HIV-1-Induced Membrane Fusion Tetraspanins CD9 and CD81

Home , CD81, CD9

Tetraspanins CD9 and CD81 Modulate HIV-1-Induced Membrane Fusion Mónica Gordón-Alonso, María Yañez-Mó, Olga Barreiro, Susana Álvarez, M. Ángeles Muñoz-Fernández, Agustín This information is current as Valenzuela-Fernández and Francisco Sánchez-Madrid of September 27, 2021. J Immunol 2006; 177:5129-5137; ; doi: 10.4049/jimmunol.177.8.5129 http://www.jimmunol.org/content/177/8/5129 Downloaded from

References This article cites 61 articles, 37 of which you can access for free at: http://www.jimmunol.org/content/177/8/5129.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

by guest on September 27, 2021 *average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2006 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Tetraspanins CD9 and CD81 Modulate HIV-1-Induced Membrane Fusion1

Mońica Gordoń-Alonso,* Marıá Yan˜ez-Mo´,* Olga Barreiro,* Susana A´ lvarez,† M. A´ ngeles Munõz-Fernańdez,† Agustıń Valenzuela-Fernańdez,2* and Francisco Sańchez-Madrid3*

Protein organization on the membrane of target cells may modulate HIV-1 transmission. Since the tetraspanin CD81 is associated to CD4, the receptor of HIV-1 envelope protein (Env; gp120/gp41), we have explored the possibility that this molecule may modulate the initial steps of HIV-1 infection. On the other hand, CD81 belongs to the tetraspanin family, which has been described as organizers of protein microdomains on the plasma membrane. Therefore, the role of CD81 and other related tetraspanin, CD9, on the cell-to-cell fusion process mediated by HIV-1 was studied. We found that anti-tetraspanin Abs enhanced the syncytia formation induced by HIV-1 envelope proteins and viral entry in human T lymphoblasts. In Downloaded from addition, anti-CD81 Abs triggered its clustering in patches, where CD4 and CXCR4 were included. Moreover, the knocking down of CD81 and CD9 expression resulted in an increase in syncytia formation and viral entry. Accordingly, overexpression of CD81 and CD9 rendered cells less susceptible to Env-mediated syncytia formation. These data indicate that CD9 and CD81 have an important role in membrane fusion induced by HIV-1 envelope. The Journal of Immunology, 2006, 177: 5129–5137. http://www.jimmunol.org/

uman immunodeﬁciency virus type 1 expresses on its simultaneously with the entry into AIDS phase (11). In addi- surface envelope protein complexes (Env),4 com- tion, HIV-1-induced syncytia formation provides a suitable ex- H posed by subunits gp120 and gp41, that mediate viral perimental model to study viral entry in target cells (12). attachment and membrane fusion. It is well known that gp120 Virus-cell and cell-to-cell fusion processes are not fully un- binds to CD4, which allows its interaction with CCR5 or derstood. It is feasible that the existence of preassembled pro- CXCR4, the two major coreceptors, and the subsequent unfold- tein complexes on target cells might regulate these phenomena. ing of gp41 (1–3). Then, gp41 inserts its hydrophobic motif Tetraspanins comprise a family of integral proteins that span

(fusion peptide) in the cell membrane, triggering virus-cell the membrane 4-fold and establish specialized microdomains by guest on September 27, 2021 membrane fusion. HIV-1 infects preferentially macrophages, based on noncovalent protein-protein interactions (13). These ϩ dendritic cells, and CD4 T lymphocytes (4–6). HIV-1 induces proteins possess a highly conserved structure with a short and a ϩ ϩ the fusion of uninfected CD4 CXCR4/CCR5 cells and in- large extracellular loop (LEL). The LEL domain contains crit- fected cells expressing Env, resulting in the formation of giant ical protein-protein interaction sites that allow noncovalent as- multinucleated cells, termed syncytia. Cell-to-cell fusion rep- sociation of these proteins with other tetraspanins and trans- resents another way of virus spreading with the advantage of membrane proteins, such as integrins and members of the Ig being inaccessible to humoral immune response (7–10). More- superfamily (13, 14). In this regard, it has been demonstrated over, viral strains prone to induce syncytia usually emerged that tetraspanins can modulate the function of proteins associated with them such as integrins (15) or ICAM-1 and VCAM-1 (16). Disruption of tetraspanin-based membrane microdomains *Servicio de Inmunologıá, Hospital Universitario de la Princesa, Universidad Au- interferes with important cellular processes, such as signal tońoma de Madrid, Madrid, Spain; and †Departamento de Inmuno-Biologıá Molec- ular, Hospital General Universitario Gregorio Maranõń, Madrid, Spain transduction, Ag presentation, cell migration, and cellular ad- Received for publication January 12, 2006. Accepted for publication July 14, 2006. hesion (14, 17–19). Tetraspanins are also involved in membrane fusion events such as sperm-oocyte fusion (20), myotube for- The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance mation (21), and fusion of mononuclear phagocytes (22). In with 18 U.S.C. Section 1734 solely to indicate this fact. addition, these molecules are implicated in viral processes such 1 F.S.-M. is supported by Ministerio de Educacioń y Ciencia Grant BFU2005-08435/ as CD63 in HIV infection (23, 24), CD81 in hepatitis C virus BMC, Fundacioń para la Investigacioń y Prevencioń del SIDA en Espanã (FIPSE) Grants 36289/02 and 24508/05, Lilly Foundation, and “Ayuda a la Investigacioń infection (25), CD82 in cell-to-cell human T cell leukemia virus Ba´sica 2002 de la Fundacioń Juan March.” A.V.-F. is supported by grants from FIPSE type I (HTLV-1) spreading (26), and CD9 in feline immuno- 24508/05 and PI050995 from Fondo de Investigacioń Sanitaria, Instituto de Salud deficiency virus (FIV) and canine distemper virus spreading Carlos III, Ministerio de Sanidad y Consumo. (27, 28). 2 Current address: Departamento de Medicina Fı´sica y Farmacologıá, Facultad de Medicina, Universidad de La Laguna, 38071 Tenerife, Spain. In the present study, we addressed the possible role of CD9 and 3 Address correspondence and reprint requests to Dr. Francisco Sańchez-Madrid. Ser- CD81 on the fusion process mediated by HIV-1 Env. Our data vicio de Inmunologıá. Hospital Universitario de la Princesa. Diego de Leoń 62, 28006 show that CD9 and CD81 blockade rendered target cells more Madrid, Spain. E-mail address: [email protected] susceptible to syncytia formation induced by HIV-1 Env. Accord- 4 Abbreviations used in this paper: Env, envelope viral protein; FIV, feline immuno- ingly, short interference RNA (siRNA) of CD9 or CD81 expres- deficiency virus; HTLV-1, human T cell leukemia virus type 1; LEL, large extracellular loop; siRNA, short interference RNA; X-gal, 5-bromo-4-chloro-3-indoyl-␤- sion enhanced viral entry and syncytia formation, whereas CD9 D-galactopyranoside. and CD81 overexpression had an opposing effect.

Materials and Methods Abs, reagents, and recombinant DNA constructs The anti-CD4 HP2/6 mAb (IgG1) that blocks gp120/CD4 interaction has been described previously (29). The biotinylated anti-CD4, anti-CXCR4, and anti-CCR5 mAbs were purchased from BD Pharmingen. The anti-CD4 v4-PE mAb (IgG1) that does not react with the gp120 binding site was from BD Biosciences. Anti-CD9 mAbs (VJ1/20, VJ1/10, VJ1/8, and GR2110) and anti-CD147 (VJ1/9; IgG1) have been described previously (30, 31). Anti-CD81 (IgG1) mAbs 5A6 and I33.2.2 were provided by Dr. S. Levy (Stanford University, Stanford, CA) and Dr. R. Vilella (Hospital Clinic, Barcelona, Spain), respectively. The anti-CD3 OKT3 mAb was a gift from B. Alarcoń (Centro de Biologıá Molecular, Madrid, Spain). The goat anti-mouse IgG (whole molecule) was purchased from Sigma-Aldrich. Secondary Abs Alexa488-anti-mouse IgG and Streptavidin-Rhoda- mineRed-X were purchased from Molecular Probes. Anti-CD45 D3/9 (IgG1) mAb has been described previously (32). Anti-vimentin mAb clone VIM 13.2 was purchased from Sigma-Aldrich. The fluorescent cell trackers Calcein-AM, Cell Tracker Orange 5-((and- 6)-(4-chloromethyl-benzoyl-amino)tetramethylrhodamine)-mixed isomers (CMTMR), and Cell Tracker Blue 7-amino-4-chloromethylcoumarin (CMAC) were from Molecular Probes. The fusion inhibitor peptide T20 was from Roche Diagnostics. Recombinant human IL-2 was provided by Downloaded from the National Institutes of Health AIDS Research and Reference Reagent Program 2002–2003. The wild type-CD9-GFP and wild type-CD81-GFP constructs have been described previously (16, 33). These expression vectors were transfected in CEM and HeLa P5 cells by electroporation or nucleofection, following the manufacturer’s instructions. Immunofluorescence and cell-to-cell fusion

experiments were performed 24 h after transfection. http://www.jimmunol.org/

Cells and cell cultures The human T cell line CEM 1.3 and the HIV-1 envelope (Env)-HxBc2 expressing Jurkat T cell (Jurkat HxBc2; provided by the National Institutes of Health AIDS Research and Reference Reagent Program 2002–2003) FIGURE 1. CD81 localizes at areas where gp120/gp41 interacts with were cultured in RPMI 1640 culture medium supplemented with 10% FCS. CD4. A, CEM 1.3 T cells were stained with the anti-CD9 VJ1/20 (blue line) The HeLa P5 cell clone, stably transfected with human CD4 and CCR5- GFP cDNA and an HIV-LTR-driven ␤-gal reporter gene (34, 35), were or the anti-CD81 I.33.2.2 (green line) mAbs or the negative control X63 provided by Dr. M. Alizon (Hoˆpital Cochin, Paris, France). HeLa 243 and (gray line) and analyzed by flow cytometry. B, Localization of CD81 dur- HeLa ADA cells, also provided by Dr. M. Alizon, coexpress Tat and Env ing cell-to-cell fusion induced by gp120/41. Target CEM 1.3 cells were by guest on September 27, 2021 HIV-1 proteins (34–36). Env proteins of HeLa 243 and HeLa ADA cells incubated for 3 h with CMAC-blue-labeled Envϩ HxBc2 cells and fixed are X4- and R5-tropic, respectively. PBMC from healthy donors were iso- and stained with the I33.2.2 anti-CD81 mAb (green fluorescence). Corre- lated by Ficoll-Hypaque gradient centrifugation and cultured for 2 days in sponding merged images of DIC and CMAC staining are shown. CD81 RPMI 1640 medium supplemented with 10% FCS in the presence of PHA staining is also shown in an intensity color-coded image, and the histogram ␮ (5 g/ml). Then, isolated T lymphoblasts were maintained with recombi- analyzes fluorescence intensity along the line depicted on the image. Bar, nant human IL-2 (50 U/ml) for 5 days. 10 ␮m. C, Induction of capping of CD81 and CD4 by free HIV-1 virions. CEM 1.3 cells were incubated with HIV-1 virions for 90 min and fixed and Flow cytometry analysis stained with an anti-CD4 or anti-CD147 (red fluorescence) and anti-CD81 Cells were washed and incubated with anti-tetraspanins mAbs or biotin- (green fluorescence) mAb. CEM 1.3 cells prior virus exposure are shown ␮ ylated anti-CXCR4 mAb, anti-CCR5 mAb, and anti-CD4 mAb for 20 min in the upper panel. Merged and DIC images are also shown. Bars, 10 m. at room temperature. After washing with PBS, cells were incubated with D, Exogenous tetraspanins are redistributed to the cell-to-cell contacts. streptavidin-R-PE or a goat anti-mouse IgG labeled with PE (Molecular Target CEM 1.3 cells transiently transfected with GFP, CD9-GFP, and Probes) for 15 min, washed again, and analyzed by flow cytometry. CD81-GFP constructs were incubated for 3 h with CMAC-labeled HxBc2 cells (blue). Then, cells were fixed and stained with the HP2/6 anti-CD4 Immunofluorescence and confocal images mAb (red fluorescence). Corresponding merged images of differential interference contrast (DIC) and CMAC as well as merged fluorescence im- HeLa, CEM 1.3, or HxBc2 T cells were fixed for 3 min in 3% parafor- ages are shown. Arrows depict heterotypic cell contacts. Bars, 10 ␮m. maldehyde in PBS, and immunostained for CD9 and CD81, as described previously (30). Then, cells were visualized using a Leica DMR photomi- croscope (Leica) and a Leica TCS-SP confocal microscope. The intensity color-coded image was obtained with Leica software, and fluorescence intensity histograms were generated by ImageJ from National Institutes of HIV-1 Env-mediated cell-to-cell fusion assay Health web site. In capping experiments, cells were treated with 7 ␮g/ml Double fluorescence cell fusion assay was performed as described previ- recombinant gp120 (National Institutes of Health AIDS Research and Ref- ously (37). Briefly, CMTMR-loaded Jurkat HxBc2 cells expressing X4- erence Reagent Program 2002–2003) 90 min before fixation and labeling tropic HIV-1 HxBc2-Env were cocultured with CEM 1.3 cells labeled with with an anti-CD4 v4-PE mAb. Double staining immunofluorescences were Calcein-AM. Fused cells were detected 16 h later by flow cytometry as blocked with nonimmune mouse serum before second primary Ab. To double-stained cells. Percentage of fusion is calculated as 100 ϫ UR/UL, avoid cross-talk between the different Abs used, primary Abs for staining where UR is the percentage of double stained cells and UL is the percent- were directly conjugated with the fluorocrome or biotin. age of single stained CMTMRϩ cells (see Fig. 2A). Cells were trypsinized previous to flow cytometry analysis to disrupt cellular aggregates. When Western blot analysis indicated, cells were preincubated with the anti-CD4 HP2/6 mAb. ␤-galactosidase cell fusion assay was performed as described previously Cells were lysed in 1% Nonidet P-40 in PBS with protease inhibitors (37). Briefly, HeLa 243 or HeLa ADA cells were coincubated with HeLa (Roche Diagnostics) for 30 min at 4°C. Then, cell lysates were run in 12% P5 cells in 96-well plates at a 1:1 ratio for 16 h. Only when gp120/gp41- SDS-PAGE and immunoblotted for CD81 and vimentin. mediated fusion occurs, Tat protein present in the cytoplasm of HeLa Envϩ The Journal of Immunology 5131

cells transactivates LTR promoter at HeLa P5 nuclei. For syncytia detec- tion, cells were ﬁxed with 0.5% glutaraldehyde and stained with the ␤-galactosidase substrate 5-bromo-4-chloro-3-indoyl-␤-D-galactopyranoside (X-Gal), as described previously (34). X-Gal blue staining allows an over- view of the extent of syncytia formed. For a quantitative measurement of syncytia formation, cells in parallel experiments were washed, lysed (50 ␮l of lysis buffer), and ␤-galactosidase enzymatic activity was evaluated by chemiluminiscence, using a kit that couples both ␤-galactosidase and lu- ciferase activity (␤-gal reporter gene assay; Roche Diagnostics). HIV-1 entry and infection

HIV-1NL4.3 entry and infection were assayed in HeLa P5 cells as described previously (38). Briefly, HIV-1NL4.3 infection of HeLa P5 cells was conducted in 96-well plates for5hat37°C. When indicated, cells were pretreated with the anti-CD4 HP2/6 mAb (10 ␮g/ml). Then, virus was removed by washing (PBS) and subsequent trypsination (5 min, 37°C) of infected cells. HeLa P5 cells were cultured for another 3 days before lysis and ␤-galactosidase activity determination. Human T lymphoblasts (106 cells) stimulated for 5 days with IL-2 were infected for3hat37°C in 96-well plates in the presence of the different Abs in suspension or in precoated plates cross-linked by goat anti-mouse ␮ ␮ IgG (20 g/ml), anti-CD3 (clone OKT3 at 0.5 g/ml), and anti-CD81 (5A6 Downloaded from at 4 ␮g/ml). Then, virus was removed by washing (PBS) of infected cells. Cell-free supernatants were harvested at 24, 48, and 72 h and assayed for p24 contents by ELISA (INNOTEST HIV-1 Ag mAb; Innogenetic). Viral particles from cell-free supernatants were also quantified by COBAS Ampliprep/COBAS Amplicor HIV-1 monitor test (Roche Diagnostics), which specifically amplifies the viral gene pol.

siRNA assay http://www.jimmunol.org/ To knockdown the expression of specific tetraspanins, the RNA duplexes targeting the silencing sequences CAATTTGTGTCCCTCGGGC and CACCTTCTATGTAGGCATC (Ambion) for CD81 and ACCTTCAC CGTGAAGTCCT and GAGCATCTTCGAGCAAGAAA for CD9 (16) were used. A double-stranded siRNA designed by Eurogentec, which does not pair with any eucaryotic mRNA, was used as control. siRNA was transfected in CEM 1.3 cells by electroporation or nucleofection, and HeLa P5 cells were transfected with oligofectamine (Invitrogen Life Technolo- gies), following the manufacturer’s instructions. The kinetics of silencing were followed by FACS analysis. The highest interferences were achieved FIGURE 2. Engagement of CD81 increases syncytia formation of lym- by guest on September 27, 2021 20 h after transfection for CEM 1.3 cells and 3 days postoligotransfection phoid cell lines. A, Target CEM 1.3 T cells or primary human T lympho- for HeLa P5 cells. To enrich the tetraspanin low-expressing population, the blasts were preincubated or not for 30 min at 37°C with 5 ␮g/ml purified siRNA-treated cells were negatively selected with anti-CD81 magnetic anti-CD4 (HP2/6), anti-CD81 (5A6 and I.33.2.2), or anti-CD147 (VJ1/9) coated beads (Dynabeads M450 goat anti-mouse IgG; Dynal Biotech) for mAb. Then, HxBc2 T cells were added and incubated for either 7 or 14 h. 5 min at 4°C under rotation. These cells were counted and used for the Syncytia formation was quantified by flow cytometry and represented as fusion assays and analyzed by flow cytometry to assess the expression of Ϯ tetraspanins, CD4, CCR5, and CXCR4. the mean fold induction respect to no Ab SD of three independent p Ͻ 0.05 compared with cells with ,ء .experiments performed by duplicate Results no Ab (Student’s t test). The dot plot shows a prototype experiment, in which UR gated cells correspond to double-stained syncytia population. B, CD81 localizes at cellular contacts during syncytia formation Representative phase contrast micrographs of syncytia formed at 14 h of induced by gp120/gp41 incubation between mAb-pretreated target CEM cells and HxBc2 Envϩ It has been reported that CD81 is associated with CD4 (39, 40) and cells. Images were acquired with a ϫ10 objective. Bars, 50 ␮m. C,T that provides a costimulatory signal that increases HIV-1 gene ex- lymphoblasts untreated or treated with soluble anti-CD81 (5A6) mAb in pression (41). To determine the possible role of CD81 in HIV-1- suspension were infected with fully competent HIV-1 NL4-3. Cell-free supernatants were harvested at 24, 48, and 72 h postinfection. Virus pro- mediated cell-to-cell fusion, we first analyzed its expression in duction was measured by p24-ELISA, and it is represented as the mean CEM1.3 cells (Fig. 1A). This T cell line expressed significant lev- fold induction respect to untreated T lymphoblasts Ϯ SD of three inde- p Ͻ 0.05 compared with ,ء .els of CD81 but null levels of CD9. Then, the subcellular local- pendent experiments performed by triplicate ization of CD81 and CD4 was studied in T lymphocytes exposed untreated T lymphoblasts (Student’s t test). D, The enhancing effect on to HIV-1 and during syncytia formation. We found that in CEM virus production is also observed when the anti-CD81 (5A6) mAb is cross- 1.3 cells and T lymphoblasts exposed to HIV-1 virions, CD4 and linked by anti-mouse IgG coated to the plate, either alone or in combination CD81 were concentrated at the area of viral contact, a phenomena with an anti-CD3 (OKT3). Fold induction of a representative experiment called capping (38, 42) (Fig. 1C and data not shown). However, measured at 72 h and performed by triplicate Ϯ SD is shown. E, Clustering CD147, a molecule expressed at comparable levels as CD81 in of CD81 and CD4 induced by anti-CD81 5A6 mAb. CEM 1.3 cells were ␮ these cells (data not shown), remained evenly distributed. Thus, preincubated for 30 min with 5 g/ml purified anti-CD45 D3/9 (used as control Ab) or anti-CD81 5A6 mAbs. Then, HxBc2 Envϩ cells were added CD81 coclustered with CD4 when it is engaged by gp120. On the and incubated for another 3 h. After incubation, cells were fixed and other hand, before the exposure to the virus, both CD4 and CD81 stained either with FITC-anti-CD81 plus biotinylated anti-CD4 mAb (up- were uniformly distributed along the plasma membrane (Fig. 1C, per panel) or Alexa488-anti-mouse IgG plus biotinylated anti-CD4 mAb upper panel). In addition, when target CEM 1.3 cells contacted (lower panel). Finally, samples were stained with Streptavidin-Rhoda- with cells expressing gp120/gp41 of HIV-1 (Jurkat HxB2c cells), mineRed-X to detect biotinylated anti-CD4 mAb. A representative confo- CD81 accumulated at the areas of intercellular contact, where cal section of each staining and the merged image are shown. Asterisks at membrane fusion events occur. The intensity color-coded image DIC images depicted Envϩ cells. Bars, 10 ␮m. 5132 TETRASPANINS AND HIV-1 SYNCYTIA FORMATION Downloaded from

FIGURE 3. Interference of CD81 in CEM target cells increases syncytia formation induced by gp120. A, CD81 knocking-down was assessed by Western blot analysis in total cell lysates with anti-CD81 5A6 mAb. Vimentin signal is shown as load control. B, CD4, CXCR4, and CD81 expression was assessed by flow cytometry in CEM 1.3 T cells transfected with the negative control siRNA or CD81 siRNA oligonucleotides. Data represent the mean fluorescence /p Ͻ http://www.jimmunol.org ,ء .intensity with respect to negative control siRNA oligonucleotide-transfected cells Ϯ SD in three independent experiments performed by duplicate 0.05 compared with negative control siRNA-treated cells (Student’s t test). C, Silencing CD81-enhanced syncytia formation. Negative control siRNA- or CD81 siRNA oligonucleotide-transfected target CEM 1.3 cells were incubated for 14 h with HxBc2 Envϩ cells. Syncytia formation was quantified by flow cytometry and represented as the mean fold induction with respect to negative siRNA oligonucleotide-transfected cells Ϯ SD of three independent experiments performed by duplicate. As a control, syncytia formation was completely abrogated in the presence of 10 ␮g/ml purified anti-CD4 (HP2/6) p Ͻ 0.05 compared with negative control siRNA-treated cells (Student’s t test). D, CD81 and CD4 localization during syncytia formation ,ء .or 10 nM T20 between negative control siRNA or CD81 siRNA oligonucleotides transfected CEM 1.3 T cells and CMAC blue-labeled HxBc2 T cells. After3hof incubation, syncytia were fixed and stained with anti-CD81 I.33.2.2 mAb and biotinylated anti-CD4 mAb. Corresponding merged images of differential interference contrast (DIC) and the blue CMAC probe are shown. Arrows depict heterotypic contacts. Bars, 10 ␮m. by guest on September 27, 2021 and the histogram revealed that the staining in the area of cell anti-CD81 Ab is added, a great proportion of cells had already contact is brighter than the expected one for two apposed mem- undergone membrane fusion induced by gp120/gp41. This effect branes (Fig. 1B). Hence, tetraspanin CD81 appeared to gather was specific of CD81 binding since the presence of an isotype where gp120/gp41 engages with CD4 during both virus-cell at- control Ab VJ1/9, that recognizes CD147, did not exert any sig- tachment and syncytia formation. Since both Envϩ and target cells nificant effect (Fig. 2, A and B). As expected, syncytia formation express CD81, to confirm that tetraspanins on target cells were was prevented by either a blocking anti-CD4 Ab or the fusion accumulating at cell-to-cell contacts, CEM cells were transfected inhibitor peptide T-20, indicating that this process depends on with cDNAs coding for CD9-GFP and CD81-GFP and incubated CD4-gp120 interaction (Fig. 2, A and B, and data not shown). To with Envϩ cells. The exogenous tetraspanins were also recruited verify that this observation was not a consequence from a possible toward gp120/gp41, together with CD4 (Fig. 1D), verifying that aggregating effect of the Abs, cells were incubated simultaneously tetraspanins on the target plasma membrane localized toward with T20 and anti-CD81 mAbs. Syncytia formation was blocked at Envϩ cells. levels comparable to negative control (anti-CD4) (data not shown). Hence, Ab engagement of CD81 facilitates syncytia formation that Anti-CD81 Abs enhance lymphocyte membrane fusion induced is dependent on CD4/gp120 interaction. by HIV-1 Env Next, the possible effect of anti-CD81 mAb (5A6) in viral entry To explore the possible functional role of CD81, we analyzed syn- was assayed in primary human T cells. T lymphoblasts isolated cytia formation in the presence of different mAb against this tet- from healthy donors were infected with the X4-tropic HIV-1 NL4–3 raspanin. We observed that 5A6 anti-CD81 mAb increased HIV- viral strain in the presence or absence of 5A6 mAb. Cells were 1-mediated-cell fusion and favored the formation of large syncytia treated with the Abs before virus addition to target early viral entry between either CEM 1.3 or primary human T lymphoblasts and events. Supernatants were harvested at 24, 48, and 72 h, and viral HxB2c cells (Fig. 2A). However, quantitative flow cytometry data production was evaluated by both ELISA and quantitative RT- did not reflect the strong enhancing effect of both 5A6 and I33.2.2 PCR. Engagement of CD81 was sufficient to increase virus anti-CD81 mAbs on syncytia formation that can be visualized by production at every time point (Fig. 2C and data not shown). Like- microscopy (Fig. 2B). Indeed, these Abs induced such large syn- wise, an increase in virus production was observed with cross- cytia in overnight incubations that these giant multinucleated cells linked Abs coated to the plate, not only when the anti-CD3 was could not enter the capillar of the flow cytometer. Therefore, anal- present, but also when T lymphoblasts were incubated with 5A6 yses at shorter incubation times were conducted to obtain a quan- mAb either alone or combined with anti-CD3 (Fig. 2D). titative measurement of anti-CD81 effect (Fig. 2A). At 7 h, there is On the other hand, we observed that CD81 engagement induced little syncytia formation in the absence of Abs. However, when an a significant clustering of this tetraspanin together with CD4 and The Journal of Immunology 5133

CXCR4 (Fig. 2E and data not shown). This effect was observed in both conjugated and isolated cells. This preclustering might facilitate the interaction of gp120 and CD4 and CXCR4, allowing more rapid and effective membrane fusion events.

Effect of knocking-down CD81 expression on syncytia formation Expression of CD81 in CEM target cells was specifically reduced by siRNA oligonucleotides. Interference in CEM 1.3 cells was maximal at 20 h posttransfection, and CD81 expression was de- creased greatly as determined by both flow cytometry and Western blot analysis (Fig. 3, A and B). CEM 1.3 cells silenced for CD81 had similar levels of CD4 and CXCR4 than control cells (Fig. 3B). These cells showed enhanced syncytia formation with HXB2c Envϩ cells. Anti-CD4 and the fusion inhibitor T20 blocked syncytia formation both in cells interfered with the negative control or anti-CD81 oligonucleotide (Fig. 3C). Remarkably, interference of CD81 expression in target cells did not affect CD4 or CD81 redistribution to cellular contacts (CD81 mainly expressed on Envϩ Downloaded from cells) (Fig. 3D) or their capping to viral-cell synapses (data not shown). Thus, CD81 interference does not seem to alter CD4 subcellular localization to both cell-to-cell and virus-cell contacts but enhances cell-to-cell membrane fusion. FIGURE 4. CD9 and CD81 localize at cell-to-cell contacts and Abs anti-CD9 and anti-CD81 increase syncytia formation in a HeLa cell model. A, HeLa P5 cells were stained with the anti-CD9 VJ1/20 (blue line) or the http://www.jimmunol.org/ Role of CD9 and CD81 in the cell fusion induced by gp120/41 anti-CD81 I.33.2.2 (green line) mAbs or the negative control X63 (gray in a HeLa cellular model line) and analyzed by flow cytometry. B, Localization of CCR5, CD9, and CD81 in the HeLa model during syncytia formation. Target HeLa P5 cells It has been reported that HeLa P5 target cells (which express CD4, (CCR5-GFPϩ) were incubated for 3 h with HeLa Envϩ cells and fixed and CXCR4, and CCR5 and possess the ␤-galactosidase reporter gene stained with anti-CD9 (VJ1/20) or anti-CD81 (I33.2.2) mAbs. Asterisks at ϩ controlled by HIV LTR promoter) and Env cells (which harbor differential interference contrast (DIC) images depicted Envϩ cells. Fluo- the HIV promoter transactivator Tat) constitute a highly reproduc- rescence intensity is analyzed along the lines depicted and shown in his- ible model to analyze the preliminary steps of the membrane fu- tograms. Bars, 10 ␮m. C, Enhancing effect of anti-tetraspanin Abs in syn-

sion process induced by gp120/gp41 (34, 35, 43). In addition, these cytia formation. HeLa P5 target cells were preincubated or not for 30 min by guest on September 27, 2021 ␮ ␮ HeLa clones express both CXCR4 and CCR5, thus allowing in- at 37°C with 10 g/ml purified anti-CD4 (HP2/6) and 5 g/ml anti-CD9 (VJ1/20, VJ1/10, VJ1/8, and GR2110), anti-CD81 (5A6 and I.33.2.2), or vestigation of syncytia formation induced by both T- and M-tropic ϩ anti-CD147 (VJ1/9) mAbs. Then, HeLa Env ADA cells were added and gp120. We found that these HeLa clones expressed comparable incubated for 14 h. Syncytia formation was quantified by ␤-galactosidase levels of tetraspanins CD9 and CD81 (Fig. 4A). In these cells, CD9 activity and represented as the mean fold induction respect to no Ab Ϯ SD -p Ͻ 0.05 com ,ء .and CD81 were evenly distributed and redistributed to the cellular of six independent experiments performed by triplicate ϩ contacts between HeLa P5 cells and HeLa Env , where CD4, pared with cells treated with no mAb (Student’s t test). CXCR4, and CCR5 were also present (Fig. 4B and data not shown). In agreement with our data with T cell lines, both anti- CD81 and anti-CD9 Abs increased syncytia formation between ϩ Discussion HeLa P5 and HeLa Env cells but not the isotype control Ab One of the mechanisms for CD4ϩ T cell depletion by HIV is VJ1/9 (Fig. 4C). Furthermore, HeLa P5 target cells with a dimin- through the induction of short-lived syncytia (44). Given that vi- ished expression of CD9 and CD81 (40–60% reduction induced ruses depend on their host cells to replicate and spread, surface by siRNA; Fig. 5, A and B), but normal levels of CD4, CXCR4, protein distribution and intracellular activation state of target cells and CCR5 (Fig. 5C) showed increased syncytia formation (Fig. 5, may affect the efficiency of infection. Tetraspanins are proteins D and E). CD81 silencing mainly enhanced the X4-tropic fusion involved in a wide range of cellular and viral processes, particu- system, whereas CD9 silencing exerted a higher effect in the R5- larly fusion events (21–28, 45). Tetraspanins may also regulate tropic fusion system. Control experiments demonstrated that syn- preliminary steps of viral cycle due to their function as molecular cytia formation was dependent on the interaction of CD4 and organizers of cellular membrane protein microdomains (13). In gp120/gp41 as it was completely abrogated by a blocking anti- this report, we provide evidence for the involvement of CD9 and CD4 Ab (Fig. 5, D and E). In agreement with these data, we found CD81 in virus-cell and cell-to-cell gp120/gp41-mediated fusion. that HeLa P5 cells with a deficient expression of CD9 and CD81 CD81 is the major tetraspanin expressed in T cells and is consti-

were more susceptible to HIV-1NL4–3 viral entry (Fig. 6). tutively associated to CD4 (39, 40). During syncytia formation, On the other hand, HeLa P5 target cells overexpressing CD9- CD81 is recruited toward cell-to-cell contacts where gp120 inter- GFP or CD81-GFP formed a lower number of syncytia with HeLa acts with its cell receptor and coreceptor. CD81 also relocalized in ϩ Env cells than those transfected with GFP (Fig. 7). As in CD9 response to free HIV-1 viral particles together with CD4. The en- and CD81 siRNA, tetraspanin overexpression did not affect CD4, hancing effect of knocking-down CD81 expression is more signif- CXCR4, and CCR5 levels (data not shown). Therefore, knocking- icant in the X4-tropic-mediated membrane fusion in all the exper- down CD9 and CD81 expression in target cells enhances cell-to- imental models tested. In the case of CD9, knockdown cell membrane fusion, whereas increasing their expression reduces experiments were performed in HeLa cells because the T cell lines this phenomenon. analyzed expressed low or null levels of this tetraspanin. However, 5134 TETRASPANINS AND HIV-1 SYNCYTIA FORMATION Downloaded from http://www.jimmunol.org/ by guest on September 27, 2021

FIGURE 5. Effect of silencing CD9 and CD81 in syncytia formation of HeLa cells. A, HeLa P5 cells transfected with the negative siRNA control (black line) CD9 siRNA or CD81 siRNA oligonucleotides (green line) were stained with the anti-CD9 VJ1/20 or the anti-CD81 I.33.2.2 mAbs or the negative control X63 (dotted line) and analyzed by ﬂow cytometry. B, CD9 and CD81 knocking-down was also assessed by Western blot analysis in total lysates The Journal of Immunology 5135

FIGURE 6. Effect of CD9 and CD81 knocking-down on HIV-1 entry in the HeLa model. Negative siRNA control, CD9 siRNA, or CD81 siRNA FIGURE 7. oligonucleotide-transfected HeLa P5 cells were incubated for 3 h with free Effect of overexpression of CD9 and CD81 on syncytia for- ␤ mation. Target HeLa P5 cells were transfected with GFP, CD9-GFP, or HIV-1 NL4-3 virions (X4-tropic). Viral entry was quantified by -galac- ϩ tosidase activity and represented as the mean fold induction respect to CD81-GFP and incubated with HeLa Env cells for 14 h. Syncytia for- ␤ negative siRNA oligonucleotide-transfected cells Ϯ SD of three indepen- mation was quantified by -galactosidase activity and represented as the Ϯ dent experiments performed by triplicate. As a control, syncytia formation mean fold induction respect to GFP-transfected cells SD of three inde- was completely abrogated in the presence of 10 ␮g/ml purified anti-CD4 pendent experiments performed by triplicate. As a control, syncytia for- ␮ (HP2/6), and no ␤-galactosidase activity was observed in cells without free mation was completely abrogated in the presence of 10 g/ml purified p Ͻ ء -p Ͻ 0.05 compared with negative control siRNA-treated anti-CD4 (HP2/6). , 0.05 compared with GFP-transfected cells (Stu ,ء .HIV-1 virions t cells (Student’s t test). dent’s test). Downloaded from

the role of CD9 may be very important in macrophages, the main linked by anti-IgG, and it therefore could be due to CD81 engage- target cells for R5-tropic HIV-1, which up-regulate the expression ment before viral exposure. of this tetraspanin during their differentiation (46). Therefore, the On the other hand, the effect of these Abs cannot be linked to a

enhancing effect of CD9 or CD81 silencing is more significant possible aggregating consequence as cells were trypsinized before http://www.jimmunol.org/ depending on the viral tropism, which correlates with the in vivo flow cytometer data acquisition to dissociate unspecific cellular expression of these tetraspanins in target cells. Accordingly, a pre- aggregates, and the fusion inhibitor T20 is able to block the en- vious report has suggested differences between the fusion mecha- hancing effect of the Abs. Moreover, mAbs with different aggre- nism triggered by CXCR4 and CCR5 (47). gation properties (VJ1/20 and VJ1/10) exerted the same enhancing Most of previous studies on the effect of tetraspanin blockade effect (31). reported that anti-CD9 and anti-CD81 Abs inhibit fusion of ga- Our data show, in two different cellular models, that Env-me- metes, myoblasts, virus-infected cells, and virus-induced cell-to- diated cell-to-cell membrane fusion is enhanced by silencing CD9 cell fusion (22, 27, 28, 40, 48, 49). However, in agreement with or CD81 expression using siRNA treatment of target cells. This our data, it has been reported that the fusion of monocytes and effect is specific for CD9 and CD81 since we found that interfer- by guest on September 27, 2021 alveolar macrophages is promoted by anti-CD9 and -CD81 Abs ence of other tetraspanin, CD151, partially inhibited Env-induced and enhanced in CD9- and CD81-null mice macrophages (22). It membrane fusion and had no effect in viral entry. CD151 is also is very likely that the preclustering of CD81 with CD4 and CXCR4 recruited to cell-to-cell contacts but its expression is lower than induced by anti-CD81 Abs may facilitate the gp120/gp41-medi- that of CD9 and CD81 in the cellular model used (M. Gordon- ated membrane fusion, explaining the enhancing effect that they Alonso and M. Yań˜ez-Mo´, unpublished observations). In addition, produced in syncytia formation. It has been reported that CD81 another specific siRNA oligonucleotide directed against different engagement increases HIV-1 gene expression due to the transcrip- target sequences of either CD9 or CD81 confirmed the data pre- tional activation of HIV-1 provirus, a late step in virus infection sented (data not shown). cycle (41). However, it is evident that this mechanism cannot ac- CD9 and CD81 could affect HIV-1-induced membrane fusion count for the enhancing effect observed by us because our exper- by different pathways: indirectly, due to enhanced T cell or LFA-1 imental system was designed to discriminate the virus-induced activation, or directly, organizing associated proteins on the cell membrane fusion process from other processes triggered by HIV-1 membrane such as CD4 and gp120 coreceptors. In this regard, it thereafter. These authors also reported a cooperation of CD81 en- has been described that anti-CD81 mAb activate LFA-1 (50, 51), gagement with CD3 stimulation in virus production when the Abs which has been described as an enhancer of HIV-1 infection and were added to already infected cells (41). Nevertheless, they did syncytia formation (52, 53). Although we could not rule out a role not observe the enhancing effect when cells are in the presence of for LFA-1 in this process, the enhancing effect of anti-CD81 mAb the anti-CD81 mAb alone. Our data show that anti-CD81 mAb also occurs in the HeLa cell system, where there is no expression induces an enhanced HIV viral production both alone and cross- of LFA-1. In addition, the effect of CD81 engagement in CEM

with the anti-CD9 VJ1/20 or the anti-CD81 5A6 mAb. Vimentin signal is shown as load control. C, CD4, CXCR4, and CCR5 expression was determined by flow cytometry in HeLa P5 cells transfected with the negative siRNA control, CD9 siRNA, or CD81 siRNA oligonucleotides. Data represent the mean fluorescence intensity respect to negative siRNA control oligonucleotide-transfected cells Ϯ SD of five independent experiments. D, X-Gal staining of syncytia formed between negative siRNA control, CD9 siRNA, or CD81 siRNA oligonucleotide-transfected HeLa P5 cells and HeLa ADA (R5-tropic) or 243 (X4-tropic) cells. After 14 h of incubation, syncytia were fixed and stained with X-gal. Representative phase contrast micrographs acquired with a ϫ10 objective are shown. Bars, 100 ␮m. E, Negative siRNA control, CD9 siRNA, or CD81 siRNA oligonucleotide-transfected target HeLa P5 cells were incubated for 14 h with HeLa ADA (R5-tropic) or 243 (X4-tropic) cells. Syncytia formation was quantified by ␤-galactosidase activity and represented as the mean fold induction respect to negative siRNA oligonucleotide-transfected cells Ϯ SD of five independent experiments performed by triplicate. As a p Ͻ 0.05 compared with negative control ,ء .(control, syncytia formation was completely abrogated in the presence of 10 ␮g/ml purified anti-CD4 (HP2/6 siRNA-treated cells (Student’s t test). 5136 TETRASPANINS AND HIV-1 SYNCYTIA FORMATION

1.3-HxBc2 membrane fusion is not inhibited by the LFA-1 block- 8. Alimonti, J. B., T. B. Ball, and K. R. Fowke. 2003. Mechanisms of CD4ϩ T ing molecule, BIRT 377 (54) (M. Gordon-Alonso and M. Yań˜ez- lymphocyte cell death in human immunodeficiency virus infection and AIDS. J. Gen. Virol. 84: 1649–1661. Mo´, unpublished observations). On the other hand, tetraspanins are 9. LaBonte, J., T. Patel, W. Hofmann, and J. Sodroski. 2000. Importance of mem- involved in different signaling pathways in T cells as the activation brane fusion mediated by human inmunodeficiency virus envelope glycoproteins for lysis of primary CD4-positive T cells. J. Virol. 74: 10690–10698. of protein kinase C (41, 55). Accordingly, CD81 ligation by mAbs 10. Orenstein, J. M. 2000. In vivo cytolysis and fusion of human immunodeficiency stimulates T cell activation, and it is known that activated lym- virus type 1-infected lymphocytes in lymphoid tissue. J. Infect. Dis. 182: phocytes are easily infected by HIV-1 (41, 50, 56). Another pos- 338–342. 11. Koot, M., I. P. Keet, A. H. Vos, R. E. de Goede, M. T. Roos, R. A. Coutinho, sibility is that CD81 alters actin organization in viral synapses F. Miedema, P. T. Schellekens, and M. Tersmette. 1993. Prognostic value of through the regulation of integrin function (15). Actin remodeling HIV-1 syncytium-inducing phenotype for rate of CD4ϩ cell depletion and pro- is essential for the fusion process (57–59) and is required for the gression to AIDS. Ann. Intern. Med. 118: 681–688. 12. Ou, W., Y. Xiong, and J. Silver. 2004. Quantification of virus-envelope-mediated recruitment of membrane molecules into clusters where fusion cell fusion using a tetracycline transcriptional transactivator: fusion does not cor- events take place. We and others (3, 60, 61) have observed a ring relate with syncytium formation. Virology 324: 263–272. of actin at viral synapses, and drugs that disrupt actin network 13. Levy, S., and T. Shoham. 2005. The tetraspanin web modulates immune-signal- ling complexes. Nat. Rev. Immunol. 5: 136–148. inhibit membrane fusion. However, no difference in actin remod- 14. Hemler, M. 2003. Tetraspanin proteins mediate cellular penetration, invasion, eling has been observed between CEM 1.3 cells interfered with the and fusion events and define a novel type of membrane microdomain. Annu. Rev. Cell Dev. Biol. 19: 397–422. control oligonucleotide or with the CD81siRNA conjugated with 15. Berditchevski, F. 2001. Complexes of tetraspanins with integrins: more than HxBc2. Therefore, according to our results and previous reports, meets the eye. J. Cell Sci. 114: 4143–4151. the alteration of the membrane protein microdomains, where CD4 16. Barreiro, O., M. Yanez-Mo, M. Sala-Valdes, M. Gutierrez-Lopez, S. Ovalle, A. Higginbottom, P. Monk, C. Cabanas, and F. Sanchez-Madrid. 2005. Endo- is included, due to diminution of tetraspanin expression or by en- thelial tetraspanin microdomains regulate leukocyte firm adhesion during extrav- Downloaded from gagement with anti-tetraspanin Abs, seems to be the most likely asation. Blood 105: 2852–2861. mechanism for the effects observed. Thus, although the reduction 17. Yanez-Mo, M., M. Mittelbrunn, and F. Sanchez-Madrid. 2001. Tetraspanins and intercellular interactions. Microcirculation 8: 153–168. in CD9 or CD81 expression by siRNA does not affect the level of 18. Hemler, M. 2001. Specific tetraspanin functions. J. Cell Biol. 155: 1103–1107. expression of CD4 nor its subcellular localization, it may alter its 19. Vogt, A. B., S. Spindeldreher, and H. Kropshofer. 2002. Clustering of MHC- association with gp120 coreceptors (CXCR4 or CCR5) or CD4 peptide complexes prior to their engagement in the immunological synapse: lipid raft and tetraspan microdomains. Immunol. Rev. 189: 136–151. presentation to gp120 in a more subtle way. We think that given 20. Stein, K. K., P. Primakoff, and D. Myles. 2004. Sperm-egg fusion: events at the http://www.jimmunol.org/ that CD81 is constitutively associated with CD4, the engagement plasma membrane. J. Cell Sci. 117: 6269–6274. 21. Tachibana, I., and M. Hemler. 1999. Role of transmembrane 4 superfamily of CD81 with Abs or its reduction of expression might disrupt (TM4SF) proteins CD9 and CD81 in muscle cell fusion and myotube mainte- CD81-CD4 associations. Under such conditions, a higher number nance. J. Cell Biol. 146: 893–904. of CD4 molecules would be available to associate with CXCR4 or 22. Takeda, Y., I. Tachibana, K. Miyado, M. Kobayashi, T. Miyazaki, T. Funakoshi, H. Kimura, H. Yamane, Y. Saito, H. Goto, et al. 2003. Tetraspanins CD9 and CCR5, forming useful complexes for gp120/gp41-induced mem- CD81 function to prevent the fusion of mononuclear phagocytes. J. Cell Biol. brane fusion. In addition, CD4 not associated with CD81 might 161: 945–956. interact more readily with gp120 viral protein. 23. von Lindern, J., D. Rojo, K. Grovit-Ferbas, C. Yeramian, C. Deng, G. Herbein, M. R. Ferguson, T. Pappas, J. Decker, A. Singh, et al. 2003. Potencial role for It is evident that the understanding of HIV-1-induced membrane CD63 in CCR5-mediated HIV-1 infection of macrophages. J. Virol. 77: fusion could yield interesting therapeutic strategies to directly 3624–3633. by guest on September 27, 2021 block the infection and to inhibit other important transmission 24. Pelchen-Matthews, A., B. Kramer, and M. Marsh. 2003. Infectious HIV-1 as- sembles in late endosomes in primary macrophages. J. Cell Biol. 162: 443–455. pathways such as viral cell-to-cell spreading. Our results show that 25. Pileri, P., Y. Uematsu, S. Campagnoli, G. Galli, F. Falugi, R. Petracca, the levels of expression of CD9 and CD81 or its engagement with A. Weiner, M. Houghton, D. Rosa, G. Grandi, and S. Abrignani. 1998. Binding Abs on target cells alters HIV-1-induced cell-to-cell fusion and of hepatitis C virus to CD81. Science 282: 938–941. 26. Pique, C., C. Lagaudriere-Gesbert, L. Delamarre, A. Rosenberg, H. Conjeaud, HIV-1 entry. Therefore, this work provides further evidence on the and M. Dokhelar. 2000. Interaction of CD82 tetraspanin proteins with HTLV-1 relevance of target cells in HIV-1 virus transmission and supports envelope glycoproteins inhibits cell-to-cell fusion and virus transmission. Virol- ogy 276: 455–465. the feasibility of therapeutic strategies directed to induce less sus- 27. de Parseval, A., D. Lerner, P. Borrow, B. Willett, and J. Elder. 1997. Blocking of ceptible host cells. feline immunodeficiency virus infection by a monoclonal antibody to CD9 is via inhibition of virus release rather than interference with receptor binding. J. Virol. 71: 5742–5749. Acknowledgments 28. Schmid, E., A. Zurbriggen, U. Gassen, B. Rima, V. ter Meulen, and We thank Dr. R. Gonza´lez-Amaro for helpful reading of the manuscript J. Schneider-Schaulies. 2000. Antibodies to CD9, a tetraspan transmembrane and the Servicio de Virologıá del Hospital Universitario de la Princesa protein, inhibit canine distemper virus-induced cell-cell fusion but not virus-cell (Madrid, Spain) for performing the quantitative pol-specific RT-PCR fusion. J. Virol. 74: 7554–7561. 29. Carrera, A. C., F. Sanchez-Madrid, M. Lopez-Botet, C. Bernabeu, and assays. M. O. De Landazuri. 1987. Involvement of the CD4 molecule in a post-activation event on T cell proliferation. Eur. J. Immunol. 17: 179–186. Disclosures 30. Yanez-Mo, M., A. Alfranca, C. Cabanas, M. Marazuela, R. Tejedor, M. A. Ursa, The authors have no financial conflict of interest. L. K. Ashman, M. O. de Landazuri, and F. Sanchez-Madrid. 1998. Regulation of endothelial cell motility by complexes of tetraspan molecules CD81/TAPA-1 and ␣ ␤ CD151/PETA-3 with 3 1 integrin localized at endothelial lateral junctions. References J. Cell Biol. 141: 791–804. 1. Moore, J., A. Trkola, and T. Dragic. 1997. Co-receptors for HIV-1 entry. Curr. 31. Yanez-Mo, M., R. Tejedor, P. Rousselle, and F. Sanchez -Madrid. 2001. Tet- Opin. Immunol. 9: 551–562. raspanins in intercellular adhesion of polarized epithelial cells: spatial and func- 2. Doms, R., and D. Trono. 2000. The plasma membrane as a combat zone in the tional relationship to integrins and cadherins. J. Cell Sci. 114: 577–587. HIV battlefield. Genes Dev. 14: 2677–2688. 32. Pulido, R., M. Cebrian, A. Acevedo, M. O. de Landazuri, and F. Sanchez-Madrid. 3. Gallo, S. A., C. M. Finnegan, M. Viard, Y. Raviv, A. Dimitrov, S. S. Rawat, 1988. Comparative biochemical and tissue distribution study of four distinct A. Puri, S. Durell, and R. Blumenthal. 2003. The HIV Env-mediated fusion CD45 antigen specificities. J. Immunol. 140: 3851–3857. reaction. Biochim. Biophys. Acta 1614: 36–50. 33. Mittelbrunn, M., M. Yanez-Mo, D. Sancho, A. Ursa, and F. Sanchez-Madrid. 4. Poli, G., G. Pantaleo, and A. S. Fauci. 1993. Immunopathogenesis of human 2002. Cutting edge: dynamic redistribution of tetraspanin CD81 at the central immunodeficiency virus infection. Clin. Infect. Dis. 17(Suppl. 1): S224–S229. zone of the immune synapse in both T lymphocytes and APC. J. Immunol. 169: 5. Collman, R. G., C. F. Perno, S. M. Crowe, M. Stevenson, and L. J. Montaner. 6691–6695. 2003. HIV and cells of macrophage/dendritic lineage and other non-T cell res- 34. Pleskoff, O., and C. Treboute. 1997. Identification of a chemokine receptor en- ervoirs: new answers yield new questions. J. Leukocyte Biol. 74: 631–634. coded by human cytomegalovirus as a cofactor for HIV-1 entry. Science 276: 6. Larsson, M. 2005. HIV-1 and the hijacking of dendritic cells: a tug of war. 1874–1878. Springer Semin. Immunopathol. 26: 309–328. 35. Pleskoff, O., N. Sol, B. Labrosse, and M. Alizon. 1997. Human immunodefi- 7. McCune, J. 2001. The dynamics of CD4ϩ T cell depletion in HIV disease. Nature ciency virus strains differ in their ability to infect CD4ϩ cells expressing the rat 410: 974–979. homolog of CXCR-4 (fusin). J. Virol. 71: 3259–3262. The Journal of Immunology 5137

36. Schwartz, O., and M. Alizon. 1994. Impairment of T cell receptor-dependent 48. Chen, M. S., K. S. Tung, S. A. Coonrod, Y. Takahashi, D. Bigler, A. Chang, stimulation in CD4ϩ lymphocytes after contact with membrane-bound HIV-1 Y. Yamashita, P. W. Kincade, J. C. Herr, and J. M. White. 1999. Role of the envelope glycoprotein. Virology 198: 360–365. integrin-associated protein CD9 in binding between sperm ADAM 2 and the egg ␣ ␤ 37. Valenzuela-Fernandez, A., J. Blanco, B. Krust, R. Franco, and integrin 6 1: implications for murine fertilization. Proc. Natl. Acad. Sci. USA A. G. Hovanessian. 1997. Neutralizing antibodies against the V3 loop of human 96: 11830–11835. immunodeficiency virus type 1 gp120 block the CD4-dependent and -indepen- 49. Willett, B., M. Hosie, A. Shaw, and J. Neil. 1997. Inhibition of feline immuno- dent binding of virus to cells. J. Virol. 71: 8289–8298. deficiency virus infection by CD9 antibody operates after virus entry and is in- 38. Valenzuela-Fernandez, A., S. Alvarez, M. Gordon-Alonso, M. Barrero, A. Ursa, dependent of virus tropism. J. Gen. Virol. 78(Pt. 3): 611–618. J. R. Cabrero, G. Fernandez, S. Naranjo-Suarez, M. Yanez-Mo, J. M. Serrador, et 50. Todd, S. C., S. G. Lipps, L. Crisa, D. R. Salomon, and C. D. Tsoukas. 1996. al. 2005. Histone deacetylase 6 regulates human immunodeficiency virus type 1 CD81 expressed on human thymocytes mediates integrin activation and interleu- infection. Mol. Biol. Cell 16: 5445–5454. kin 2-dependent proliferation. J. Exp. Med. 184: 2055–2060. 39. Imai, T., M. Kakizaki, M. Nishimura, and O. Yoshie. 1995. Molecular analyses 51. VanCompernolle, S. E., S. Levy, and S. C. Todd. 2001. Anti-CD81 activates of the association of CD4 with two members of the transmembrane 4 superfam- LFA-1 on T cells and promotes T cell-B cell collaboration. Eur. J. Immunol. 31: ily, CD81 and CD82. J. Immunol. 155: 1229–1239. 823–831. 40. Imai, T., and O. Yoshie. 1993. C33 antigen and M38 antigen recognized by 52. Hioe, C. E., P. C. Chien, Jr., C. Lu, T. A. Springer, X. H. Wang, J. Bandres, and monoclonal antibodies inhibitory to syncytium formation by human T cell leu- M. Tuen. 2001. LFA-1 expression on target cells promotes human immunodefi- kemia virus type 1 are both members of the transmembrane 4 superfamily and ciency virus type 1 infection and transmission. J. Virol. 75: 1077–1082. associate with each other and with CD4 or CD8 in T cells. J. Immunol. 151: 53. Fortin, J. F., B. Barbeau, H. Hedman, E. Lundgren, and M. J. Tremblay. 1999. 6470–6481. Role of the leukocyte function antigen-1 conformational state in the process of 41. Tardif, M. R., and M. J. Tremblay. 2005. Tetraspanin CD81 provides a costimu- human immunodeficiency virus type 1-mediated syncytium formation and virus latory signal resulting in increased human immunodeficiency virus type 1 gene infection. Virology 257: 228–238. expression in primary CD4ϩ T lymphocytes through NF-␬B, NFAT, and AP-1 54. Kelly, T. A., D. D. Jeanfavre, D. W. McNeil, J. R. Woska, Jr., P. L. Reilly, transduction pathways. J. Virol. 79: 4316–4328. E. A. Mainolfi, K. M. Kishimoto, G. H. Nabozny, R. Zinter, B. J. Bormann, and 42. Dianzani, U., M. Bragardo, D. Buonfiglio, V. Redoglia, A. Funaro, P. Portoles, R. Rothlein. 1999. Cutting edge: a small molecule antagonist of LFA-1-mediated J. Rojo, F. Malavasi, and A. Pileri. 1995. Modulation of CD4 lateral interaction cell adhesion. J. Immunol. 163: 5173–5177. with lymphocyte surface molecules induced by HIV-1 gp120. Eur. J. Immunol. 55. Maecker, H. T. 2003. Human CD81 directly enhances Th1 and Th2 cell activa- Downloaded from 25: 1306–1311. tion, but preferentially induces proliferation of Th2 cells upon long-term stimu- 43. Chen, S., S. Lee, C. Chuang, and V. Raj. 1999. Trans-dominant interference with lation. BMC Immunol. 4: 1. human immunodeficiency virus type 1 replication and transmission in CD4ϩ cells 56. Virelizier, J. L. 1989. Cellular activation and human immunodeficiency virus by an envelope double mutant. J. Virol. 73: 8290–8302. infection. Curr. Opin. Immunol. 2: 409–413. 44. Andreau, K., J. L. Perfettini, M. Castedo, D. Metivier, V. Scott, G. Pierron, and 57. Jolly, C., K. Kashefi, M. Hollinshead, and Q. Sattentau. 2004. HIV-1 cell to cell G. Kroemer. 2004. Contagious apoptosis facilitated by the HIV-1 envelope: fu- transfer across an Env-induced, actin-dependent synapse. J. Exp. Med. 199: sion-induced cell-to-cell transmission of a lethal signal. J. Cell Sci. 117: 283–293.

5643–5653. 58. Eitzen, G. 2003. Actin remodeling to facilitate membrane fusion. Biochim. Bio- http://www.jimmunol.org/ 45. Le Naour, F., E. Rubinstein, C. Jasmin, M. Prenant, and C. Boucheix. 2000. phys. Acta 1641: 175–181. Severely reduced female fertility in CD9-deficient mice. Science 287: 319–321. 59. Pontow, S. E., N. V. Heyden, S. Wei, and L. Ratner. 2004. Actin cytoskeletal 46. Ouchi, N., S. Kihara, S. Yamashita, S. Higashiyama, T. Nakagawa, reorganizations and coreceptor-mediated activation of rac during human immu- I. Shimomura, T. Funahashi, K. Kameda-Takemura, S. Kawata, N. Taniguchi, nodeficiency virus-induced cell fusion. J. Virol. 78: 7138–7147. and Y. Matsuzawa. 1997. Role of membrane-anchored heparin-binding epider- 60. Sylwester, A., D. Wessels, S. A. Anderson, R. Q. Warren, D. C. Shutt, mal growth factor-like growth factor and CD9 on macrophages. Biochem. J. R. C. Kennedy, and D. R. Soll. 1993. HIV-induced syncytia of a T cell line form 328(Pt. 3): 923–928. single giant pseudopods and are motile. J. Cell Sci. 106(Pt. 3): 941–953. 47. Merat, R., H. Raoul, T. Leste-Lasserre, P. Sonigo, and G. Pancino. 1999. Variable 61. Iyengar, S., J. Hildreth, and D. Schwartz. 1998. Actin-dependent receptor colo- constraints on the principal immunodominant domain of the transmembrane gly- calization required for human immunodeficiency virus entry into host cells. J. Vi- coprotein of human immunodeficiency virus type 1. J. Virol. 73: 5698–5706. rol. 72: 5251–5255. by guest on September 27, 2021