sign in sign up
<<
Home , Bradypterus, Locustellidae, Old World warbler, Striated grassbird

Philippine Journal of Science 142 (1): 1-11, June 2013 ISSN 0031 - 7683 Date Received: ?? Feb 20??

DNA Barcoding of in the University of the Diliman Campus, with Emphasis on Striated Grassbirds Megalurus palustris

Adrian U. Luczon*, Andrew F. Torres, Jonas P. Quilang, Perry S. Ong and Ian Kendrich C. Fontanilla*

Institute of Biology, University of the Philippines Diliman, Diliman, Quezon City 1101, Philippines

DNA barcoding is increasingly being used by researchers across the globe to aid in the identification of . Using this taxonomic tool on species in an urban green space within Manila, i.e. the University of the Philippines Diliman campus, Luzon, Philippines, DNA barcodes of eleven species were generated. Different haplotypes for some of the species were observed. Using BLAST, the cytochrome oxidase subunit 1 (COI) sequence of every species from this study was correctly matched with the corresponding species having a COI record in Genbank, with the exception of the Megalurus palustris, which is a new COI record. The three distinct haplotypes for M. palustris were then compared with COI sequences from other members of the sylviid “ ” to determine the effectiveness of the DNA barcode in discriminating it with other species. Results show that COI was successful in placing M. palustris as a distinct .

Key Words: cytochrome oxidase I gene, DNA barcoding, , Megalurus, Philippines

INTRODUCTION species (Packer et al. 2009). DNA barcode profiles were developed as a taxonomic tool to address this limitation. Out of the approximately 10,000 identified bird species, 607 can be found in the Philippines. Of the global total, DNA barcoding employs a universally accepted standard about 2% is found nowhere else in the world (Dickinson sequence from a short region of the mitochondrial et al. 1991; WBCP 2010). Due to the Philippines’ highly genome that consistently distinguishes between any diverse, endemism-rich, but highly threatened biodiversity, two given species to their taxonomic status based on a the country is considered a top priority in terms of global library of sequences linked to vouchered specimens from conservation (Myers et al. 2000). Yet, Lohman et al. all over the world (Hebert et al. 2003a). The use of the (2010) concluded that these values for Philippine avian 648-bp region of the mitochondrial cytochrome c oxidase endemism might be gravely underestimated. subunit I (COI) gene has been suggested in previous studies as a DNA barcode for the identification of plays a key role in any biological study. Any species (Hebert et al. 2003b). Today, several consortia experiment addressing scientific problems involving a and projects have been established to collectively barcode taxon must first ascertain the correct identification of the DNA of all the identified species of the world as well that taxon. Even today when there is an explosion in as new species that are continuously being discovered. the number of species being discovered, morphology The Consortium for the Barcode of Life (CBOL) is an alone sometimes is unable to discriminate between initiative joined by many research organizations, natural *Corresponding author: [email protected] history museums and herbaria, and private assemblies

1 Philippine Journal of Science Luczon AU et al: Barcoding UP Diliman Birds Vol. 142 No. 1, June 2013 that intends to develop DNA barcoding as a global MATERIALS AND METHODS standard in the identification of species. The All Birds Barcoding Initiative (ABBI), a flagship program of Bird Sampling CBOL, aims to establish an archive of DNA barcodes Birds were sampled by setting up mist nets within the for all bird species that are linked to museum specimens University of the Philippines campus in Diliman, Quezon (ABBI 2005). Currently, the Barcode of Life Data City, Philippines (N 14° 39’, E 121° 04’). Nine sampling (BoLD) Systems functions as a repository of these DNA sites were established for sampling birds (see Figure 2). barcode sequences as well as a public database in which Biological samples used for DNA extraction were barcode sequences can be accessed. In the Philippines, derived primarily from blood feathers, although blood the University of the Philippines Diliman Institute of were also drawn from the jugular vein of live samples Biology (UPD IB) established the DNA Barcoding of or pectoral muscle of specimens that died during capture Life-Philippine Network (DOLPhiN) in 2008 and is an if blood feathers were not available. In lieu of actual ongoing program that aims to apply DNA barcoding voucher specimens, high quality pictures were taken to Philippine biodiversity, particularly to its native for each bird in different orientations (lateral, dorsal and endemic species. Luczon et al. (2010) produced and ventral). Standard morphometric data such as bill the first set of COI DNA barcodes for DOLPhiN from length, bill depth, tarsus length, wing length, tail length, the White Collared Kingfisher, Todiramphus chloris, and body weight were also taken. Before releasing, each from UP Diliman, followed by Ong et al. (2011) for live bird was clipped on its tail feathers or tagged with the Philippine accipitrids found in the Philippine Eagle aluminum rings on one of its legs to avoid processing Center in Davao City and Aquilino et al. (2011) for the recaptured specimens. ichthyofauna of Taal Lake.

Some resident birds of the Philippines belong to the DNA Extraction, PCR Amplification, and Old World group from the family , Sequencing comprising approximately 400 species. Sylviidae The total genomic DNA was obtained from the blood, blood is recognized as one of the main families in the feathers or pectoral muscle samples using the Promega™ order Passeriformes, albeit its composition remains Wizard® Genomic DNA Purification Kit following the unsettled among different authors. Based on DNA-DNA manufacturer’s protocols. The 5’ 650 bp fragment of the hybridization studies, Sibley et al. (1990) proposed cytochrome c oxidase subunit I (COI) was amplified using that should be split from Sylviidae, while the primers developed by Hebert et al. (2004) - BirdF1 Sylviidae should be divided into the subfamilies (TTCTCCAACCACAAAGACATTGGCAC) and BirdR1 Megalurinae, Acrocephalinae, Garrulacinae and (ACGTGGGAGATAATTCCAAATCCTG). Sylviinae. However, recent work involving direct DNA evidence (Cibois 2003; Barker 2004; Beresford et al. Fifty μL amplification reactions were done in 0.2 mL tubes, 2005) showed that the Old World Warblers should be using Taq DNA Polymerase and dNTPack from Roche® reorganized as different families. Based on sequence (Roche, USA). The volumes and final concentrations used data of the nuclear intron II of the myoglobin gene and for each component were the following: 5 μL PCR buffer the mitochondrial cytochrome b gene, it was proposed with MgCl2 (10 mM Tris–HCl, 1.5 mM MgCl2, 50 mM o that the sylviids be divided into the true Sylviidae, KCl, pH 8.3 [20 C]), 2.5 μL (0.5 mM) each of the primers Timaliidae, Cisticolidae, , Megaluridae, BirdF1 and BirdR1, 1.0 μL (0.2 mM) dNTPs, 34.75 μL Cettidae, Aegithallidae, Phylloscopidae, the Malagasy distilled water, 0.25 μL of 5 units/μL Taq polymerase, and warblers and some unclassified sylviids (Alström et al. 4 μL of the DNA sample. The polymerase chain reaction 2006). Alström et al. (2011) later changed Megaluridae conditions included a two-stage profile based on the to Locustellidae as the name Locustellinae (Bonaparte, method of Kerr et al. (2007). The first stage involved an 1854) has priority over Megalurinae (Blyth, 1875) initial start of 60 seconds at 94°C followed by six cycles (Bock, 1994). of 60 seconds at 94°C, 90 seconds at 45°C, and 90 seconds at 72°C. It was then followed by another 35 cycles of 60 This study, which is a continuation of that of Luczon et al. seconds at 94°C, 90 seconds at 55°C and 90 seconds at (2010), aims to produce a barcode profile for Philippine 72°C. The final run involved a final extension of five birds found within the UP Diliman campus. Vallejo et al. minutes at 72°C. (2008) identified 36 species, of which 14% are endemic, interspersed in various habitats in UP Diliman such as To confirm the amplification of the COI gene and the the campus’s green spaces and buildings. Notable among absence of any contamination to the DNA sample, the these birds is the Striated Grassbird, Megalurus palustris PCR products were run on a 1% agarose gel in 0.5X (Figure 1), an from the sylviid family TBE buffer and visualized using EtBr-UV illumination. Locustellidae, which has not been barcoded previously. The bands on the gel were excised and purified using

2 Philippine Journal of Science Luczon AU et al: Barcoding UP Diliman Birds Vol. 142 No. 1, June 2013

Figure 1. Representative image of Megalurus palustris. A - Lateral view, B - Dorsal view, C - Ventral view.

QIAquick® DNA Extraction Kit (Qiagen, USA) following package (Staden et. 2000) and then aligned using the manufacturer’s protocols. Purified PCR products BioEdit Sequence Alignment Editor Version 7.0.5.3 were then sent to Macrogen, Inc. in Korea or 1stBase in (Hall 1999). All sequences were submitted to BoLD Singapore for sequencing. under the project Barcoding of UP Diliman Birds (Project code: BUPD). The sequences were also submitted to GenBank and were given the accession Sequence Assembly numbers JF957001 – JF957040. The COI sequences acquired from the sequencing companies were assembled using the STADEN

3 Philippine Journal of Science Luczon AU et al: Barcoding UP Diliman Birds Vol. 142 No. 1, June 2013

Figure 2. Areas sampled for birds in University of the Philippines Diliman Campus. 1 – Harding ng Rosas, 2 – University Avenue, 3 – Marine Science Institute, 4 – Institute of Biology extension, 5 – Institute of Environmental Science and Meteorology, 6 – UP Lagoon, 7 – Along Academic Oval, 8 – Main Library, 9 – Bonsai Garden. Source: Map of the University of the Philippines, Diliman, retrieved 25 February 2012 from www.maps.google.com.

Basic Local Alignment Search Tool (BLAST) Sequence Analysis Each sequence was queried in BLAST (Altschul et al. The barcodes of M. palustris are new records and 1990) in order to score its similarity with other DNA were subjected to further sequence analysis that would sequences available in GenBank. The validity of each bird determine their placement with other COI sequences species sequence was evaluated based on the sequences of sylviid birds (Old World Warblers) from the BoLD that scored the highest (i.e. highest scorers should be at and GenBank databases. Two outgroup sequences were least confamilial with the species of query). Kimura-2- added to the alignment and were taken from families Parameter (Kimura 1981) distances were then calculated Zosteropidae and Timaliidae, which are closely related using PAUP*4.0b10 (Swofford 2002) for the sequences to the Old World Warblers (Ericson & Johansson 2003). in this study and those from the BLAST results. Analysis of the dataset was limited to 600 nucleotides,

4 Philippine Journal of Science Luczon AU et al: Barcoding UP Diliman Birds Vol. 142 No. 1, June 2013 while identical sequences were removed from the Several haplotypes were detected within species: three for alignment using DAMBE (Xia et al. 2001), leaving only the Pied Fantail Rhipidura javanica, four for the Brown distinct sequences. Shrike Lanius cristatus, two for the Grey Wagtail Motacilla cinerea, two for Passer montanus, two for the Long-tailed K2P pairwise distances of the dataset were then calculated Shrike Lanius schach, and three for the Striated Grassbird using PAUP*4.0b10. A COI gene tree for the Old World Megalurus palustris. Only one haplotype was found in the warblers was then constructed to check if the COI Yellow-vented Pycnonotus goiavier, the Pacific gene would demonstrate clustering that reflects species Hirundo tahitica, the Common Kingfisher delineation. The tree was derived from the K2P distances Alcedo atthis, the White-breasted Waterhen Amaurornis of the aligned sequences and then constructed using phoenicurus, and the Zebra dove Geopelia striata; however, Neighbor Joining (NJ) (Saitou & Nei 1987) method. only one individual each was sequenced for A. phoenicurus, H. tahitica and A. atthis. Most COI sequences generated from this study have similar COI sequences that correspond to the same species in the records of Genbank with a K2P RESULTS distance range of 0 – 2.041%, lower than the threshold set Although the COI region cannot always elucidate basal by Hebert et al. (2004) at 2.7%. Many of these matches relationships among taxa, as a barcode region, it has the were derived from specimens outside the Philippines; for ability to identify species almost unambiguously. A total instance, L. cristatus haplotype 1 was most similar with L. of 40 cytochrome c oxidase subunit I (COI) sequences cristatus from Russia (GenBank GQ482014) at 2.041% from 11 species belonging to 10 families and four orders K2P distance; L. cristatus haplotype 3 with that from were obtained (Table 1). All species are native and (GenBank EF621603) at 0.153%, Passer montanus resident species in the Philippines, with the exception of haplotype 2 with that from South Korea (GenBank the Eurasian Tree Sparrow Passer montanus, which is an EF515797) at 0.312%, and Lanus schach haplotype 1 introduced species. Another species, the White-collared with that from China (GenBank EF621605) at 0.611%. Kingfisher Todiramphus chloris, was already sequenced On the other hand, COI sequences for A. phoenicurus and analyzed by Luczon et al. (2010). All sequences and M. palustris are not in the records of Genbank. The were checked for gaps by comparing the translated amino species that are most similar to them are the Giant Wood- acid sequences with Gallus gallus complete cytochrome rail Aramides ypecaha (12.179% K2P distance) and the c oxidase subunit 1 gene (GenBank AP003580). No Middendorf's Warbler Locustella ochotensis (10.677 – gaps or premature stop codons were found, indicating no 11.864%), respectively. A. phoenicurus, however, does pseudogenes were inadvertently obtained. have records in BoLD with 99.86-100% similarity to the

Table 1. BLAST results and K2P distances of the COI sequences of birds in University of the Philippines Diliman. BLAST Results # of No. Species % K2P distance indiv. Closest similarity in Genbank Gaps Difference (% difference) 1 Pycnonotus goiavier 5 Pycnonotus goiavier (FJ473200) 0.611 0/655 0.613 Rhipidura javanica 2 Rhipidura javanica (FJ473207) 0 0/655 0 haplotype 1 Rhipidura javanica 2 2 Rhipidura javanica (FJ473100) 0 0/655 0 haplotype 2 Rhipidura javanica 1 Rhipidura javanica (FJ473209) 0 0/637 0 haplotype 3 Lanius cristatus haplotype 1 1 Lanius cristatus (GQ482014) 2.017 0/694 2.041 Lanius cristatus haplotype 2 2 Lanius cristatus (EF621603) 0 0/655 0 3 Lanius cristatus haplotype 3 1 Lanius cristatus (EF621603) 0.153 0/655 0.153 Lanius cristatus haplotype 4 1 Lanius cristatus (GQ482014) 0 0/671 0 4 Hirundo tahitica 1 Hirundo tahitica (GU460336) 1.007 0/695 1.012

Table 1 continued next page . . .

5 Philippine Journal of Science Luczon AU et al: Barcoding UP Diliman Birds Vol. 142 No. 1, June 2013

Motacilla cinerea 1 Motacilla cinerea (GQ482197) 0 0/694 0 haplotype 1 5 Motacilla cinerea 1 Motacilla cinerea (GQ482196) 0 0/694 0 haplotype 2 6 Alcedo atthis 1 Alcedo atthis (GQ481312) 0 0/694 0 Passer montanus 3 Passer montanus (EF515797) 0 0/685 0 haplotype 1 7 Passer montanus 2 Passer montanus (EF515797) 0.293 0/683 0.312 haplotype 2 Lanius schach haplotype 1 4 Lanius schach (EF621605) 0.458 0/655 0.460 Lanius schach haplotype 2 1 Lanius schach (EF621605) 0.611 0/655 0.614 9 Amaurornis phoenicurus 1 Aramides ypecaha (FJ027147) 10.920 10/696 12.179 10 Geopelia striata 5 Geopelia striata (HM746791) 0 0/695 0 Megalurus palustris Locustella ochotensis 3 10.720 1/681 11.864 haplotype 1 (GQ482098) Megalurus palustris Locustella ochotensis 11 1 10.791 4/695 11.817 haplotype 2 (GQ482098) Megalurus palustris Locustella ochotensis 1 9.784 4/695 10.677 haplotype 3 (GQ482098) Todiramphus chlorisa Todiramphus sanctus 3 1.727 0/695 1.742 haplotype 1 (EU410489) 12 Todiramphus chlorisa Todiramphus sanctus 2 1.871 0/695 2.03 haplotype 2 (EU410489) aLuczon et al. (2010) Basic Local Alignment Search Tool (BLAST) cytochrome c oxidase I (COI)

COI sequence from UP Diliman; these BoLD sequences being evaluated becomes more exclusive. It should be for A. phoenicurus were derived from individuals from noted, however, that the maximum K2P distance for Australia and Japan. the conspecific comparison is high (0.1126). This high distance came from a pairwise comparison between two Sylvia mystacaea individuals. Analysis of Molecular Data for Megalurus palustris A total of 169 unique sequences were used for the study. This consists of COI sequences of Old World Warblers Gene Tree Construction (‘Sylviidae’) downloaded from Genbank and BoLD Prior to tree construction, the dataset was checked for databases, the three sequence haplotypes of M. palustris substitution saturation using Xia test (Xia & Lemey 2009). generated in this study, and two outgroup representatives Since no saturation was observed, we proceeded with the each from Zosteropidae (Zosterops erythropleurus) and construction of a Neighbor-Joining (NJ) tree based on the Timaliidae (Garrulax lunulatus). As seen in table 2, the K2P model (see Figure 3). Bootstrap values for the NJ tree average K2P distance decreases as the taxonomic level generated were included in the topology.

Table 2. Minimum, maximum, and mean Kimura-2-Parameter pairwise values of all 169 unique Old World Warbler haplotypes. Comparisons # of comparisons minimum average maximum standard error between genera 10989 0.0640 0.1668 0.2262 0.0001 between species 2509 0.0017 0.1253 0.1851 0.0005 within species 331 0 0.0094 0.1126 0.0008

6 Philippine Journal of Science Luczon AU et al: Barcoding UP Diliman Birds Vol. 142 No. 1, June 2013

Figure 3. Neighbor-joining phylogenetic tree of some old world warblers including outgroup taxa from Zosterpoidae (white-eyes) and Timaliidae (babblers), based on a 600-bp fragment of the COI gene. Bootstrap support values are indicated at the nodes of the tree; bootstrap values less than 50% are not shown. Scale bar represents corrected genetic distance based on K2P model of substitution (0.02 = 1 nucleotide change for every 50 nucleotides). Classifications are based on Alström et al. (2006), Alström et al. (2011), and Sibley et al. (1990).

7 Philippine Journal of Science Luczon AU et al: Barcoding UP Diliman Birds Vol. 142 No. 1, June 2013

The gene tree was rooted on the outgroup taxon, Z. by multiplying by ten the average intraspecific distance erythropleurus, revealing relationships within the Old of a particular group studied. If two individuals have a World Warbler group with nine genera (containing 51 genetic distance that exceeds this threshold, then these ingroup species) and their relationship with the second individuals most likely belong to different unrecognized outgroup taxon, G. lunulatus. species. Empirically, their study derived a 2.7% threshold for birds. From the BLAST results in this study and The three distinct haplotypes of M. palustris clustered the K2P distances generated, sequence homology was together in the NJ tree. M. palustris haplotype 3 not always 100% for intraspecific comparison between (JF957021) seemed to have diverged from the other two the individuals and the gene sequences from Genbank. haplotypes (JF957022 and JF957020). This topology However, it still falls within the threshold set by Hebert received 100% NJ bootstrap support. The M. palustris et al. (2004) at 2.7% or less for species demarcation. This is then shown as a sister clade of several species demonstrates the effectiveness of the COI DNA barcodes of Locustella with bootstrap support of 96%. Most as markers for accurately identifying species. In addition, congeneric and conspecific sequences were grouped these differences in sequences might indicate geographic together and were supported with high bootstrap values. variations between populations of each species. For Observations regarding the placements of other sylviids example, Kerr et al. (2009) found 44 Palearctic bird based on the COI gene tree are worth mentioning. species exhibiting divergent COI sequences that follow Groupings of some recently recognized sylviid families known phylogeographic patterns of distribution. were evident in the gene tree such as the Phylloscopidae Currently, three subspecies of the Striated Grassbird (Phylloscopus spp.), Acrocephalidae ( are recognized: M. palustris palustris (Horsfield, 1821) and Hippolais spp.), and Locustellidae (Megalurus, distributed across the Philippines and throughout the Locustella, and spp). The cettid family insular south-east Asia; M. palustris toklao (Blyth, 1843) was consistently grouped with the sylviid Urusphena from , , China, and throughout the peninsula squameiceps with 74% bootstrap support. The family of , , , and ; and M. Sylviidae sensu stricto did not cluster together, with the palustris forbesi (Bangs, 1919) from northern Luzon and Sylvia being monophyletic but is not joined by Borneo. Another race described as M. palustris andrewsi Chamaea fasciata and squameiceps. Chamaea has been synonymized with M. palustris toklao (Deignan fasciata clustered with the Phylloscopidae clade in the 1946; Internet Bird Collection 2011). Aside from these, no NJ tree; however, this relationship is not well supported. other subspecies has been distinguished, though studies The relationship of the second outgroup taxon, G. lunulatus, on M. palustris have been limited. with the rest of the taxa is also quite problematic. Instead This study presents the first barcodes for M. palustris of diverging from the Old World Warblers, it consistently (ABBI 2011). Three unique 600-bp barcode sequences clustered with members of the Old World Warblers. of the mitochondrial COI gene were derived from five However, its placement is also not supported by bootstrap. individuals sampled within the UP Diliman campus. One of the M. palustris COI haplotypes has a considerably high distance value with respect to the other haplotypes. Since two subspecies are found in the Philippines, this could DISCUSSION indicate variation at the subspecies level. However, further Eleven species of birds from UP Diliman were successfully studies on populations of the Striated Grassbirds in the barcoded. This study was able to sample about 29% of the Philippines are needed in order to confirm this hypothesis. species observed by the previous wildlife survey of Ong The placement of the sequences obtained for M. palustris et al. (1999) or 31% of the species observed by Vallejo was evaluated through construction of a gene tree and et al. (2008). sequence divergence comparisons among species of the Except for P. goiavier, H. tahitica, A. phoenicurus, A. Old World Warblers “Sylviidae” where the current family atthis and G. striata, the species sequenced in this study of the Striated Grassbird, Locustellidae, was previously have several haplotypes associated with them even if included. Sequences include genera that were under the study site was just within the UP Diliman campus. Sylviidae sensu Sibley et al. (1990) such as Phylloscopus, Additional haplotypes for H. tahitica and A. atthis could Acrocephalus, Locustella, Sylvia, Chamaea, , potentially be found with additional sampling. Urosphena, and Hippolais. Hebert et al. (2004) set a threshold to delineate species The three unique M. palustris sequences are shown and discover new ones based on pairwise sequence to cluster together with high bootstrap support. The differences. The threshold, though later criticized, is set intraspecific distances based on five individuals of this

8 Philippine Journal of Science Luczon AU et al: Barcoding UP Diliman Birds Vol. 142 No. 1, June 2013 species from UP Diliman ranged from 0 - 0.0592, which group and the utility of the COI gene have also been is lower than the 10x the average intraspecific distance evaluated by comparing genetic distances with other COI for the Sylviidae (10 x 0.00943 = 0.0943) calculated in sequences from species belonging to the sylviid taxa. this study. This indicates the presence of only one species Results show that the COI was able to place M. palustris for the five individuals. in a distinct taxonomic group. This provides support for the use of COI as a means of species delineation. In the Sylvia clade, however, intraspecific distances between two Ménétries's Warbler Sylvia mystacaea DNA barcodes for M. palustris have been produced but sequences have reached 0.1126, greater than the screening not for its three subspecies. Barcoding studies for its threshold of the Sylviidae, which therefore warrants subspecies are therefore recommended to explore recent further scrutiny to test for misidentification or the presence species lineage divergences that might have occurred of a cryptic species. Evaluation and validation for new within the taxon as well as for a comprehensive evaluation species other than that from M. palustris, however, are if DNA barcodes have enough resolution in investigating beyond the scope of this study. subspecies relationships. Additional sampling for other species, particularly acquiring a minimum of five The COI tree showed that the M. palustris sequences individuals per species, is also recommended. clustered together with several Locustella species (Figure 3). The relationship within the locustellid family, however, has yet to be re-established as Alström et al. (2011) have recently discovered non-monophyly within this clade ACKNOWLEDGEMENTS based on four nuclear genes and one mitochondrial gene. The phylogeny of Locustellidae they generated strongly We acknowledge the funding agencies that have made this disagreed with the current taxonomy at the generic level, study possible: The Emerging Science and Technology and they proposed a revised classification that recognized Program of the Office of the Vice-President for Academic four genera of the Locustellidae family. One of these, Affairs (OVPAA) of the University of the Philippines Megalurus, is actually non-monophyletic. They stressed, System, the Philippine Council for Advanced Science however, that the classification is tentative and took into and Technology Research and Development of the account the phylogenetic uncertainty that is due to the Department of Science and Technology (PCASTRD- conflict between their results based on multiple loci on DOST), the Office of the Vice-Chancellor for Research the one hand and morphology and vocalizations on the and Development (OVCRD) – UP Diliman, and the other. Nevertheless, the obtained M. palustris sequences Energy Development Corporation. in our study nested together with Locustella, the Striated Grassbird’s sister genus. Analyses using the COI barcode gene for the Old World REFERENCES Warblers returned monophyletic groupings of conspecific, congeneric, and even some confamilial sequences with [ABBI] ALL BIRDS BARCODING INITIATIVE. 2012. strong bootstrap support. These observations support the Barcoding Life Takes Flight: Retrieved from http:// potential of the DNA barcode in differentiating closely www.barcodingbirds.org/ on 4 July 2010. related species but destabilize the efficiency of the COI ALSTRÖM P, ERICSON PGP, OLSSON U, SUNDBERG gene in inferring phylogeny of distant taxa. For this reason, P. 2006. Phylogeny and classification of the avian morphology, biogeography, ecology, and other taxonomic superfamily . and characters should also be considered when trying to infer 38: 381-397. species relationships as relying on a single-locus DNA barcode is not enough (Moritz & Cicero 2004). ALSTRÖM P, FREGIN S, NORMAN JA, ERICSON PGP, CRISTIDIS L, OLSSON U. 2011. Multilocus analysis of a taxonomically densely sampled dataset reveals extensive non-monophyly in the avian family CONCLUSION AND RECOMMENDATIONS Locustellidae. Molecular Phylogenetics and Evolution 58: 513–526. This study provides COI barcodes for bird species captured within the University of the Philippines Diliman. Using ALTSCHUL SF, GISH W, MILLER W, MYERS EW, BLAST, the species were correctly identified by comparing LIPMAN DJ. 1990. Basic local alignment search tool. it with other COI sequences in Genbank. The COI sequence Journal of Molecular Biology 215:403-410. of the Striated Grassbird Megalurus palustris generated AQUILINO SVL, TANGO JM, FONTANILLA IKC, in this study is a new record for DNA barcoding. The PAGULAYAN RC, BASIAO ZU, ONG PS, QUILANG placement of M. palustris within the Old World Warbler

9 Philippine Journal of Science Luczon AU et al: Barcoding UP Diliman Birds Vol. 142 No. 1, June 2013

JP. 2011. DNA barcoding of the ichthyofauna of Taal gap – COI barcode resolution in eastern Palearctic Lake, Philippines. Molecular Ecology Resources 11: birds. Frontiers in Zoology 6:29 (doi: 10.1186/1742- 612-619. 9994-6-29). BARKER FK, CIBOIS A, SCHIKLER P, FEINSTEIN J, KERR KCR, STOECKLE MY, DOVE CJ, WEIGT LA, CRACRAFT J. 2004. Phylogeny and diversification of FRANCIS CM, HEBERT PDN. 2007. Comprehensive the largest avian radiation. Proceedings of the National DNA barcode coverage of North American birds. Academy of Sciences 101: 11040-11045. Molecular Ecology Notes 7: 535–543. BERESFORD P, BARKER FK, RYAN PG, CROWE LOHMAN DJ, INGRAM KK, PRAWIRADILAGA TM. 2005. African endemics span the tree of DM, WINKER K, SHELDON FH, MOYLE RG, NG (Passeri): molecular systematics of several evolutionary PKL, ONG PS, WANG LK, BRAILE TM, ASTUTI 'enigmas'. Proceedings of the Royal Society of London D, MEIER R. 2010. Cryptic genetic diversity in B 272: 849-858. “widespread” Southeast Asian bird species suggests that Philippine avian endemism is gravely underestimated. CIBOIS A. 2003. Mitochondrial DNA phylogeny of Biological Conservation 143: 1885–1890. babblers (Timaliidae). The Auk 120(1): 34-54. LUCZON AU, MOHAMMAD ISA AHM, QUILANG JP, CONSORTIUM FOR THE BARCODE OF LIFE. What ONG PS, FONTANILLA IKC. 2010. DNA barcoding is CBOL? Retrieved from http://www.barcodeoflife. of the White-Collared Kingfisher Todiramphus chloris org/what-is-cbol/ on 30 June 2010. (Boddaert 1783) (Alcedinidae) using the mitochondrial DEIGNAN HG. 1946. Races of the Striated Marsh cytochrome c oxidase subunit I gene. Philippine Warbler. The Auk 63: 381-383. Science Letters 3(2):74-77. DICKINSON EC, KENNEDY RS, PARKES KC. (eds). MORITZ C, CICERO C. 2004. DNA barcoding: Promise 1991. The birds of the Philippines: an annotated check- and pitfalls. Public Library of Science Biology 2(10): list. London, British Ornithologists’ Union. e354. ERICSON PER GP, JOHANSSON US. 2003. Phylogeny MYERS N, MITTERMEIER RA, MITTERMEIER CG, of (Aves: Passeriformes) based on nuclear and DA FONSECA GAB, KENT J. 2000. Biodiversity mitochondrial sequence data. Molecular Phylogenetics hotspots for conservation priorities. Nature 403: and Evolution 29: 126–138. 853–858. HALL TA. 1999. BioEdit: a user-friendly biological ONG PS, LUCZON AU, QUILANG JP, SUMAYA sequence alignment editor and analysis program for AMT, IBANEZ JC, SALVADOR DJ, FONTANILLA Windows 95/98/NT. Nucleic Acids Symposium Series IKC. 2011. DNA barcodes of Philippine accipitrids. 41:95-98. Molecular Ecology Resources 11(2):245-254. HEBERT PDN, CYWINSKA A, BALL SL, DEWAARD ONG PS, PEDREGOSA MDG, DE GUIA MG. 1999. JR. 2003a. Biological identifications through DNA Wildlife inventory of the University of the Philippines barcodes. Proceedings of the Royal Society of London (UP) Diliman and the Ateneo de Manila University B 270: 313–321. Campus Diliman, Quezon City, Luzon, Philippines. Science Diliman 11(1): 6-20. HEBERT PDN, RATNASINGHAM S, DEWAARD JR. 2003b. Barcoding animal life: Cytochrome c oxidase PACKER L, GIBBS J, SHEFFIELD C, HANNER subunit 1 divergences among closely related species. R. 2009. DNA barcoding and the mediocrity of Proceedings of the Royal Society of London B 270: morphology. Molecular Ecology Resources 9(suppl.1): S596–S599. 42-50. HEBERT PDN, STOECKLE MY, ZEMLAK TS, SAITOU N, NEI M. 1987. The neighbor-joining method: FRANCIS CM. 2004. Identification of birds through a new method for reconstructing phylogenetic trees. DNA barcodes. Public Library of Science Biology Molecular Biology and Evolution 4:406-425. 2(10): e312. SIBLEY CG, AHLQUIST JE, MONROE JR BL. 1990. INTERNET BIRD COLLECTION. Striated Grassbird A classification of the living birds of the world based (Megalurus palustris). Retrieved from http://ibc. on DNA-DNA hybridization studies. The Auk 105(3): lynxeds.com/species/striated-grassbird-megalurus- 409-423. palustris on 29 March 2011. STADEN R, BEAL K, BONFIELD J. 2000. The Staden KERR KCR, BIRKS SM, KALYAKIN MV, RED’KIN YA, KOBLIK EA, HEBERT PDN. 2009. Filling the

10 Philippine Journal of Science Luczon AU et al: Barcoding UP Diliman Birds Vol. 142 No. 1, June 2013

package, 1998. Methods in Molecular Biology 132: 115-130. SWOFFORD D. 2002. PAUP*4.0. Sunderland, MA: Sinauer Associates. VALLEJO JR. BM, ALOYA AB, ONG PS, TAMINO A, VILLASPER J. 2008. Spatial patterns of bird diversity and abundance in an urban tropical landscape: the University of the Philippines (UP) Diliman Campus. Science Diliman 20(1): 1-10. WILD BIRD CLUB OF THE PHILIPPINES [WBCP]. 2010.Philippine Bird List. Retrieved from http:// www.birdwatch.ph/html/checklist/checklist.html on 17 July 2010. XIA X, LEMEY P. 2009. Assessing substitution saturation with DAMBE. In: Lemey P. (ed.). The Phylogenetic Handbook. Cambridge, UK, Cambridge University Press, pp. 611-626. XIA X, XIE Z. 2001. DAMBE: Data analysis in molecular biology and evolution. Journal of Heredity 92:371-373

11