) is a desmosomal transmembrane Stanley, 1993). In both diseases patients develop glycoprotein that belongs to the cadherin superfamily of cell autoantibodies against desmogleins; in PV against Dsg3 and in adhesion receptors (Amagai et al., 1991; Koch and Franke, PF against desmoglein 1 (Dsg1). It has been shown 1994). It is expressed and assembled into desmosomes in convincingly that these desmoglein-specific antibodies are certain strata of stratified squamous epithelia (Franke et al., pathogenic, that is they bind to the cell surface of desmoglein- 1994; Karpati et al., 1993; Schwarz et al., 1990; Arnemann et expressing keratinocytes in vivo and induce loss of cell al., 1993; Schafer et al., 1994; Schmidt et al., 1994). In skin, adhesion leading to the formation of blisters (Amagai et al., Dsg3 is expressed in keratinocytes of the basal and immediate 1992, 1994, 1995). PF blisters occur in the superficial suprabasal cell layers (e.g. Amagai et al., 1996). epidermis where Dsg1 is expressed, wheras PV blisters occur Even though desmosomes are multiprotein complexes thought in the deep epidermis and stratified squamous epithelia of to be important in maintaining cell-to-cell adhesion, there have mucous membranes where Dsg3 is expressed. This histologic been few in vivo models that confirm their actual function. One finding in PV is called suprabasilar acantholysis. exception has been the study of the pathophysiology of the Evidence that antibodies in PV interfere directly with an autoantibody-mediated pemphigus diseases, which has provided adhesive function of Dsg3 in desmosomes was obtained from strong evidence for the importance of desmogleins in providing analyzing mice that we recently generated with a targeted cell adhesion between keratinocytes. disruption of the DSG3 gene (DSG3−/−) (Koch et al., 1997). 2530 P. J. Koch and others The phenotype of these mice strikingly resembled that of PV with 10 column volumes each of buffer 1 (10 mM Tris-HCl, pH 7.5), patients. These DSG3−/− mice developed oral and vaginal buffer 2 (10 mM Tris-HCl, pH 7.5/0.5 M NaCl) and buffer 3 (100 mM mucous membrane lesions with the typical histology of PV. At glycine/10 mM Tris-HCl/0.5 M NaCl, pH 2.5). After equilibration of sites of trauma, gross and histologic PV-like lesions of the skin the column in buffer 1, the heat inactivated serum (20 minutes, 56°C), were seen as well. These findings showed that a loss of Dsg3 diluted 1:4 in buffer 1, was loaded onto the affinity matrix. The loading step was repeated three more times. The affinity matrix was function is sufficient to cause a PV-like phenotype, thus then washed with 20 volumes each of buffers 1 and 2. Antibodies were supporting the idea that PV autoantibodies directly interfere eluted with 10 column volumes of buffer 3. Neutralization of with Dsg3-dependent cell-cell adhesion. approximately 18 ml of eluate with 2 ml of 1 M Tris-HCl, pH 8, was Surprisingly, around day 20 after birth, DSG3−/− mice followed by dialysis against phosphate-buffered saline (PBS). displayed another prominent phenotype, hair loss. Because Antibodies were then concentrated with Centriprep Concentrators little is known about the role of desmosomes and their (Amicon, Beverly, MA). Bovine serum albumin (BSA) was added components in the structure and function of hair, we analyzed (final concentration 0.1%) and the affinity-purified antibodies were the balding phenotype of these knockout mice to learn how stored at −20oC. Dsg3 may function in the hair follicle. Western blotting In this study we demonstrate defective anchorage of telogen Whole skin extracts from newborn mice were prepared by pulverizing hairs to the folliclar epithelium due to splitting of desmosomes skin in liquid nitrogen then incubating in 2× Laemmli buffer (Bio-Rad between the keratinocytes surrounding the hair club and the Laboratories) for 10 minutes at 100°C. Immunoblotting was basal layer of the outer root sheath (ORS). This same area of performed as previously described (Koch et al., 1997). The following the hair follicle, in both mice and humans, shows intense primary antibodies were used: mouse monoclonal anti-desmoglein staining for Dsg3. These data are the first to show a structural antibody (DG3.10, Biodesign, Kennebunk, ME; specific for Dsg1 and function for a desmosomal cadherin in the hair follicle. Dsg2) (Koch et al., 1990, 1991) and rabbit anti-Dsg3 (immunoaffinity-purified, see above). Immunohistochemistry MATERIALS AND METHODS Formalin-fixed, paraffin-embedded tissue was sectioned (4 µm thick) and tissue slides were subsequently deparaffinized by incubations in Mice xylene and in ethanol (2× 5 minutes in each solvent). The tissue was The DSG3−/− mice were obtained from matings of DSG3+/− then microwaved in ‘target unmasking fluid’ (TUF; Signet, Dedham, heterozygotes (Koch et al., 1997). MA) for 4.5 minutes at 900 W. After several PBS washes, the tissue was incubated in 0.1% trypsin/PBS for 10 minutes at 41°C and then Generation of a mouse Dsg3 fusion protein again washed in PBS. After an incubation of 7 minutes in 3% Total RNA was isolated from the skin of the back of a two day old hydrogen peroxide solution and washing with 20% ethanol, tissues DSG3+/+ mouse with the RNAzol B reagent (Tel-Test Inc., were incubated for 5 minutes in blocking buffer (1% normal goat Friendswood, TX). Subsequently, RNA was converted into single- serum/1% BSA/PBS). The first antibody was diluted in blocking stranded cDNA using the ‘Superscript Preamplification System’ buffer and incubated with the tissues for 2 hours at room temperature (Gibco-BRL, Grand Island, NY). A cDNA fragment of 317 base pairs or overnight at 4°C. After three washes in PBS (5 minutes each), encoding the amino acid sequence of the extracellular domain 5 (EC5) biotinylated goat anti-rabbit IgG or biotinylated goat anti-mouse IgG of mouse Dsg3 (for domain designation see Amagai et al., 1991) was (Vector Laboratories, Burlingame, CA; diluted 1:200 in blocking amplified by PCR using primers MDSG3F (5′- buffer) was added and the sections were incubated for 1 hour. After GCGGGATCCACTTCCTCACCTTCTGTG) and MDSG3R (5′- three PBS washes (5 minutes each), the sections were incubated with GCGAAGCTTCCCATATGTGTTAGGCTC; cloning sites are ‘Vectastain’ (Vector Laboratories) for 30 minutes and then washed underlined). In the PCR, various amounts of cDNA were used as a with PBS (3× 5 minutes). Antibody binding was detected with ‘Stable template in the presence of 20 pmol of each primer, 200 µM dNTP, DAB’ (Research Genetics, Huntsville, AL). The DAB reactions were 2 U AmpliTaq and 1× PCR buffer (enzyme and buffer supplied by stopped by rinsing the slides several times in water. After Perkin Elmer, Norwalk, CT) in a total volume of 100 µl. The counterstaining with hematoxylin (Gill’s Formulation #3, 1:10 diluted amplification conditions were: 1 minute 94°C, 2 minutes 54°C and 2 in water; Fisher Scientific, Pittsburgh, PA), sections were dehydrated minutes 72°C followed by 30 cycles with 45 seconds 94°C, 1 minute in ethanol and, finally, coverslips were applied with Elvanol.
Load more

Recommended publications
  • Human N-Cadherin / CD325 / CDH2 Protein (His & Fc Tag)
    Human N-Cadherin / CD325 / CDH2 Protein (His & Fc Tag) Catalog Number: 11039-H03H General Information SDS-PAGE: Gene Name Synonym: CD325; CDHN; CDw325; NCAD Protein Construction: A DNA sequence encoding the human CDH2 (NP_001783.2) (Met 1-Ala 724) was fused with the C-terminal polyhistidine-tagged Fc region of human IgG1 at the C-terminus. Source: Human Expression Host: HEK293 Cells QC Testing Purity: > 70 % as determined by SDS-PAGE Endotoxin: Protein Description < 1.0 EU per μg of the protein as determined by the LAL method Cadherins are calcium dependent cell adhesion proteins, and they preferentially interact with themselves in a homophilic manner in Stability: connecting cells. Cadherin 2 (CDH2), also known as N-Cadherin (neuronal) (NCAD), is a single-pass tranmembrane protein and a cadherin containing ℃ Samples are stable for up to twelve months from date of receipt at -70 5 cadherin domains. N-Cadherin displays a ubiquitous expression pattern but with different expression levels between endocrine cell types. CDH2 Asp 160 Predicted N terminal: (NCAD) has been shown to play an essential role in normal neuronal Molecular Mass: development, which is implicated in an array of processes including neuronal differentiation and migration, and axon growth and fasciculation. The secreted recombinant human CDH2 is a disulfide-linked homodimeric In addition, N-Cadherin expression was upregulated in human HSC during protein. The reduced monomer comprises 813 amino acids and has a activation in culture, and function or expression blocking of N-Cadherin predicted molecular mass of 89.9 kDa. As a result of glycosylation, it promoted apoptosis. During apoptosis, N-Cadherin was cleaved into 20- migrates as an approximately 114 and 119 kDa band in SDS-PAGE under 100 kDa fragments.
    [Show full text]
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • Cell Adhesion and Angiogenesis
    Cell adhesion and angiogenesis. J Bischoff J Clin Invest. 1997;99(3):373-376. https://doi.org/10.1172/JCI119168. Perspective Find the latest version: https://jci.me/119168/pdf Perspectives Series: Cell Adhesion in Vascular Biology Cell Adhesion and Angiogenesis Joyce Bischoff Department of Surgery, Children’s Hospital and Harvard Medical School, Children’s Hospital, Boston, Massachusetts 02115 Introduction and postcapillary venules (3). Thus, the formation of a new mi- Angiogenesis is the growth of new capillary blood vessels from crovessel requires a number of interactions that must be coor- preexisting capillaries and postcapillary venules. This process dinated in a spatially and temporally specified manner. These is critical for normal growth and development and in protec- adhesion events are likely mediated by endothelial cell adhe- tive responses such as wound healing and inflammation. In sion molecules and ECM molecules that provide instructions healthy adults, angiogenesis does not normally occur except in to the endothelial cells as they migrate into the perivascular certain phases of the female reproductive cycle. However, ab- space and assemble into new vessels with surrounding peri- errant angiogenesis can occur in a variety of pathologic set- cytes. tings. These include the neovascularization of solid tumors, the Cell adhesion and endothelial cell growth growth of vessels into the retina in diabetic retinopathy, and the unwanted vessel growth in chronic inflammatory diseases. Adhesion of endothelial cells to ECM and attainment of an The hypothesis that angiogenic diseases, in particular tumor appropriate cellular shape has been known for many years to growth and metastases, may be alleviated by inhibiting the an- be crucial for endothelial cell growth, differentiation, and sur- giogenic responses (1) has prompted many to investigate the vival.
    [Show full text]
  • L1 Cell Adhesion Molecule in Cancer, a Systematic Review on Domain-Specific Functions
    International Journal of Molecular Sciences Review L1 Cell Adhesion Molecule in Cancer, a Systematic Review on Domain-Specific Functions Miriam van der Maten 1,2, Casper Reijnen 1,3, Johanna M.A. Pijnenborg 1,* and Mirjam M. Zegers 2,* 1 Department of Obstetrics and Gynaecology, Radboud university medical center, 6525 GA Nijmegen, The Netherlands 2 Department of Cell Biology, Radboud Institute for Molecular Life Sciences, Radboud university medical center, 6525 GA Nijmegen, The Netherlands 3 Department of Obstetrics and Gynaecology, Canisius-Wilhelmina Hospital, 6532 SZ Nijmegen, The Netherlands * Correspondence: [email protected] (J.M.A.P); [email protected] (M.M.Z.) Received: 24 June 2019; Accepted: 23 August 2019; Published: 26 August 2019 Abstract: L1 cell adhesion molecule (L1CAM) is a glycoprotein involved in cancer development and is associated with metastases and poor prognosis. Cellular processing of L1CAM results in expression of either full-length or cleaved forms of the protein. The different forms of L1CAM may localize at the plasma membrane as a transmembrane protein, or in the intra- or extracellular environment as cleaved or exosomal forms. Here, we systematically analyze available literature that directly relates to L1CAM domains and associated signaling pathways in cancer. Specifically, we chart its domain-specific functions in relation to cancer progression, and outline pre-clinical assays used to assess L1CAM. It is found that full-length L1CAM has both intracellular and extracellular targets, including interactions with integrins, and linkage with ezrin. Cellular processing leading to proteolytic cleavage and/or exosome formation results in extracellular soluble forms of L1CAM that may act through similar mechanisms as compared to full-length L1CAM, such as integrin-dependent signals, but also through distinct mechanisms.
    [Show full text]
  • CDH1 Gene Cadherin 1
    CDH1 gene cadherin 1 Normal Function The CDH1 gene provides instructions for making a protein called epithelial cadherin or E-cadherin. This protein is found within the membrane that surrounds epithelial cells, which are the cells that line the surfaces and cavities of the body, such as the inside of the eyelids and mouth. E-cadherin belongs to a family of proteins called cadherins whose function is to help neighboring cells stick to one another (cell adhesion) to form organized tissues. Another protein called p120-catenin, produced from the CTNND1 gene, helps keep E-cadherin in its proper place in the cell membrane, preventing it from being taken into the cell through a process called endocytosis and broken down prematurely. E-cadherin is one of the best-understood cadherin proteins. In addition to its role in cell adhesion, E-cadherin is involved in transmitting chemical signals within cells, controlling cell maturation and movement, and regulating the activity of certain genes. Interactions between the E-cadherin and p120-catenin proteins, in particular, are thought to be important for normal development of the head and face (craniofacial development), including the eyelids and teeth. E-cadherin also acts as a tumor suppressor protein, which means it prevents cells from growing and dividing too rapidly or in an uncontrolled way. Health Conditions Related to Genetic Changes Breast cancer Inherited mutations in the CDH1 gene increase a woman's risk of developing a form of breast cancer that begins in the milk-producing glands (lobular breast cancer). In many cases, this increased risk occurs as part of an inherited cancer disorder called hereditary diffuse gastric cancer (HDGC) (described below).
    [Show full text]
  • Increased Expression of Cell Adhesion Molecule P-Selectin in Active Inflammatory Bowel Disease Gut: First Published As 10.1136/Gut.36.3.411 on 1 March 1995
    Gut 1995; 36: 411-418 411 Increased expression of cell adhesion molecule P-selectin in active inflammatory bowel disease Gut: first published as 10.1136/gut.36.3.411 on 1 March 1995. Downloaded from G M Schurmann, A E Bishop, P Facer, M Vecchio, J C W Lee, D S Rampton, J M Polak Abstract proposed, entailing margination from the The pathogenic changes of inflammatory centreline of blood flow towards the vascular bowel disease (IBD) depend on migration wall, rolling, tethering to the endothelia, stable of circulating leucocytes into intestinal adhesion, and finally, transendothelial migra- tissues. Although leucocyte rolling and tion.1 Each of these steps involves specific fam- tenuous adhesion are probably regulated ilies of adhesion molecules, which are by inducible selectins on vascular expressed on endothelial cells and on circulat- endothelia, little is known about the ing cells as their counterparts and ligands.2 3 expression of these molecules in Crohn's The selectin family of adhesion molecules, disease and ulcerative colitis. Using which comprises E-selectin, P-selectin, and L- immunohistochemistry on surgically selectin, predominantly mediates the first steps resected specimens, this study investi- of cellular adhesion4 5 and several studies have gated endothelial P-selectin (CD62, gran- shown upregulation of E-selectin on activated ular membrane protein-140) in frozen endothelial cells in a variety oftissues6-8 includ- sections of histologically uninvolved ing the gut in patients with IBD.9 10 Little tissues adjacent to inflammation (Crohn's investigation has been made, however, of P- disease= 10; ulcerative colitis= 10), from selectin in normal and diseased gut, although highly inflamed areas (Crohn's its DNA was cloned and sequenced in 1989.11 disease=20; ulcerative colitis=13), and P-selectin (also known as PADGEM, from normal bowel (n=20).
    [Show full text]
  • Frequent Promoter Methylation of CDH1 in Non-Neoplastic Mucosa of Sporadic Diffuse Gastric Cancer
    ANTICANCER RESEARCH 33: 3765-3774 (2013) Frequent Promoter Methylation of CDH1 in Non-neoplastic Mucosa of Sporadic Diffuse Gastric Cancer KYUNG HWA LEE1*, DAVID HWANG2*, KI YOUNG KANG2, SOONG LEE3, DONG YI KIM4, YOUNG EUN JOO5 and JAE HYUK LEE1 Departments of 1Pathology, 4Surgery, and 5Internal Medicine, Chonnam National University Medical School, Gwangju, Republic of Korea; Departments of 2Anatomy and 3Internal Medicine, College of Medicine, Seonam University, Namwon, Republic of Korea Abstract. Background/Aim: To identify promoter observed in recent decades (1, 2). Diffuse gastric cancer methylation as a major silencing mechanism in potential (DGC) accounts for approximately 30% of all gastric precursor lesions of sporadic diffuse gastric cancer (DGC), carcinomas, and the prognosis is poor particularly for young we investigated promoter methylation of CDH1 (E-Cadherin patients (3, 4). It has long been known that DGCs show gene) in a series of DGCs and matched normal mucosa. diminished homophilic cell-to-cell cohesion (5). Inactivating Materials and Methods: The extent of CDH1 gene promoter germline CDH1 (E-Cadherin gene) mutation has been methylation was explored using methylation-specific described in the families with hereditary DGC, an polymerase chain reaction (MSP) and pyrosequencing (PS) autosomal-dominant disease characterized by clustering of in 72 DGCs with a matched pair of normal mucosa. Results: early-onset DGC (6, 7). The diminished or lack of E- MSP and PS revealed CDH1 promoter methylation in 73.6% Cadherin immunoreactivity observed in hereditary DGC cells (53/72) and 77.8% (56/72) of DGC samples, respectively. PS harboring CDH1 mutations is consistent with bi-allelic detected CDH1 methylation in 70.8% (51/72) and 72.2% CDH1 inactivation by a second-hit mechanism that leads to (52/72) of matched normal mucosa from adjacent and remote E-Cadherin loss and determines diffuse cancer development foci, respectively.
    [Show full text]
  • The Poliovirus Receptor (CD155)
    Cutting Edge: CD96 (Tactile) Promotes NK Cell-Target Cell Adhesion by Interacting with the Poliovirus Receptor (CD155) This information is current as Anja Fuchs, Marina Cella, Emanuele Giurisato, Andrey S. of September 27, 2021. Shaw and Marco Colonna J Immunol 2004; 172:3994-3998; ; doi: 10.4049/jimmunol.172.7.3994 http://www.jimmunol.org/content/172/7/3994 Downloaded from References This article cites 19 articles, 8 of which you can access for free at: http://www.jimmunol.org/content/172/7/3994.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 27, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2004 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. THE JOURNAL OF IMMUNOLOGY CUTTING EDGE Cutting Edge: CD96 (Tactile) Promotes NK Cell-Target Cell Adhesion by Interacting with the Poliovirus Receptor (CD155) Anja Fuchs, Marina Cella, Emanuele Giurisato, Andrey S. Shaw, and Marco Colonna1 The poliovirus receptor (PVR) belongs to a large family of activating receptor DNAM-1, also called CD226 (6, 7).
    [Show full text]
  • A Mode of Cell Adhesion and Migration Facilitated by CD44-Dependent Microtentacles
    A mode of cell adhesion and migration facilitated by CD44-dependent microtentacles Kayla J. Wolfa,b, Poojan Shuklab, Kelsey Springerb, Stacey Leea,b, Jason D. Coombesb,c, Caleb J. Choyd, Samuel J. Kennye,KeXue,f, and Sanjay Kumara,b,g,1 aUniversity of California, Berkeley–University of California San Francisco Graduate Program in Bioengineering, Department of Bioengineering, University of California, Berkeley, CA 94720; bDepartment of Bioengineering, University of California, Berkeley, CA, 94720; cInflammation Biology, School of Immunology and Microbial Sciences, Faculty of Life Sciences and Medicine, King’s College London, London, United Kingdom, SE5 9NU; dDepartment of Molecular and Cell Biology, University of California, Berkeley, CA 94720; eDepartment of Chemistry, University of California, Berkeley, CA 94720; fDivision of Molecular Biophysics and Integrated Bioimaging, Lawrence Berkeley National Laboratory, Berkeley, CA 94720; and gDepartment of Chemical and Biomolecular Engineering, University of California, Berkeley, CA 94720 Edited by David A. Weitz, Harvard University, Cambridge, MA, and approved March 25, 2020 (received for review August 19, 2019) The structure and mechanics of many connective tissues are grafted C6 gliomas (14). Furthermore, knockdown (KD) of dictated by a collagen-rich extracellular matrix (ECM), where col- CD44 in human GBM tumors slows tumor growth and sensitizes lagen fibers provide topological cues that direct cell migration. tumors to cytotoxic agents (15). CD44 is also a marker of glioma However, comparatively little is known about how cells navigate stem cells (GSCs) (also known as tumor-initiating cells) and the hyaluronic acid (HA)-rich, nanoporous ECM of the brain, a contributes to maintaining stemness (16). Our laboratory has problem with fundamental implications for development, inflam- shown that CD44 is necessary for adhesion and migration on mation, and tumor invasion.
    [Show full text]
  • Cell Adhesion Molecules in Normal Skin and Melanoma
    biomolecules Review Cell Adhesion Molecules in Normal Skin and Melanoma Cian D’Arcy and Christina Kiel * Systems Biology Ireland & UCD Charles Institute of Dermatology, School of Medicine, University College Dublin, D04 V1W8 Dublin, Ireland; [email protected] * Correspondence: [email protected]; Tel.: +353-1-716-6344 Abstract: Cell adhesion molecules (CAMs) of the cadherin, integrin, immunoglobulin, and selectin protein families are indispensable for the formation and maintenance of multicellular tissues, espe- cially epithelia. In the epidermis, they are involved in cell–cell contacts and in cellular interactions with the extracellular matrix (ECM), thereby contributing to the structural integrity and barrier for- mation of the skin. Bulk and single cell RNA sequencing data show that >170 CAMs are expressed in the healthy human skin, with high expression levels in melanocytes, keratinocytes, endothelial, and smooth muscle cells. Alterations in expression levels of CAMs are involved in melanoma propagation, interaction with the microenvironment, and metastasis. Recent mechanistic analyses together with protein and gene expression data provide a better picture of the role of CAMs in the context of skin physiology and melanoma. Here, we review progress in the field and discuss molecular mechanisms in light of gene expression profiles, including recent single cell RNA expression information. We highlight key adhesion molecules in melanoma, which can guide the identification of pathways and Citation: D’Arcy, C.; Kiel, C. Cell strategies for novel anti-melanoma therapies. Adhesion Molecules in Normal Skin and Melanoma. Biomolecules 2021, 11, Keywords: cadherins; GTEx consortium; Human Protein Atlas; integrins; melanocytes; single cell 1213. https://doi.org/10.3390/ RNA sequencing; selectins; tumour microenvironment biom11081213 Academic Editor: Sang-Han Lee 1.
    [Show full text]
  • Desmoglein 3 Promotes Cancer Cell Migration and Invasion by Regulating Activator Protein 1 and Protein Kinase C-Dependent-Ezrin Activation
    Oncogene (2014) 33, 2363–2374 & 2014 Macmillan Publishers Limited All rights reserved 0950-9232/14 www.nature.com/onc ORIGINAL ARTICLE Desmoglein 3 promotes cancer cell migration and invasion by regulating activator protein 1 and protein kinase C-dependent-Ezrin activation L Brown1, A Waseem1, IN Cruz2, J Szary1, E Gunic1, T Mannan1, M Unadkat1, M Yang2, F Valderrama3,EAO0Toole4 and H Wan1 Desmoglein 3 (Dsg3), the pemphigus vulgaris antigen, has recently been shown to be upregulated in squamous cell carcinoma (SCC) and has been identified as a good tumor-specific marker for clinical staging of cervical sentinel lymph nodes in head and neck SCC. However, little is known about its biological function in cancer. The actin-binding protein Ezrin and the activator protein 1 (AP-1) transcription factor are implicated in cancer progression and metastasis. Here, we report that Dsg3 regulates the activity of c-Jun/AP-1 as well as protein kinase C (PKC)-mediated phosphorylation of Ezrin-Thr567, which contributes to the accelerated motility of cancer cells. Ectopic expression of Dsg3 in cancer cell lines caused enhanced phosphorylation at Ezrin-Thr567 with concomitant augmented membrane protrusions, cell spreading and invasive phenotype. We showed that Dsg3 formed a complex with Ezrin at the plasma membrane that was required for its proper function of interacting with F-actin and CD44 as Dsg3 knockdown impaired these associations. The increased Ezrin phosphorylation in Dsg3-overexpressing cells could be abrogated substantially by various pharmacological inhibitors for Ser/Thr kinases, including PKC and Rho kinase that are known to activate Ezrin. Furthermore, a marked increase in c-Jun S63 phosphorylation, among others, was found in Dsg3-overexpressing cells and the activation of c-Jun/AP-1 was further supported by a luciferase reporter assay.
    [Show full text]
  • Mouse Anti-Human Desmoglein-3 (EC2 Domain) Monoclonal Antibody, Clone QWC39 (CABT-L2646) This Product Is for Research Use Only and Is Not Intended for Diagnostic Use
    Mouse Anti-Human desmoglein-3 (EC2 domain) monoclonal antibody, clone QWC39 (CABT-L2646) This product is for research use only and is not intended for diagnostic use. PRODUCT INFORMATION Product Overview Recombinant monoclonal antibody to desmoglein-3. Variable regions (i.e. specificity) from the EBV transformed human B cell clone QWC39. Made by immortalizing IgG-expressing B cells from Pemphigus vulgaris (PV) patients. Specificity This antibody specifically recognizes a conformational epitope in the EC2 domain of human desmoglein-3 (DSG). This antibody was isolated as a human IgG4 from a patient with mucocutaneous pemphigus vulgaris. This antibody has in vitro and in vivo pathogenic activity, as assessed in a keratinocyte dissociation assay and by the formation of microscopic blisters in newborn mice. This antibody crossreacts with murine DSG-3. Immunogen Desmoglein-3 Isotype IgG1, κ Source/Host Mouse Species Reactivity Human Clone QWC39 Purification Protein A affinity purified Conjugate Unconjugated Applications IA Format Liquid Concentration 1 mg/ml Size 200 ug; 1 mg Buffer PBS Preservative See individual product datasheet Storage Store at -20 or -70°C upon receipt. Divide antibody into aliquots prior usage. Avoid multiple freeze-thaw cycles. Ship Wet ice 45-1 Ramsey Road, Shirley, NY 11967, USA Email: [email protected] Tel: 1-631-624-4882 Fax: 1-631-938-8221 1 © Creative Diagnostics All Rights Reserved Warnings For research use only and not for use in diagnostic or therapeutic procedures. BACKGROUND Introduction Desmosomes are cell-cell junctions between epithelial, myocardial, and certain other cell types. Desmoglein 3 is a calcium-binding transmembrane glycoprotein component of desmosomes in vertebrate epithelial cells.
    [Show full text]