Journal of Cell Science 111, 2529-2537 (1998) 2529 Printed in Great Britain © The Company of Biologists Limited 1998 JCS3800 Desmoglein 3 anchors telogen hair in the follicle Peter J. Koch, M. G. Mahoney, George Cotsarelis, Kyle Rothenberger, Robert M. Lavker and John R. Stanley* Department of Dermatology, University of Pennsylvania School of Medicine, 211 CRB, 415 Curie Blvd, Philadelphia, PA 19104, USA *Author for correspondence (e-mail: [email protected]) Accepted 6 July; published on WWW 13 August 1998 SUMMARY Little is known about the function of desmosomes in the (acantholysis) between the cells surrounding the telogen normal structure and function of hair. Therefore, it was club and the basal layer of the outer root sheath epithelium. surprising that mice without desmoglein 3 (the autoantigen Electron microscopy revealed ‘half-desmosomes’ at the in pemphigus vulgaris) not only developed mucous plasma membranes of acantholytic cells. Similar membrane and skin lesions like pemphigus patients, but acantholytic histology and ultrastructural findings have also developed hair loss. Analysis of this phenotype been previously reported in skin and mucous membrane indicated that hair was normal through the first growth lesions of DSG3−/− mice and pemphigus vulgaris patients. phase (‘follicular neogenesis’). Around day 20, however, Immunoperoxidase staining with an antibody raised when the hair follicles entered the resting phase of the hair against mouse desmoglein 3 showed intense staining on the growth cycle (telogen), mice with a targeted disruption of cell surface of keratinocytes surrounding the telogen hair the desmoglein 3 gene (DSG3−/−) lost hair in a wave-like club in normal mice. Similar staining was seen in human pattern from the head to the tail. Hair then regrew and was telogen hair with an anti-human desmoglein 3 antibody. lost again in the same pattern with the next synchronous Finally, a scalp biopsy from a pemphigus vulgaris patient hair cycle. In adults, hair was lost in patches. Gentle hair showed empty telogen hair follicles. These data pulls with adhesive tape showed that anagen (growing) demonstrate that desmoglein 3 is not only critical for cell hairs were firmly anchored in DSG3−/− mice, but telogen adhesion in the deep stratified squamous epithelium, but hairs came out in clumps compared to that of DSG3+/− and also for anchoring the telogen hair to the outer root sheath +/+ littermates in which telogen hairs were firmly of the follicle and underscore the importance of anchored. Histology of bald skin areas in DSG3−/− mice desmosomes in maintaining the normal structure and showed cystic telogen hair follicles without hair shafts. function of hair. Histology of hair follicles in early telogen, just before clinical hair loss occurred, showed loss of cell adhesion Key words: Desmoglein, Pemphigus, Desmosome, Hair INTRODUCTION There are two major types of pemphigus, pemphigus vulgaris (PV) and pemphigus foliaceus (PF) (reviewed by Desmoglein 3 (Dsg3) is a desmosomal transmembrane Stanley, 1993). In both diseases patients develop glycoprotein that belongs to the cadherin superfamily of cell autoantibodies against desmogleins; in PV against Dsg3 and in adhesion receptors (Amagai et al., 1991; Koch and Franke, PF against desmoglein 1 (Dsg1). It has been shown 1994). It is expressed and assembled into desmosomes in convincingly that these desmoglein-specific antibodies are certain strata of stratified squamous epithelia (Franke et al., pathogenic, that is they bind to the cell surface of desmoglein- 1994; Karpati et al., 1993; Schwarz et al., 1990; Arnemann et expressing keratinocytes in vivo and induce loss of cell al., 1993; Schafer et al., 1994; Schmidt et al., 1994). In skin, adhesion leading to the formation of blisters (Amagai et al., Dsg3 is expressed in keratinocytes of the basal and immediate 1992, 1994, 1995). PF blisters occur in the superficial suprabasal cell layers (e.g. Amagai et al., 1996). epidermis where Dsg1 is expressed, wheras PV blisters occur Even though desmosomes are multiprotein complexes thought in the deep epidermis and stratified squamous epithelia of to be important in maintaining cell-to-cell adhesion, there have mucous membranes where Dsg3 is expressed. This histologic been few in vivo models that confirm their actual function. One finding in PV is called suprabasilar acantholysis. exception has been the study of the pathophysiology of the Evidence that antibodies in PV interfere directly with an autoantibody-mediated pemphigus diseases, which has provided adhesive function of Dsg3 in desmosomes was obtained from strong evidence for the importance of desmogleins in providing analyzing mice that we recently generated with a targeted cell adhesion between keratinocytes. disruption of the DSG3 gene (DSG3−/−) (Koch et al., 1997). 2530 P. J. Koch and others The phenotype of these mice strikingly resembled that of PV with 10 column volumes each of buffer 1 (10 mM Tris-HCl, pH 7.5), patients. These DSG3−/− mice developed oral and vaginal buffer 2 (10 mM Tris-HCl, pH 7.5/0.5 M NaCl) and buffer 3 (100 mM mucous membrane lesions with the typical histology of PV. At glycine/10 mM Tris-HCl/0.5 M NaCl, pH 2.5). After equilibration of sites of trauma, gross and histologic PV-like lesions of the skin the column in buffer 1, the heat inactivated serum (20 minutes, 56°C), were seen as well. These findings showed that a loss of Dsg3 diluted 1:4 in buffer 1, was loaded onto the affinity matrix. The loading step was repeated three more times. The affinity matrix was function is sufficient to cause a PV-like phenotype, thus then washed with 20 volumes each of buffers 1 and 2. Antibodies were supporting the idea that PV autoantibodies directly interfere eluted with 10 column volumes of buffer 3. Neutralization of with Dsg3-dependent cell-cell adhesion. approximately 18 ml of eluate with 2 ml of 1 M Tris-HCl, pH 8, was Surprisingly, around day 20 after birth, DSG3−/− mice followed by dialysis against phosphate-buffered saline (PBS). displayed another prominent phenotype, hair loss. Because Antibodies were then concentrated with Centriprep Concentrators little is known about the role of desmosomes and their (Amicon, Beverly, MA). Bovine serum albumin (BSA) was added components in the structure and function of hair, we analyzed (final concentration 0.1%) and the affinity-purified antibodies were the balding phenotype of these knockout mice to learn how stored at −20oC. Dsg3 may function in the hair follicle. Western blotting In this study we demonstrate defective anchorage of telogen Whole skin extracts from newborn mice were prepared by pulverizing hairs to the folliclar epithelium due to splitting of desmosomes skin in liquid nitrogen then incubating in 2× Laemmli buffer (Bio-Rad between the keratinocytes surrounding the hair club and the Laboratories) for 10 minutes at 100°C. Immunoblotting was basal layer of the outer root sheath (ORS). This same area of performed as previously described (Koch et al., 1997). The following the hair follicle, in both mice and humans, shows intense primary antibodies were used: mouse monoclonal anti-desmoglein staining for Dsg3. These data are the first to show a structural antibody (DG3.10, Biodesign, Kennebunk, ME; specific for Dsg1 and function for a desmosomal cadherin in the hair follicle. Dsg2) (Koch et al., 1990, 1991) and rabbit anti-Dsg3 (immunoaffinity-purified, see above). Immunohistochemistry MATERIALS AND METHODS Formalin-fixed, paraffin-embedded tissue was sectioned (4 µm thick) and tissue slides were subsequently deparaffinized by incubations in Mice xylene and in ethanol (2× 5 minutes in each solvent). The tissue was The DSG3−/− mice were obtained from matings of DSG3+/− then microwaved in ‘target unmasking fluid’ (TUF; Signet, Dedham, heterozygotes (Koch et al., 1997). MA) for 4.5 minutes at 900 W. After several PBS washes, the tissue was incubated in 0.1% trypsin/PBS for 10 minutes at 41°C and then Generation of a mouse Dsg3 fusion protein again washed in PBS. After an incubation of 7 minutes in 3% Total RNA was isolated from the skin of the back of a two day old hydrogen peroxide solution and washing with 20% ethanol, tissues DSG3+/+ mouse with the RNAzol B reagent (Tel-Test Inc., were incubated for 5 minutes in blocking buffer (1% normal goat Friendswood, TX). Subsequently, RNA was converted into single- serum/1% BSA/PBS). The first antibody was diluted in blocking stranded cDNA using the ‘Superscript Preamplification System’ buffer and incubated with the tissues for 2 hours at room temperature (Gibco-BRL, Grand Island, NY). A cDNA fragment of 317 base pairs or overnight at 4°C. After three washes in PBS (5 minutes each), encoding the amino acid sequence of the extracellular domain 5 (EC5) biotinylated goat anti-rabbit IgG or biotinylated goat anti-mouse IgG of mouse Dsg3 (for domain designation see Amagai et al., 1991) was (Vector Laboratories, Burlingame, CA; diluted 1:200 in blocking amplified by PCR using primers MDSG3F (5′- buffer) was added and the sections were incubated for 1 hour. After GCGGGATCCACTTCCTCACCTTCTGTG) and MDSG3R (5′- three PBS washes (5 minutes each), the sections were incubated with GCGAAGCTTCCCATATGTGTTAGGCTC; cloning sites are ‘Vectastain’ (Vector Laboratories) for 30 minutes and then washed underlined). In the PCR, various amounts of cDNA were used as a with PBS (3× 5 minutes). Antibody binding was detected with ‘Stable template in the presence of 20 pmol of each primer, 200 µM dNTP, DAB’ (Research Genetics, Huntsville, AL). The DAB reactions were 2 U AmpliTaq and 1× PCR buffer (enzyme and buffer supplied by stopped by rinsing the slides several times in water. After Perkin Elmer, Norwalk, CT) in a total volume of 100 µl. The counterstaining with hematoxylin (Gill’s Formulation #3, 1:10 diluted amplification conditions were: 1 minute 94°C, 2 minutes 54°C and 2 in water; Fisher Scientific, Pittsburgh, PA), sections were dehydrated minutes 72°C followed by 30 cycles with 45 seconds 94°C, 1 minute in ethanol and, finally, coverslips were applied with Elvanol.