Investigating the Functional Consequence of Pik3c2b Ablation in a Skeletal Muscle Model

Kamran Rezai

A thesis submitted in conformity with the requirements for the degree of Master of Science Department of Molecular Genetics University of Toronto

Master of Science

Molecular Genetics University of Toronto

2019

Abstract

Phosphoinositide 3-kinases (PI3Ks) and its three distinct classes are involved in a myriad of cellular processes, including: cell growth, survival and intracellular trafficking. The Class II PI3Ks remain one of the least studied classes of lipid kinases. There are three isoforms of class II kinases, PIK3C2α, PIK3C2β and PIK3C2γ. Our laboratory identified PIK3C2β as a modifier of X-linked myotubular myopathy (XLMTM) caused by mutations in MTM1. However, PIK3C2β’s role in muscle and the consequences PIK3C2β ablation has not been elucidated. To answer this question. I generated a skeletal-muscle specific PIK3C2β KO mouse and found lower fasting glucose levels and increased AKT activation in muscle in an age-dependent manner. Next, I created and characterized PIK3C2β KO C2C12 myoblasts and discovered increased surface GLUT4 levels upon insulin stimulation. These new insights into the consequences of PIK3C2β ablation represent an opportunity to develop novel therapeutic strategies in XLMTM and metabolic disorders.

Acknowledgements

I would like to acknowledge my supervisor Dr. James Dowling for providing his leadership and guidance throughout my graduate degree. The opportunity to learn, grow and do research in his laboratory within the Hospital for Sick Children was a valuable experience I can take with me towards my future career in science. I would also like to thank my committee members Dr. Mikko Taipale and Dr. John Brumell for their advice, critiques, and encouragement at our meetings.

To everyone in the laboratory who made themselves available to bounce ideas around and troubleshoot experiments, thank you for making the laboratory a fun and collaborative place to work. I was very lucky to join a great group of fellow graduate students who provided leadership, positivity, friendship and fun outside of the lab; a special thanks to all.

I would like to thank my family and close friends for their support throughout this journey. Making the move to a new city to take on this challenge could not be done without each of you.

iii

Table of Contents

Contents Acknowledgements ...... iii Table of Contents ...... iv List of Figures ...... vi Chapter 1 Introduction ...... 1 1.1 Phosphoinositides ...... 1

1.2 Phosphatidylinositol 3-Kinases ...... 2

1.3 Class II PI3Ks ...... 3

1.4 PIK3C2B, a Class II PI3K ...... 5

1.5 PIK3C2B, An X-linked Myotubular Myopathy Disease Modifier ...... 7

1.6 Insulin Regulation of GLUT4 Translocation ...... 9

1.7 Endosomal Recycling of GLUT4 ...... 11

1.8 Summary ...... 11

Chapter 2 In-vivo Characterization of the Loss of PIK3C2B in a Skeletal-Muscle Specific Knockout Model ...... 14 2.1 Acta Driven Expression of Cre-recombinase Generates Pik3c2b KOs ...... 14

2.2 Metabolic Analysis of Pik3c2b KO Mice ...... 15

Chapter 3 In-vitro Characterization of the Loss of PIK3C2B in C2C12 Myoblasts ...... 20 3.1 Creating CRISPR-Cas9 Mediated Pik3c2b KOs in C2C12 Myoblasts ...... 20

3.2 Characterizing Pik3c2b KO C2C12 Myoblasts ...... 22

Chapter 4 Discussion ...... 29 Chapter 5 Future Directions ...... 33 5.1 Specific Aim 1: Determine the cause of increased surface GLUT4 in Pik3c2b KO

myoblasts ...... 33

References ...... 35 Appendix I: Materials and Methods ...... 44

List of Figures

Figure 1. Specifics of the Pik3c2b mouse model ...... 15 Figure 2. GTT of Pik3c2b KO mice compared to WT show a decreased fasting blood glucose level ...... 17 Figure 3. Insulin tolerance test (ITT) of Pik3c2b KO mice compared to WT ...... 18 Figure 4. Insulin stimulation in vivo displays a trend towards enhanced phospho-AKT (S473) activation ...... 19 Figure 5. Experimental Design of CRISPR-CAS9 Editing of Pik3c2b and Sequence Analysis. 21 Figure 6. Western Blot Analysis of CRISPR-CAS9 Pik3c2b KO Clones ...... 22 Figure 7. Insulin time-course in Pik3c2b KO myoblasts exhibit increased AKT activation compared to WT ...... 23 Figure 8. Analysis of mTORC1 activation in Pik3c2b KO myoblasts ...... 24 Figure 9. GLUT4 translocation assay (OPD) performed on WT and Pik3c2b KO C2C12 myoblasts...... 26 Figure 10. Total GLUT4 protein expression in WT and Pik3c2b KO C2C12 myoblasts ...... 27 Figure 11. GLUT4 endocytosis assay performed on WT and Pik3c2b KO C2C12 myoblasts .... 28

Chapter 1 Introduction

1.1 Phosphoinositides

Phosphoinositides (PIPs) are important cellular signaling molecules generated and regulated by PI kinases and phosphatases. PIPs have been extensively studied due to their involvement in a myriad of cellular processes, such as: endosomal trafficking, exocytosis, autophagy and signal transduction1. PIPs belong to a family of membrane lipids characterized by the phosphorylation state of its base structure: phosphatidylinositol (PtdIns). These lipid molecules are composed of two fatty acid chains and a glycerol backbone tethered to an inositol ring with a phosphate linker2. Reversible phosphorylation of positions D3, D4 and D5 of the inositol ring results in seven distinct species of PIPs.

Regulation of these different PIPs is vital for cellular function as each PIP varies in its expression, localization and interactions with effector proteins. Additionally, these molecules are short lived and are present at low concentrations predominantly at cytosolic surface of membranes. PtdIns comprises 80% of the total cellular levels of PIPs3,4. PtdIns4P and

PdtIns(4,5)P2 represent the second most abundant PIPs at approximately 10% of total PIPs. The least abundant PIPs, PtdIns3P, PtdIns(3,4)P2, PtdIns5P, PtdIns(3,5)P2 and PtdIns(3,4,5)P3 each represent less than 1.5% of total PIP levels3. The seven PIPs vary widely in their subcellular localization, function and their ability to recruit specific effector proteins that mediate cellular signaling events. Generally, PI 3-phosphates are involved in endosomal trafficking while PI 4- phosphates are found at the plasma membrane and within the exocytic pathway1.

PIPs mediate their function through direct binding to effector proteins altering their enzymatic activity and/or localization leading to a cellular response. PIPs are able to direct and target binding partners via several specific lipid-binding domains: pleckstrin homology (PH), FYVE (Fab-1, YGL023, Vps27 and EEA1), phox (PX) and Epsin N-Terminal Homology (ENTH)5. These lipid-binding domains offer PIPs another level of complexity. For example, the PH domain was first shown to bind PtdIns(3,4)P2 but later some PH domains were demonstrated to have high affinity for PIPs with adjacent phosphates5,6. Further experimental approaches to define PH domain specificity revealed low affinity for PtdIns3P, PtdIns4P and PtdIns(3,5)P2.

Additionally, there is cross-specificity of PX and FYVE domains that are able to bind PtdIns3P with high affinity7. Several PIPs are generated as precursors for other PIPs which further adds importance to proper regulation of phosphorylation as perturbations in these pathways can have unpredictable or deleterious effects in the cell. The significance of proper PIP regulation is underscored by the number of human diseases where dysregulation of PI phosphatases and kinases are linked to the pathophysiology8. To date, PI metabolizing enzymes were reported to be involved in more than twenty genetic diseases9.

As the goal of my thesis is to characterize and understand the consequences of losing a class II phosphatidylinositol 3-kinase (PI3K) enzyme, PIK3C2B, the next section will focus on defining various key roles and functions of PI3Ks.

1.2 Phosphatidylinositol 3-Kinases

The phosphatidylinositol 3-kinases are a family of enzymes that are responsible for phosphorylation of the D3 position on the inositol ring in PtdIns and other PIP species. The production of these lipid molecules leads to activation of diverse cellular functions, such as: cell survival, proliferation, the endosomal/lysosomal system and metabolism. The PI3K family is comprised of three distinct classes organized by sequence homology and their preferred lipid substrate, referred to as class I, II and III PI3Ks. Each class has known and distinct roles within the cell, including the different isoforms within each class10. The class I PI3Ks are further divided into two sub-categories, class IA (α, β, δ-isoforms) that are coupled to receptor tyrosine kinases (RTKs) and class IB (γ-isoforms) which are coupled to G-protein-coupled receptors (GPCRs)11. The class IA PI3Ks function as heterodimers with a p110 catalytic subunit and a p85 regulatory subunit facilitates interactions with RTKs or their substrates. The class IB PI3Ks also functions as heterodimers with p110 catalytic subunit and p101 regulatory subunits. The p101 subunit facilitates interaction with Gβγ dimers formed downstream of GPCRs12. The class I PI3Ks are the most highly studied class and much of our understanding about PI3K signaling come from the PI3K-AKT signaling arm. Following discovery of the PH domain, bioinformatic approaches identified AKT as containing a PH-binding domain. The PH domain was first

6,13,14 postulated to bind PtdIns(4,5)P2 but later shown to bind to PtdIns(3,4,5)P3 and PtdIns(3,4)P2 . Thus, AKT was directly linked to PI3K activity.

AKT is activated by various growth factors and insulin in a PI3K-dependent response. AKT activation is found upstream of major cellular functions, such as: metabolism, protein synthesis and cell cycle and survival. Consequently, aberrations in AKT signaling can have adverse effects. Hyperactivity of AKT is observed in 50% of cancers and inactivating mutations can cause insulin resistance and diabetes15,16. Furthermore, the AKT pathway has many downstream targets with over 100 AKT substrates that have been reported in the literature17.

The class III PI3K, also known as vacuolar protein sorting-associated protein 34 (Vps34), was first discovered as the sole PI3K in Saccharomyces cerevisiae18. In S. cerevisiae, VPS34 is involved in endosomal trafficking of proteins to the vacuole19. VPS34 is part of heterodimeric complex with VPS15, a regulatory subunit20. In mammals, VPS34 is the sole class III PI3K also known as PIK3C3. PIK3C3, which is ubiquitously expressed and has substrate specificity for PtdIns, and therefore primarily generates PtdIns3P21. PIK3C3 is required for macroautophagy which is triggered during nutrient deprivation22. Furthermore, PIK3C3 is critical for endosomal trafficking, phagocytosis and mTOR signaling23. The majority of PtdIns3P generated at endosomal membranes is by PIK3C3 which allows for recruitment of effector proteins leading to endosomal maturation24. Several animal models of PIK3C3 have been studied. Full-body knockout models of PIK3C3 are embryonically lethal while conditional knockouts showed autophagy defects with significant disruption in tissue health and function25,26. Interestingly, partial PIK3C3 kinase inactivation can enhance insulin sensitivity through AMPK activation in metabolic tissues and an increase in mitochondrial content27. Thus, PIK3C3 is a vital regulator of intracellular trafficking, PtdIns3P production and cellular signalling.

1.3 Class II PI3Ks

There are three class II kinase isoforms, known as: PIK3C2A, PIK3C2B and PIK3C2G. The class II kinases are the least studied; however, the literature on each isoform continues to expand and findings support the hypothesis that different isoforms play unique and non-redundant roles.

4,28 The class II PI3Ks are unique in that they can produce both PtdIns3P and PtdIns(3,4)P2 . However, there is controversy over whether PtdIns or PtdIns4P is the preferred substrate and which cellular conditions might dictate any preference. Furthermore, unlike the class I and III PI3Ks that function as heterodimeric units, the class II PI3Ks function as monomers without a regulatory subunit. All PI3Ks share the same “PI3K motif” comprised of a C2 domain, helical 3 domain and the catalytic domain. However, the class II PI3Ks contain a unique C-terminus with an PX-domain and an additional C2 domain10.

The best studied class II PI3K is PIK3C2A, which has had many reported functions. PIK3C2A is ubiquitously expressed in mammals and can be activated by EGF, insulin and cytokines29–31. Several animal models for PIK3C2A deficiency have been reported and three separate groups have found PIK3C2A null mice to be embryonically lethal32–34. One group reported that PIK3C2A knockdown in endothelial cells reduced PtdIns3P levels at endosomes and critical endothelial cell signaling highlighting a role in vasculogenesis32. An additional animal model discovered PIK3C2A enrichment at the base of primary cilium where loss of PIK3C2A activity led to defects in cilium function in a PtdIns3P dependent manner35. Much like the class I PI3Ks, PIK3C2A has been implicated in regulating key components of cellular metabolism. In pancreatic β cells PIK3C2A knockdown led to increased proliferation and insulin signaling36. A PIK3C2A inactivation model demonstrated that heterozygous aged-male mice present with leptin resistance, develop insulin resistance and glucose intolerance37. Another described insulin- dependent activation of PIK3C2A in L6 myoblasts38. Indeed PIK3C2A-generated a pool of PtdIns3P at the plasma membrane in response to insulin stimulation. PIK3C2A is also required for maximal GLUT4 translocation38.

PIPs as well as PI kinases and phosphatases have been shown to regulate many steps in endocytosis, autophagy and exocytosis pathways. PIK3C2A through generation of PtdIns(3,4)P2 contributes to receptor-mediated endocytosis, also referred to as clathrin-mediated endocytosis (CME)39. PIK3C2A was first shown to interact with clathrin directly and later studies demonstrated its localization at clathrin-coated vesicles40,41. PIK3C2A mediated generation of

PtdIns(3,4)P2 is required at the maturation stage of clathrin-coated pits (CCPs) in order to recruit effector protein that will facility CCP scission from the plasma membrane42.

PIK3C2G is another member of the class II PI3Ks with few reported functions in the literature. PIK3C2G expression is more restricted than other class II PI3Ks. Expression analysis in human tissues discovered enrichment in liver, breast, salivary glands, prostate and macrophages43,44. In vitro analysis of PIK3C2G confirmed substrate specificity for both PtdIns and PtdIns4P45. Few studies implicate PIK3C2G expression in human disease; recently, low copy number was attributed to increased risk of recurrence and death in a colorectal cancer patient population46.

Another group discovered an association between specific PIK3C2G polymorphisms and type 2 diabetes mellitus where a C437T mutation was linked to lower fasting serum insulin levels47. PIK3C2G null animals had reduced liver glycogen and developed insulin resistance with age and high-fat diet34. In this model, AKT2 activation was quickly diminished in hepatic tissue upon insulin stimulation compared to WT, suggesting the PIK3C2G is required for sustained AKT2 activation. Indeed, a reduction in PtdIns(3,4)P2 levels following insulin stimulation in PIK3C2G null mice was discovered. PIK3C2G localizes to Rab5+ early endosomes (EEs) under basal and insulin stimulated conditions and is responsible for PtdIns(3,4)P2 production at EEs. Thus, PIK3C2G is a Rab5 recruiter downstream of insulin signaling in hepatic tissue34.

Class II kinases represent the least studied class of PI3Ks; however, the literature on each isoform continues to expand every year. The next section will focus on the final class II isoform, PIK3C2B, and its roles in cellular signaling and disease.

1.4 PIK3C2B, a Class II PI3K

The final class II PI3K isoform, PIK3C2B is ubiquitously expressed in mammals and has been implicated in various cancers and diabetes. Similarly to the other class II isoforms, PIK3C2B is

10,28 known to generate both PtdIns3P and PtdIns(3,4)P2 . However, PIK3C2B is unique in that multiple murine models of PIK3C2B ablation have shown no deleterious phenotypes33,48–50. These early studies were essential in confirming the non-redundant roles of the class II PI3Ks; however, the discovery of PIK3C2Bs distinct cellular functions remained.

Several studies have discovered PIK3C2B interactors that have provided insight into potential functions of this class II PI3K. In a co-immunoprecipitation study, PIK3C2B was found to interact with Dbl, a Rho family guanine nucleotide exchange factor, to modulate cell morphology and cytoskeleton regulation through the activation of RhoA51. Furthermore, PIK3C2B was found to regulate cytoskeletal organization by associating with the Eps8/Abi1/Sos1 complex upon EGF stimulation52. This complex also required constitutive PI3KC2B association to Grb2 and Shc leading enhanced cell migration in cancer cells due to Rac activation.

PIK3C2B expression is associated with several cancer types. PI3K inhibition has been a focus of targeted cancer therapy as PI3K/AKT/mTOR dysregulation is a hallmark in many cancers, to

5 date several PI3K inhibitors have achieved FDA approval53,54. In neuroblastoma tumors and cell lines PIK3C2B is highly expressed and upon PIK3C2B ablation there was reduced AKT activation and tumor growth55. Furthermore, PIK3C2B overexpression in breast cancer samples and cell lines (MCF7, T47D and MDA-MB-231) contributes to proliferation in vitro and in vivo56. Successful downregulation of PIK3C2B in these models led to cell cycle arrest through the regulation of cyclin B1 expression via an upregulation of mir-449a56. In prostate cancer (PCa) cells, PIK3C2B regulates MEK1/2 and ERK1/2 activation to regulate cell invasion and proliferation57. Importantly, these cellular phenotypes could be ameliorated with PIK3C2B downregulation. And finally, a larger study found PIK3C2B overexpression in multiple cancer types from a wider analysis of tumor samples and cell lines, including acute myeloid leukemia, glioblastoma multiforme, small cell lung cancer and neuroblastoma. Consistent with previous studies, PIK3C2B inhibition or downregulation was able to diminish the proliferative capacity of certain cancer cell lines and induce apoptosis58. While it is difficult to ascertain the true potential of PIK3C2B as an onco-target from these studies; nonetheless, they highlight the importance of developing specific pharmacological inhibition of the kinase which will be conducive to learning more about its cellular roles and functions.

There are two key studies that have demonstrated a role for PIK3C2B in diabetes and metabolism. Recently, a PIK3C2B kinase dead mouse model (D1212A mutation in the DFG motif in exon 24) exhibit enhanced glucose tolerance and insulin sensitivity50. Western blot analysis of various metabolic tissues found enough PIK3C2B expression in the brain, liver, white adipose tissue, muscle and spleen. The authors proposed a model where PIK3C2B inactivation leads to a slowed endosomal flux in hepatocytes causing insulin receptor (IR) to remain trapped in APPL1+ very-early endosomes and a defect in maturation into EEA1+ early endosomes. Consequently, there is a sustained IR signaling leading to enhanced AKT activation and an improved metabolism in the mice. Interestingly, while there was a 60% reduction in total PtdIns3P levels at the basal state in hepatocytes, upon insulin stimulation there was no difference between WT and PIK3C2B inactivation. Thus, it is unclear how the loss of PIK3C2B kinase activity led to these cellular and animal phenotypes50. Nonetheless, the authors proposed that PIK3C2B may be a drug target for insulin sensitization in treating type 2 diabetes. Furthermore, a recent publication describing a new role for PIK3C2B in nutrient signaling by demonstrating that the loss of PIK3C2B leads to mTORC1 hyperactivation28. The authors discovered that

PIK3C2B-mediated production of PtdIns(3,4)P2 at lysosomes under serum deprivation conditions led to the recruitment of the inhibitory 14-3-3γ protein and subsequent mTORC1 inhibition28. It is interesting that these two studies propose mechanisms of action with differing PIPs generated from PIK3C2B kinase activity. Thus, it is important that both PtdIns3P and

PtdIns(3,4)P2 are evaluated when the class II PI3Ks are studied. In the mTORC1 inhibition model, it was shown that there is no increase in AKT signaling. These experiments were performed in Hela and HEK293 cells, which are of epithelial origin but the exact origin of HEK293 cells is controversial59. Therefore, it is likely that the consequences of the loss of PIK3C2B protein expression or kinase activity is tissue and cell type specific.

1.5 PIK3C2B, An X-linked Myotubular Myopathy Disease Modifier

All three classes of PI3Ks generate PIPs in a reversible manner and are under dynamic regulation. The reverse reactions are carried out by PI-phosphatases and each have their own substrate specificities. Each of the class II PI3Ks can produce both PtdIns3P and PtdIns(3,4)P2.

PtdIns(3,4)P2 can be dephosphorylated by PTEN and INPP4A/B at position D3 and D4, respectively60,61. However, PtdIns3P is primarily dephosphorylated by the myotubularin-related proteins (MTMRs)61. The myotubularin family consists of 15 known isoforms but only nine exhibit phosphatase activity. Dysregulation and mutations of the MTMRs has been implicated in human diseases such as neuropathies and myopathies62. The loss of the MTMR member, MTM1, results in X-linked myotubular myopathy (XLMTM) a severe neuromuscular disease that presents at birth with muscle weakness, hypotonia and early lethality63. The laboratory previously discovered that the loss of MTM1 results in a significant increase in PtdIns3P levels in both murine and zebrafish models of myotubular myopathy. An initial hypothesis proposed that lowering PtdIns3P levels can improve or rescue the XLMTM phenotype. This was tested by targeting the class II and III PI3 kinases responsible for the production of PtdIns3P in skeletal muscle64. Of the 3 known class II isoforms, PIK3C2B has been identified to be highly expressed in skeletal muscle65.

PIK3C2B ablation in the background of the XLMTM mouse model rescues the disease phenotype, while the loss of PIK3C3 leads to a worsened phenotype49. The laboratory demonstrated a restoration of PtdIns3P levels in muscle with the loss of PIK3C2B. Additionally, a temporal knockout of PIK3C2B rescued the otherwise lethal XLMTM phenotype in a later 7 stage of disease progression and several broad-PI3 kinase inhibitors improved the XLMTM phenotype and survival in both mice and zebrafish49. Therefore, PIK3C2B was identified as a modifier of the XLMTM disease phenotype and an exciting therapeutic target.

The case for targeting PIK3C2B with potent and specific inhibitors continues to grow with several possible therapeutic opportunities. The most exciting opportunity is for the treatment of XLMTM where the current therapeutic landscape lacks an FDA approved treatment. There are many recent studies on XLMTM disease modifiers. Our laboratory has demonstrated that PIK3C2B ablation in the background of the XLMTM mouse model rescues the disease phenotype49. Additionally, the Laporte group has shown in that DNM2 in a heterozygous state and anti-sense oligonucleotide (ASO) or shRNA mediated knockdown is able to rescue the disease phenotype66–68. A recently published study identified MTMR2 as a disease modifier as its exogenous expression improved the XLMTM disease phenotype in mice69. Recently, our laboratory published our findings that tamoxifen therapy improves the XLMTM phenotype by reducing DNM2 protein expression70. And finally, gene therapy for XLMTM has been making progress clinically. Audentes Therapeutics is developing AT132, an AAV8 carrying MTM1, which showed strong preclinical data in murine and canine models and currently progressing through phase 1/2 clinical trials71. Concurrently an ASO therapeutic program targeting DNM2 mRNA is being developed by Dynacure. While many new and exciting strategies to treat XLMTM have been discovered in recent years, it is now time to translate new treatments into the clinic.

Other studies have identified PIK3C2B as a potential onco-target in various cancers and as a potential treatment for type 2 diabetes. However, considering the findings that PIK3C2B is a genetic modifier of XLMTM, it appears that PIK3C2B plays an important role in muscle by reversing this devasting disease. While our laboratory found evidence of PIP rebalancing, other genetic or chemical interventions in XLMTM found therapeutic benefit without affecting PIP levels72,73. Thus, it is prudent to investigate the role of PIK3C2B in muscle to gain insight into the mechanism by which it confers therapeutic benefit in XLMTM and the consequences of inhibition or genetic deletion in an otherwise healthy state.

1.6 Insulin Regulation of GLUT4 Translocation

Skeletal muscle is the primary site of glucose uptake and largest insulin-sensitive organ74. The development of insulin resistance in skeletal muscle influences whole body glucose homeostasis and is a prominent feature of type 2 diabetes. This is not surprising as skeletal muscle is responsible for 85% of glucose uptake in the body75. Insulin is the key metabolic hormone responsible for facilitating glucose uptake into muscle and adipose tissue by rapidly translocating GLUT4 (glucose transporter type 4) to the plasma membrane.

Glucose transporters are from a 14 member family of integral membrane proteins each with differing specificities for hexose and tissue expression76. GLUT4 is required for glucose transport into skeletal muscle, heart, brain and adipose tissue. In the basal state, approximately 5% of the total GLUT4 pool can be found at the cell surface77. Following insulin stimulation GLUT4, primarily stored in endosomal system and in GLUT4 storage vesicles (GSVs), is rapidly translocated to the plasma membrane78.

Insulin-mediated glucose-uptake begins with the activated insulin receptor (IR) phosphorylating insulin receptor substrate (IRS) leading to recruitment of class I PI3Ks which predominantly phosphorylates PtdIns(4,5)P2 (PIP2) producing PtdIns(3,4,5)P3 (PIP3). AKT binds PIP3 through its PH domain causing its rapid translocation to the plasma membrane. Furthermore, the accumulation of PIP3 at the plasma membrane will lead to the activation of PIP3-dependent kinases (PDK-1/2). Next, AKT is phosphorylated at its two activation sites Thr308 and Ser473 by PDK1 and mTORC2, respectively79. For phosphorylated-AKT to reach its highest level of activity, phosphorylation at S473 is required14. One of the major downstream targets of AKT in this pathway is the Rab GAP (GTPase-activating protein) AKT substrate of 160 kDa (AS160). The role of AS160 is best understood as a molecular gate-keeper of GLUT4 translocation. During unstimulated conditions, AS160 will inhibit the GTP loading of Rab GTPases thereby preventing GLUT4 translocation. However, under insulin-stimulated conditions AKT-mediated phosphorylation of AS160 eliminates its Rab-GAP activity. The initial steps of insulin-mediated GLUT4 translocation has been well characterized to date; however, it is important to note that different cell types have been shown to have differing downstream targets and effectors. Here, I will discuss the reported evidence relevant for skeletal muscle models.

The Rab GTPases are a large family of small G proteins. There are approximately 70 members reported in humans and they function as key regulators of intracellular vesicle traffic80. In muscle cells, AS160 has been shown to have interactions with Rab8A, Rab13 and Rab14 determined by knockdown experiments81,82. It is these Rab GTPases that will recruit effector proteins to mobilize GLUT4 storage vesicles. In a cellular overexpression model of the 4A-AS160 mutant, where the 4 phosphorylation sites are mutated, GLUT4 translocation is inhibited but overexpression of Rab8A, Rab13 and Rab14 is able to rescue the phenotype81,82. Rab8A activity downstream of insulin stimulation was further substantiated by evidence of its GTP loading along with Rab1382. How Rab GTPases mediate GLUT4 translocation and their binding partners in muscle remains poorly defined. However, under insulin stimulated conditions Rab8A binds to MyoVa in a Chinese hamster ovary cell model83. The authors then investigated this interaction in L6 myoblasts and discovered that MyoVa colocalized with Rab8A and MyoVa knockdown leads to a perinuclear accumulation of GLUT4 vesicles. Furthermore, upon insulin stimulation MyoVa engages Rab8A leading to GLUT4 vesicles being trafficked towards the plasma membrane83. Studies of Rab13 have suggested its primary function is near the plasma membrane. Rab13 was shown to interact with Mical-L2, an alpha-actinin-4 (Actn4) binding protein, which connects GLUT4 vesicles to the actin filament network upstream of vesicle fusion to the plasma membrane84. Meanwhile, Rab14 has been placed at the endosomal sorting of GLUT4 in GSVs85.

It is important to note that there are two parallel processes that are involved in GLUT4 translocation. There is the complex AKT-AS160 arm that drives GLUT4 translocation and there is Rac activation and actin remodeling arm. Both arms have been studied independently discovering that they do not hold influence over one another but are each required for GLUT4 translocation82. The Rho-family small GTPase, Rac1, is activated downstream of insulin signaling leading to dynamic actin remodeling. Rac1 skeletal-muscle specific deletions have been shown to cause insulin resistance and reduced glucose uptake86. Furthermore, Rac1 silencing has demonstrated that it is active actin remodeling and not stable actin networks that facilitate GLUT4 translocation87. There are several downstream effectors that have been shown to regulate endocytosis and translocation of GLUT4, including: nucleating factors WAVE and neuronal Wiskott-Aldrich syndrome protein (n-WASP) that engage with the actin cytoskeleton regulator Arp2/387. Together these effectors act as the scaffold for GLUT4 translocation leading to fusion of GLUT4 into the plasma membrane.

1.7 Endosomal Recycling of GLUT4

Surface GLUT4 levels are regulated by a dynamic balance between exocytosis and endocytosis. In the basal state, surface GLUT4 is reduced by rapid endocytosis and little exocytic activity. And conversely, elevated surface GLUT4 levels upon insulin stimulation lead to slowed endocytosis and rapid exocytosis88. Furthermore, GLUT4 is continuously recycled to and from the plasma membrane with a very long half-life of 48-hours before being targeted for degradation89.

GLUT4 can be internalized in two different processes, cholesterol-dependent endocytosis and clathrin-mediated endocytosis (CME). In muscle cells, CME is the dominant pathway for GLUT4 internalization90. Like most plasma membrane proteins, GLUT4 CME involves clathrin- coated pits and dynamin91. CCPs turned clathrin-coated vesicles (CCVs) upon membrane scission later fuse with early endosomes which are marked by the presence of Rab4, Rab5 and EEA1. Rab5 is reported to mediate vesicle association with the microtubular network through dynein92. Interestingly, Rab5 inhibition increases surface levels of GLUT492. Next, GLUT4 can enter different intracellular compartments, such as the endosome recycling compartment (ERC), late endosomes and the trans-golgi network (TGN) to be recycled back to the PM or lysosomes for degradation93. The Rab GTPase thought to regulate GLUT4 vesicle movement through the ERC and TGN is Rab11. When Rab11 is inhibited there is an increase in GLUT4 and transferrin receptor (TfR) colocalization, defects in basal endosomal recycling and ultimately reduced GLUT4 translocation upon insulin stimulation94. It is important to note that the models of GLUT4 endocytosis and subsequent endosomal activity were characterized in comparison to TfR. Both processes share similar Rab GTPases involved as well as endosomal recycling steps and have been colocalized within endosomal compartments89. The class II PI3Ks are implicated in various roles involving the endosomal/lysosomal system and Rab GTPase effectors. Investigating the mechanisms into which PIK3C2B or different PIP species interact with these networks can provide novel insights into these well studied systems.

1.8 Summary

The exact mechanisms which PIK3C2B mediates its functions has been elusive. Importantly, there has been little consensus in proposed models of PIK3C2B function in terms of the

11 important PIP species synthesized and cellular pathways perturbed upon the loss of PIK3C2B expression.

There are four major studies that can be built upon to help narrow down the role of PIK3C2B. First, PIK3C2B has been identified as an onco-target in various cancer models but how its overexpression supports uncontrolled growth or an intracellular environment that contributes to survival in cancer cells has not been determined. Secondly, a major study identifying that PIK3C2B kinase dead mouse leads to increased insulin sensitivity, improved glucose tolerance and resistance to high-fat diet induced fatty liver50. Third, PIK3C2B was implicated in nutrient signaling where both knockdowns and knockouts led to mTORC1 hyperactivation and the authors ultimately identified PIK3C2B as a mTORC1 suppressor in low-nutrient conditions28. And finally, our own laboratory was able to discover that PIK3C2B is a modifier of and ultimately rescues the XLMTM phenotype in mice49. As with other class II PI3Ks there appears to be a role for PIK3C2B in metabolism, endolysosomal pathway and a unique role in muscle biology.

With these discoveries in mind, the specific aims of my thesis are: 1) Investigate the consequences of losing PIK3C2B expression in a skeletal-muscle specific knockout mouse, and 2) Determine the changes in intracellular signaling and dynamic regulation of GLUT4 in a skeletal muscle model upon the loss of PIK3C2B expression.

Towards for first aim, I conducted preliminary metabolic characterizations of a skeletal-muscle specific Pik3c2b knockout mouse. PIK3C2B under a different skeletal-muscle promoter was demonstrated to rescue the XLMTM phenotype under double knockout conditions of Mtm1/Pik3c2b49. Furthermore, a role for PIK3C2B was shown in glucose uptake and insulin sensitivity in a full-body kinase dead model with a focus on hepatocytes50. Therefore, I sought to determine if PIK3C2B ablation can recapitulate positive metabolic phenotypes in a muscle- specific manner.

For my second aim, I have developed an in-vitro model for investigating the role of PIK3C2B in skeletal muscle. Using CRISPR-CAS9 gene editing and C2C12 myoblasts I successfully produced Pik3c2b knockout myoblasts for further investigation. PIK3C2B has not been well studied specifically in the muscle and much of the literature focuses on non-muscle cell types

12 and tissue. Importantly, the C2C12 myoblasts obtained from the laboratory of Dr. Amira Klip stably express myc-tagged GLUT4. This cell model allows one to investigate various GLUT4 dynamics, including: translocation, endocytosis and co-localization experiments.

Chapter 2 In-vivo Characterization of the Loss of PIK3C2B in a Skeletal-Muscle Specific Knockout Model

The data generated in this chapter is based on a muscle-specific Pik3c2bfl/fl Acta1-Cre mouse-line (referred to as Pik3c2b KOs). To characterize this mouse line, I confirmed that the Acta1 muscle- specific promoter can efficiently ablate PIK3C2B protein expression in muscle, performed glucose tolerance tests and probed PI3K-dependent AKT activation in response to insulin stimulation.

2.1 Acta Driven Expression of Cre-recombinase Generates Pik3c2b KOs

The Pik3c2b KO mouse utilizes the Cre/lox P system which allows for conditional deletions. This system is one of the most powerful genetic tools used in murine models. Tissue specific knockouts of genes are exciting avenues to gain greater insight into the tissue-specific function of proteins. Furthermore, Cre/lox P constructs are capable of providing spatial or temporal control of gene deletion, such as tamoxifen inducible models allowing for genetic deletions upon tamoxifen delivery95. Cre-recombinase, originally a bacteriophage PI enzyme, catalyzes DNA recombination between two forward positioned LoxP sites that have been inserted into the genetic sequence of the target gene. The LoxP sites in this genetic model flank the catalytic domain of Pik3c2b, thus successful Cre-recombinase expression and activity will flox out this region (Figure 1a).

There are several promoters that may be used to drive muscle-specific expression of Cre- recombinase. Here the Acta1 (or HSA) promoter was used to specifically express Cre- recombinase in striated muscle fibers, which has been shown to provide efficient recombination in skeletal muscle96. The laboratory previously demonstrated that a muscle-specific Pik3c2bfl/fl Ckmm-Cre produced a knockout line where pups were born at mendelian ratios, similar to their WT siblings and had normal muscle structure49. In this previous study it was concluded that the Pik3c2bfl/fl Ckmm-Cre mouse did not alter skeletal muscle structure and function. Similarly, I was able to confirm successful reduction of PIK3C2B protein expression under the Acta-Cre promoter (Figure 1c) that directly corresponded to the genotype record from extracted genomic DNA (Figure 1b).

Figure 1. Specifics of the Pik3c2b mouse model (a) A schematic of Pik3c2b with its catalytic domain (exon 3-5) flanked by LoxP sites. Under the muscle-specific Acta1 promoter, Cre-recombinase expression will flox out this region leading to Pik3c2b KO mice. (b) The expected genotype results of mice that are homozygous for the floxed alleles (fl/fl), heterozygous (fl/+) or wild type alleles and Cre positive. (c) Western blot analysis of quadricep muscle reveals undetectable PIK3C2B protein levels in KO mice.

To get a complete picture of the Pik3c2b KO mouse under the Acta1 promoter, it will be important to conduct a deeper characterization with additional experiments. I plan to investigate the muscle structure by H&E straining and electron micrograph of skeletal muscle sections to confirm muscle development is normal. The muscle-specific Pik3c2b KO mouse generated under the Mck promoter was previously characterized by the laboratory49. While the characterization identified a healthy mouse with normal development, within the electron micrograph (EM) images of skeletal muscle sections we can observe increased mitochondria accumulated near the sarcoplasmic reticulum. Interestingly, mitochondrial abnormalities are often found in skeletal muscle in the presence of metabolic disorders; such as: obesity and diabetes97. Other studies in humans found that increasing mitochondria parameters (oxidative capacity, mitochondrial count in muscle and biogenesis) led to improved metabolic outcomes98–100. If this mitochondrial phenotype can be confirmed there is an opportunity to identify a role for Pik3c2b in regulating a part of mitochondrial biology in skeletal muscle. My own observations of the Pik3c2b KO mouse found that the mice were born healthy and were indistinguishable from their WT littermates.

2.2 Metabolic Analysis of Pik3c2b KO Mice

Phosphoinositides and the PI3K family of enzymes have been shown to be key players in metabolic function and homeostasis. As previously discussed, the class II PI3Ks have roles in

15 various metabolic pathways in specific tissue types which further strengthens the non-redundant hypothesis of the different isoforms. With this evidence in mind, I decided to conduct a metabolic analysis of the Pik3c2b KO mice. Since this is a skeletal-muscle specific model any phenotype that arises will help pinpoint the muscle-specific activity of PIK3C2B. This is not the first case of a muscle-specific deletion of a PI kinase leading to a metabolic phenotype. Shisheva et al. previously reported that a muscle-specific Pykfyve deletion led to glucose intolerance and insulin resistance in a murine model101. This discovery was complemented by data showing decreased surface GLUT4 levels upon insulin stimulation and a reduced AKT response compared to wild type mice. The metabolic impact of a muscle-specific genetic deletion is not a surprising result. Skeletal muscle is the primary site of glucose uptake and largest insulin- sensitive organ that is responsible for up to 85% of glucose uptake in the body75. Impairment in insulin signaling and aberrations in its downstream pathway within muscle can cause systemic issues with glucose homeostasis74.

I began the metabolic analysis on the muscle-specific Pik3c2b KO mice with a glucose tolerance test (GTT) mice from the same sex that were fasted for 5-6 hours during the day. The experiment was carried out on two age different groups: 8-week-old mice (2mo) and 56-week-old mice (8mo). I discovered that the glucose tolerance in the 2mo group were comparable to wild type mice (Figure 2a, b). Interestingly, the male mice 8mo group had an improved GTT curve compared to wild type mice but upon closer analysis I found that the aged group had a lower fasting blood glucose (Figure 2c, d). Female Pik3c2b KO mice at 8mo had a significantly lower fasting blood glucose compared to WT, 138 mg/dL +/- 22.3 mg/dL compared to 180 mg/dL +/- 12.1 mg/dL (p=0.002). Male Pik3c2b KO mice at 8mo had a lower average fasting blood glucose compared to WT, 125.74 mg/dL +/- 10.38 mg/dL compared to 170.10 mg/dL +/- 60.46 mg/dL (p=0.08). A lower fasting blood glucose can be achieved through either a decrease in glucose output (via the liver) or an increase in glucose uptake by peripheral tissues like adipose and muscle. Glucose intolerance found in aged mice is well understood phenotype. Several studies have attempted to track the metabolic decline caused by aging in mice. One complete study connected age to a gain in fat mass, glucose intolerance and insulin resistance102. The researchers connected this metabolic phenotype to changes observed in the insulin and mTOR pathways, which had blunted downstream signaling of AKT-PI3K and mTOR-S6K1. As discussed previously, PIK3C2B was shown to be a negative-regulator of mTORC1 activity and the kinase-

16 dead model of PIK3C2B caused increased activation of AKT in multiple tissue types28,50. Thus, we can postulate that the loss of PIK3C2B expression can help rescue this age-dependent metabolic phenotype and be the mechanism for lower fasting blood glucose.

Figure 2. GTT of Pik3c2b KO mice compared to WT show a decreased fasting blood glucose level at 8mo. Following a 6-hour daytime fast, mice were injected with a volume of 20% glucose solution required was calculated as 2g of glucose/kg of body mass. Blood glucose readings were taken at the indicated time points. (a) Male WT mice (n=15), Pik3c2bfl/+ mice (n=9) and Pik3c2b KO mice (n=6). (b) Female WT mice (n=8), Pik3c2bfl/+ mice (n=3) and Pik3c2b KO mice (n=3). (c) WT mice (n=4), Pik3c2bfl/+ mice (n=2) and Pik3c2b KO mice (n=7). (d) WT mice (n=6), Pik3c2bfl/+ mice (n=6) and Pik3c2b KO mice (n=6), T=0 blood glucose levels significantly different between Pik3c2b KO and WT (**P<0.01); Student’s t test, 2-tailed. Error bars indicate SEM. Insulin tolerance tests were conducted in a complete set of 8mo female mice and there was no difference found between the Pik3c2b KO group and wild type mice (Figure 3). This data suggests that Pik3c2b KO mice did not become sensitive or resistant to insulin with the loss of PIK3C2B expression. It is important to note that the Pik3c2b KO mouse is muscle-specific, thus

17 endogenous insulin production, release and activity in other insulin-responsive tissues is unaltered. Furthermore, the liver and adipose tissue remain as functional sites for an insulin- response and subsequent metabolic activity.

Figure 3. Insulin tolerance test (ITT) of Pik3c2b KO mice compared to WT show a comparable insulin response. Following a 6-hour daytime fast, mice were injected with 0.75U insulin/kg of body mass intraperitoneally. Blood glucose readings were taken at the indicated time points. Data is presented as the percent change from the basal reading for each genotype. WT mice (n=6), Pik3c2bfl/+ mice (n=6) and Pik3c2b KO mice (n=6). Next, I probed for the intracellular response to insulin-stimulation in skeletal muscle of Pik3c2b KO mice. As discussed previously, AKT is activated by various growth factors and insulin in a PI3K-dependent response. Insulin mediated AKT activation begins with the insulin receptor (IR) interacting with insulin receptor substrate (IRS) leading to recruitment of class I PI3Ks which predominantly converts PIP2 into PIP3. AKT can engage with PIP3 through its PH domain causing rapid translocation to the plasma membrane. In the study describing the PIK3C2B kinase dead model, it was proposed that the enhanced AKT activation found in hepatocytes is due to increased PIP3 levels compared to WT hepatocytes50.

Female 8mo Pik3c2b KO were IP injected with insulin or PBS and sacrificed after 20 minutes for tissue extraction. Protein extracts were prepared from quadricep muscle and probed for phospho-AKT (S473) levels. The phospho-AKT (S473)/Total AKT ratio of insulin stimulated Pik3c2b KO mice compared to WT mice had an enhanced activation of AKT (P=0.24) (Figure 4b). However, within the sample size of 3, a single KO data point had WT-like levels of AKT activation creating a wide range for the KO group. To strengthen these results and confirm that a muscle-specific deletion of Pik3c2b can lead to enhanced AKT activation, I’d like to increase the

18 sample size of the 8mo mice and conduct a similar experiment in mice at the 2mo time-point. I also attempted to probe for P70S6K activation to investigate if the loss of PIK3C2B protein expression can lead to enhanced mTORC1 activation previously discussed, however the antibody was unable to produce quantifiable western blots from quadricep protein lysates.

Figure 4. Insulin stimulation in vivo displays a trend towards enhanced phospho-AKT (S473) activation in Pik3c2b KO mice compared to WT. Insulin- stimulation was performed on 7-8-month-old female mice. Following 6-hours of fasting, mice were IP injected with 0.75U/kg body weight of insulin or PBS. (a) Representative Western blots for phospho-AKT and total AKT for insulin stimulated and unstimulated WT, HET and KO mice. (b) Protein levels of both phospho-AKT and total AKT was determined by densitometry and presented as a ratio of pAKT/Total AKT. All groups are represented as fold difference from the average of PBS injected WT mice ± SEM (n=3 mice per group). One developing hypothesis based on the data presented could be that Pik3c2b KO mice are protected from age-dependent high fasting blood glucose in mice due to enhanced activation of the AKT signaling in skeletal muscle that can drive increased glucose. However, further experimentation and larger sample sizes are required to confirm the trends observed and strengthen the hypothesis with significant data. I previously had plans for a high-fat diet study as a metabolic stressor but with the subtle and variable mouse phenotypes observed I decided to focus on characterizing the loss of PIK3C2B expression in a cell model. Using a cellular model, I can better probe aberrations to intracellular signaling, pathways and conduct a wider variety of experimental techniques.

Chapter 3 In-Vitro Characterization of the Loss of PIK3C2B in C2C12 Myoblasts

Based on animal data generated there is evidence for PIK3C2B participating in the insulin- mediated PI3K/AKT response in skeletal muscle and in glucose homeostasis. I decided to probe for the consequences of losing PIK3C2B protein expression in C2C12 myoblasts. To do this I considered various readouts: AKT activation, mTORC1 signaling, GLUT4 translocation and endocytosis. While previous studies focused on other tissue and cell types, data generated here will be the first insights for the possible roles of PIK3C2B the context of skeletal muscle.

3.1 Creating CRISPR-Cas9 Mediated Pik3c2b KOs in C2C12 Myoblasts

C2C12 myoblasts have been shown to be a suitable cell model to follow up these animal experiments due their ability to represent muscle biology at the single cell level and the ability to differentiate them into elongated myotubes103–105. Thus, I decided to use C2C12 myoblasts and CRISPR-CAS9 technology to create a Pik3c2b KO cell line. CRISPR-CAS9 technology has been increasingly used to replace conventional techniques in gene editing. To create the CRISPR-Cas9 mediated knockout, I followed the landmark paper describing genome engineering by Dr. Feng Zhang106. Cas9 is a nuclease that uses small RNA guides to anneal to the target DNA sequence allowing for highly efficient and specific gene editing in a variety of cell types107. I selected the SpCas9 which creates double-strand breaks at the target site. Double strand breaks are repaired by non-homologous end joining (NHEJ) which can lead to indels or frameshift mutations in the target sequence106. When the error-prone NHEJ process is targeted to coding exons then the subsequent mutations can create genetic knockouts via early-stop codons108.

Using the webtool CHOPCHOP I selected highly efficient sgRNA target sites for PIK3C2B109. These guide RNAs were then cloned into the sPsCas9 expressing plasmid with a puromycin selection marker106. The plasmids were electroporated into GLUT4-Myc expressing C2C12s and sorted into 96-well plates to create single cell colonies. Clonal populations that were successfully expanded were cryopreserved and screened by PCR at the predicted cut site to confirm genetic alterations. In order to visualize the sequencing result I used the webtool “ICE” by Synthego, which uses the raw chromatogram data and converts it into NGS style sequencing results110.

From several clones I was able to identify two that presented with significant disruption to the coding sequence when compared to the WT sequence. The first clone, 5-5, was predicted to have multiple and large indels within the coding sequence making it difficult to ascertain the exact genetic alterations (Figure 5c). The second clone, 5-11, was predicted to primarily have a +1 base pair frameshift at amino acid 250 (Figure 5d). After inserting this frameshift into the predicted mRNA sequence of PIK3C2B I was able to identify an early stop codon introduced at amino acid 302, positioned before the catalytic domain. Following these results, I performed a western blot and was able to confirm the loss of PIK3C2B protein expression in both clones (Figure 6a). Clone 6-9 electroporated with gRNA 2 did not produce a sequencing result that could be analyzed by the webtool ICE but showed reduced protein expression (Figure 6b).

Figure 5. Experimental Design of CRISPR-CAS9 Editing of Pik3c2b and Sequence Analysis. (a) Schematic of Mus. Pik3c2b coding sequence with the position of gRNA target sites. (b) gRNA target sequence with the PAM sequence in red, efficiency and ranking pulled from the CHOPCHOP webtool109. (c-d) Following clonal isolation and subsequent expansion, clones were sequenced at the gRNA target site with a WT control. Graphs presented are the predicted genetic changes as determined by the webtool ICE by Synthego110. Clone 5-5 was predicted to have many indel changes; however, clone 5-11 presented with a dominant +1 base pair frameshift. Graphs were originally generated by ICE with minor adaptations.

Figure 6. Western Blot Analysis of CRISPR-CAS9 Pik3c2b KO Clones. (a) Equal loading of protein lysate from 3 CRISPR-CAS9 edited clones. Clone 5-5 and clone 5-11 generated from gRNA 1 (Figure 4b) had no detectable PIK3C2B protein expression. Clone 6-9 generated from gRNA 2 (Figure 4b) presented with reduced protein expression compared to WT. (b) Relative PIK3C2B protein expression compared to WT C2C12s (n=1).

3.2 Characterizing Pik3c2b KO C2C12 Myoblasts

Next, I began to characterize the Pik3c2b KO myoblasts by first confirming the trend in increased AKT activation observed in the Pik3c2b KO animal data. To identify changes in insulin-stimulated activation in the AKT-PI3K pathway I serum-starved Pik3c2b KO and WT cells for 3-hours and stimulated with 100mM insulin for up to 30 mins. From the time-course experiment I observed an enhanced AKT activation at each time-point (Figure 7). Thus, the Pik3c2b KO myoblasts are able to recapitulate the phenotype from Pik3c2b KO mice and the previously reported data highlighting an enhanced AKT activation in metabolic tissues (liver, muscle and adipose tissue); however, this AKT phenotype is not present in cell lines of fibroblast or epithelial origin28,50. The discrepancy between enhanced AKT activation depending on tissue type can be explained by the physiological functions of AKT in different cell and tissue types. In epithelial or mesenchymal cell types AKT activation serves as a function for cell survival and growth; whereas, AKT activation in muscle is required for glucose uptake and protein synthesis111.

Figure 7. Insulin time-course in Pik3c2b KO myoblasts exhibit increased AKT activation compared to WT. (a) Representative western blot of phospho-AKT (S473) compared to total AKT for Pik3c2b KO and WT C2C12 myoblasts stimulated with 100nM insulin for the indicated amount of time (b) Protein levels of both phospho-AKT and total AKT was determined by densitometry and presented as a ratio of pAKT/Total AKT. All groups are represented as fold difference from WT C2C12 myoblasts following 5 min of insulin stimulation ± SEM (n=3). The mechanism of action for the increased AKT activation is yet to be determined. One avenue to understand the observed changes is by evaluating the changes in PIP levels upon the loss the PIK3C2B protein expression at the basal and insulin stimulated state. One can predict reduced levels of PtdIns3P or PtdIns(3,4)P2 as both PIPs have been shown to have reduced expression in Pik3c2b KO conditions28,49. As mentioned previously, PIP3 levels were shown to be increased hepatocytes in the PIK3C2B kinase dead model, I would like to determine if this phenotype is recapitulated in muscle cells50. Furthermore, it is possible that there is a compensatory mechanism upon the loss of PIK3C2B protein expression. Thus, I would like to confirm that protein expression of the class I PI3Ks and PIK3C2A remain unchanged under Pik3c2b KO conditions in this cell model. Lastly, it is important to note that PI3K-dependent AKT activation occurs primarily at T308 and phosphorylation at S473 by mammalian target of rapamycin complex 2 (mTORC2) is responsible for the full activation and stability of AKT112. Therefore, investigating the phosphorylation stats at T308 will provide insight into mTORC2 activity under Pik3c2b KO conditions.

Two important pathways downstream of AKT activation I chose for investigation were mTORC1 and GLUT4 translocation. To probe the mTORC1 pathway I looked recapitulate the report that found Pik3c2b knockdown in HEK293 and Hela cells led to mTORC1 hyperactivation28. The experiments presented in this study discovered that nutrient-deprived cells followed by reintroduction of nutrients (fetal bovine serum) led to mTORC1 hyperactivation in

Pik3c2b knockdown cells. Following a similar experimental design, I found a comparable mTORC1 activation in Pik3c2b KO myoblasts when compared to WT with the reintroduction of nutrients (Figure 8b). Interestingly, mTORC1 activation in Pik3c2b KO myoblasts under insulin stimulation had a muted response compared to WT cells (Figure 8b). This data further confirms the trend towards tissue or cell type specific consequences of ablating PIK3C2B protein expression.

Figure 8. Analysis of mTORC1 activation in Pik3c2b KO myoblasts. (a) Representative western blot of phospho- P70S6K (T389) compared to total P70S6K for Pik3c2b KO and WT C2C12 myoblasts serum starved for 3-hours followed by a 30 min “nutrient rescue” with FBS or stimulated with 100nM insulin for 20 min (b) Protein levels of both phospho-P70S6K and total P70S6K was determined by densitometry and presented as a ratio of pP70S6K/Total P70S6K. All groups are represented as the fold difference from WT C2C12 myoblasts ± SEM (n=3). Next, I looked at another major downstream pathway of AKT activation: GLUT4 translocation. In the basal state, 5% of the total GLUT4 pool is located at cell surface with the remaining GLUT4 pool stored in endosomal system and in GSVs77,78. Furthermore, skeletal muscle is the primary site of insulin-stimulated glucose uptake in the body, thus C2C12 myoblasts can serve as a good model to study the loss of PIK3C2B protein expression and the regulation of GLUT4 translocation113.

Two well studied and utilized cell models derived from skeletal muscle are L6 rat myoblasts and C2C12 mouse myoblasts. L6 myoblasts have historically been used to study glucose metabolism and GLUT4 translocation because they sufficiently express GLUT4 which is able to drive glucose uptake114. C2C12 myoblasts have been extensively studied as a model for differentiation,

24 muscle development and myotube contraction115. Interestingly, C2C12 myoblasts have been found to express insufficient levels of GLUT4 protein116. However, the C2C12 myoblasts obtained from the laboratory of Dr. Amira Klip stably express GLUT4 with a myc epitope in the first extracellular loop, thus I can conduct measurable and meaningful GLUT4 translocation experiments.

The GLUT4 translocation assay (referred to as the OPD assay) takes advantage of the extracellular myc tag in a colorimetric detection assay117. The OPD assay is conducted under non-permeable conditions following fixation, which allows for specific binding of an anti-myc antibody to the myc tag of GLUT4 that has been successfully transported and fused into the PM. I was able to detect a significant increase in surface GLUT4 in insulin stimulated Pik3c2b KO myoblasts compared to surface GLUT4 in insulin stimulated WT myoblasts (Figure 9a). As an experimental control, AICAR is used since it can stimulate GLUT4 translocation via the AMPK pathway118. Both WT and KO myoblasts reacted with similar levels of GLUT4 translocation, providing evidence that AMPK signaling is undisturbed with the loss of PIK3C2B protein expression. Since the OPD assay stimulates with insulin for 20 minutes before fixation, I wanted to perform a time-course to observe GLUT4 translocation to the plasma membrane over time. Both WT and PIK3C2B KO myoblasts appear to peak at the 15-minute point and at the 30- minute point the PIK3C2B KO myoblasts still exhibit elevated surface GLUT4 compared to basal levels (Figure 9b).

Figure 9. GLUT4 translocation assay (OPD) performed on WT and Pik3c2b KO C2C12 myoblasts. (a) Myoblasts were seeded in 24-well plates in triplicates and allowed to reach ~90% confluence. Myoblasts were then serum starved for 3 hours. Following starvation cells were stimulated with 100mM insulin for 20 minutes or 250mM AICAR for 30 minutes and the cells were fixed to followed by immunological detection of the myc epitope and a colorimetric assay was performed. WT myoblast showed a significant increase in surface GLUT4 with insulin stimulation (**P= 0.0015). The increase in surface GLUT4 from basal levels was significantly different in KO myoblasts compared to WT (*P= 0.0457). All groups are represented as the fold difference from basal the condition ± SEM (n=3), (b) An OPD time-course experiment was performed, cells were stimulated with 100mM insulin for the indicated amount of time before the experiment was terminated. Surface GLUT4 levels were significantly different at the 10m (**P= 0.0368) and 30m (*P= 0.137) timepoints All groups are represented as the fold difference from basal the condition ± SEM (n=3 for WT, n=6 for KO). I decided to evaluate total GLUT4 protein levels in the myoblasts to determine if there is any discrepancy in protein expression. I found that WT and KO myoblasts have similar GLUT4 protein expression under normal cell culture conditions and following a 3-hour starvation. However, upon insulin stimulation for 20 minutes, total GLUT4 levels drop in WT myoblasts not in the KO myoblasts (Figure 10). This could suggest an alteration in endosomal recycling towards the late endosomes/lysosomes that is slowed or perturbed in the Pik3c2b KO myoblasts.

Figure 10. Total GLUT4 protein expression in WT and Pik3c2b KO C2C12 myoblasts. (a) Representative western blot of total GLUT4 in WT and KO myoblasts. Cells were evaluated in 3 conditions: serum fed (normal cell culture conditions), 3-hour starvation and 100mM of insulin stimulation for 20 min. Upon insulin stimulation, GLUT4 expression trends downward when compared to KO myoblasts which retain basal levels of GLUT4 expression. (b) Protein levels of GLUT4 was determined by densitometry and presented as the fold difference from serum-fed WT C2C12 myoblasts ± SEM (n=3). An increase of surface GLUT4 levels could be the result of changes in exocytosis or endocytosis. Therefore, I sought to conduct a GLUT4 endocytosis assay to investigate if this pathway is affected in the Pik3c2b KO myoblasts. First, cells are stimulated with 100mM of insulin for 20 min followed by washing with ice-cold PBS. Next, cells were blocked and probed with an anti- myc antibody on ice. The plates used for measuring endocytosis were warmed up to 37°C to allow for GLUT4 internalization to take place. Next, the cells were fixed and an OPD was performed to detect surface levels of GLUT4. Consistent with previous data, the overall surface levels of GLUT4 were increased at each time point in KO myoblasts compared to WT (Figure 11a). However, when overlaying the charts of KO and WT myoblasts compared to their own starting point, I found the lines overlapping (Figure 11b). This data suggests there is no defect in endocytosis because of the similar rates of endocytosis upon the removal of insulin. However, this needs to be further studied to rule out slowed endocytosis as a mechanism of the increased surface GLUT4. I would like to repeat the assay with additional time-points since the data presented was generated from the first time I conducted the assay.

Figure 11. GLUT4 endocytosis assay performed on WT and Pik3c2b KO C2C12 myoblasts. (a) Myoblasts were seeded in 24-well plates in triplicates and allowed to reach ~90% confluence. Myoblasts were then serum starved for 3 hours. Following starvation cells were stimulated with 100mM insulin for 20 min followed by immunological detection of the myc epitope. Select plates were re-warmed to 37°C to allow for GLUT4 internalization. A colorimetric assay was performed to detect surface levels of GLUT4. KO myoblasts presented with increased levels of GLUT4 at each time point but rate of endocytosis was not significantly different. All groups are represented as the fold difference from the control plate (did not undergo internalization) ± SEM (n=1 biological replicate, n=9 technical replicates). (b) KO myoblasts normalized to its control plate overlaid with the WT myoblasts. All groups are represented as the fold difference from basal the condition ± SEM (n=1 biological replicate, n=9 technical replicates).

Chapter 4 Discussion

The purpose of the research project presented was to investigate the muscle-specific role of PIK3C2B and to study any phenotype that arises from PIK3C2B ablation in order to gain new insights on its role in muscle. There have been several proposed models of PIK3C2B function based on inhibition, knockdown or knockout experiment in various tissue and cell types; however, none more exciting than our laboratories study identifying PIK3C2B has a modifier of the XLMTM phenotype. XLMTM is a devastating skeletal-muscle disease and gaining insight into the role PIK3C2B in muscle will be valuable for translating this therapeutic target into the clinic.

Several studies have also addressed a role for PIK3C2B in metabolism and the endolysosomal system. First, in a PtdIns3P-dependent manner, the kinase inhibition of PIK3C2B was demonstrated to improve insulin sensitivity and glucose metabolism which highlighted a role in regulating early endosomes in hepatocytes. Secondly, PIK3C2B was identified to be a mTORC1 suppressor in a PtdIns(3,4)P2-dependent manner and a regulator of late endosomes/lysosomes in HEK293 cells; however, they found the early endosomes to be unaltered. While the stories presented are complex and variable, they set the stage for an important investigation of PIK3C2B in a skeletal-muscle model.

To begin, I conducted preliminary metabolic tests in a Pik3c2b KO mouse driven by the muscle- specific Acta promoter under the Cre/LoxP system. Consistent with previously generated PIK3C2B mouse models, I found the mice to be phenotypically normal, born at expected mendelian ratios and normal survival. These findings continue to support the hypothesis that targeting PIK3C2B can be a safe therapeutic target; however, it is not possible say there is no detectable phenotype without deeper investigation. A briefing by Dear and colleagues tackle this discussion head on and suggest several possibilities: (1) an abnormal phenotype is present but has not been discovered, (2) an abnormal phenotype is present but certain conditions or stressors need to be applied for discovery, or (3) no abnormal phenotype is present119. The authors discuss possible explanations for no detectable phenotypes, such as: genetic redundancy, activation of alternative pathways, genetic background, etc. But before resolving to the third option there is still ample work to be completed to rule out the lack of a discernable phenotype. There are

29 several global consortiums with well-defined phenotyping pipelines for investigating mouse lines, but I decided to undergo a smaller-scale approach taking into consideration the previous reported functions of PIK3C2B. One such approach was glucose tolerance tests in young and older mice where I discovered a trend in reduced fasting glucose levels. The significance of regulating blood glucose below hyperglycaemic levels in the context of metabolic disorders cannot be understated. Chronic hyperglycaemia in itself has been shown to contribute to the pathophysiology and medical complications of type 2 diabetes in humans120. To strengthen these results, it will be important to conduct additional metabolic tests and increase sample sizes.

The current knowledge of PIK3C2B function and the consequences of its ablation is variable among cell types and tissue. Despite this I was able to recapitulate previous findings of enhanced AKT activation in Pik3c2b KO mice which may explain the lowered fasting glucose levels. This also points towards an insulin-dependent role for PIK3C2B in metabolic tissues. Although these data are promising and warranted further investigation, I decided to investigate an insulin- dependent role for PIK3C2B in a cell model to take a closer look at the important pathways downstream of insulin stimulation.

As part of investigating the loss of PIK3C2B in a cell model, I optimized an efficient CRISPR- CAS9 mediated gene knockout protocol for C2C12 myoblasts also amendable to other cell lines. As discussed previously, PIK3C2B appeared to have a role in the endosomal recycling of IR in hepatocytes, thus I sought to determine if there any effects on GLUT4 since it is an important downstream target of IR signaling in muscle. Considering this I decided to create the Pik3c2b knockout myoblasts in GLUT4-myc expressing cells.

Next, I sought to examine if Pik3c2b KO myoblasts can recapitulate the observed enhanced AKT activation and the reported mTORC1 hyperactivation. While an enhanced insulin-mediated AKT activation remained consistent, mTORC1 signaling was normal under nutrient starvation and replenishment conditions but not under insulin-stimulation. Interestingly, these responses may be linked as mTOR signaling downstream of insulin signaling can feedback via S6 kinase to phosphorylate IRS-1 (S307) and consequently inhibit insulin signaling121. Therefore, I can propose that blunted mTORC1 activation (via p-S6K) may confer stronger or longer insulin signaling in metabolic tissues like muscle. However, this hypothesis is difficult to reconcile with previous findings that PIK3C2B is a negative regulator of mTORC1 at late

30 endosomes/lysosomes. Further investigation into this signaling arm will be required and importantly, investigating the phosphorylation status of IRS-1 between wild type and Pik3c2b KO myoblasts. It will also be interesting to see how Pik3c2b null adipocytes respond to elucidate if there is a distinct role for PIK3C2B in metabolic tissues versus other tissue or cell types.

The next major downstream event of insulin signaling is GLUT4 translocation. The OPD assay takes advantage of GLUT4myc expressing C2C12 myoblasts to detect GLUT4 that has been fused into the plasma membrane. With the previous reports of increased receptor signaling of IR with PIK3C2B inhibition, I hypothesized that there could be increased GLUT4 at the plasma membrane. Following insulin stimulation, I discovered an increase in surface GLUT4 in Pik3c2b KO myoblasts. To follow up these results I also confirmed that under basal and starvation conditions total GLUT4 protein levels are similar between the groups. However, in this same experiment I found that total GLUT4 levels drop in wild type myoblasts upon insulin- stimulation. These results are inconsistent with the literature as GLUT4 degradation typically requires a longer duration of insulin stimulation (hours) but the high dose of insulin (100nM) used here may have accelerated this process122. Next steps include recapitulating these cellular phenotypes in other Pik3c2b KO myoblasts and within subclones to ensure these results are consistent. These findings implicate PIK3C2B in the steps leading to GLUT4 translocation, but further investigation is required to pinpoint where along this pathway PIK3C2B is involved.

Finally, I looked to investigate the possible mechanisms of increased surface GLUT4 in muscle cells. While the exocytic pathways may be involved, the class II PI3Ks have been implicated in the endosomal system. PIK3C2A has an important role in clathrin-mediated endocytosis and interestingly PIK3C2B has a clathrin binding domain but a role has yet to be discovered123. And in recent literature PIK3C2B inhibition was shown to affect Rab5+ early endosomes structures and Rab5 is important for GLUT4 recycling50,124. My first attempt at adapting the OPD assay to measure endocytosis indicated similar rates of endocytosis while displaying an overall increase in surface GLUT4. These results suggest that endocytosis of GLUT4 maybe normal and that an increase in surface GLUT4 is based on exocytic activity, but further investigation and optimization of this protocol is required, importantly more time points and biological replicates.

The data presented in my research study set the stage for investigating a role for PIK3C2B in GLUT4 trafficking and to conduct a closer study into the intracellular signaling changes

31 observed in the Pik3c2b KO myoblasts. Gaining deeper insights into the functions of PIK3C2B by elucidating its roles here can build a strong case for developing PIK3C2B inhibition into therapeutic strategies in XLMTM and metabolic disorders.

Chapter 5 Future Directions

There are many remaining questions regarding the function of PIK3C2B. Significant work is required to position PIK3C2B in the many processes it has been implicated within, such as: the endolysosomal system and vesicle traffic, tumorigenesis, a XLMTM modifier and in improving metabolic phenotypes. Furthermore, consensus needs to be reached on the important PIP species produced by PIK3C2B to meditate its functions. Gaining insight or understanding into these outstanding questions will be key for translating PIK3C2B inhibition into a therapeutic.

5.1 Specific Aim 1: Determine the cause of increased surface GLUT4 in Pik3c2b KO myoblasts

PIK3C2B has specifically been implicated in early endosomal recycling and so have the other class II PI3Ks, pointing towards a possible role in GLUT4 endocytosis or its endosomal recycling34,42,50. However, it is difficult to rule out alterations in GLUT4 exocytosis due to the increased AKT activation observed in certain Pik3c2b KO models and the data presented. Another piece of information to consider is the defective recycling of TfR discovered in Mtm1 depleted HeLa cells leading to decreased surface TfR125. Interestingly, Pik3c2b knockdown can correct this cellular phenotype70. This is important as TfR-containing GLUT4 vesicles are known to recycle from the endosome to the plasma membrane85. Therefore, it is possible that the loss of PIK3C2B expression can lead to a gain of function in GLUT4 endosomal recycling or exocytosis.

To address these questions, it will be important to consider the relevant Rab GTPases that mediate the endosomal or exocytic trafficking of GLUT4. To test abnormalities in Rab GTPase function one will probe their localization with either tagged-Rab constructs or immunocytochemistry to investigate Rab activity. First, one can observe the response of Rab5 upon insulin stimulation in wild type and Pik3c2b KO myoblasts. We can expect that Rab5 is positioned near the plasma membrane as it plays a key role in clathrin-coated vesicle budding and fusion with early endosomes, which has been shown to facilitate GLUT4 internalization87,92. Furthermore, PI3K-signaling leads to Rab5 inhibition where Rab5-GTP levels are reduced 75%

33 in the first 20 minutes of insulin stimulation92. Thus, it will be important to evaluate Rab5 dynamics following insulin removal as well.

In similar experiments, Rab11 can be evaluated as it was demonstrated to be important for endosomal recycling back to the plasma membrane as well as the important Rab GTPases for GLUT4 exocytosis from GSVs (Rab8A and Rab14). These studies will help position the gain of function upon the loss of PIK3C2B and narrow the scope into more specific experiments.

Additionally, it will be important to consider the intracellular localization of GLUT4 in wild type and PIK3C2B depleted myoblasts. One can employ live-imaging techniques to detect changes in GLUT4 endocytosis and exocytosis upon insulin stimulation. For these experiments it may be preferable to use the efficient Pik3c2b gRNA previously generated to create knockout lines in wild type C2C12 myoblasts and utilize a GFP-GLUT4myc construct. Furthermore, I have prepared GFP and RFP PIK3C2B construct amendable for localization experiments with both GLUT4 and the Rab GTPases.

Finally, these cellular models can be utilized to elucidate the important PIP species produced by PIK3C2B in skeletal muscle. Previous studies have highlighted changes in PtdIns3P,

PtdIns(3,4)P2 and PIP3; however, the lack of consensus and variability has led to more questions than answers. Thus, using molecular probes/antibodies to evaluate localization and quantify total PIP levels at basal and insulin stimulated states will be important to understand how the loss of PIK3C2B mediates this GLUT4 cellular phenotype.

References 1. Schink, K. O., Raiborg, C. & Stenmark, H. Phosphatidylinositol 3-phosphate, a lipid that regulates membrane dynamics, protein sorting and cell signalling. BioEssays (2013). doi:10.1002/bies.201300064 2. Balla, T. Phosphoinositides: Tiny Lipids With Giant Impact on Cell Regulation. Physiol. Rev. (2013). doi:10.1152/physrev.00028.2012 3. De Craene, J. O., Bertazzi, D. L., Bär, S. & Friant, S. Phosphoinositides, major actors in membrane trafficking and lipid signaling pathways. International Journal of Molecular Sciences (2017). doi:10.3390/ijms18030634 4. Di Paolo, G. & De Camilli, P. Phosphoinositides in cell regulation and membrane dynamics. Nature (2006). doi:10.1038/nature05185 5. Itoh, T. & Takenawa, T. Phosphoinositide-binding domains: Functional units for temporal and spatial regulation of intracellular signalling. Cellular Signalling (2002). doi:10.1016/S0898-6568(02)00028-1 6. Harlan, J. E., Hajduk, P. J., Yoon, H. S. & Fesik, S. W. Pleckstrin homology domains bind to phosphatidylinositol-4,5-bisphosphate. Nature (1994). doi:10.1038/371168a0 7. Ellson, C. D., Andrews, S., Stephens, L. R. & Hawkins, P. T. The PX domain: a new phosphoinositide-binding module . J. Cell Sci. (2002). 8. McCrea, H. J. & De Camilli, P. Mutations in phosphoinositide metabolizing enzymes and human disease. Physiology (Bethesda). (2009). doi:10.1152/physiol.00035.2008 9. Staiano, L., De Leo, M. G., Persico, M. & De Matteis, M. A. Mendelian disorders of PI metabolizing enzymes. Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids (2015). doi:10.1016/j.bbalip.2014.12.001 10. Jean, S. & Kiger, A. A. Classes of phosphoinositide 3-kinases at a glance. J. Cell Sci. (2014). doi:10.1242/jcs.093773 11. Katso, R. et al. Cellular Function of Phosphoinositide 3-Kinases: Implications for Development, Immunity, Homeostasis, and Cancer. Annu. Rev. Cell Dev. Biol. (2002). doi:10.1146/annurev.cellbio.17.1.615 12. Stephens, L. R. et al. The Gβγ/sensitivity of a PI3K is dependent upon a tightly associated adaptor, p101. Cell (1997). doi:10.1016/S0092-8674(00)80187-7 13. Haslam, R. J., Koide, H. B. & Hemmings, B. A. Pleckstrin domain homology [11]. Nature (1993). doi:10.1038/363309b0 14. Stokoe, D. et al. Dual role of phosphatidylinositol-3,4,5-trisphosphate in the activation of protein kinase B. Science (80-. ). (1997). doi:10.1126/science.277.5325.567 15. Kok, C. Y. et al. COSMIC: exploring the world’s knowledge of somatic mutations in human cancer. Nucleic Acids Res. 43, D805–D811 (2014). 16. Tan, K. et al. Analysis of Genetic Variation in Akt2/PKB-β in Severe Insulin Resistance, 35

Lipodystrophy, Type 2 Diabetes, and Related Metabolic Phenotypes. Diabetes 56, 714 LP – 719 (2007). 17. Manning, B. D. & Cantley, L. C. AKT/PKB Signaling: Navigating Downstream. Cell 129, 1261–1274 (2007). 18. Brown, J. R. & Auger, K. R. Phylogenomics of phosphoinositide lipid kinases: Perspectives on the evolution of second messenger signaling and drug discovery. BMC Evol. Biol. (2011). doi:10.1186/1471-2148-11-4 19. Odorizzi, G., Babst, M. & Emr, S. D. Phosphoinositide signaling and the regulation of membrane trafficking in yeast. Trends in Biochemical Sciences (2000). doi:10.1016/S0968-0004(00)01543-7 20. Herman, P. K., Stack, J. H., DeModena, J. A. & Emr, S. D. A novel protein kinase homolog essential for protein sorting to the yeast lysosome-like vacuole. Cell (1991). doi:10.1016/0092-8674(91)90650-N 21. Raiborg, C., Schink, K. O. & Stenmark, H. Class III phosphatidylinositol 3-kinase and its catalytic product PtdIns3P in regulation of endocytic membrane traffic. FEBS Journal (2013). doi:10.1111/febs.12116 22. Levine, B. & Klionsky, D. J. Development by self-digestion: Molecular mechanisms and biological functions of autophagy. Developmental Cell (2004). doi:10.1016/S1534- 5807(04)00099-1 23. Byfield, M. P., Murray, J. T. & Backer, J. M. hVps34 is a nutrient-regulated lipid kinase required for activation of p70 S6 kinase. J. Biol. Chem. (2005). doi:10.1074/jbc.M507201200 24. Wallroth, A. & Haucke, V. Phosphoinositide conversion in endocytosis and the endolysosomal system. Journal of Biological Chemistry (2018). doi:10.1074/jbc.R117.000629 25. Jaber, N. et al. Class III PI3K Vps34 plays an essential role in autophagy and in heart and liver function. Proc. Natl. Acad. Sci. (2012). doi:10.1073/pnas.1112848109 26. Liu, Y. et al. Class III PI3K positively regulates platelet activation and thrombosis via PI(3)P-directed function of NADPH oxidase. Arterioscler. Thromb. Vasc. Biol. (2017). doi:10.1161/ATVBAHA.117.309751 27. Bilanges, B. et al. Vps34 PI 3-kinase inactivation enhances insulin sensitivity through reprogramming of mitochondrial metabolism. Nat. Commun. (2017). doi:10.1038/s41467- 017-01969-4 28. Marat, A. L. et al. mTORC1 activity repression by late endosomal phosphatidylinositol 3,4-bisphosphate. Science (80-. ). (2017). doi:10.1126/science.aaf8310 29. Brown, R. A., Domin, J., Arcaro, A., Waterfield, M. D. & Shepherd, P. R. Insulin activates the α isoform of class II phosphoinositide 3-kinase. J. Biol. Chem. (1999). doi:10.1074/jbc.274.21.14529

30. Arcaro, A. et al. Class II phosphoinositide 3-kinases are downstream targets of activated polypeptide growth factor receptors. Mol. Cell. Biol. (2000). 31. Ktori, C., Shepherd, P. R. & O’Rourke, L. TNF-α and leptin activate the α-isoform of class II phosphoinositide 3-kinase. Biochem. Biophys. Res. Commun. (2003). doi:10.1016/S0006-291X(03)00933-1 32. Yoshioka, K. et al. Endothelial PI3K-C2α, a class II PI3K, has an essential role in angiogenesis and vascular barrier function. Nat. Med. (2012). doi:10.1038/nm.2928 33. Mountford, J. K. et al. The class II PI 3-kinase, PI3KC2α, links platelet internal membrane structure to shear-dependent adhesive function. Nat. Commun. (2015). doi:10.1038/ncomms7535 34. Braccini, L. et al. PI3K-C2γ 3 is a Rab5 effector selectively controlling endosomal Akt2 activation downstream of insulin signalling. Nat. Commun. (2015). doi:10.1038/ncomms8400 35. Franco, I. et al. PI3K class II α controls spatially restricted endosomal PtdIns3P and Rab11 activation to promote primary cilium function. Dev. Cell (2014). doi:10.1016/j.devcel.2014.01.022 36. Leibiger, B. et al. PI3K-C2α Knockdown Results in Rerouting of Insulin Signaling and Pancreatic Beta Cell Proliferation. Cell Rep. (2015). doi:10.1016/j.celrep.2015.08.058 37. Alliouachene, S. et al. Inactivation of class II PI3K-C2α induces leptin resistance, age- dependent insulin resistance and obesity in male mice. Diabetologia (2016). doi:10.1007/s00125-016-3963-y 38. Falasca, M. et al. The role of phosphoinositide 3-kinase C2α in insulin signaling. J. Biol. Chem. (2007). doi:10.1074/jbc.M704357200 39. Kaksonen, M. & Roux, A. Mechanisms of clathrin-mediated endocytosis. Nature Reviews Molecular Cell Biology (2018). doi:10.1038/nrm.2017.132 40. Borner, G. H. H. et al. Multivariate proteomic profiling identifies novel accessory proteins of coated vesicles. J. Cell Biol. (2012). doi:10.1083/jcb.201111049 41. Gaidarov, I., Smith, M. E. K., Domin, J. & Keen, J. H. The class II phosphoinositide 3- kinase C2α is activated by clathrin and regulates clathrin-mediated membrane trafficking. Mol. Cell (2001). doi:10.1016/S1097-2765(01)00191-5 42. Posor, Y. et al. Spatiotemporal control of endocytosis by phosphatidylinositol-3,4- bisphosphate. Nature (2013). doi:10.1038/nature12360 43. Kok, K., Geering, B. & Vanhaesebroeck, B. Regulation of phosphoinositide 3-kinase expression in health and disease. Trends in Biochemical Sciences (2009). doi:10.1016/j.tibs.2009.01.003 44. El Sheikh, S. S. et al. Topographical expression of class IA and class II phosphoinositide 3-kinase enzymes in normal human tissues is consistent with a role in differentiation. BMC Clin. Pathol. (2003). doi:10.1186/1472-6890-3-1

45. Misawa, H. et al. Cloning and characterization of a Novel class II phosphoinositide 3- kinase containing C2 domain. Biochem. Biophys. Res. Commun. (1998). doi:10.1006/bbrc.1998.8294 46. Li, A. et al. PIK3C2G copy number is associated with clinical outcomes of colorectal cancer patients treated with oxaliplatin. Int. J. Clin. Exp. Med. (2015). 47. Daimon, M. et al. Association of the PIK3C2G gene polymorphisms with type 2 DM in a Japanese population. Biochem. Biophys. Res. Commun. (2008). doi:10.1016/j.bbrc.2007.10.180 48. Harada, K., Truong, A. B., Cai, T. & Khavari, P. A. The class II phosphoinositide 3- kinase C2beta is not essential for epidermal differentiation. Mol. Cell. Biol. (2005). doi:10.1128/MCB.25.24.11122-11130.2005 49. Sabha, N. et al. PIK3C2B inhibition improves function and prolongs survival in myotubular myopathy animal models. J. Clin. Invest. (2016). doi:10.1172/JCI86841 50. Alliouachene, S. et al. Inactivation of the Class II PI3K-C2β Potentiates Insulin Signaling and Sensitivity. Cell Rep. (2015). doi:10.1016/j.celrep.2015.10.052 51. Błajecka, K. et al. Phosphoinositide 3-Kinase C2β Regulates RhoA and the Actin Cytoskeleton through an Interaction with Dbl. PLoS One (2012). doi:10.1371/journal.pone.0044945 52. Katso, R. M. Phosphoinositide 3-Kinase C2beta Regulates Cytoskeletal Organization and Cell Migration via Rac-dependent Mechanisms. Mol. Biol. Cell (2006). doi:10.1091/mbc.e05-11-1083 53. Fruman, D. A. & Rommel, C. PI3K and cancer: Lessons, challenges and opportunities. Nat. Rev. Drug Discov. (2014). doi:10.1038/nrd4204 54. Pons-Tostivint, E., Thibault, B. & Guillermet-Guibert, J. Targeting PI3K Signaling in Combination Cancer Therapy. Trends in Cancer (2017). doi:10.1016/j.trecan.2017.04.002 55. Russo, A., Okur, M. N., Bosland, M. & O’Bryan, J. P. Phosphatidylinositol 3-kinase, class 2 beta (PI3KC2β) isoform contributes to neuroblastoma tumorigenesis. Cancer Lett. (2015). doi:10.1016/j.canlet.2015.01.026 56. Chikh, A. et al. Class II phosphoinositide 3-kinase C2β regulates a novel signaling pathway involved in breast cancer progression. Oncotarget (2016). doi:10.18632/oncotarget.7761 57. Mavrommati, I., Cisse, O., Falasca, M. & Maffucci, T. Novel roles for class II Phosphoinositide 3-Kinase C2β in signalling pathways involved in prostate cancer cell invasion. Sci. Rep. (2016). doi:10.1038/srep23277 58. Boller, D. et al. Targeting PI3KC2β impairs proliferation and survival in acute leukemia, brain tumours and neuroendocrine tumours. Anticancer Res. (2012). 59. Stepanenko, A. A. & Dmitrenko, V. V. HEK293 in cell biology and cancer research: Phenotype, karyotype, tumorigenicity, and stress-induced genome-phenotype evolution.

Gene (2015). doi:10.1016/j.gene.2015.05.065 60. Malek, M. et al. PTEN Regulates PI(3,4)P2 Signaling Downstream of Class I PI3K. Mol. Cell (2017). doi:10.1016/j.molcel.2017.09.024 61. Hsu, F. S. & Mao, Y. The structure of phosphoinositide phosphatases: Insights into substrate specificity and catalysis. Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids (2015). doi:10.1016/j.bbalip.2014.09.015 62. Mruk, D. D. & Cheng, C. Y. The myotubularin family of lipid phosphatases in disease and in spermatogenesis. Biochem. J. (2010). doi:10.1042/bj20101267 63. Jungbluth, H., Wallgren-Pettersson, C. & Laporte, J. Centronuclear (myotubular) myopathy. Orphanet Journal of Rare Diseases (2008). doi:10.1186/1750-1172-3-26 64. Backer, J. M. The regulation and function of Class III PI3Ks: novel roles for Vps34. Biochem. J. (2008). doi:10.1042/BJ20071427 65. Arcaro, A. et al. Human phosphoinositide 3-kinase C2beta, the role of calcium and the C2 domain in enzyme activity. J. Biol. Chem. (1998). doi:10.1074/jbc.273.49.33082 66. Cowling, B. S. et al. Reducing dynamin 2 expression rescues X-linked centronuclear myopathy. J. Clin. Invest. (2014). doi:10.1172/JCI71206 67. Tasfaout, H. et al. Antisense oligonucleotide-mediated Dnm2 knockdown prevents and reverts myotubular myopathy in mice. Nat. Commun. (2017). doi:10.1038/ncomms15661 68. Tasfaout, H. et al. Single Intramuscular Injection of AAV-shRNA Reduces DNM2 and Prevents Myotubular Myopathy in Mice. Mol. Ther. (2018). doi:10.1016/j.ymthe.2018.02.008 69. Raess, M. A. et al. Expression of the neuropathy-associated MTMR2 gene rescues MTM1-associated myopathy. Hum. Mol. Genet. (2017). doi:10.1093/hmg/ddx258 70. Maani, N. et al. Tamoxifen therapy in a murine model of myotubular myopathy. Nat. Commun. (2018). doi:10.1038/s41467-018-07057-5 71. Childers, M. K. et al. Gene therapy prolongs survival and restores function in murine and canine models of myotubular myopathy. Sci. Transl. Med. (2014). doi:10.1126/scitranslmed.3007523 72. Robb, S. A. et al. Impaired neuromuscular transmission and response to acetylcholinesterase inhibitors in centronuclear myopathies. Neuromuscul. Disord. (2011). doi:10.1016/j.nmd.2011.02.012 73. Amoasii, L. et al. Myotubularin and PtdIns3P remodel the sarcoplasmic reticulum in muscle in vivo. J. Cell Sci. (2013). doi:10.1242/jcs.118505 74. DeFronzo, R. A. & Tripathy, D. Skeletal muscle insulin resistance is the primary defect in type 2 diabetes. Diabetes care (2009). doi:10.2337/dc09-S302 75. Carnagarin, R., Dharmarajan, A. M. & Dass, C. R. Molecular aspects of glucose homeostasis in skeletal muscle - A focus on the molecular mechanisms of insulin

resistance. Molecular and Cellular Endocrinology (2015). doi:10.1016/j.mce.2015.09.004 76. Thorens, B. & Mueckler, M. Glucose transporters in the 21st Century. Am. J. Physiol. Metab. (2009). doi:10.1152/ajpendo.00712.2009 77. Pessin, J. E. & Saltiel, A. R. Signaling pathways in insulin action: molecular targets of insulin resistance. J. Clin. Invest. 106, 165–169 (2000). 78. Slot, J. W., Geuze, H. J., Gigengack, S., Lienhard, G. E. & James, D. E. Immuno- localization of the insulin regulatable glucose transporter in brown adipose tissue of the rat. J. Cell Biol. 113, 123–135 (1991). 79. Gonzalez, E. & McGraw, T. E. Insulin-modulated Akt subcellular localization determines Akt isoform-specific signaling. Proc. Natl. Acad. Sci. (2009). doi:10.1073/pnas.0901933106 80. Zhen, Y. & Stenmark, H. Cellular functions of Rab GTPases at a glance. J. Cell Sci. (2015). doi:10.1242/jcs.166074 81. Ishikura, S., Bilan, P. J. & Klip, A. Rabs 8A and 14 are targets of the insulin-regulated Rab-GAP AS160 regulating GLUT4 traffic in muscle cells. Biochem. Biophys. Res. Commun. (2007). doi:10.1016/j.bbrc.2006.12.140 82. Sun, Y., Bilan, P. J., Liu, Z. & Klip, A. Rab8A and Rab13 are activated by insulin and regulate GLUT4 translocation in muscle cells. Proc. Natl. Acad. Sci. (2010). doi:10.1073/pnas.1009523107 83. Sun, Y., Chiu, T. T., Foley, K. P., Bilan, P. J. & Klip, A. Myosin Va mediates Rab8A- regulated GLUT4 vesicle exocytosis in insulin-stimulated muscle cells. Mol. Biol. Cell (2014). doi:10.1091/mbc.e13-08-0493 84. Sun, Y., Jaldin-Fincati, J., Liu, Z., Bilan, P. J. & Klip, A. A complex of Rab13 with MICAL-L2 and α-actinin-4 is essential for insulin-dependent GLUT4 exocytosis. Mol. Biol. Cell (2015). doi:10.1091/mbc.e15-05-0319 85. Sadacca, L. A., Bruno, J., Wen, J., Xiong, W. & McGraw, T. E. Specialized sorting of GLUT4 and its recruitment to the cell surface are independently regulated by distinct Rabs. Mol. Biol. Cell (2013). doi:10.1091/mbc.E13-02-0103 86. Sylow, L. et al. Rac1 signaling is required for insulin-stimulated glucose uptake and is dysregulated in insulin-resistant murine and human skeletal muscle. Diabetes (2013). doi:10.2337/db12-1148 87. Jaldin-Fincati, J. R., Pavarotti, M., Frendo-Cumbo, S., Bilan, P. J. & Klip, A. Update on GLUT4 Vesicle Traffic: A Cornerstone of Insulin Action. Trends in Endocrinology and Metabolism (2017). doi:10.1016/j.tem.2017.05.002 88. Martin, O. J., Lee, A. & McGraw, T. E. GLUT4 distribution between the plasma membrane and the intracellular compartments is maintained by an insulin-modulated bipartite dynamic mechanism. J. Biol. Chem. (2006). doi:10.1074/jbc.M505944200 89. Foley, K., Boguslavsky, S. & Klip, A. Endocytosis, recycling, and regulated exocytosis of

glucose transporter 4. Biochemistry (2011). doi:10.1021/bi2000356 90. Ishikura, S., Antonescu, C. N. & Klip, A. Documenting GLUT4 exocytosis and endocytosis in muscle cell monolayers. Curr. Protoc. Cell Biol. (2010). doi:10.1002/0471143030.cb1515s46 91. Al-Hasani, H., Hinck, C. S. & Cushman, S. W. Endocytosis of the glucose transporter GLUT4 is mediated by the GTPase dynamin. J. Biol. Chem. (1998). doi:10.1074/jbc.273.28.17504 92. Huang, J., Imamura, T. & Olefsky, J. M. Insulin can regulate GLUT4 internalization by signaling to Rab5 and the motor protein dynein. Proc. Natl. Acad. Sci. (2001). doi:10.1073/pnas.241368698 93. Leto, D. & Saltiel, A. R. Regulation of glucose transport by insulin: Traffic control of GLUT4. Nature Reviews Molecular Cell Biology (2012). doi:10.1038/nrm3351 94. Zeigerer, A. GLUT4 Retention in Adipocytes Requires Two Intracellular Insulin- regulated Transport Steps. Mol. Biol. Cell (2002). doi:10.1091/mbc.e02-02-0071 95. Feil, S., Valtcheva, N. & Feil, R. Inducible cre mice. Methods Mol. Biol. (2009). doi:10.1007/978-1-59745-471-1_18 96. Schuler, M., Dierich, A., Chambon, P. & Metzger, D. Efficient temporally controlled targeted somatic mutagenesis in hepatocytes of the mouse. Genesis (2004). doi:10.1002/gene.20039 97. Groennebaek, T. & Vissing, K. Impact of resistance training on skeletal muscle mitochondrial biogenesis, content, and function. Frontiers in Physiology (2017). doi:10.3389/fphys.2017.00713 98. Toledo, F. G. S. et al. Mitochondrial capacity in skeletal muscle is not stimulated by weight loss despite increases in insulin action and decreases in intramyocellular lipid content. Diabetes (2008). doi:10.2337/db07-1429 99. Toledo, F. G. S., Watkins, S. & Kelley, D. E. Changes induced by physical activity and weight loss in the morphology of intermyofibrillar mitochondria in obese men and women. J. Clin. Endocrinol. Metab. (2006). doi:10.1210/jc.2006-0002 100. Toledo, F. G. S. et al. Effects of physical activity and weight loss on skeletal muscle mitochondria and relationship with glucose control in type 2 diabetes. Diabetes (2007). doi:10.2337/db07-0141 101. Ikonomov, O. C. et al. Muscle-specific Pikfyve gene disruption causes glucose intolerance, insulin resistance, adiposity, and hyperinsulinemia but not muscle fiber-type switching. Am. J. Physiol. Endocrinol. Metab. (2013). doi:10.1152/ajpendo.00030.2013 102. Houtkooper, R. H. et al. The metabolic footprint of aging in mice. Sci. Rep. (2011). doi:10.1038/srep00134 103. Burattini, S. et al. C2C12 murine myoblasts as a model of skeletal muscle development: Morpho-functional characterization. Eur. J. Histochem. (2004).

104. McMahon, D. K. et al. C2C12 cells: biophysical, biochemical, and immunocytochemical properties. Am. J. Physiol. (1994). 105. Manabe, Y. et al. Characterization of an Acute Muscle Contraction Model Using Cultured C2C12 Myotubes. PLoS One (2012). doi:10.1371/journal.pone.0052592 106. Ran, F. A. et al. Genome engineering using the CRISPR-Cas9 system. Nat Protoc (2013). doi:10.1038/nprot.2013.143 107. Cho, S. W., Kim, S., Kim, J. M. & Kim, J. S. Targeted genome engineering in human cells with the Cas9 RNA-guided endonuclease. Nat. Biotechnol. (2013). doi:10.1038/nbt.2507 108. Cong, L. et al. Multiplex genome engineering using CRISPR/Cas systems. Science (80-. ). (2013). doi:10.1126/science.1231143 109. Labun, K., Montague, T. G., Gagnon, J. A., Thyme, S. B. & Valen, E. CHOPCHOP v2: a web tool for the next generation of CRISPR genome engineering. Nucleic Acids Res. (2016). doi:10.1093/nar/gkw398 110. Hsiau, T. et al. Inference of CRISPR Edits from Sanger Trace Data. bioRxiv (2018). doi:10.1101/251082 111. Manning, B. D. & Toker, A. AKT/PKB Signaling: Navigating the Network. Cell (2017). doi:10.1016/j.cell.2017.04.001 112. Sarbassov, D. D., Guertin, D. A., Ali, S. M. & Sabatini, D. M. Phosphorylation and regulation of Akt/PKB by the rictor-mTOR complex. Science 307, 1098–1101 (2005). 113. Kraegen, E. W., James, D. E., Jenkins, A. B. & Chisholm, D. J. Dose-response curves for in vivo insulin sensitivity in individual tissues in rats. Am. J. Physiol. 248, E353-62 (1985). 114. Ueyama, A., Yaworsky, K. L., Wang, Q., Ebina, Y. & Klip, A. GLUT-4myc ectopic expression in L6 myoblasts generates a GLUT-4-specific pool conferring insulin sensitivity. Am. J. Physiol. Metab. (2017). doi:10.1152/ajpendo.1999.277.3.e572 115. Cooper, S. T. et al. C2C12 co-culture on a fibroblast substratum enables sustained survival of contractile, highly differentiated myotubes with peripheral nuclei and adult fast myosin expression. Cell Motil. Cytoskeleton (2004). doi:10.1002/cm.20010 116. Tortorella, L. L. & Pilch, P. F. C 2 C 12 myocytes lack an insulin-responsive vesicular compartment despite dexamethasone-induced GLUT4 expression . Am. J. Physiol. Metab. (2015). doi:10.1152/ajpendo.00092.2002 117. Jaldin-Fincati, J. R., Bilan, P. J. & Klip, A. GLUT4 Translocation in Single Muscle Cells in Culture: Epitope Detection by Immunofluorescence. Methods Mol. Biol. 1713, 175–192 (2018). 118. Kurth-Kraczek, E. J., Hirshman, M. F., Goodyear, L. J. & Winder, W. W. 5’ AMP- activated protein kinase activation causes GLUT4 translocation in skeletal muscle. Diabetes (1999). doi:10.2337/diabetes.48.8.1667 119. Barbaric, I., Miller, G. & Dear, T. N. Appearances can be deceiving: Phenotypes of 42

knockout mice. Briefings in Functional Genomics and Proteomics (2007). doi:10.1093/bfgp/elm008 120. Campos, C. Chronic hyperglycemia and glucose toxicity: Pathology and clinical sequelae. Postgrad. Med. (2012). doi:10.3810/pgm.2012.11.2615 121. Manning, B. D. Balancing Akt with S6K: Implications for both metabolic diseases and tumorigenesis. Journal of Cell Biology (2004). doi:10.1083/jcb.200408161 122. Ma, J., Nakagawa, Y., Kojima, I. & Shibata, H. Prolonged insulin stimulation down- regulates GLUT4 through oxidative stress-mediated retromer inhibition by a protein kinase CK2-dependent mechanism in 3T3-L1 adipocytes. J. Biol. Chem. (2014). doi:10.1074/jbc.M113.533240 123. Wheeler, M. & Domin, J. The N-terminus of phosphoinositide 3-kinase-C2β regulates lipid kinase activity and binding to clathrin. J. Cell. Physiol. (2006). doi:10.1002/jcp.20507 124. Tessneer, K. L., Jackson, R. M., Griesel, B. A. & Olson, A. L. Rab5 activity regulates GLUT4 sorting into insulin-responsive and non-insulin-responsive endosomal compartments: A potential mechanism for development of insulin resistance. Endocrinology (2014). doi:10.1210/en.2013-2148 125. Ketel, K. et al. A phosphoinositide conversion mechanism for exit from endosomes. Nature (2016). doi:10.1038/nature16516

Appendix I: Materials and Methods Animal Care and Treatment All animal procedures were performed in compliance with the Animals for Research Act of Ontario and the Guidelines of the Canadian Council on Animal Care. The Centre for Phenogenomics (TCP) Animal Care Committee reviewed and approved all procedures conducted on animals at TCP. Mice were maintained under proper environmental regulations: temperature and light cycles, unlimited access to water, appropriate food supply, and clean enclosures. Pups were weaned from their mothers according to standard protocols, and tails were clipped for genotyping. Generation and Genotyping of the Skeletal-Muscle Specific Pik3c2b KO Mouse Floxed Pik3c2b and Cre mice [B6.129-Pik3c2btm1Pkha/J and B6.Cg-Tg(ACTA1-cre)79Jme/J] were originally obtained from Jackson Laboratory. Mice were crossed to make Pik3c2bfl/+ Acta- Cre heterozygous mice, and in-crossed to produce double floxed alleles and thus skeletal muscle- specific KO animals. Genotyping of mice-tail biopsies was performed by PCR with DNA isolated using the Qiagen DNeasy DNA isolation kit (Qiagen, Germany), according to the manufacturer’s instructions. Floxed Pik3c2b alleles were detected by PCR using the primers Pik3c2b-F: 5’-TGTTAGAACCTGCCGCCTTTAC-3’ and Pik3c2b-R: 5’- CCGAATCAGCCTCATTTCCTCTC-3’. The PCR was performed in the following conditions: 94°C for 4 min, 94°C for 30 sec, 60°C for 30 sec, 72°C for 30 sec, repeat previous three steps 35 times, and 72°C for 10 min. The Acta-Cre genotype was detected by PCR using two primer sets; one to detect the transgene and the other as an internal control, Acta-Cre-F: 5’- GCGGTCTGGCAGTAAAAACTATC-3', Acta-Cre-R: 5'-GTGAAACAGCATTGCTGTCACTT-3', Acta-Cre-Ctl-F: 5'-CTAGGCCACAGAATTGAAAGATCT -3' and Acta-Cre-Ctl-R 5'- GTAGGTGGAAATTCTAGCATCATCC -3'. The PCR was performed in the following conditions: 94°C for 3 min, 94°C for 1 min, 60°C for 1 min, 72°C for 1 min, repeat previous three steps 35 times, and 72°C for 5 min. PCR reactions were performed using the 2X Taq FroggaMix (FroggaBio) with the Veriti Thermal Cycler PCR machine (Applied Biosystems), according to the manufacturer’s instructions. Glucose Tolerance Tests All experiments were performed on 2 to 8-month-old mice or as specified. Mice were kept on standard chow on a 12-hr light-dark cycle. Experiments were performed following the International Mouse Phenotyping Resource of Standardized Screens (IMPReSS) with minor adjustments. Briefly, mice were transferred to clean cages to be fasted for 6-hours on the day of testing. Mice were subsequently weighed and the volume of 20% glucose solution required was calculated as 2g of glucose/kg of body mass. As mice were restrained, a drop of blood from the tail vein was collected and the baseline glucose was measured with the One Touch Ultra2 (LifeScanInc). The glucose solution was delivered intraperitoneally (IP), and blood glucose was measured intermittently (15, 30, 60, and 120 minutes).

Insulin Tolerance Tests Experiments were performed following the International Mouse Phenotyping Resource of Standardized Screens (IMPReSS) with minor adjustments. Briefly, mice were transferred to clean cages to be fasted for 6-hours on the day of testing. Mice were subsequently weighed and the volume of insulin (Sigma-Alrich) required was calculated as 0.75U insulin/kg of body mass. As mice were restrained, a drop of blood from the tail vein was collected and the baseline glucose was measured with the One Touch Ultra2 (LifeScanInc). The insulin solution was delivered intraperitoneally, and blood glucose was measured intermittently (20, 40 and 60 minutes). Protein Extraction Insulin stimulation in vivo was completed on 7-8-month-old female mice. Following 6-hours of fasting, mice were IP injected with 0.75U/kg body weight of insulin (Sigma-Aldrich) or PBS. Liver, heart, and muscle tissue were extracted and snap frozen on dry ice and stored at -80°C until protein extraction. Quadricep muscle was minced and homogenized for 3 min using the TissueLyserII (Qiagen) in 1X cell lysis buffer supplemented with protease and phosphatase inhibitors. Lysates were chilled at 4 °C for 10 min, then centrifuged at 12,000×g for 45 min at 4 °C. Supernatants were collected, and protein concentration determined using the Pierce™ BCA protein assay kit (Thermo Fisher Scientific). Protein extracts were prepared with 6X reducing Laemmli buffer before immunoblotting. In vitro insulin stimulation experiments were carried out on WT and PIK3C2B KO C2C12 myoblasts. Cell lines were simultaneously seeded at a density of 150, 000 cells per well in 6-well plates. Plates were incubated for 48-hours at 37°C in a humidified atmosphere of 5% CO2 to reach confluence. Following experimental treatments, plates were washed with ice-cold PBS and cells were scraped and collected with 1X cell lysis buffer. Cell lysates were prepared for immunoblotting as described previously. Immunoblotting Muscle protein lysates (50 µg/lane) and cell protein lysates (30-40ug/lane) were resolved by SDS-PAGE, and proteins were transferred onto PVDF membranes, according to standard procedures. Equal loading and transfer efficiency were verified by Ponceau S Red (Sigma) staining. Membranes were blocked for 1 h in 1X TBST (20 mmol/L Tris-base, 150 mmol/L NaCl, 0.1% Tween-20, pH 7.5) containing 5% skim milk powder and incubated overnight with primary antibody. After washing in 1X TBST, membranes were incubated for 1 h with horseradish peroxidase-conjugated goat anti-rabbit or goat anti-mouse IgG secondary antibody (1:5000, BioRad) in 1X TBST containing 5% skim milk powder. Primary antibodies used were: PIK3C2B (1:1000, Clone 22/PI3-K, BD Biosciences), HSP90 (Clone OTI4C10, Origene), β- actin (1:5000, ab8226, Abcam), pAKT (1:1000, #9271, Cell Signaling), AKT (1:1000, #2920, Cell Signaling), GLUT4 (1:1000, IF8, sc-53566, Santa Cruz), phospho-P70 S6K Thr389 (1:500, #9234, Cell Signaling), p70 S6K (1:1000, #2708, Cell Signaling).

Densitometry Analysis Blots were imaged by chemiluminescence (Clarity Max™ ECL, BioRad) using the Gel Doc™ XR + Gel Documentation System (BioRad), and band signal intensities determined using ImageLab software (BioRad). All densitometry values are individually standardized to corresponding values of total β-actin or HSP90 for each experiment, and expressed as the fold change of the WT group of each blot or the untreated control.

Cell Culture and In Vitro Experiments C2C12 cell line expressing GLUT4-myc (hereon referred to as C2C12-G4myc) was a gift from Dr. Amira Klip. Myoblasts were cultured in DMEM supplemented with 10% fetal bovine serum and 1% antibiotics (100 U/ml penicillin/streptomycin, Gibco). Cells were incubated at 37°C in a humidified atmosphere of 5% CO2. Myoblasts were grown in monolayers in 15cm treated polystyrene plates (Corning) until 90-100% confluence. Growth media was exchanged for fresh growth media every 2 days to restore optimal growth conditions. Adherent cells were dissociated by trypsinization for 3 min and counted with an automated cell counter (CountessII, ThermoFisher) prior to seeding. CRISPR-CAS9 Mediated Gene Editing To create PIK3C2B knockout myoblasts, specific and efficient single-guide RNAs targeting Mus. Pik3c2b predicted by the webtool CHOPCHOP were cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 a gift from Feng Zhang (Addgene plasmid # 62988)106,109. Briefly, the two candidate sgRNAs were selected with the following sequence: sgRNA 1 targeting exon 2: 5’- CGAGAAGTATAGGTTCGAGG-3’ and sgRNA 2 targeting exon 28: 5’- ACGAGGCGACATACATCCAG-3’. The sgRNAs were annealed to their reverse compliment and ligated into PX459 following digestion with Bbs1. PX459 with sgRNAs were transformed into bacteria (One Shot™ Stbl3™ E. coli, Thermofisher) and later sequenced to confirm sgRNA insertion. C2C12 myoblasts were electroporated with the plasmid using the Nucleofector Kit V (catalog #VCO-1001, Amaxa) according to manufacturer’s instructions. Freshly electroporated myoblasts were cultured for 48-hours to allow for recovery and plasmid expression. Next, puromycin selection (4ug/mL) was administered for up to 72-hours before passaging cells at a density of 1cell/well in 96-well plates. Single cell colonies were slowly expanded, and successful gene editing was confirmed by sanger-sequencing of the target site and by western blot. GLUT4 Translocation Assay (OPD) Cell surface levels of GLUT4 of C2C12-G4myc myoblasts was measured using an antibody- coupled colorimetric assay. Briefly, myoblasts were seeded at a density of 75, 000 cells per well in a 24-well plate and incubated for 24-hours to reach confluence. Myoblasts were serum starved for 3-hours in serum-free DMEM followed by the treatment as indicated. The experiment was terminated by quickly washing with ice-cold PBS and fixation with 4% PFA for 10min on ice, then 10min at room temperature. Wells were rinsed and incubated with 0.1M glycine in PBS to quench PFA for 10min, then blocked with 5% goat serum in PBS for 30min. The myc epitope was probed with an anti-myc antibody (1:500, C3956, Sigma-Aldrich) for 1-hour at 4°C, wells were washed 5 times and incubated with goat anti-rabbit secondary antibody (1:1000, BioRad) for 1-hour at 4°C. Cells were washed 5 times with PBS and incubated with O-phenylenediamine 46 solution (OPD) composed of: 1 tablet OPD peroxidase substrate (#P5412, Sigma-Aldrich), phosphate-citrate buffer (0.05M NaH2PO4, 0.05M citric acid, pH 5.0) and 60uL H2O2 (H1009, Sigma-Aldrich). Plates were incubated in the dark until the solution begins to turn a brownish- yellow where 3M HCl is added to stop the reaction. From each well 200uL is collected in duplicate and transferred to a 96-well plate. Absorbance was measured at 492 nm in an Epoch plate reader (BioTek). GLUT4 Endocytosis Assay The GLUT4 endocytosis assay was performed as previously described90. Briefly, C2C12- GLUT4myc myoblasts were seeded at a density of 75, 000 cells per well in a 24-well plate and incubated for 24-hours to reach confluence. Myoblasts were serum starved for 3-hours in serum- free DMEM followed by the treatment as indicated. Cells were stimulated with 100nM insulin (Sigma-Alrich) for 20min. Wells were washed 3 times with ice-cold PBS and blocked with 5% goat serum in PBS for 20 min on ice. Next, the myc epitope was probed with an anti-myc antibody (1:500, C3956, Sigma-Aldrich) for 1-hour on ice. All plates were washed 5 times with ice-cold PBS and the plates selected to undergo endocytosis were washed with warmed PBS and the wells were replenished with warmed serum-free DMEM to be incubated at 37°C for the indicated amount of time. Plates were quickly transferred to ice and washed 2 times with ice-cold PBS followed by fixation of all plates with 4% PFA in PBS for 10 min. Wells were washed with PBS and excess PFA was quenched with 0.1M glycine for 10 min on ice. A second blocking step was performed for 15 min on ice followed by labeling with a goat anti-rabbit secondary antibody (1:1000, BioRad) for 1-hour on ice. Plates were washed 5 times and an OPD reaction was performed as previously described. Data Analysis GraphPad Prism software, version 6.0 (GraphPad) was used for constructing all graphs and for performing all statistical analyses. All data presented is expressed as the as the mean ± SEM (unless otherwise specified). For all analyses *P£ 0.05, **P £ 0.01, and ***P £ 0.001.