Investigating the Functional Consequence of Pik3c2b Ablation in a Skeletal Muscle Model
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
AN INVESTIGATION of the ROLE of PAK6 in TUMORIGENESIS By
AN INVESTIGATION OF THE ROLE OF PAK6 IN TUMORIGENESIS by JoAnn Roberts A Thesis Submitted to the Faculty of The Charles E. Schmidt College of Medicine In Partial Fulfillment of the Requirements for the Degree of Master of Science Florida Atlantic University Boca Raton, Florida August 2012 ACKNOWLEDGMENTS This material is based upon work supported by the National Science Foundation under Grant No. DGE: 0638662. Any opinions, findings, and conclusions or recommendations expressed in this material are those of the author(s) and do not necessarily reflect the views of the National Science Foundation. I would like to thank and acknowledge my thesis advisor, Dr. Michael Lu, for his support and guidance throughout the writing of this thesis and design of experiments in this manuscript. I would also like to thank my colleagues for assistance in various trouble-shooting circumstances. Last, but certainly not least, I would like to thank my family and friends for their support in the pursuit of my graduate studies. iii ABSTRACT Author: JoAnn Roberts Title: An Investigation of the Role of PAK6 in Tumorigenesis Institution: Florida Atlantic University Thesis Advisor: Dr. Michael Lu Degree: Master of Science Year: 2012 The function and role of PAK6, a serine/threonine kinase, in cancer progression has not yet been clearly identified. Several studies reveal that PAK6 may participate in key changes contributing to cancer progression such as cell survival, cell motility, and invasiveness. Based on the membrane localization of PAK6 in prostate and breast cancer cells, we speculated that PAK6 plays a role in cancer progression cells by localizing on the membrane and modifying proteins linked to motility and proliferation. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Inhibition of Pikfyve Using YM201636 Suppresses the Growth of Liver Cancer Via the Induction of Autophagy
ONCOLOGY REPORTS 41: 1971-1979, 2019 Inhibition of PIKfyve using YM201636 suppresses the growth of liver cancer via the induction of autophagy JIU-ZHOU HOU1, ZHUO-QING XI1, JIE NIU1, WEI LI1, XIAO WANG1, CHAO LIANG1, HUA SUN1, DONG FANG1 and SONG-QIANG XIE2 1Institute for Innovative Drug Design and Evaluation; 2Institute of Chemical Biology, School of Pharmacy, Henan University, Kaifeng, Henan 475004, P.R. China Received May 9, 2018; Accepted December 6, 2018 DOI: 10.3892/or.2018.6928 Abstract. Liver cancer is among the most common types Introduction of cancer worldwide. The aim of the present study was to investigate whether the phosphatidylinositol-3-phos- Liver cancer is one of the most common types of cancer world- phate 5-kinase (PIKfyve) inhibitor, YM201636, exerts wide, ranking as the third leading cause of cancer-associated anti-proliferative effects on liver cancer. The methods used in mortality (1). Despite the great advances in the use of modern the present study included MTT assay, flow cytometry, western surgical techniques in combination with chemotherapy, the blot analysis and an allograft mouse model of liver cancer. The overall 5-year survival rate for patients with liver cancer results revealed that YM201636 inhibited the proliferation of remains poor (2). Therefore, novel strategies for the anticancer HepG2 and Huh-7 cells in a dose-dependent manner. HepG2 therapy of liver cancer are urgently required. and Huh-7 cells exhibited strong monodansylcadaverine Phosphatidylinositol-3-phosphate 5-kinase (PIKfyve) is a staining following treatment with YM201636. Accordingly, lipid kinase that phosphorylates phosphatidylinositol-3-phos- YM201636 treatment increased the expression of the phate (PI3P) to generate phosphatidylinositol 3,5-bisphosphate autophagosome-associated marker protein microtubule-asso- [PtdIns(3,5)P2] or phosphatidylinositol 5-phosphate ciated 1A/1B light chain 3-II in HepG2 and Huh-7 cells. -
PIK3C2G (NM 004570) Human Mutant ORF Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC402758 PIK3C2G (NM_004570) Human Mutant ORF Clone Product data: Product Type: Mutant ORF Clones Product Name: PIK3C2G (NM_004570) Human Mutant ORF Clone Mutation Description: P146L Affected Codon#: 146 Affected NT#: 437 Nucleotide Mutation: PIK3C2G Mutant (P146L), Myc-DDK-tagged ORF clone of Homo sapiens phosphoinositide-3- kinase, class 2, gamma polypeptide (PIK3C2G) as transfection-ready DNA Effect: Dibees, ype 2, ssoiion wih Symbol: PIK3C2G Synonyms: PI3K-C2-gamma; PI3K-C2GAMMA Vector: pCMV6-Entry (PS100001) Tag: Myc-DDK ACCN: NM_004570 ORF Size: 4335 bp ORF Nucleotide >RC402758 representing NM_004570 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCATATTCTTGGCAAACGGATCCAAATCCTAATGAATCACACGAAAAGCAGTATGAACACCAAGAAT TTCTCTTTGTAAATCAACCCCATTCTTCTAGCCAAGTCAGTCTGGGTTTTGATCAGATAGTAGATGAGAT CAGTGGCAAAATTCCACACTACGAGAGTGAAATTGATGAAAACACCTTTTTTGTGCCCACTGCACCAAAA TGGGACTCAACAGGGCATTCATTAAATGAAGCACACCAAATATCCTTGAATGAATTCACTTCTAAAAGCC GTGAACTCTCCTGGCATCAAGTTAGCAAAGCACCAGCAATTGGTTTTAGTCCTTCTGTGTTACCAAAACC TCAAAATACGAATAAAGAATGCTCCTGGGGAAGCCCCATAGGAAAACATCATGGTGCTGATGATTCCAGA TTCAGTATTTTAGCTCTATCATTCACAAGTTTGGATAAAATTAATCTAGAGAAAGAATTAGAAAATGAAA ATCATAACTACCATATAGGATTTGAAAGTAGCATTCCTCCAACAAATTCATCCTTCTCAAGTGACTTCAT GCCGAAAGAAGAGAATAAAAGGAGTGGACATGTGAACATTGTGGAACCATCTTTGATGCTTTTGAAAGGC -
Phosphoinositide 3-Kinase-C2α Regulates Polycystin-2 Ciliary Entry
BASIC RESEARCH www.jasn.org Phosphoinositide 3-Kinase-C2a Regulates Polycystin-2 Ciliary Entry and Protects against Kidney Cyst Formation † Irene Franco,* Jean Piero Margaria,* Maria Chiara De Santis,* Andrea Ranghino, ‡ Daniel Monteyne, Marco Chiaravalli,§ Monika Pema,§ Carlo Cosimo Campa,* ‡| Edoardo Ratto,* Federico Gulluni,* David Perez-Morga, Stefan Somlo,¶ Giorgio R. Merlo,* Alessandra Boletta,§ and Emilio Hirsch* *Molecular Biotechnology Center, Department of Molecular Biotechnology and Health Sciences, University of Torino, Turin, Italy; †Renal Transplantation Center “A. Vercellone”, Division of Nephrology, Dialysis and Transplantation, Department of Medical Sciences, Città della Salute e della Scienza, Hospital and Research Center for Experimental Medicine (CeRMS) and Center for Molecular Biotechnology, University of Torino, Turin, Italy; ‡Laboratoire de Parasitologie Moléculaire, Institut de Biologie et de Médecine Moléculaires (IBMM), Université Libre de Bruxelles, Gosselies, Charleroi, Belgium; §Division of Genetics and Cell Biology, Dibit San Raffaele Scientific Institute, Milan, Italy; |Center for Microscopy and Molecular Imaging (CMMI), Université Libre de Bruxelles, Gosselies, Belgium; and ¶Section of Nephrology, Yale University School of Medicine, New Haven, Connecticut. ABSTRACT Signaling from the primary cilium regulates kidney tubule development and cyst formation. However, the mechanism controlling targeting of ciliary components necessary for cilium morphogenesis and signaling is largely unknown. Here, we studied the function of class II phosphoinositide 3-kinase-C2a (PI3K-C2a)inrenal tubule-derived inner medullary collecting duct 3 cells and show that PI3K-C2a resides at the recycling endo- some compartment in proximity to the primary cilium base. In this subcellular location, PI3K-C2a controlled the activation of Rab8, a key mediator of cargo protein targeting to the primary cilium. -
Cellular and Molecular Signatures in the Disease Tissue of Early
Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of -
The DNA Methylation Landscape of Glioblastoma Disease Progression Shows Extensive Heterogeneity in Time and Space
bioRxiv preprint doi: https://doi.org/10.1101/173864; this version posted August 9, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The DNA methylation landscape of glioblastoma disease progression shows extensive heterogeneity in time and space Johanna Klughammer1*, Barbara Kiesel2,3*, Thomas Roetzer3,4, Nikolaus Fortelny1, Amelie Kuchler1, Nathan C. Sheffield5, Paul Datlinger1, Nadine Peter3,4, Karl-Heinz Nenning6, Julia Furtner3,7, Martha Nowosielski8,9, Marco Augustin10, Mario Mischkulnig2,3, Thomas Ströbel3,4, Patrizia Moser11, Christian F. Freyschlag12, Jo- hannes Kerschbaumer12, Claudius Thomé12, Astrid E. Grams13, Günther Stockhammer8, Melitta Kitzwoegerer14, Stefan Oberndorfer15, Franz Marhold16, Serge Weis17, Johannes Trenkler18, Johanna Buchroithner19, Josef Pichler20, Johannes Haybaeck21,22, Stefanie Krassnig21, Kariem Madhy Ali23, Gord von Campe23, Franz Payer24, Camillo Sherif25, Julius Preiser26, Thomas Hauser27, Peter A. Winkler27, Waltraud Kleindienst28, Franz Würtz29, Tanisa Brandner-Kokalj29, Martin Stultschnig30, Stefan Schweiger31, Karin Dieckmann3,32, Matthias Preusser3,33, Georg Langs6, Bernhard Baumann10, Engelbert Knosp2,3, Georg Widhalm2,3, Christine Marosi3,33, Johannes A. Hainfellner3,4, Adelheid Woehrer3,4#§, Christoph Bock1,34,35# 1 CeMM Research Center for Molecular Medicine of the Austrian Academy of Sciences, Vienna, Austria. 2 Department of Neurosurgery, Medical University of Vienna, Vienna, Austria. 3 Comprehensive Cancer Center, Central Nervous System Tumor Unit, Medical University of Vienna, Austria. 4 Institute of Neurology, Medical University of Vienna, Vienna, Austria. 5 Center for Public Health Genomics, University of Virginia, Charlottesville VA, USA. 6 Department of Biomedical Imaging and Image-guided Therapy, Computational Imaging Research Lab, Medical University of Vi- enna, Vienna, Austria. -
Mutations in PIK3C2A Cause Syndromic Short Stature
University of Groningen Mutations in PIK3C2A cause syndromic short stature, skeletal abnormalities, and cataracts associated with ciliary dysfunction Tiosano, Dov; Baris, Hagit N; Chen, Anlu; Hitzert, Marrit M; Schueler, Markus; Gulluni, Federico; Wiesener, Antje; Bergua, Antonio; Mory, Adi; Copeland, Brett Published in: PLoS genetics DOI: 10.1371/journal.pgen.1008088 IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below. Document Version Publisher's PDF, also known as Version of record Publication date: 2019 Link to publication in University of Groningen/UMCG research database Citation for published version (APA): Tiosano, D., Baris, H. N., Chen, A., Hitzert, M. M., Schueler, M., Gulluni, F., ... Buchner, D. A. (2019). Mutations in PIK3C2A cause syndromic short stature, skeletal abnormalities, and cataracts associated with ciliary dysfunction. PLoS genetics, 15(4), [e1008088]. https://doi.org/10.1371/journal.pgen.1008088 Copyright Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons). Take-down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum. -
Role and Regulation of the P53-Homolog P73 in the Transformation of Normal Human Fibroblasts
Role and regulation of the p53-homolog p73 in the transformation of normal human fibroblasts Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Bayerischen Julius-Maximilians-Universität Würzburg vorgelegt von Lars Hofmann aus Aschaffenburg Würzburg 2007 Eingereicht am Mitglieder der Promotionskommission: Vorsitzender: Prof. Dr. Dr. Martin J. Müller Gutachter: Prof. Dr. Michael P. Schön Gutachter : Prof. Dr. Georg Krohne Tag des Promotionskolloquiums: Doktorurkunde ausgehändigt am Erklärung Hiermit erkläre ich, dass ich die vorliegende Arbeit selbständig angefertigt und keine anderen als die angegebenen Hilfsmittel und Quellen verwendet habe. Diese Arbeit wurde weder in gleicher noch in ähnlicher Form in einem anderen Prüfungsverfahren vorgelegt. Ich habe früher, außer den mit dem Zulassungsgesuch urkundlichen Graden, keine weiteren akademischen Grade erworben und zu erwerben gesucht. Würzburg, Lars Hofmann Content SUMMARY ................................................................................................................ IV ZUSAMMENFASSUNG ............................................................................................. V 1. INTRODUCTION ................................................................................................. 1 1.1. Molecular basics of cancer .......................................................................................... 1 1.2. Early research on tumorigenesis ................................................................................. 3 1.3. Developing -
S42003-020-1008-Z.Pdf
ARTICLE https://doi.org/10.1038/s42003-020-1008-z OPEN A negative feedback loop between JNK-associated leucine zipper protein and TGF-β1 regulates kidney fibrosis Qi Yan 1,2,6, Kai Zhu1,6, Lu Zhang1,3,6, Qiang Fu1, Zhaowei Chen1, Shan Liu1, Dou Fu1, Ryota Nakazato4, ✉ 1234567890():,; Katsuji Yoshioka4, Bo Diao5, Guohua Ding1, Xiaogang Li3 & Huiming Wang 1 Renal fibrosis is controlled by profibrotic and antifibrotic forces. Exploring anti-fibrosis factors and mechanisms is an attractive strategy to prevent organ failure. Here we identified the JNK- associated leucine zipper protein (JLP) as a potential endogenous antifibrotic factor. JLP, predominantly expressed in renal tubular epithelial cells (TECs) in normal human or mouse kidneys, was downregulated in fibrotic kidneys. Jlp deficiency resulted in more severe renal fibrosis in unilateral ureteral obstruction (UUO) mice, while renal fibrosis resistance was observed in TECs-specific transgenic Jlp mice. JLP executes its protective role in renal fibrosis via negatively regulating TGF-β1 expression and autophagy, and the profibrotic effects of ECM production, epithelial-to-mesenchymal transition (EMT), apoptosis and cell cycle arrest in TECs. We further found that TGF-β1 and FGF-2 could negatively regulate the expression of JLP. Our study suggests that JLP plays a central role in renal fibrosis via its negative crosstalk with the profibrotic factor, TGF-β1. 1 Department of Nephrology, Renmin Hospital of Wuhan University, Wuhan, China. 2 Department of Geriatrics, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China. 3 Department of Internal Medicine, and Biochemistry and Molecular Biology, Mayo Clinic, Rochester, MN 55905, USA. -
SAC Phosphoinositide Phosphatases at the Tonoplast Mediate Vacuolar Function in Arabidopsis
SAC phosphoinositide phosphatases at the tonoplast mediate vacuolar function in Arabidopsis Petra Novákováa,b,c, Sibylle Hirschb,c,1, Elena Ferarub,c,2, Ricardo Tejosb,c,3, Ringo van Wijkd, Tom Viaeneb,c, Mareike Heilmanne, Jennifer Lerchee, Riet De Ryckeb,c, Mugurel I. Ferarub,c,2, Peter Gronesa,b,c, Marc Van Montagub,c,4, Ingo Heilmanne, Teun Munnikd, and Jirí Frimla,b,c,4 aInstitute of Science and Technology Austria, 3400 Klosterneuburg, Austria; bDepartment of Plant Systems Biology, Flanders Institute for Biotechnology and cDepartment of Plant Biotechnology and Bioinformatics, Ghent University, 9052 Ghent, Belgium; dSection of Plant Physiology, Swammerdam Institute for Life Sciences, University of Amsterdam, 1090 GE, Amsterdam, The Netherlands; and eDepartment of Cellular Biochemistry, Institute for Biochemistry and Biotechnology, Martin-Luther-University Halle-Wittenberg, 06099 Halle, Germany Contributed by Marc Van Montagu, January 2, 2014 (sent for review December 4, 2013) Phosphatidylinositol (PtdIns) is a structural phospholipid that can function of this minor phospholipid. Recent observations also be phosphorylated into various lipid signaling molecules, desig- hint at a role for PPIs in plant vacuoles (18–20), but the data are nated polyphosphoinositides (PPIs). The reversible phosphoryla- scarce and remain inconclusive. tion of PPIs on the 3, 4, or 5 position of inositol is performed by Advances in deciphering various cellular roles of PIs include a set of organelle-specific kinases and phosphatases, and the insights into the phosphatases responsible for hydrolyzing PPIs. characteristic head groups make these molecules ideal for regu- A group of phosphatases, designated suppressor of actin (SAC) lating biological processes in time and space. -
Analysis of Inherited and Somatic Variants to Decipher Canine Complex Traits
Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 1454 Analysis of inherited and somatic variants to decipher canine complex traits KATE MEGQUIER ACTA UNIVERSITATIS UPSALIENSIS ISSN 1651-6206 ISBN 978-91-513-0310-9 UPPSALA urn:nbn:se:uu:diva-347165 2018 Dissertation presented at Uppsala University to be publicly examined in B:22, BMC, Husargatan 3, Uppsala, Monday, 21 May 2018 at 13:15 for the degree of Doctor of Philosophy (Faculty of Medicine). The examination will be conducted in English. Faculty examiner: David Sargan (University of Cambridge). Abstract Megquier, K. 2018. Analysis of inherited and somatic variants to decipher canine complex traits. Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 1454. 67 pp. Uppsala: Acta Universitatis Upsaliensis. ISBN 978-91-513-0310-9. This thesis presents several investigations of the dog as a model for complex diseases, focusing on cancers and the effect of genetic risk factors on clinical presentation. In Papers I and II, we performed genome-wide association studies (GWAS) to identify germline risk factors predisposing US golden retrievers to hemangiosarcoma (HSA) and B- cell lymphoma (BLSA). Paper I identified two loci predisposing to both HSA and BLSA, approximately 4 megabases (Mb) apart on chromosome 5. Carrying the risk haplotype at these loci was associated with separate changes in gene expression, both relating to T-cell activation and proliferation. Paper II followed up on the HSA GWAS by performing a meta-analysis with additional cases and controls. This confirmed three previously reported GWAS loci for HSA and revealed three new loci, the most significant on chromosome 18.