Validation of Marketed Medicinal Plants of District Lahore, Based on Classical and Molecular Markers ______

VALIDATION OF MARKETED MEDICINAL PLANTS OF DISTRICT LAHORE, BASED ON CLASSICAL AND MOLECULAR MARKERS ______

SEHRISH RAMZAN

______

DEPARTMENT OF BOTANY LAHORE COLLEGE FOR WOMEN UNIVERSITY, LAHORE 2018

VALIDATION OF MARKETED MEDICINAL PLANTS OF DISTRICT LAHORE, BASED ON CLASSICAL AND MOLECULAR MARKERS ______

A THESIS SUBMITTED TO LAHORE COLLEGE FOR WOMEN UNIVERSITY IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY IN BOTANY

SEHRISH RAMZAN

______

DEPARTMENT OF BOTANY LAHORE COLLEGE FOR WOMEN UNIVERSITY, LAHORE 2018

MY WORK IS DEDICATED TO MY PARENTS, MY HUNSBAND AND KIDS FOR THEIR PRAYERS, LOVE AND ENDLESS SUPPORT AND ENCOURGEMENT

ACKNOWLEDGMENTS

First of all I bow my head before Almighty Allah, the most Beneficent and the most Merciful, who is the entire and only source of every knowledge and wisdom endowed to mankind and who blessed me with the ability to do this work. It is the blessing of Almighty Allah and His Prophet Hazrat Muhammad (Sallallaho Alaihe Wasallam) which enabled me to achieve this goal.

My special gratitude goes to our ever active Vice Chancellor Prof Dr. Farkhanda Manzoor for her facilitations and patronage during the whole course of this research.

I am profoundly thankful to Prof. Dr. Farah Khan, Chairperson of Botany Department, for providing the light under which I dare to think of conducting the research and struggle to complete it. I am humbly thank you for affording an opportunity to aspire for the valuable academic degree through this study.

I would like to take this opportunity to convey my cordial gratitude and appreciation to my supervisor Dr. Shabnum Shaheen, and co-supervisor Prof. Dr. Farah Khan, for their patience, motivation, enthusiasm, and immense knowledge. I am really indebted to them for their accommodative attitude, thought provoking guidance, immense intellectual input, patience and sympathetic behavior.

I am highly obliged to Dr. Khadim Hussain, Assistant Professor in GCU, Faisalabad who provided valuable guidance throughout my research. I am greatly thankful for his extend and endless help, which I took as much as I could without fear of any reluctance. I am thankful to Nazish, Ammara and Kamran of Dept. of Bioinformatics in GCU, Faisalabad for their great cooperation.

I offer my great regards to Dr. Mushtaq Ahmed, Associate Professor and Dr. Muhammad Zafar, Herbarium Curator in Department of Plant Sciences, Quaid-i-Azam University, for their sincere cooperation and for providing me access to the reference specimens of under study plants.

My sincere thanks also go to my best friends Nidaa, Nadia Khalid, Mehreen Jalal and Hina Afzal for their support, guidance and prayers throughout my studies and research work. Furthermore my heartfelt thanks to my lab fellows Mehwish Jaffer, Sidra Younas and Tahira Illyas for their help and moral sustenance.

I am thankful to Sarfaraz, Nadeem, Asif, Tariq, Hassan and Ms. Shaheen, attendants of Dept. of Botany for their cooperation.

Last but not least, I am really thankful to my loving, caring and inspiring parents Mr Muhammad Ramzan and Ishrat Ramzan. Thank you both of you for always paving the way to my destinations and for strengthening the resoluteness of my dreams by sacrificing yours. I acknowledge and offer my heartiest gratitude to all my family members especially my sister Faiza for their moral support and cooperation. I also owe a special thanks to my Husband Mr. Waseem Abbas for his encouragement, patience, tolerance and motivation which enabled me to achieve this goal with excellence. His kind involvement gave me the knowledge that will continue to benefit me all my life. I thank him for the kindness towards me.

SEHRISH RAMZAN

CONTENTS

Title Page No.

List of Table i List of Figures v List of Plates xiii List of Abbreviations xiv Abstract xv Chapter 1 : Introduction 1.1: Introduction to medicinal plants 1 1.2: Importance of medicinal plants in healthcare 1 system 1.3: Adulteration in medicinal plants – A Burning 3 Issue 1.4: Reasons of adulteration 3 1.4.1: Adulteration caused due to the similar 3 morphology 1.4.2: Adulteration caused due to confusion in 4 Vernacular names 1.4.3: Lack of elementary knowledge about the 5 authentic plant source 1.5: Significance of taxonomic approaches in 5 resolving adulteration issue of medicinal plants 1.5.1: Morphological Analysis 5 1.5.2: Microscopic Analysis 6 1.5.3: Organoleptic Analysis 6 1.5.4: Molecular approaches in Medicinal 7 Plants Identification 1.6: Justification of the Current Research 10 1.7: Aims and objective 11 Chapter 2: Review of Literature 12 2.1. Adulteration; a burning issue 12

2.2. Use of classical taxonomic markers in 13 medicinal plant identification 2.3. Use of classical taxonomic markers in 17 medicinal plant identification Chapter 3: Materials and Methods 24 3.1: Survey of herbal markets and data collection 24 3.2: Collection of herbal and fresh plant samples 24 3.3: Taxonomic investigation 32 3.3.1: Morphological investigation 32 3.3.2: Leaf epidermal anatomical investigation 32 3.3.3: Palynological investigation 33 3.3.4: Light microscopic photography 33 3.3.5: Scanning electron microscopic 33 photographs 3.3.6: Organoleptic analysis 33 3.3.7: Solubility analysis 33 3.4: DNA barcoding 36 3.4.1: Preparation of stock solutions of DNA 36 extraction 3.4.2: Preparation of DNA extraction solutions 37 from the stock solutions 3.4.3: DNA extraction from plant material 39 3.4.4: DNA analysis techniques 39 3.4.5: Amplification of DNA 40 3.4.6: Purification of DNA 42 3.4.7: Application of biostatiscal tools 42 Chapter 4: Results Taxonomy results 44 4.1a: Cinnamomum verum Persl. vs Canella 44 winterana 4.2a: Cinnamomum Tamala (Buch-Ham.) T. Nees & 58 Eberm. Vs Cinnamomum Obtusifolium (Roxb.) Nees 4.3a: Gymnema sylvestre (Retz.) ex Sm. vs Gymnema 71 lactiferum (L.) R.Br. ex Schult 4.4a: Sphaeranthus indicus Linn. vs Sphaeranthus 84 africanus L. 4.5a: Artemisia maritima Linn. vs Artemisia 98 absinthium L 4.6a: Butea monosperma (Lam.) Taub. vs Averrhoa 111 carambolaL. 4.7a: 4.7a: Achillea millefolium L. vs Adhatoda 124 vasica Nees 4.8a: Morus nigraL. vs Morus albaL. 137 DNA Barcoding results 150 4.1b: Cinnamomum verum 156 4.2b: Cinnamomum tamala 149 4.3b: Gymnema sylvestre 161 4.4b: Sphaeranthus indicus 166 4.5b: Artemisia maritima 171 4.6b: Butea monosperma 176 4.7b: Achillea millefolium 182 4.8b: Morus nigra 187 Chapter 5: Discussion 192 5.1: Authentication of selected medicinal plants on 192 the basis of classical and molecular markers 5.1.1: Authentication of Cinnamomum verum 192 vs Canella winterana 5.1.2: Authentication of Cinnamomum 194 tamala vs Cinnamomum obtusifolium 5.1.3: Authentication of Gymnema sylvestre vs 196 Gymnema lactiferum 5.1.4: Authentication of Sphaeranthus indicus 197 vs Sphaeranthus africanus 5.1.5: Authentication of Artemisia maritima vs 199 Artemisia absinthium 5.1.6: Authentication of Butea monosperma vs 201 Averrhoa carambola 5.1.7: Authentication of Achillea millefolium vs 203 Adhatoda vasica 5.1.8: Authentication of Morus nigra vs Morus 204 alba 5.2: Authentication of selected medicinal plants on 206 the basis of advanced markers (DNA barcoding) 5.2.1: Cinnamomum verum (Darchini) 206 5.2.2: Cinnamomum tamala (Tezpath) 207 5.2.3: Gymnema sylvestre (Gurmar 207 booti)

5.2.4: Sphaeranthus indicus (Gul mundi) 208 5.2.5: Artemisia maritime (Afsathine) 208 5.2.6: Butea monosperma (Kamarkus) 209 5.2.7: Achillea millefolium (Branjasaf) 209 5.2.8: Morus nigra (Toth siyah) 210 5.3: Conclusion 211 5.4: Future recommendation 212 References 213 Annexures x vii Plagiarism Report xviii List of Publications and reprints xix

List of Tables

Table No. Title Page No.

1.1: Most commonly used DNA markers in plants 8 identification 1.2 Disadvantages of most commonly used DNA markers in 9 plants identification 3.1 Category and ages of informants 24 3.2 Collection sites for selected medicinal plants 30 3.3 Stock solution preparation 36 3.4 2X CTAB buffer (Resuspension buffer) 37 3.5 Preparation of washing buffer 38 3.6 Preparation of TE buffer 38 3.7 Short oligonucleotide primers 40 3.8 PCR reagents for each reaction 42 4.1a Qualitative morphological comparison of Cinnamomum 50 verum and Canella winterana 4.1b Quantitative morphological comparison between 51 Cinnamomum verum and Canella winterana 4.1c Qualitative leaf epidermal anatomical comparison 52 between Cinnamomum verum and Canella winterana 4.1d Quantative leaf epidermal anatomyical comparison 53 between Cinnamomum verum and Canella winterana 4.1e Qualitative and quantitative palynological comparison 54 between Cinnamomum verum and Canella winterana 4.1f Solubility analysis of different samples of Cinnamomum 55 verum in various solvents 4.2a Qualitative morphological comparison between 63 Cinnamomum tamala and Cinnamon obtusifolium 4.2b Quantitative morphological comparison between 64 Cinnamomum tamala and Cinnamon obtusifolium 4.2c Qualitative leaf epidermal anatomical comparison 65 ii

between Cinnamomum tamala and Cinnamon obtusifolium 4.2d Quantitative leaf epidermal anatomical comparison 66 between Cinnamomum tamala and Cinnamon obtusifolium 4.e Quantitative and qualitative palynological comparison 67 between Cinnamomum tamala and Cinnamon obtusifolium 4.2f Solubility analysis of different samples of Cinnamomum 68 tamalain various solvents 4.3a Qualitative morphological comparison between 76 Gymnema sylvestre and Gymnema lactiferum 4.3b Quantitative morphological comparison between 77 Gymnema sylvestre and Gymnema lactiferum 4.3c Qualitative leaf epidermal anatomical comparison 78 between Gymnema sylvestre and Gymnema lactiferum 4.3d Quantitative leaf epidermal anatomical comparison 79 between Gymnema sylvestre and Gymnema lactiferum 4.3e Qualitative and quantitative palynological comparison 80 between Gymnema sylvestre and Gymnema lactiferum 4.3f Solubility analysis of different samples of Gymnema 81 sylvestre in various solvents 4.4a Qualitative morphological comparison between 89 Sphaeranthus indicus and Sphaeranthus africanus 4.4b Quantitative morphological comparison between 90 Sphaeranthus indicus and Sphaeranthus africanus 4.4c Qualitative leaf epidermal anatomical comparison 91 between Sphaeranthus indicus and Sphaeranthus africanus 4.4d Quantitative leaf epidermal anatomical comparison 92 between Sphaeranthus indicus and Sphaeranthus africanus 4.4e Qualitative and quantitative palynological comparison 93 iii

between Sphaeranthus indicus and Sphaeranthus africanus 4.4f Solubility analysis of different samples of Sphaeranthus 94 indicus in various solvents 4.5a Qualitative morphological comparison between 103 Artemisia maritima and Artemisia absinthium 4.5b Quantitative morphological comparison between 104 Artemisia maritima and Artemisia absinthium 4.5c Qualitative leaf epidermal anatomical comparison 105 between Artemisia maritima and Artemisia absinthium

4.5d Quantitative leaf epidermal anatomical comparison 106 between Artemisia maritima and Artemisia absinthium 4.5e Qualitative and quantitative palynological comparison 107 between Artemisia maritima and Artemisia absinthium 4.5f Solubility analysis of different samples of Artemisia 108 maritima in various solvents 4.6a Qualitative morphological comparison between Butea 116 monosperma and Averrhoa carambola 4.6b Quantitative morphological comparison between Butea 117 monosperma and Averrhoa carambola 4.6c Qualitative leaf epidermal anatomical comparison 118 between Butea monosperma and Averrhoa carambola 4.6d Quantitative leaf epidermal anatomical comparison 119 between Butea monosperma and Averrhoa carambola 4.6e Qualitative and quantitative palynologcial comparison 120 between Butea monosperma and Averrhoa carambola 4.6f Solubility analysis of different samples of Butea 121 monosperma in various solvents 4.7a Qualitative morphological comparison between Achillea 129 millefolium and Adhatoda vasica 4.7b Quantitative morphological comparison between 130 Achillea millefolium and Adhatoda vasica iv

4.7c Qualitative leaf epidermal anatomical comparison 131 between Achillea millefolium and Adhatoda vasica 4.7d Quantitative leaf epidermal anatomical comparison 132 between Achillea millefolium and Adhatoda vasica 4.7e Qualitative and quantitative palynological comparison 133 between Achillea millefolium and Adhatoda vasica 4.7f Solubility analysis of different samples of Achillea 134 millifolium in various solvents 4.8a Qualitative morphological comparison between Morus 142 nigra and Morus alba 4.8b Quantitative morphological comparison between Morus 143 nigra and Morus alba 4.8c Quanlitative morphological comparison between Morus 144 nigra and Morus alba 4.8d Quantitative leaf epidermal anatomical comparison 145 between Morus nigra and Morus alba 4.8e Qualitative and quantitative palynological comparison 146 between Morus nigra and Morus alba 4.8f Solubility analysis of different samples of Morus nigra 147 in different solvents

List of Figures

Figure No. Title Page No.

3.1 Data collection about marketed herbal samples 25 3.2 Cinnamomum verum (darchini) 26 3.3 Cinnamomum tamala (tezpat) 26 3.4 Gymnema sylvestre 27 3.5 Sphaeranthus indicus 27 3.6 Artemisia maritime (afsathine) 28 3.7 Butea monosperma resin crystals 28 3.8 Ahatoda vasica 29 3.9 Achillea millefolium (branjasaf) 29 4.1a Quantative morphological comparison between 56 Cinnamomum verum and Canella winterana 4.1b Quantative leaf epidermal anatomy comparison between 56 Cinnamomum verum and Canella winterana 4.1c Quantitative palynological comparison between 57 Cinnamomum verum and Canella winterana 4.1d Phylogenetic analysis of matK sequences of marketed 151 samples of Cinnamomum verum. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for phylogenetic tree construction in Mega 6 software tool. 4.1e Phylogenetic analysis of nrITS sequences of marketed 152 samples of Cinnamomum verum. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for phylogenetic tree construction in Mega 6 software tool. 4.1f Phylogenetic analysis of rbcL sequences of marketed 153 samples of Cinnamomum verum. Other sequences were retrieved from the databases based on BLAST analysis. vi

Neighbour joining algorithm was used for phylogenetic tree construction in Mega 6 software tool. 4.1g Phylogenetic analysis of psbA-trnH sequences of marketed 154 samples of Cinnamomum verum. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for phylogenetic tree construction in Mega 6 software tool. 4.1h PCR amplification of Cinnamomum verum 155 4.2a Quantitative morphological comparison between 69 Cinnamomum tamala and Cinnamon obtusifolium 4.2b Quantitative leaf epidermal anatomy comparison between 69 Cinnamomum tamala and Cinnamon obtusifolium 4.2c Quantitative palynological comparison between 70 Cinnamomum tamala and Cinnamon obtusifolium 4.2d Phylogenetic analysis of matK sequences of marketed 156 samples of Cinnamomum tamala. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for phylogenetic tree construction in Mega 6 software tool. 4.2e Phylogenetic analysis of nrITS sequences of marketed 157 samples of Cinnamomum tamala. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for phylogenetic tree construction in Mega 6 software tool. 4.2f Phylogenetic analysis of rbcL sequences of marketed 158 samples of Cinnamomum tamala. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for phylogenetic tree construction in Mega 6 software tool. 4.2g Phylogenetic analysis of psbA-trnH sequences of marketed 159 samples of Cinnamomum tamala. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for phylogenetic tree vii

construction in Mega 6 software tool. 4.2h PCR amplification of Cinnamomum tamala 160 4.3a Quantitative morphological comparison between Gymnema 82 sylvestre and Gymnema lactiferum 4.3b Quantitative leaf epidermal anatomical comparison 82 between Gymnema sylvestre and Gymnema lactiferum 4.3c Qualitative and quantitative palynological comparison 83 between Gymnema sylvestre and Gymnema lactiferum 4.3d Phylogenetic analysis of matK sequences of fresh and 161 marketed samples of Gymnema sylvestre. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for phylogenetic tree construction in Mega 6 software tool. 4.3e Phylogenetic analysis of nrITS sequences of fresh and 162 marketed samples of Gymnema sylvestre. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for phylogenetic tree construction in Mega 6 software tool. 4.3f Phylogenetic analysis of rbcL sequences of fresh and 163 marketed samples of Gymnema sylvestre. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for phylogenetic tree construction in Mega 6 software tool. 4.3g Phylogenetic analysis of psbA-trnH sequences of fresh and 164 marketed samples of Gymnema sylvestre. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for phylogenetic tree construction in Mega 6 software tool. 4.2h PCR amplification of Gymnema sylvestre 165 4.4a Quantitative morphological comparison between 96 Sphaeranthus indicus and Sphaeranthus africanus 4.4b Quantitative leaf epidermal anatomical comparison 96 between Sphaeranthus indicus and Sphaeranthus africanus viii

4.4c Quantitative palynological comparison between 97 Sphaeranthus indicus and Sphaeranthus africanus 4.4d Phylogenetic analysis of matK sequences of marketed 166 samples of Sphaeranthus indicus. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for phylogenetic tree construction in Mega 6 software tool. 4.4e Phylogenetic analysis of nrITS sequences of fresh and 167 marketed samples of Sphaeranthus indicus. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for phylogenetic tree construction in Mega 6 software tool. 4.4f Phylogenetic analysis of rbcL sequences of fresh and 168 marketed samples of Sphaeranthus indicus. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for phylogenetic tree construction in Mega 6 software tool. 4.4g Phylogenetic analysis of psbA-trnH sequences of fresh and 169 marketed samples of Sphaeranthus indicus. Other sequences were retrieved from the databases based on BLAST analysis. 4.4h PCR amplification of Sphaeranthus indicus 170 4.5a Quantitative morphological comparison between Artemisia 109 maritime and Artemisia absinthium 4.5b Quantitative leaf epidermal anatomical comparison 109 between Artemisia maritime and Artemisia absinthium 4.5c Quantitative palynological comparison between Artemisia 110 maritime and Artemisia absinthium 4.5d Phylogenetic analysis of matK sequences of fresh and 171 marketed samples of Artemisia maritima. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for phylogenetic tree construction in Mega 6 software tool. ix

4.5e Phylogenetic analysis of nrITS sequences of fresh and 172 marketed samples of Artemisia maritima. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for phylogenetic tree construction in Mega 6 software tool. 4.5f Phylogenetic analysis of rbcL sequences of fresh and 173 marketed samples of Artemisia maritima. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for phylogenetic tree construction in Mega 6 software tool. 4.4g Phylogenetic analysis of psbA-trnH sequences of marketed 174 samples of Artemisia maritima. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for phylogenetic tree construction in Mega 6 software tool. 4.4h PCR amplification of Artemisia maritima 175 4.6a Quantitative morphological comparison between Butea 122 monosperma and Averrhoa carambola 4.6b Quantitative leaf epidermal anatomical comparison between Butea monosperma and Averrhoa carambola 4.6c Qualitative and quantitative palynologcial comparison 123 between Butea monosperma and Averrhoa carambola 4.6d Phylogenetic analysis of matK sequences of fresh and 176 marketed samples of Butea monosperma. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for phylogenetic tree construction in Mega 6 software tool. 4.6e Phylogenetic analysis of m sequences of fresh and marketed 177 samples of Butea monosperma. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for phylogenetic tree construction in Mega 6 software tool. 4.6f Phylogenetic analysis of rbcL sequences of fresh and 178 x

marketed samples of Butea monosperma. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for phylogenetic tree construction in Mega 6 software tool. 4.6g Phylogenetic analysis of TrnH-psbA sequences of fresh and 179 marketed samples of Butea monosperma. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for phylogenetic tree construction in Mega 6 software tool. 4.6h PCR amplification of Butea monosperma 180 4.7a Quantitative morphological comparison between Achillea 135 millefolium and Adhatoda vasica 4.7b Quantitative leaf epidermal anatomical comparison 135 between Achillea millefolium and Adhatoda vasica 4.7c Quantitative palynological comparison between Achillea 136 millefolium and Adhatoda vasica 4.7d Phylogenetic analysis of matK sequences of fresh and 182 marketed samples (shown in red font color) of Achillea millefolium. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for phylogenetic tree construction in Mega 6 software tool. 4.7e Phylogenetic analysis of nrITS sequences of marketed 183 samples (shown in red font color) of Achillea millefolium. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for phylogenetic tree construction in Mega 6 software tool. 4.7f Phylogenetic analysis of rbcL sequences of marketed 184 samples (shown in red font color) of Achillea millefolium. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for phylogenetic tree construction in Mega 6 software tool. 4.7g Phylogenetic analysis of TrnH-psbA sequences of marketed 185 xi

samples (shown in red font color) of Achillea millefolium. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for phylogenetic tree construction in Mega 6 software tool. 4.7h PCR amplification of Achillea millifolium L 186 4.8a Quantitative morphological comparison between Morus 148 nigra and Morus alba 4.8b Quantitative leaf epidermal anatomical comparison 148 between Morus nigra and Morus alba 4.8c Quantitative palynological comparison between Morus 149 nigra and Morus alba 4.8d Phylogenetic analysis of matK sequences of marketed 187 samples of Morus nigra. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for phylogenetic tree construction in Mega 6 software tool. 4.8e Phylogenetic analysis of nrITS sequences of marketed 188 samples of Morus nigra. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for phylogenetic tree construction in Mega 6 software tool 4.8f Phylogenetic analysis of rbcL sequences of marketed 189 samples of Morus nigra. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for phylogenetic tree construction in Mega 6 software tool. 4.8g Phylogenetic analysis of TrnH-psbA sequences of marketed 190 samples of Morus nigra. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for phylogenetic tree construction in Mega 6 software tool. xii

4.8h PCR amplification of Morus nigra 191

xiii

List of Plates

Plate No. Title Page No.

4.1 Cinnamomum verum 48 4.2 Cinnamomum tamala 61 4.3 Gymnema sylvestre 74 4.4 Sphaeranthus indicus 87 4.5 Artemisia maritima 101 4.6 Butea monosperma 114 4.7 Achillea millefolium 127 4.8 Morus nigra 140

xiv

List of Abbreviations

Light microscope LM Scanning electron microscope SEM Polymerase chain reaction PCR Deoxyribonucleic acid DNA

Double distilled water Dd H2O Polar to equatorial ratio P/E ratio

ABSTRACT

Concept of plant based medicines is gaining popularity day by day that is why their utilization has also been increased. But in medicinal plants utilization basic issue lies with their quality assurance. Some medicinal plants morphologically resemble with each other and during their field collection these plants are usually misidentified and replaced with the original plant species. This adulteration problem can affect the drug utilizer at local, national as well as at global level. Use of adulterer plant for curing specific ailment can result in horrible form. Hence current study was aimed to establish some authentication tools for identification of original medicinal plant species. These tools had provided basis for characterization and validation of marketed medicinal plants and recommended to minimize the issue of quality assurance of herbal drugs. For this study some selected medicinal plants (Cinnamomum verum, Cinnamomum tamala, Gymnema sylvestre, Sphaeranthus indicus, Artemesia maritima, Averrhoa carambola, Achillea millefolium and Morus nigra) were collected from local herbal markets of Lahore, along their original plant species collected from the fields. In this regard, standardization and authentication of selected drugs was achieved by combination of taxonomic parameters (morphology, anatomy, palynology and solubility analysis) and advance genomic markers (DNA barcoding). Results reported some significant morphological, anatomical and palynological markers for identification of studied medicinal plants. For example anatomical studies of Cinnamomum verum and Canella winterana showed stomatal variation i.e. anomocytic in C. verum and paracytic in C. winterana. Moreover Sphaeranthus indicus was clearly distinct from Sphaeranthus africanus on the basis of size of epidermal cells as 52.6 µm in S. indicus and 61.8 µm in S. africanus. Similarly palynological results revealed circular to spheroidal shape of pollen in Achillea millifolium while oblate shape was observed in Adhatoda vasaka. Furthermore colpi length of Artemisia maritima was 11.8 µm while 4.5 µm in Artemisia absinthium. The authenticity of herbal samples was also confirmed by DNA barcoding technique in which four primers i.e., matK, nrITS, rbcL and psbA-trnH were successfully used. It had been observed that most successful primer was rbcL followed by nrITS and matK primer whereas psbA-trnH produced least number of amplification. Overall results can be concluded as maximum adulteration was observed in all marketed samples of Cinnamomum verum, Cinnamomum tamala, xvi

Artemisia maritima and Butea monosperma. However less adulteration was found in samples of Gymnema sylvestre followed by Sphaeranrhus indicus, Morus nigra and Achillea millefolium.

1.1: Introduction to medicinal plants

Medicinal plants can be defined as the plants which are used to treat or prevent a specific disease in human beings (Anselem, 2004). These plants may either be wild or domestic. For millions of years, human population is using medicinal plants for multiple health issues (Sofowara, 1982; Hill, 1989; Iqbal, 1993; Walter, 2001). According to the WHO (World Health Organization) a vast number of human beings in various developed and under developing countries depend upon these plants for their physical health maintenance (Rabe and Van Stoden, 2000; Muthu et al., 2006; Ullah et al., 2006). This is probabaly due to their low cost, accessibility ease and less side effects in comparison to the modern formulated medicines (Iwu et al., 1999; Idu et al., 2007; Ammara et al., 2009; Patel et al., 2012). These medicinal plants are either used directly in herbal formulations or serve as the raw materials for pharmaceutical drugs (Carlini, 2003). Research and experiments regarding medicinal plants offers new approaches for the development of modern drugs (Ali, 2011). 1.2: Importance of medicinal plants in healthcare system

A large number of medicinal plants had been reported for their cure to a number of diseases. Such as Achillea millefolum L. is used as a stimulant tonic, carminative and intestinal and stomach gas expellent. It has soothing and healing effect on mucous membrane. Its aqueous extract is also reported important against the thinning of hair (Chopra et al., 2002). Another medicinal species Gymnema sylvestre (Retz.) R.Br.ex Sm, famous as a sugar destroyer is reported for glycolytic. For many centuries, G. sylvestre had been recommended for optimization of sugar metabolism by revival of pancreas cell and stimulated them to produce insulin. Moreover, G. sylvestre is also effective in eliminating the sugar either neutralizes or suppresses the desire of sweets (Subhose et al., 2005). Cinnamomum tamala (Buch.- Ham.)T.Nees&Eberm. is locally known by the name of Tejpat and in Sanskrit it is called Tejpatra (Baruah and Nath, 2007). Traditionally green leaves of C.

2 tamala has been used to extract the green dye (Gaur, 2008) and natural preservative of juices like pineapple (Kapoor et al., 2008). Moreover various parts of C. tamala also have been used in Ayurvedia preparation. Bark oil of cinnamon possesses very delicate spice aroma and sweet pungent taste. The major constituents of cinnamon are cinnamaldehyde and its minor constituents impart the flavor and characteristic odor due to which it is widely used in industry for seasoning the fast food, meat, sauces, pickles, backed food, tobacco flavors, cola drinks and also in dental as well as pharmaceutical preparations (FAO, 1995). Ficus religiosa L. (a member of family Moraceae) is commonly known as Peepal. This plant has very long shelf life and all its parts like leaves, fruits, seeds and bark have medicinal importance. It is famous as antiprotozoal, astringent, antiviral, and antidiarrhoeal activity. Moreover it is also widely used against the skin diseases, infectious diseases, inflammation and cancer.

Mulberries possess large amount of anthocyanin and provide a great source of vitamins and minerals (Gerasopoluos and Stavorulakis, 1997). They are used as food except that, their different parts like bark, leaves and fruits are used in medicine from many years. Mulberries are used as laxative, anthelmetic, expectorant, fever treatment and lower blood pressure as well as unine discharge (Baytop, 1999). Butea monosperma (Lam.) taub, (flame of forest or Palas) is another important medicinal plant of the Fabaceae family. It is used against various diseases due to its healing effect. The bark of B. monosperma possess appetizer properity and used to treat the liver disorder, piles treatment, inflammation of fracture and also blood purification. The leaves are astringent, appetizer, anthelmintic and cure the piles. Flowers, fruit and seed retain astringent and diuretic properity, also reduces body swellings and eye diseases (Kirtikar and Basu, 1984). Another chief medicinal herb is Glycyrrhiza glabra L. which is recognized as licorice during past ages (Wang and Nixon, 2001). Various valuable compounds like aglycone, glycyrrhizin and glycyrrhetinic acid were extracted from their root. Clinically these compounds were effective against hyperlipidemia (Tamir et al., 2001). Moreover Cassia fistula L. is well-known medicinal plant due to its great importance. Its stem and bark is widely used as emetic, antihelmintic,

3 antitubercular, diuretic, laxative, febrifuge and as well as in the healing of pustules and ulcer, dyspepsia, constipation, ringworm, fever, cardiac and diabetic problem (Kirthikar & Basu, 1933). Likewise fruits and roots of Viola betonicifolia Sm. are used mostly in the treatment of kidney diseases and respiratory diseases like bronchitis and pneumonia. Their flowers are being used in the treatment of cold, cough and congenital lung problems. Some other uses are treatment of skin problems, pharyngitis and blood disorders (Bhatt and Negi, 2006). 1.3: Adulteration in medicinal plants

The term adulteration means mixing or replacement of original herbal drugs with its resembled, less inferior plant which has different chemical or therapeutic properties. Substitution or adulteration in traded herbal raw material is a common practice. Adulteration or substitution in herbal medicine is a burning issue of the herbal industry. The reasons behind this fact are extinction of required species, deforestation or may be incorrect taxonomical identification. Adulteration may be accidental or intentional (Kokate et al., 2007; Mukherjee, 1991). Faith in herbal methods of treatment has lessened down due to adulteration. Even adulteration in herbal samples is a major drawback behind their promotion.

1.4: Reasons of adulteration

There are various reasons of adulteration of herbal plants.

1.4.1: Adulteration caused due to the similar morphology In this type of adulteration, adulterant plant may or may not have any therapeutic or chemical value, but morphologically resembled with the original medicnal plant. For example Leaves of Cinnamomum tamal (Tejpat) are aromatic and traded as a spice (Edward, 1993; Dhar et al., 2002; Anonymous, 2006). It is also used as carminative, in treatment of diarrhea and relieves colic pain. An Indian bay leaf (Cinnamomum obtusifolium (Roxb.) Nees) closely resembles to the Cinnamomum tamala and is commonly used adulterant of cinnamon. Another example of adulteration is Cinnamomum verum, its dried bark is used in flavoring the food like sweets, cake, biscuits

and pickle (Abeysinghe et al., 2009). It is adulterated with the thick, hard and less aromatic bark of Canella winterana due to close resemblance (Thomas and Duethi, 2001). Similarly seeds of Mucuna pruriens (L) DC. show adulteration with the seeds of some members of Papilionaceae due to superficial resemblance. Furthermore Mucuna utilis Wight. which was sold in herbal markets as white variety are oftenly adulerated with the Mucuna deeringiana (Bort) Merr. Two other varities, Mucuna cohinchinesis (Lour.) A.Chev. and Canavalia virosa (Roxb.) Wight & Arn. are also adulteranted and sold in Indian herbal markets. Authentic plant seeds are 1 cm in length, shiny surface with mosaic pattern and color black to brown. While Mucuna deeringiana seeds are slightly bigger and 1.5 to 2cm in size. The seeds of Mucuna utilis are buff or white colored and seeds of Mucuna deeringiana are dull black (Mitra and Kannan, 2007). Sometimes adulteration arises due to color resemblance and some drugs changes their color with the passage of time. Ratanjot is the example of this kind of adulteration. In the past, the roots of Ventilage madraspatana Gaertn. from western ghats were considered as the source of rattan jot but now a days instead of Ventilago madraspatana, Arnebia euchroma (Royle) .M.Ohnst. is used as rattan jot source. 1.4.2: Adulteration caused due to confusion in Vernacular names

This type of adulteration specially arises due to the confusion in vernacular names. The two herbs the Fumaria parviflora Lam. and Mollugo pentaphylla L. are used to sold under the same vernacular name either parpata or parpadagam. In a few regions of Southern India, Mollugo pentaphylla L. is supplied as the parpata or parpadagam, while in Northern India, herbal suppliers supply the Fumaria parviflora Lam under this local name. These two herbs can easily be identified by their leaves and stem. The leaves of Mollugo pentaphylla are simple and small and stem is pale yellow to light brown, thin and wiry whereas the leaves of Fumaria parviflora Lam. are digitate alongwith narrow segments and stem is dark brown to black color (Mitra and Kannan, 2007). Similarly Cassia angustifolia Vahl is another important example of this type of adulteration. C. angustifolia is commonly known as Senna, an important medicinal plant widely used in digestive disorder,

5 constipation, asthma, depression and various skin diseases. Herbalists and physicians in Arabian and Indo-Pak Sub-Continents preferred the C. angustifolia Vahl to treat various diseases. While broken aerial parts of an adulterant plant, Cassia obtusifolia L. are also sold in herbal markets of these countries under the same name of senna (Dymock, 1972).

1.4.3: Lack of elementary knowledge about the authentic plant source

Another important adulterations reason is a careless collection of herbal drugs by the herbal collectors or suppliers. In Ayurveda medicine system, Nagakesar is important drug and its authentic source is Mesua ferrea L. however the marketed samples are often adulterated with the flowers of Calophyllum inophyllum L. This is due to insufficient basic knowledge of suppliers and collectors about the actual habitat location of this particular plant. Although genuine plant can easily be distinguished from adulterant by cross sectioning of ovary i.e. two celled ovary was observed in original plant while in adulterant plant ovary is one celled (Mitra and Kannan, 2007). Another example is Parmelia perlata (Huds.) Ach. commonly known as Shaileya, is used in Unani, Siddha and Ayurveda system of medication. Its marketed samples showed that they are mixed with other species like Parmelia cirrhata and Parmelia perforate. However the original plant can easily be identified by the nature of thallus (Mitra and Kannan, 2007). 1.5: Significance of taxonomic approaches in resolving adulteration issue of medicinal plants

There are various methods which can be used for the authenticity of herbal plants used as raw material in herbal industry. Most commonly used methods for authentication are morpho-anatomical, palynological, organoleptic and solubility analysis (Mishra and Srivastava, 2016).

1.5.1: Morphological Analysis

Morphological investigation of herbal plants means examining the external features of selected parts of plants (i.e. leaves, flowers, fruits, seeds, stem, or rhizome) or the whole plant (Sultana et al., 2011). It is the initial and

6 essential step in taxonomy for the identification of medicinal plants. Moreover this investigation is very useful in order to identify the genuine plant from its adulterant. Multiple scientists suggested morphological characters for the identification of different medicinal plants (Saidulu et al., 2014; Alves et al., 2000). They argued that if a collector possessed the basic knowledge about the medicinal plant’s morphology, he or she can collect the medicinal plant with more accuracy. Mahmood et al. (2010) identified the an valuable medicinal species Camellia sinensis (L.) Kuntze on the basis of its morphological parameters. Similar study on morphology of Trachystemon orientalis (L) G.Don was also given by the Akcin et al. (2004).

1.5.2: Microscopic Analysis

Microscopic analysis include both anatomical and palynological characters. Both of these characters (anatomical and palyonological) play valuable role in taxonomic identification and description of the medicinal plants. In anatomy the characters like shape and type of stomata, its structure, type and category of trichomes and shape of epidermal cells are the commonly studied for distinguishing the genuine plant from its adulterant (Akbar et al., 2014).

The ability to identify the plant from its pollen enables the botanists or even the taxonomists to resolve the confusions among the genuine and adulterant plant. Light Microscopy (LM) and the scanning electron microscopy (SEM) of pollen grains are very useful in authentication of medicinal plant species (Zafar et al., 2011; Khan et al., 2011). On the basis of various pollen characters i.e. shape and type of pollen, colpi length, nature of pollen sculpturing and surface ornamentation, genuine plant can be easily distinguished from its adulterant plant (Sultana et al., 2011).

1.5.3: Organoleptic Analysis

Authentication of herbal drugs by organoleptic analysis involves all the senses and the analysis includes identification of odor, color, shape, size, taste, texture, structure and weight etc. It is simple but common practice among the herbalists, local inhabitants, herb traders and practitioners (Akbar et al., 2014).

1.5.4: Molecular approaches in Medicinal Plants Identification

Authentication of herbal plants by molecular markers means analysis of unique genetic structure of the plants. It is more advantageous over other taxonomic markers because they are most accurate, less time consuming, independent of environmental conditions, specimen age and physiological factors. Furthermore, these molecular markers did not depend on specific tissue and always show results at any plant developmental stage. DNA based techniques are sources of accurate, efficient and inexpensive testing tool for the authentication of millions of medicinal plant samples. It is useful authentication tool for the safety monitoring and quality control of herbal pharmaceuticals. Genetic markers means sequences of few nucleotide (gene) of chromosomes that have ability to differentiate between the cells or individuals or even at a species level. As every plant has specific DNA sequences so they are identified by unique molecular markers. Through this technique original plant can easily be differentiated from its adulterant (Ganie et al., 2015). Nowadays, a wide range of molecular markers is available and among them most commonly used markers are listed in Table 1.1. Although a number of molecular markers were widely used for different studies but these markers have some limitation too which were mentioned in Table 1.2.

A universal molecular tool, DNA barcode is a technique proposed in the last decade for the identification of species (Hebert et al., 2003). The DNA barcoding symbolically showed the way in which infrared scanner identified the product through the strips of Universal Product Code. This approach at the same time is based on variability analysis within single or few standard particular region of genome that are known as DNA barcodes. The logic of this technique is that DNA barcode sequences correspond to the each specific species means it showed low intraspecific variability instead showed large difference between the taxa (high intraspecific variability). Universally accessible markers, DNA barcode had been used successfully for the delimitation of inter species in detail (Hebert et al., 2003). Different Barcodes like matK, rbcL, psbA–trnH and ITS2 have been established for the herbal plants authentication. This molecular technique was very beneficial as it was

not only showed significant results in confirmation of obscure species but also in powder herbal samples (Ganie et al., 2013).

Table 1.1: Most commonly used DNA markers in plants identification

Sr. no. Commonly used molecular markers References

i. Amplified Fragment Length Gowda et al. (2010); Polymorphism (AFLP) Tripathi et al. (2011)

ii. Restriction Fragment Length Biswas and Biswas, Polymorphism (RFLP) (2013); Guan et al, (2018)

iii. Random Amplified Polymorphic DNA Thormann et al. (RAPD) (1994); Abou zid (2014)

iv. Simple Sequence Repeats (SSR) Hon et al. (2003); Shirasawa et al. (2013)

v. Inter Simple Sequence Repeats (ISSR) Kojima et al. (1998); Vijayan et al. (2014)

vi. Sequence Characterized Amplified Kiran et al. (2010); Regions (SCAR) Yadav et al. (2012) vii. Loop Mediated Isothermal Amplification Parida et al. (2008); (LAMP) Ganie et al. (2013) viii. Single Nucleotide Polymorphism (SNP) Bundock (2009)

Table 1.2: Disadvantages of most commonly used DNA markers in plants identification

Markers Disadvantage Reference

RFLP a) Time consuming, Fairly expensive and Ganie et al. (2015)

limited sensitivity b) Required huge amount of DNA c) Required wide-ranging possible skill

RAPD a) Highly sensitive show variable Ganie et al. (2015)

reults with laboratory changes. b) Less reproducible marker c) Low anneling temperature (28- 38oC)

ISSR a) Species-specific Ganie et al. (2015)

b) Dominant marker c) Reproducibility issue

SSR a) Species-specific Ellegren (2004)

b) High developmental costs c) Required much time and costs

d) Presence of null alleles is major drawback e) Difficulty in interpretation

AFLP a) Marker clustering Ganie et al. (2015)

b) technically challenging c) involve harmful radioactive material d) florescent tags

SCAR a) Prerequisite Sequence to design Ganie et al. (2015) PCR primers

1.6: Justification of the Current Research

One of the weaknesses behind the acceptance of herbal product formation is lack of quality control and standardization. It is quite difficult to establish the specific quality control standards due to the complex nature and innate unpredictability of chemical constituents of herbal drugs. Adulteration of marketed herbal samples remains the severe issue in national as well as in international markets due to the incorrect botanical identification and confused nomenclature of traded herbal drugs. The morphological and microscopic investigation to authenticate any herbal sample is comparatively simple and direct but its accuracy depends only on trained botanists. Solubility testing also has some contradiction because it depends on species chemical constituents and chemical profile can vary with the growing season, harvesting time, post harvesting period and also storage duration. Limitations of these classical parameters can cause hindernace in medicinal plant authentication process. So it is a need of time to develop some sensitive and more effective tools for the authentication of medicinal plants. Therefore DNA based markers are considered more reliable and effective tools for plant identification by various researchers. Various DNA fingerprinting approaches like AFLP, RFLP, RAPD, SSR markers, sequencing of ribosomal DNA-ITS regions and bar coding of DNA had been used for the development of species specific markers of medicinal plants. Among them DNA barcoding is considered more trustworthy in order to resolve authenticity issue of various controversial herbal drugs sold in local herbal markets. Hence this current project was an effort to highlight and document the adulteration among particular medicinal herbs sold in herbal markets of Lahore, Pakistan.

1.7: Aims and Objective

i. To highlight some herbal plants which are facing adulteration problem in herbal markets of Lahore, Pakistan. ii. To estimate the extent of adulteration and substitution in selected herbal drugs marketed in Lahore, Pakistan. iii. To use morphological characters which provided basic and pictorial information for correct identification and validation of traded medicinal plants iv. To employ light and scanning electron microscopy for anatomical and palynological features which have provided useful taxonomic data for genuine medicinal plants identification. v. To implement DNA Barcoding technique as identification tool for resolving adulteration problem persisting among studied herbal drugs.

2.1: Adulteration; a burning issue

Kumar (2014) described the increasing trend of Indian herbal medicines among the generations of 20th and 21st century. However, he also mentioned the risk of substitution or replacement among the source of these herbal medicines. Deforestation, species extinction due to their over exploitation and mistaken identification are some probable causes for their adulteration. Therefore establishment of reliable methods for herbal plant identification and standardization are mandatory for the bright future of herbal industry. In other case eventually people will lose their trust on traditional medicines.

Neelam et al. (2014) highlighted an important issue of adulteration in India where 80% rural population depends on the herbal treatment system for the prevention of diseases. They defined adulteration as addition of other similar drugs into or instead of original drugs to get large net profit. They also listed some important causes of adulteration such as substitution by chance due to the confusion about vernacular name or may be due to the lack of background plant knowledge. Moreover morphological resemblance, same aroma or may be due to the lack of attention during field collection can also be a cause of adulteration.

Dubey and Savant (2015) stated that 80% of Indian rural population rely on indigenous medicine system. However this herbal system is under threat of adulteration. They highlighted some key reasons for this adulteration i.e. deliberate addition of some irrelevant substances to enhance the product weightage, misperception about their indigenous names, insufficient background knowledge about genuine medicinal plant, overlapping morphology, careless field collection, non-availability of particular plant and many other anonymous reasons. They documented a list of possible adulterants and substituents of ayurvedic drugs sold in herbal markets around the world.

In recent times Ahmad and Hassan (2015) also highlighted the burning issue of adulteration in medicinal plants. In some cases the substitution does not harm the end user, however mostly it is unacceptable because replacement of authentic medicinal plant with adulterant may cause adverse health effects. These effects could 13 be mild to severe. Therefore understanding of adulteration types and possible substituents of medicinal plants is mandatory to control this dishonest activity.

2.2: Use of classical taxonomic markers in medicinal plant identification

Lwin (2008) had done comparative taxonomic (morphological and anatomical) studies of two medicinal plants (Polygonum chineses L. and Rhoeo discolor) inhabited in the Dawei district. Morphological studies of P. chinese showed that it was swollen at node, black patches were seen at central portion of each leaf blade with ochreate stipules. It was reported with terminally corymbose inflorescence, trigonous ovary and trifixed stigma. The microscopic analysis revealed that the anomocytic type of stomata were present. Striation was present on both surfaces of cuticle. Midrib in transverse section showed collateral vascular bundles, 8-10 in number among them one bundle was large while other were small. Moreover calcium oxalate crystals were seen in parenchyma cells. However in R. discolor leaves were upright, crowded, green from upper surface and reddish purple from lower surface. Axillary inflorescence was recorded in this species. The androecium was consisted of 6 stamens and often covered with the moniliform hair, whereas gynoecium with trilocular carpels and capitate stigma. Anatomical studies reported the isobilateral leaves with tetracytic type of stomata. Larger cells were present on lower epidermis while smaller cells were on upper epidermis. Stomata were present on lower surface, tetragonal type of crystals were present in mesophyll cells. The overall results suggested that these morphological and anatomical markers are good enough for differentiation between these two species.

Yousaf et al. (2010) has carried out the taxonomic studies of medicinally important genus Solanum. This genus is represented by 15 species in Pakistan and out of these 11 species are medicinally valuable. They used the statistical methods for interpretation of morphological and anatomical data. Cluster analysis and Euclidean distance measured similarity matrix were used to determine the relationship among the studied taxa of Solanum. The correlation analaysis exhibited the significant relationship between floral and stem characters. All of these features were found taxonomically viable in identification of Solanum. 14

Ceasalpinia benthamiana (Baill.) Herend. and Zarucchi (Mezoneuron benthamianum Baill.) (Ceasalpiniaceae) traditionally used in treatment of erectile dysfunction, dysentery, urethral discharges, diseases and wounds. Despite of long traditional history of use for various ailments, no systematic work was done for the authentication of C. benthamiana. The major obstacle in this work was the unavailability of pure plant sample. Various pharmacognostic standardization methods had been employed for the authentication of plant material (root & bark) including study of micro and macro morphological features. The results obtained were very useful and will be helpful for further studies and establishment of monograph for plant (Dickson et al., 2007) .

Sultana et al. (2011) provided some valuable taxonomic tools for standardization of a valuable medicinal plant Azadirachta indica A.Juss. (neem). This drug is often adulterated at local and global levels. It was observed that two different species (Azadirachta indica and Melia azedarach L.) were sold under the same vernacular name in herbal markets of Indo-Pak Subcontinent. In this study both of these species were standardized by making comparison in their morphology, anatomy, palynology, organoleptography, pharmacogonisy, UV and IR analyses. This research contributed towards the standardization and global acceptance of Neem as an herbal drug.

Tripathi and Mondal (2012) has carried out the comparative stomatal studies of six species of a valuable medicinal genus Cassia which is used by the rural peoples of South West Bengal as medicine. Leaf clearings and cuticular preparations were examined with light microscope. Results reported great stomatal diversity in their shape, size, types and orientation, which has the great value in the plant systematics. In this study species were differentiated on the basis of presence and absence of stomata, types of stomata, stomata index, and the shape of epidermal cells. Overall three types of stomata were observed i.e. paracytic, anisocytic and anomocytic. Among all the three types of stomata the paracytic type was more common.

Sultana et al. (2012) has carried out the taxonomic (palynology and anatomy) and pharmacognostic (powdered drug reactions with other chemical reagents and fluorescence analysis) authentication of Cassia angustifolia. The 15 powdered drug of the Cassia angustifolia is pale greenish in colour while its adulterant Cassia obustifolia is dark green in colour. It was concluded that the knowledge of morpho-palynological, anatomical and pharmacognostical analysis may lead to the authentication of herbal drugs like Senna for the purpose of employment in quality assurance of pharmaceutical products globally.

Sultana and Zafar (2013) authenticated herbal medicine named Henna (Lawsonia inermis) which is traditionally used for treatment of skin and hair problems and jaundice. The aim of this study was to investigate the indigenous knowledge regarding medicinal plants, morphological and microscopic studies of pollen, leaf anatomical studies, florescence study under UV and IR and also the preliminary phytochmeical tests were performed to distinguish the genuine plant from its adulterant. This authentication helped in standardization of genuine drug. Lawsoniai nermis was authenticated from Mirabilis jalap (adulterant plant) on the basis of taxanomy and pharmacognsy. This study was significant for authentication of original herbal drugs that might leads to the worldwide safe herbal formulations.

Fazal et al. (2013) provided viable taxonomical tools for the identification of some valuable medicinal plants i.e. Achillea millefolium, Acorus calamus, Arnebia nobilis, Fumaria indica, Gymnema sylvestre, Origanum vulgare, Paeonia emodi, Peganum harmala, Psoralea corylifolia, Rauwolfia serpentina, and Vetiveria zizanioides. These characters are supportive in the quality assurance and standardization of these medicinal plants which can assure their safe use.

Unnati et al. (2014) had done anatomical studies of a medicinal plant Adhatoda vasica which is used as bronchodilator and expectorants in India. Microscopic studies of A. vasica showed diacytic type of stomata, thin layered polygonal epidermal cells with 2-4 celled trichomes which were sessile glandular, and blunt ended. This study provided a guide for the correct identification and standardization of this particular herbal plant.

Mallya et al. (2014) had done anatomical analysis of a common Ayurvedic drug mundi (Sphaeranthus indicus). Results revealed that anisocytic type of stomata were present on upper epidermis while anomocytic stomata were present on lower epidermis of leaf. Stem anatomical studies reported the presence of unicellular to 16 multicellular, glandular and eglandular tichomes. These anatomical keys could be helpful in order to distinguish and identify the original plant from its adulterants.

Pramanick (2016) had done the morphological and anatomical assessment of a traditionally used herbal drug Gymnema sylvestre (Retz.) R.Br. ex Schult. This plant belongs to Apocynaceae and is famous as an antidiabetic herb due to the presence of gymnemic acid. Moreover it also had been used for the treatment of multiple ailments in traditional health care system. Therefore this study was proved to be valuable in provision of reliable taxonomic markers for the identification of this plant.

Gupta et al. (2016) suggested plant kingdom as a treasure house of multiple drugs. They stated that due to their availability ease, cheapness and side effect free nature the use of herbal medicines is increasing day by day. However their increased demand can pose problems in herbal drugs standardization. In this study a common herbal drug palas (Butea monosperma (Lamk.) Taub.) was subjected for anatomical and phytochemical characterization. These characters provided a set of plant diagnostic structures which play role in drug’s botanical identification.

Venkatachalam et al. (2018) studied the macro and microscopic features of a traditionally used herbal plant Sphaeranthus indicus (Linn.) (globe-thistle) belonging to the family Asteraceae. Its leaves are customarily used to control hyperlipidemia, epilepsy, jaundice, mental illness, diabetes, fever, cough, gastropathy, hernia, helminthiasis, dyspepsia and skin diseases and AIDS. Results reported its leaves as simple but alternate, oblong shaped, spatulate, spinous with pubescent surface and dentate margins. The fresh leaves were observed as green whereas dried leaves were greenish black in colour. In the leaf transverse sectioning sclerenchyma was absent in vascular bundles. Moreover lamina was dorsiventral with undifferentiated mesophyll cells. Multicellular and uniseriate epidermal trichomes were abundant in their distribution. The results of this study could serve as a valuable information source and provided consistent standards for identification of this particular plant material in forthcoming investigations.

2.3: Use of advanced molecular markers in medicinal plant identification

Abeysinghe et al. (2009) indentified the controversial taxonomic status of Cinnamomum speices inhabited in Srilanka. Therefore, in previous studies multiple attempts through classical taxonomic marker (foliar and pollen morphology, floral, ecophysiological characters and chemical testing) had been done for their identification. However, in comparison to these classical taxonomic techniques, molecular techniques had proven more reliable in correct identification of Cinnamomum speices. Abeysinghe et al analysed seven Cinnamomum species (C. capparu-coronde, C. verum, C. litseafolium, C. dubium, C. rivulorum C. camphora and C. sinharajaense) on the basis of their nucleotide sequences related to cpDNA and ITS regions of rDNA. The studied cpDNA regions were intergenic spacer found between the trnT-tranL, tanL-tanF, trnL intron and trnH-psbA. Through which a number of variation site in cpDNA sequences of trnL-trnFIGS, trnL intron, trnH- psbAIGS, trnT-TRnL IGS and ITS regions of rDNA were identified. The results reflected that cpDNA did not reported much variations that can interpret the genetic diversity of Cinnamomum species. However, ITS regions of rDNA were proved remarkably helpful in identification of Cinnamomum species.

Vijayan and Tsou (2010) showed that species can be identified by a DNA barcode technique in which nucleotide diversity of the short segment DNA can be used. This technique as a standard is widely used in animals by introducing the CO1 (cytochrome oxidase subunit 1) while in plants, the universally acceptable barcodes are less explored and needed to be researched. Recently the association of the barcode of plant life group has identified few potential barcode loci. Among them two standard barcode loci (rbcl+matK) had been suggested for the plant barcode processing. Although these locus showed 70% plant species discriminatory potential and are widely used in many projects but still additional loci are needed for better resolution.

Selvaraj et al. (2012) found that Boerhavia diffusa is a native plant of India and is used as a component of various Indian medicines. In order to maintain the efficacy of this herbal drug correct identification during collection and preservation 18 was very necessary. Boerhavia was distinguished from its adulterant plant (B. diffusa) by using DNA Barcoding method. The phylogenetic investigation of four species of Boerhavia was carried out by barcoding technique i.e plastids gene (psbA- trnH) and nuclear ribosomal regions (ITS, ITS1, ITS2). Sequences results showed that polymorphism sites were 26%, 30%, 16% and 6% in ITS, ITS1, ITS2 and psbA-trnH respectively. Moreover B. diffusa was distinguished from its closely related species by constructing phylogenetic tree based on ITS sequences. Hence studies proved that ITS1 showed the high level of percentage variation, transition ratio and pairwise distance which was proved helpful to distinguish the B. diffusa from its other species.

Kool et al. (2012) described those medicinal plants whose roots and bark is sold in powdered form in the herbal market. Such plants faced many difficulties in their identification. In this case DNA barcoding is very helpful in species identification. 101 samples of roots were sequenced for the barcode regions i.e., rpoC1, psbA-trnH, matK and ITS regions. The sequences were found in Moroccan plant database. Along their close relative sequences were analyzed by BLAST and blastcutter. Success of sequencing with psbA-trnH, rpoC1 and ITS was high while low with matK. It was evident that rpoC1 was insufficient individually for medicinal plant identification at species level. For this purpose rpoC1 in combination with ITS and psbA-trnH were used for the identification of market samples even at genus level. The finding of this study showed that identification through barcoding technique was supportive in resolving adulteration issue.

Gutteridge and Burns (2013) insisted on the application of molecular merkers for the recognition of herbal plants. There is vast range of herbal plants having beneficial traits to treat sickness and diseases in India, China and Korea. Currently it has gained notable place in the field of traditionally used pharmaceuticals as inhabitants are taking natural soothing products that has eliminated the threats of side effect. Plant based medicines production is not often regulated and lead to some quality issues which are problematic to identify especially when the plant material have been processed into various forms i.e. tinctures, powders and other forms. Adulteration with morphologically similar species is major problem during harvesting, taxonomic misidentification, local and verbal terminology. Thus these all 19 issues may cause serious health hazards and allergic reactions due to the interaction of unknown chemicals constituent.

Burge et al. (2013) worked on the 21 species of genus Pachypodium tree mainly dominated in Madagascar and South Africa. The members of this genus were distributed in arid and semi-arid area of Madagascar but due to the deficiency of phylogenetic knowledge it was difficult to check the relationship among the members of this genus. The only method to construct the evolutionary relationship among 21 species of selected genus was DNA sequencing of nuclear ribosomal ITS and trnL-F regions of chloroplast. The phylogenetic results were compared with previous taxonomic classification and their geography. Results of this research suggested three infragenetic taxa from recent classification of genus Pachypodium. This research showed five distinct lineage which correspond to recognition of group in previous taxonomic classification. This work furthermore suggested that the complex biogeographic relationship exists in members of this genus in Madagascar and South Africa.

Newmaster et al. (2013) declared that herbal medicines are substituted or contaminated by some other morphological resembled species and their use may cause serious health issues. They employed DNA barcoding technique (rbcL+ ITS2 markers) on 44 herbal plants products from 12 different companies and 50 leaf samples were assembled from 42 herbal species and upon 30 different species as well. SRM (Standard reference material) results showed the DNA barcodes recovery from 91% of herbal products and 100% from leaf samples. They found that 59% of tested products contained DNA barcode from plants that were not mentioned on labels. Through this technique they were able to authenticate 48% of tested products, 1/3rd contaminants rich. They concluded that DNA barcoding is authentic technique to check the quality of herbal products and their substitution as well.

Biswas and Biswas (2014) discussed the worth of genome based methods in eliminating the adulteration issue existing among herbal drugs. They described that herbal drugs (mainly comprising of the crude plant parts, extracts, oils, gums, mixtures of extracts) are an integrated part of the traditional system of medicine especially in the developing countries. About 75% of the world population is dependent on this system of medicine and there has a global market of US 62 billion 20 dollar and is expected to raise US 5 trillion dollar by the year 2050. However, there is no proper method of standardization to authenticate these drugs which are adulterated. The adulteration lies mainly with the starting material. This adulteration may be intentional or non-intentional. The authentication of these medicinal plants was carried out up to a certain extent by chemical fingerprinting methods which however may not give the correct identification due to variation in the chemical composition arising from age and genotype of the plants and due to geographical variation. Hence the most desirable way to authenticate these plants was by the genome based methods. Developing DNA molecular markers and bar-coding these plants by sequencing a standard region of the DNA are best way to identify the adulterants as well as authenticate the desired species of plant.

Zhou et al. (2014) explored a traditional Chinese plant Peucedanum praeruptorum L. which is used as the expectorant and dispelling the wind heat. However due to its higher demand in markets, many plants having similar morphology are adulterated with the P. praeruptorum. DNA barcoding was used to identify the P. praeruptorum from is adulterants on the basis of short standardizes DNA sequences. Through DNA sequence analysis (internal transcribed spacer) P. praeruptorum and 13 subsitutes and its 23 adulterants were examined. The resultant data revealed that P. praeruptorum was easily identified from its adulterants plant at DNA level.

Parvathy et al. (2014) identified adulteration in black pepper (Piper nigrum) by using DNA barcoding technique. Three barcoding loci (rbcL, psbA-trnH and rpoCl) were used. Results of sequence analysis showed adulteration in two marketed samples of this spices. One of the Loci (psbA-trnH) proved an ideal for detection of adulteration of black pepper by giving two amplicons of the different size 600bp and 350bp. Further confirmation was done by cloning and sequences of both adulterant market samples. Hence DNA barcoding is very effective method to determine even the low level of adulteration (0.5%).

Raterta et al. (2014) studied the ten medicinal plants native to Manila by using DNA barcoding and found this technique effective tool for the identification of medicinal plants. This study was based on one nuclear marker (ITS) and three chloroplast markers (matK, trnH-psbA and rbcL). Among these markers, trnH-pabA 21 showed more effective results followed by other two markers i.e. ITS and matK). The 100% sequence rate success was observed in ITS marker, 82% in trnH-psbA while 78% was observed in the case of matK marker. BLAST analysis showed that matK was most preferable marker for the identification of particular species. In this study seven important plants were identified by marker trnH-psbA. Moreover matK showed 0.7% mean value for intraspecific divergence, 0.11% by ITS whereas 0.16% value was showd by trnH-psbA. Moreover it was revealed through Blast results that matK marker was significant to delimit the different species with least intraspecific divergence. Hence this study proved that trnH-psbA and matK were two important markers for the particular plants species identification specially when morphological parametes were seemed to be insufficient.

Swetha et al. (2014) identified adulteration in an important aromatic tree, Cinnamomum verum (widely used in beverages, flavouring, medicines and perfumes) with the cheaper bark of two Cinnamomum species (C. malabratum and C. aromaticum). In case of powder sample, the bark is difficult to differentiate morphologically. Therefore, DNA based technique was considered more helpful to resolve this problem. For molecular studies high quality DNA is required however bark of Cinnamomum contains secondary metabolities, polysaccharaides and polyphenols that cause hindrance in DNA extraction. Hence, a novel method high quality genomic DNA isolation and amplification from dried bark of three Cinnamomum species, was developed by trial and error. The yield of dried bark ranged from 5-8.1 μg g–1 and absorbance at 269nm and 280nm showed above 1.8 ratio, that indicated the high quality DNA. This high quality DNA was amplified through PCR by using one barcoding locus rbcL, three RAPD primers and also restriction digested (HindIII and EcoRV). The results of PCR amplification of isolated purified DNA had confirmed the high quality results which indicated the efficiency of used protocol for further molecular analysis.

Hubert and Hanner (2015) suggested the DNA barcoding, as a system which is used in species identification with the help of internal species tag (specific gene regions). DNA barcoding has developed as field of biodiversity to fill the conceptual gaps remained in the traditional taxonomy and other molecular systematics fields. 22

Hubert and Hanner listed out the DNA sequences used in taxonomy and showed differences among procedures for identification and delimitation of species.

Ganie et al. (2015) described that medicinal plants played important role in maintaining the human health and treating various diseases. However, adulteration or substitution of drug is major concern for the herbal industries and end users. Hence authentication of medicinal plants is major requirement of this time. Therefore, various classical tools (morphology, anatomy and palynology) and advanced tools (DNA markers) had solved this issue by differentiating the original plant drug from its substitute and adulterants. DNA markers (based on the nucleotide sequences) are considered very important in species identification and it is preferred because of its high discriminating power. Hence, recognition of plant by DNA markers is best approach for correct identification of herbal plant species as well as population of same species.

Spies and Spies (2018) identified the genus Clivia on DNA barcode basis. This genus belongs to family Amaryllidaceae and prevalent in South Africa and Swaziland. It has six species and one natural hybrid. Multiple confusions in their identification and taxonomy were probably due to the overlapping morphological features of the species. Therefore two DNA barcodes i.e. matK and rbcLa were employed for the authentication of this genus. Results of this study reported higher mean intraspecific variation (0.21) of matK in comparison to rbcLa (0.02). Three species i.e. C. mirabilis, C. nobilis and C. caulescens were found monophyletic in the Bayesian Inference (BI) cladogram. However the other three species (C. miniata, C. gardenii, C. robusta and their affinities) were reported as paraphyletic. Overall results concluded that C. mirabilis, C. nobilis and C. caulescens possessed unique DNA barcodes for their identification, whereas for other species further studies are required.

Shinwari et al. (2018) had done DNA based characterization of 78 medicinal species belonging to diverse families. Three reliable barcodes were used i.e. rbcL, matK and psbA-trnH. The phylogenetic relationships of these medicinal species were reflected by their phylogenetic trees. The tree constructed by matK (~800 bp), rbcL (~1400 bp) and psbA-trnH (~500 bp) sequences presented 6, 8 and 4 diverged groups, correspondingly. Results showed that Ajuga bracteosa, Bupleurum falcatum, Salvia aegyptiaca, and Acorus calamus were extremely diverged out of all species. Overall 23 this study recommended matK and rbcL as more useful barcode for studying large group of species. This study was also proved supportive in identification authentication and differentiation of novel medicinal plants from Pakistan.

Inglis et al. (2018) had done DNA barcoding studies on a Brazilian folk medicinal genus i.e. Phyllanthus. Four species of this genus (P. amarus, P. urinaria, P. niruri, and P. tenellus) were studied by using nuclear ribosomal internal transcribed spacer (ITS1 – 5.8S rRNA-ITS2), internal transcribed spacer 2, and chloroplasts rbcL, matK, psbA-trnH, trnL, and trnL-trnF. Results reported the reliability of all markers in differentiation of these four Phyllanthus species. The internal transcribed spacer and matK were seemed more advantageous because this genus is well characterized by these barcodes in Genbank database. However rbcL showed limitations in its distinguishing ability. In this study commercial sample of an herbal drug quebra-pedra (originally comprised of P. tenellus) was also authenticated. Results reported the adulteration in one of the sample with alfalfa (Medicago sativa).

The present research project was planned to highlight the adulteration issue persisting among selected medicinal plants marketed in herbal markets of district Lahore, Pakistan. For this sake the whole plan was divided into different phases which were discussed as followed; 3.1: Survey of herbal markets and data collection

Multiple surveys of selected herbal markets (Asghari and Akbari mandi) were arranged during December 2014 to December 2015. Through these surveys data regarding herbal samples sold in herbal markets of Lahore had listed down (Figure 3.1). In order to collect this information total 109 informants were interviewed through a simple questionnaire (Annexture I). Among these informants71 were vendors and 38 were herbalists (Table 3.1). Majority of informers belonged to the age of 48-62 years (46 %), followed by 33-47 years (26 %) then 18-32 years (21 %) and finally above 62 years (7.3 %).

Table 3.1: Category and ages of informants

Category of informants 18-32 33-47 48-62 Above Total no of age age age 62 age informants

Vendors (Male) 15 23 31 2 71

Herbalist (Male) 8 5 19 6 38

Total number of informants 23 28 50 8 109

3.2: Collection of herbal and fresh plant samples

The obtained list of marketed medicinal plants was studied in the light of available literature and it was found that many of these plants possessed the risk of adulteration. Among these medicinal plants eight herbal plants were selected on the basis of insufficient reported data regarding their authenticated identification (taxonomic and molecular) markers. Moreover the samples of these eight plants were also procured from twelve different herbal shops of herbal market by their local or common name and later on their binomial names were resolute by multiple medicinal 25 guides and by well trained herbalists. However the original fresh samples of selected herbal plants were also collected from different locations of Lahore and few one were imported by Lahore nursery (Table 3.2). For identification of fresh plants, all of these fresh samples were morphologically compared with the already available members present in different herbaria (Quaid-e-Azam university, NARC herbarium (National agriculturall research centre) and online available floras i.e. flora of Pakistan (http://www.efloras.org/index.aspx), flora of China and India. (https://sites.google.com/website/efloraofindia/). Each sample was assigned a specific voucher number and submitted to herbarium of Botany department, Lahore College for women university, Lahore.

Figure 3.1: Data collection about marketed herbal samples

Figure 3.2: Cinnamomum verum (Darchini)

Figure 3.3: Cinnamomum tamala (Tezpat) 27

Figure 3.4: Gymnema sylvestre(Gul mundi)

Figure 3.5: Sphaeranthus indicus (Gul mundi)

Figure 3.6: Artemisia maritime (Afsathine)

Figure 3.7: Butea monosperma resin crystals (Kamar kus)

Figure 3.8: Ahatoda vasica

Figure 3.9: Achillea millefolium (Branjasaf) 30

Table 3.2: Collection sites for selected medicinal plants

Plant name Common Voucher Status Flowerin Collection Nursery name number g period site

Cinnamomu Darchini LCWU- Importe Autumn - Lahore m verum 0875 d season nursery

Canella Darchini LCWU- Native Early Botanical Canella winterana 0876 winter or garden of winteran late fall LCWU, a Lahore

Cinnamomu Tezpatta LCWU- Native Autumn P.U - m tamala 0877 season Botanical garden

Cinnamon Tez pa LCWU- Importe Jan- - Lahore obtusifolium 0878 d march nursery

Gymnema Gurmar LCWU- Native Jan- Change - sylvestre boti 0879 march manga forest

Gymnema Gurmar LCWU- Importe Sep - - Lahore lactiferum booti 0880 d october nursery

Sphaeranthu Gul LCWU- Importe Janrch- - Lahore s indicus mundi 0881 d ma nursery

Sphaeranthu Gul LCWU- Importe Oct- - Lahore s africanus mundi 0882 d novembe nursery r

Artemisia Afsantin LCWU- Native Aug- Hilly areas - maritima 0883 Septemb er

Artemisia Vilayati LCWU- Native Aug- Shograh - absinthium afsantin 0884 Septemb er

Butea Forest fire LCWU- Native Decembe Jillani park - monosperma 0885 r to june 31

Averrhoa Kamarkus LCWU- Native Aug- Jinnah - carambola 0886 Septemb garden er

Achillea Biranjasai LCWU- Native Jan- Shograh - millefolium f 0887 march

Ahatoda Malabar LCWU- Native April- Jinnah - vasaka nut, 0888 septembe garden adulsa r

Morus nigra Toot LCWU- Native May to Jallo - siyah 0889 december botanical garden

Morus alba Shahtoot LCWU- Native May- Jinnah - 0890 June garden

3.3: Taxonomic investigation

In taxonomic studies, morphological, anatomical and palynological analysis were performed.

3.3.1: Morphological investigation

The detail morphological investigations of fresh samples were done with the help of binocular microscope (SZF model Kyowa, Japan) under various magnification powers i.e. 5X, 10X, 40X. Various qualitative characters like shape of leaf, color of leaf, venation of leaf, flower and fruit inflorescence type, and quantitative characters like size of leaf blade, height and width of stem, number of veins in leaf were studied. The descriptions of medicinal plant species were also compared by consulting wide range of floras (Nasir & Ali, 1982; Tutin & Heywood, 1972; Hooker & K.C.S.I., 1885; 1894 and Saldanha & Nicolson, 1976).

3.3.2: Leaf epidermal anatomical investigation

The leaf epidermal anatomical slides of field collected plants were prepared according to the method given by Cotton (1974) and Clark (1960) with little modification suggested by Shaheen et al. (2011). Approximately 5-8 leaves of selected samples were placed in test tubes containing 88% lactic acid and kept in boiling water for 15 to 30 minutes or as per sample requirement. Lactic acid was helpful to soften the leaf tissue so that their epidermis peels off easily. Afterwards a small leaf portion was kept on the slide and scratched slightly with the sharp blade. Lactic acid was added drop wise constantly to remove the debris even its epidermis was exposed. Clear epidermal portion was placed on glass slide and covered by a coverslip. Slides of both abaxial and adaxial leaf surfaces were prepared through this method. Various qualitative and quantitative characters were studied like shape of epidermal cells, shape of subsidiary cells, shape and type of trichomes, type of stomata, size of epidermal cells, wall thickness and number of stomata. These characters were helpful for microscopic identification of plant material.

3.2.3 Palynological investigation 33

Palynological characters were examined by employing the modified method of Zafar et al. (2011). For this purpose mature anthers were taken on glass slide and crushed gently with spatula. During this process a drop of acetocarmine was added and debris was removed with the help of camel hair brush. A small amount of glycerine jelly (Ahmad et al., 2003) was placed on crushed anther for staining the pollen and covered the slide. The prepared slides were clearly labeled with tag. Quantitative (pore size, number and length of colpi, P/E ratio, exine and intine thickness) and qualitative characters (shape of pollen, presence or absence of colpi, type of pollen sculpturing) were studied under light as well as scanning electron microscope.

3.3.3: Light Microscopic Photography (LM) Photographs of both leaf epidermal slides (abaxial and adaxial) and pollen slides were taken by light microscope (SZF model Kyowa, Japan) under 40X, 60X and 100X lens.

3.2.5 Scanning Electron Microscopic Photographs (SEM)

Scanning photographs of prepared slides of leaf epidermis and pollen were taken by the SEM (EVO/LS10 model) of Centralized Science Laboratory, LCWU, Lahore.

3.2.6 Organoleptic analysis

The physical characters (color, smell, touch, and taste of marketed samples) were studied by the organoleptic analysis (Sultana et al., 2011).

3.3.1 Solubility analysis

The solubility analysis was performed by employing the technique of Sultana et al. (2011). For this purpose powdered samples were poured in selected amount (20ml) of acids i.e. sulphuric acid, hydrochloric acid, acetic acid as well as in water. Each test tube with acid and powdered sample was gently shaked and their solubility was examined in both cold and hot state. The solubility of powdered samples and color retention in these solvents was noted (Figure 3.10-3.13).

Figure 3.10: Soulibilty analysis in sulphuric acid

Figure 3.11: Soulibilty analysis in hydrochloric acid 35

Figure 3.12: Soulibilty analysis in Acetic acid

Figure 3.13: Soulibilty analysis in water

3.4: DNA barcoding

DNA analysis is considered more sensitive and accurate method to detect the adulteration. DNA analysis of selected plant specimens was done to find out the adulteration persisted among them.

3.4.1 Preparation of Stock solutions of DNA extraction

The stock solutions of DNA extraction were prepared by following described reciepes and later on stored at room temperature.

a) 1M Tris HCl (pH:8)

1M Tris HCl was made by dissolving the 60.57g of Tris HCl in 500 ml of double distilled water and concentrated HCl was added drop wise into it to adjust the pH.

b) 0.5M EDTA (pH:8)

0.5M EDTA was prepared by dissolving the 93.06gm EDTA in small amount of distilled water and raised the final volume up to 500ml and pH was adjusted by NaOH pellets.

c) 5M NaCl

5M NaCl was prepared by dissolving the 146.1gm NaCl in the small amount of double distilled water and raised its volume up to 500ml and the solution was autoclaved.

d) 7.5M Ammonium acetate

7.5M Ammonium acetate solution was prepared by dissolving the 57.81gm Ammonium acetate in small amount of double distilled water and final volume was raised up to 100ml (Table 3.2).

Table 3.2: Stock solution preparation

Chemical M.W/g 100ml 200ml 250ml 500ml 1000ml

1M Tris 121.14 12.114 24.228 30.285 60.57 121.14

HCl (pH:8) 37

0.5M EDTA (pH:8) 372.24 18.612 37.224 46.53 93.06 186.12

5M NaCl 58.44 29.22 58.44 73.05 146.1 291.2

7.5M Ammonium 77.08 57.81 115.62 144.525 289.05 578.1 acetate

3.4.2: Preparation of DNA extraction solution from the Stock solutions

Following solutions were prepared from the stock solution.

a) Preparation of 2X CTAB buffer (Resuspension buffer)

2% CTAB solution was prepared by taking 20g of cetyl trimethyl ammonium bromide, 100ml of 100mM Tris HCl (1M), 40ml 0f 20mM EDTA (5M) and 280 ml of 1.4M NaCl from stock solutions (5M). They were dissolved in small quantity of double distilled water and final volume was raised up to 1000ml by distilled water. Later on this solution was autoclaved and stored at room temperature. For plant DNA extraction 20µl of β marcaptoethanol was also added for each 10ml of CTAB buffer (Table 3).

Table 3.3: 2X CTAB buffer (Resuspension buffer)

Chemical 50ml 100ml 200ml 250ml 500ml 1000ml

2% CTAB 1g 2g 4g 5g 10g 20g

100mM Tris HCl (Stock 5ml 10ml 20ml 25ml 50ml 100 1M)

20mM EDTA (stock 0.5M) 2ml 4ml 8ml 10ml 20ml 40

1.4 M NaCl (Stock 5M) 14ml 28ml 56ml 70ml 140ml 280

38 b) Preparation of washing buffer

500 ml of washing buffer was prepared by taking 380ml of 76% ethanol and 667µl of ammonium acetate from above stock solutions(7.5M) and dissolved in small amount of distilled water and raised the final volume till 500ml (Table 3.4).

Table 3.4: Preparation of washing buffer

Chemical 50ml 100ml 200ml 250ml 500ml 1L

76% ethanol 38ml 76ml 152ml 190ml 380ml 760ml

10mM Ammonium 0.067 0.133 0.267 0.333 0.667 1.333 acetate (Stock 7.5M) ml/ ml/ ml/ ml/ ml/ ml/

67 µl 1.33 µl 2.67 µl 333 µl 667 µl 1333 µl

c) Preparation of TE buffer

250ml of TE buffer was prepared by taking, 2.5ml of 10mM Tris HCl (Stock 1M) and 500 µl of 1m EDTA. Both of these were dissolved in small quantity of double distilled water and final volume was raised up to 500ml. This solution was autoclaved and after its cooling it was stored at -20oC for future use (Table 3.5).

Table 3.5: Preparation of TE buffer

Chemical 50ml 100ml 200ml 250ml 500ml 1L

10mM Tris HCl 0.5ml 1ml 2ml 2.5ml 5ml 10ml (Stock1M)

1mM EDTA 0.1ml/ 0.2ml/ 0.4ml/ 0.5ml/ 1ml/ 2ml/

100 µl 200 µl 400 µl 500 µl 1000 200 µl µl

3.4.3 DNA extraction from plant material

DNA extraction was done by following the method of Doyle and Doyle 1990. For extraction of genomic DNA, 1gm of each plant sample was weighed and crushed in the sterile ice cooled pestle and mortar and 750µl of CTAB and β marcaptoethanol (10ml CTAB: 20 µl β marcaptoethanol) were added into it. This slurry was transferred to the eppendorf and again 750µl CTAB was added and incubated for 30- 45 minutes. 750µl of Chloroform and isoamylalcohol (24:1) solution was added to this eppendorf and centrifuged for 15 minutes at 10,000rpm. Later on Supernatant was removed into the separate eppendorf and 750µl of chloroform and isoamylalcohol solution was added into it. This was centrifuged again at the 10,000 rpm for 15 minutes. . This step was repeated thrice and clear supernatant was collected in another eppendorf. After that 2/3part of isopropanol was added to the each eppendorf having the supernatant, DNA strands became visible in minute thread like form and these eppendroff left overnight in the freezer at -20C. This treatment was done in order to make DNA treads denser and settled. Next day these eppendorf were centrifuged at 10,000 rpm until the DNA threads were settle down in the form of pellet. The supernatant was Discarded and pellet was kept safe. The pallet was washed with 200 µl of washing buffer and this process was repeated three times. The pallet was allowed to dry and re-suspend in 50 µl of TE buffer.

3.4.4 DNA analysis techniques

For confirmation of plant DNA samples, two methods were used. a) Agarose gel electrophoresis

Gel electrophoresis technique was helpful for the confirmation of plant DNA. 1% agarose gel was formed in 0.5X TAE buffer [0.5 mM EDTA and 20mM Tris-acetate pH8.0]. For this purpose 1.5 grams of agarose powder was measured and added into the 150ml of TAE buffer (0.5X) in 250ml of flask. Two minutes boiling treatment was given to this content in microwave oven until the solution become transparent. This solution was allowed to cool down up to 60ᵒC. Afterward 6µL (0.5 µg/mL) of ethidium bromide was poured into the liquid gel. Two combs of appropriare sizes were adjusted in tray and gel was poured. Then it was allowed to solidify and gel tray was dipped in gel electrophoresis tank containing TAE buffer (0.5X). After that combs were carefully taken out. For loading the samples into gel, 5 µL of gel samples 40 and 2 µL of loading dye (5X) were thorogly mixed and loaded alongwith ladder of 1kb (Thermo Fisher Scietific, USA). The gel was electrophoresed for 30 minutes at voltage of 100 volts and observed under UV illuminator in Gel Documentation system (Biored, USA) and photographs were captured by attached system. Appearance of bands in the gel confirmed the DNA presence in the samples. b) DNA Quantification

The concentration and purity of DNA was confirmed by NanoDrop (Thermo Scientific, Wilmington, USA) at 260/280 absorbance. TE buffer was used as a blank and absorbance were recorded at 260/280nm.

3.4.5 Amplification of DNA

After the confirmation of DNA, these DNA samples were amplified through PCR. a) DNA dilutions

Various dilutions of extracted genomic DNA were prepared according to the equation.

M1V1= M2V2.

All the dilutions were prepared in the double distilled water. b) Polymerase chain reaction (PCR)

PCR is very efficient technique to amplify the particular gene region of plant DNA by using master mix and selected primers in appropriate way. The PCR of plant DNA samples were planned in the presence of suitable primers i.e., matK, rbcL, nrITS and trnH-psbA, (Sudmoon et al., 2014). These primers were selected through literature review and their sequences were enlisted (Table 3.6).

Table 3.6: Short oligonucleotide primers

Barcode Primer Primer sequence Reference

matK F 5′‐TAATTTACGATCAATTCATTC‐3′ Ford et al. matK (2009) matK R 5′‐CTTCCTCTGTAAAGAATTC‐3′ rbcL rbcL F 5′‐ATGTCACCACAAACAGAAAC‐3′ Asmussen 41

rbcL R 5′‐TCG CAT GTA CCY GCA GTT GC‐3′ and Chase, (2001)

nrITS F 5′‐CCTTATCATTTAGAGGAAGGAG‐3′ Stanford et nrITS al. (2000) nrITS R 5′‐GGAAGTAAAAGTCGTAACAAG‐3′

trnH-psbA F 5′‐GTTATGCATGAACGTAATGCTC‐3′ Tate (2002) trnH-psbA trnH-psbA R 5′-CGCGCATGGTGGATTCACAAATC‐ 3′

Sang et al. TrnH TrnH F 5′-CGCGCATGGTGGATTCACAATCC‐ (1997) 3′

TrnH R 5′-GTTATGCATGAACGTAATGCTC-3′

Tate and PsbA PsbA F 5′‐ TGCCATTATTCCTACTTCTGCA‐3′ simpson (2003) PsbA R 5′‐AGCACTAAAAAGGGAGCCG‐3′

Morgan Co1 Co1 F 5′‐TTTTTTGGGCATCCTGAGGTTTAT‐ and Blair 3′ (1998)

Co1 R 5′‐TCATGAAAACACCTTAATACC‐3′

Per reaction volume of 25µL was prepared according to the following recipe. PCR tubes containing reaction mixture were placed in PCR thermo cycler. The PCR profile was adjusted on machine at the temperature of 94ᵒC, an initial denaturation temperature for 5 minutes, annealing for 1 minute at 52ᵒC, extension for 1 minute at 72ᵒC and the final extension was done for 10 minutes at 72ᵒC. These temperatures were repeated for 40 cycles. Each PCR product (5µL) was mixed with 3µL of loading dye (5X) and it was allowed to run on 1%agarose gel for the confirmation of DNA amplification.(Table 3.7) 42

Table 3.7: PCR reagents for each reaction

PCR Reagents For 25µl reaction

25mM MgCl2 3µl

Taq Buffer 2.5 µl

2mM dNTPs 2.5 µl

Double distill H2O 9.2 µl

10µM Forward primer 2.5 µl

10µM Reverse primer 2.5µl

Taq DNA Polymerase 0.3 µl

Template DNA 2.5 µl

3.4.5: Purification of DNA

After the DNA amplification, it was necessary to purify the plant DNA product. This purification was achieved by the following technique. a) Phenol chloroform purification of DNA

For DNA purification sterile distilled water was taken into the eppendorf containing DNA and total volume of 100µL was obtained. A mixture of phenol: chloroform (100µL) was also added to same appendroff in equal quantity and thorogly mixed by inverting it. These eppendorf were centrifuged for 6 minutes at 14,000 rpm and the top aqueous phase of solution was taken into new tube. Then 9 µL of 3M sodium acetate solution (1/10th volume, pH 5.2) and 250µL of absolute ethanol (2.5 volume) were also added in eppendorf and left for 30 minutes on -20ᵒC. Later on 43 these tubes were centrifuged at 14,000rpm for 10 mints to precipitate the DNA and the ethanol was removed. Then washed the DNA pellet by100µL of ethanol (70%), centrifuged at 14,000rpm for 2 minutes and the ethanol was removed. DNA Pellet was allowed to dry and then dissolved in 20µL of sterile dilled water (SDW). To confirm purification of DNA, 4µL of DNA solution was loaded on 1% agarose gel followed the method mentioned as above. b) Sequencing of PCR product and result analysis

Purified PCR products were sent to the “Molecular biology product” for the sequencing and obtained results were comparatively analyzed.

3.4.6: Application of biostatical tools

Multiple bio statistical tools i.e. basic local alignment search tool (BLAST) were applied to find out closely related sequence of plant sequence results.. (Newmaster et al., 2013). Moreover clean sequenced results of each primer were analysed by using MEGA 6.0. The phylogenetic trees were constructed by using neighbour joining metheod. Bootstrap testing of 1000 replicates was performed to estimate the confidence level of the topology of the consensus tree.

4.1a: Cinnamomum verum Presl. vs Canella winterana (L.) Gaertn.

Characters Cinnamomum verum Canella winterana

Nomenclature English name: Darchini English name: Darchini

Trade name: Darchini Trade name: Darchini

Local name: Darchini Local name: Darchini

Worldwide Native to srilanka, cultivated in many countries of Asia and United states, west india, America, florida and Caribbean distribution Tiwan

Habitat or Cultivated habitat, forest and wetland Found commonly in calcareous soils or on limestone Occurrence

Morphology Small evergreen tree, 16m tall, bark brownish black, stem Tree 25-30 feet high, sometime 50 feet, trunk diameter 10 diameter 20 inches, young branches gray, buds puberulent, inches, branches compact, slender, horizontal, round headed at leaves opposite, petiole glabrous, 2 cm thick, leaf greenish top. Bark brown, 18 inches thick. Broken in short thick white abaxially, shiny green adaxially, leaf ovate to fragments, Inner bark aromatic. Leaves round, obovate, lanceolate, leathery, both surfaces glabrous, elevated lateral slightly emerginate and Leaf blade 5.5-15 × 2.5-5 cm long, veins and midrib, reticulate veinlets, base acute, entire rounded or blunt apex, pellucid dotted abaxial surface. Petiole margins, apex acuminate. Panicle 10-12 cm, axillary or grooved, flower diameter 7-10 mm. Short pedicels. Sepals 2- sometime terminal, rachis and peduncle puberulent. Flower 3mm, fleshy, green. Petals dark red to magenta, 4-6mm, 45

6mm, yellow, perianth tube, 6 lobes, unequal, oblong, gray fleshy, thick. Anther light red color, yellow at dehiscence, from outside, 9 stamen fertile, hairy filament near base, 2 ovary superior with one locule, seeds black 1-5mm. glands in 3rd whorls, other whorls glandless, 4 celled anther, ovary 10-15mm ovoid, glabrous, short style, discoid stigma, fruit 10-15cm, ovoid, black at maturity, in fruit cup shape parianth, dentate, dilated, acute at apex.

Leaf Abaxial surface: length of epidermal cells 80.4(75-85.8) Abaxial surface: length of epidermal cell 40.5(35-46) µm, Anatomy µm, width of epidermal cells 21.5(18.5-.24.5) µm, length of width of epidermal cell 38.6(35.2-42) µm, length of guard cell guard cells 30.7µm, width of guard cells 23.5µm, size of 24.3µm, width of guard cell 14.4µm, size of stomatal stomatal aperture 10.1 µm stomata type anomocytic, aperature 7.6 µm, type of stomata paracytic Shape of subsidiary cells 4. Shape of epidermal cells irregular epidermal cells pentagonal, isodiametric.

Adaxial surface: shape of Epidermal cells irregular, length Adaxail surface: length of epidermal cell 41.9(40.5-43.3) µm, of epidermal cells 80.1(75.7-84.5) µm, width of epidermal width of epidermal cell 37.8(35-40.6) µm, length of guard cell cells 18.4(17.7-19.1) µm, stomata absent at abaxial surface. 24.9 µm, width of guard cell 10.7 µm, size of stomatal

aperature 7.9 µm, type of stomata was paracytic, number of subsidiary cell 3, Shape of epidermal cells pentagonal, isodiametric.

Palynology Pollens in Monads, Pollen size in polar view 30(25-35) µm, Pollen in monads, moderate size 36.5(35-38)µm, Pollen size pollen size in equatorial view 28(23-33) µm, P/E ratio 1.07, in polar view 39(35-43)µm, pollen size in shorter diameter inaperturate, 1.2µm exine thickness, 1.0 intine thickness, 33(31-35) µm, long and distal aperture, exine tectate and 1.1 46

exine ornamentation spinate, reticulate, loose reticulum µm thickness, intine thickness 1.3 µm inter specific with muri that made up of thick accumulation of verruci, differences 0.7 µm, shape of pollen sun-spheroidal, glandular, spines appeared from either muri or lumina. pollen shape reticulate and pollen fertility 79%. spheroidal, inter specific differences 0.5µm and pollen fertility 89%.

Organoleptic Strongly aromatic. Less aromatic. analysis

Solubility The obtained results of solubility analysis were presented in Table no. 4.1f. analysis

Part traded Bark. Bark.

Medicinal Treating cough, stomache, flatulence. Curing headache, digestive disorder, fumitory, rheumatism, importance liver disorder, stimulant and as a tonic.

Herbal Powder bark is taken along with the honey to cure cough Crushed leaves are effective in toothaches by applying on recipes and dysentery, small piece of bark was boiled in water and effected tooth. Whereas leaf and bark tonic was medically taken as medicine. effected in female tiredness 47

Cinnamomum verum Presl. Canella winterana (L.)

Gaertn.

Plate 4.1a: Light green Plate 4.1b: Dark green leaves with 3 mid ribs leaves with single mid ribs

Plate 4.1c: Anomocytic type Plate 4.1d: Paracytic type of of stomata (LM) stomata (LM)

Plate 4.1e: Anomocytic type of Plate 4.1f: Paracytic type of stomata (SEM) stomata (SEM)

Plate 1g: Spheroidal pollen Plate 1h: Sub-spheroidal pllen (LM) shape (LM)

Plate 1i: Pollen sculpturing Plate 1j: Subspheroidal Pollen (SEM) (SEM)

Table 4.1a: Qualitative morphological comparison of Cinnamomum verum and Canella winterana

Characters Cinnamomum verum Canella winterana

Habit of plant Evergreen tree Large shrub

Stem/Bark Round, Tall & Brownish black bark Slender, horizontal & Light grey

Inflorescence Axillary panicles Determinate panicles/ terminal

Phyllotaxis Opposite Alternate clusters

Leaf shape Ovate or lanceolate Round, obovate

Leaf color Shiny greenish Dark green

Leaf venation Reticulate Tertiary venation conspicuously reticulate

Flower Yellow incospicious Red, actinomorphic

Sepal Perianth unequal, dentated, tube Sepals flashy, green, petals shape dark red to magenta, thick fleshy

Petal Absent Petal united in tube like structure

Anther Stamen fertile, Numerous stamens in staminal column

Carpel Ovary glabrous , short style Superior ovary 1 locule

Fruit Small drupe Crimson, fleshy, soft berry

Table 4.1b: Quantitative morphological comparison between Cinnamomum verum and Canella winterana

Characters Cinnamomum verum Canella winterana

Height of plant 16m 25-30 feets sometime 50 feets

Diameter of stem 20inches 10inches

Petiole 2cm 1.5cm

Leaf length 8.5-16cm 5.5- 15cm

Width of leaf 3.5-5cm 2.5-5cm

Flower 6mm 10-15mm

Sepal Perianth, 8mm 2-3mm

Petal Absent 4-6mm

Anther 9, 4 celled anther 6-12 anthers

Ovary 10-15mm 6 carpel, 5-8mm

Fruits 1-1.5cm long 1-5mm

Table 4.1c: Qualitative leaf epidermal anatomical comparison between Cinnamomum verum and Canella winterana

Characters Adaxial surface Abaxial surface

Cinnamomum Canella Cinnamomum verum Canella

verum winterana winterana

Shape of Irregular pentagonal Irregular Pentagonal epidermal cell

Shape of - Polygonal Irregular with deep Polygonal subsidiary cells undulating margins r

Stomata type - Paracytic Anomocytic Paracytic

Possibility of Absent Absent Present Absent trichome

Nature of - - Short, unicellular - trichome

Table 4.1d: Quantative leaf epidermal anatomyical comparison between Cinnamomum verum and Canella winterana

Characters Adaxial surface Abaxial surface

Cinnamomum Canella Cinnamomum Canella verum winterana verum winterana

Length of 80.1 41.9 80.4 40.5 epidermal cells (µm)

Width of 18.4 37.8 21.5 38.6 epidermal cells (µm)

Size of stomatal - 7.9 10.1 7.6 aperture (µm)

Length of guard - 24.9 30.7 24.3 cells (µm)

Width of guard - 10.7 23.5 14.4 cells (µm)

Table 4.1e: Qualitative and quantitative palynological comparison between Cinnamomum verum and Canella winterana

Cinnnerumamomum Canella Characters verum winterana

Sub- Pollen shape Sphaeroidal sphaeroidal

Pollen polar length (µm) 30 39

Pollen Equitorial length (µm) 28 35

P/E ratio 1.07 1.08

Exine thickness (µm) 2.1 1.1

Intine thickness (µm) 1 2.7

Colpi length (µm) - -

Inter specific difference (µm) 0.5 0.7

Pollen fertility % 89 74

Table 4.1f: Solubility analysis of different samples of Cinnamomum verum in various solvents

Plant name Solubility in Color of Solubility in HCl Color of Solubility in Color of Solubility in Water Color H2SO4 sample sample Acetic acid sample of sample Cold test Hot After Cold test Hot test After Cold test Hot test After Cold test Hot test After test boiling boiling boiling boiling Sample 1 Partially Soluble Dark Insoluble Insoluble Golden Insoluble Insoluble Desert Insoluble Insoluble Molten Soluble brown brown dawn bronz Sample 2 Partially Soluble Blackish Insoluble Insoluble Golden Insoluble Insoluble Desert Insoluble Insoluble Roof soluble brown brown dawn tile Sample 3 Partially Soluble Dark Insoluble Insoluble Red oxide Insoluble Insoluble Desert Insoluble Insoluble Golden Soluble brown dawn brown Sample 4 Partially Soluble Brown Insoluble Insoluble Red oxide Insoluble Insoluble Desert Insoluble Insoluble Molten Soluble dawn bronze Sample 5 Partially Soluble Blackish Insoluble Insoluble Golden Insoluble Insoluble Desert Insoluble Insoluble Desert soluble brown brown dawn dawn

Sample 6 Partially Soluble Blackish Insoluble Insoluble Panzer Insoluble Insoluble Desert Insoluble Insoluble Molten soluble brown gray dawn bronze Sample 7 Partially Soluble Dark Insoluble Insoluble Panzer Insoluble Insoluble Desert Insoluble Insoluble Golden soluble brown gray dawn brown Sample 8 Partially Soluble Blackish Insoluble Insoluble Terracotta Insoluble Insoluble Desert Insoluble Insoluble Molten soluble brown dawn bronze Sample 9 Partially Soluble Dark Insoluble Insoluble Roof tile Insoluble Insoluble Desert Insoluble Insoluble Molten soluble brown dawn bronze Sample 10 Partially Soluble Blackish Insoluble Insoluble Roof tile Insoluble Insoluble Desert Insoluble Insoluble Molten soluble brown dawn bronze Samp le 11 Partially Soluble Blackish Insoluble Insoluble Roof tile Insoluble Insoluble Eau de Insoluble Insoluble Molten soluble brown nil bronz Sample 12 Partially Soluble Blackish Insoluble Insoluble Roof tile Insoluble Insoluble Cameo Insoluble Insoluble Molten soluble brown bronze

Figure 4.1a: Quantative morphological comparison between Cinnamomum verum and Canella winterana

Figure 4.1b: Quantative leaf epidermal anatomy comparison between Cinnamomum verum and Canella winterana 56

Figure 4.1c: Quantitative palynological comparison between Cinnamomum verum and Canella winterana

4.2a: Cinnamomum tamala (Buch.-Ham.) T.Nees & Eberm. vs Cinnamomum obtusifolium (Roxb.) Nees

Characters Cinnamomum tamala Cinnamomum obtusifolium

Nomenclature English name: Indian bay leaf English name: Indian Cassia

Trade name: Tezpatta Trade name: Tezpatta

Local name: Tez pat Local name: Tezpat

Worldwide Native to india, Assam, Nepal, Burma and Sri-lanka Asia, Oceania, Australia, North south and central America, Burma, distribution Nepal and Himalayas mountain

Moist places and tropical sunshine Habitat or Found in forests and planted in gardens Occurrence

Morphology Medium sized evergreen tree, bark and foliage Large tree 5-25m tall, grey or brownish white bark, turning dark aromatic, height about 10m tall, leaves alternate or brown color on exposure, bark 0.75inch thick, rough, blaze aromatic. spirally arrange, mature leaves glabrous, oblong to Leaves 6.5-12 cm long, 1.4-3.5 cm wide, obtuse, elliptic, oblong, lanceolate, leaf upper surface smooth, base acute, main acute to acuminate, glabrous, sometimes leaves glaucous on lower nerve prominulous, obscurely from below, densely surface, very coriaceous, beneath reticulate venation. Petiole 0.5-0.8cm reticulate, midrib prominent, cylinder, lamina length long, Stout. Large panicles, long peduncle, usually sub terminal 58

is 4/5, connected by parallel, faint secondary veins, exceeding the leaves, very minutely pubescent, glabrate with maturity. petiole 1.5 m long and cylinderical, panicles slender, Branchs persistenly pubescent. Pedicel short, 0.5 cm long, hairy, silky pseudoterminal or axillary, flowers many, about 10cm pubescence. parianth 0.26 inches across. Silky lobes on both the long, pedicels 4-8mm long, filiform. surfaces. Stamens and carpel pubescent. Fruit persistent, 0.8-1.3 inches long, ovate or elliptic, grow on large parianth.

Leaf Anatomy Abaxial surface: Shape of epidermal cells tetragonal Abaxial surface: Shape of epidermal cells irregular with highly length of epidermal cell 53.9(50.5-57.3) µm, width of undulatating walls, length of epidermal cell 48.5(47-50) µm, width of epidermal cell 42.4(40-44.8) µm, length of guard cell epidermal cell 32.4(30.5-34.3) µm, length of guard cell 19.7 µm, width 35.3 µm, width of guard cell 21.8 µm, size of stomatal of guard cell 13.8 µm, size of stomatal aperature 9.7 µm, type of aperature 17.2 µm, type of stomata anomocytic. stomata anomocytic, number of subsidiary cell 4-5 . .

Glabrous trichome, no of subsidiary 4, cells Adbxial surface: Shape of epidermal cells irregular, length of extraordinary epidermal deposition. epidermal cell 47.1(45-49.2) µm, width of epidermal cell 34.5(33.1- Adaxial surface: Shape of epidermal cells tetragonal 35.9) µm, length of guard cell 19.6 µm, width of guard cell 12.7 µm, length of epidermal cell 52.6(50-55.2) µm, width of size of stomatal aperature 10.3 µm, type of stomata anomocytic. epidermal cell 41.7(40-43.4) µm, stomata absent at adaxial surface.

Palynology Pollen grains monad, multiple aperture, aperture type Pollen grains monad, inaperturate, exine ornamentation spinate and porate, echinate, pollen tectum was eutectate, Pollen circular hold, Pollen size in polar view 34(30-38) µm, size of pollen in size in polar view 30 (29-31)µm, size of pollen in shorter diameter 26(24-28) µm, exine thicknesss 1.2µm, intine shorter diameter 27(25-29) µm, P/E ratio 1.11, shape thickness 1.1µm, spine tip rounded, interspinal area show ridges, it 59

of pollen round, exine thickness 1.0 µm, intine covered by micro-verruci, polen shape sub spheroidal, interspecific thickness 0.9 µm, interspecific differences 0.4, pollen difference 0.3, pollen fertility 85% fertility 90%

Organoleptic Sweet and pungent smell Pungent smell analysis

Solubility The obtained results of solubility analysis were presented in Table no. 4.2f. analysis

Part traded Leaves Leaves

Medicinal Anti-flatulent, diuretic, carminative, treatment of Cure digestive disorder, inflammation, rheumatism, importance diarrhea, colic pain, nausea, dryness of mouth, bladder disorder

Herbal Leave are widely used in Ayurveda preparation. Improve insulin sensitivity and reduce blood glucose level. recepies Leaves decoction is used to treat the cancer.

Cinnamomum tamala Cinnamomum (Buch.-Ham.) T.Nees& obtusifolium (Roxb.)

Eberm. Nees

Plate 2a: Alternate leaves Plate 2b: Oblong to acute leaves

Plate 2c: Anomocytic type of Plate 2d: Paracytic type of stomata (LM) stomata (LM)

Plate 2e: Anomocytic type of Plate 2f: Paracytic type of stomata (SEM) stomata SEM)

Plate 2g: round shape of pollen Plate 2h: sub-spheroidal pollen (LM shape (LM)

Plate 2i: Porate aperture type Plate 2j: Spinate surface (SEM) ornamentation of Pollen (SEM)

Table 4.2a: Qualitative morphological comparison between Cinnamomum tamala and Cinnamon obtusifolium

Characters Cinnamomum tamala Cinnamon obtusifolium

Habit of plant Medium sized tree Large tree

Stem/Bark Irregular & Dark grey aromatic Grey or brownish white bark, inflorescence Terminal or axillary Panicle, pseudoterminal

Phyllotaxis Alternate or spirally arranged Opposite, subopposite or alternate

Leaf shape Oblong to lanceolate Obtuse, elliptic, acute to acuminate

Leaf color Glabrous Minutely pubescent

Leaf venation Densely reticulate Triplinerved, unequal

Flower Many axillary filiform Axillary, panicles, bisexual

Sepal Parianth, 3+3 sub equal, eliptic, ovate Parianth deciduous/ persistant, white green or sometime yellow

Petal Absent Absent

Anther 9 numerous stamens in 3 whorls Anther 4 locular

Carpel Filiform, unilocular Ovoid to ellipsoid

Fruit Drupe black fleshy Drupe, bulish black

Table 4.2b: Quantitative morphological comparison between Cinnamomum tamala and Cinnamon obtusifolium

Characters Cinnamomum tamala Cinnamon obtusifolium

Height of plant 10m 5-25m

Diameter of stem 30cm 30cm

Petiole 0.5-1.3cm 1.4-3.5cm

Leaf length 5-7.5cm 5-12cmlong,

Width of leaf 3-5cm 4-7cm

Flower 10cm 6mm

Sepal Parianth 4 mm Parianth 6.6 mm

Petal Absent Absent

Anther 3.8mm 3.5mm

Ovary 1.2mm 1.5mm

Fruits 10-14mm 0.8-1.3cm

Table 4.2c: Qualitative leaf epidermal anatomical comparison between Cinnamomum tamala and Cinnamomun obtusifolium

Characters Adaxial surface Abaxial surface

Cinnamomum Cinnamomum Cinnamomu Cinnamomum tamala obtusifolium m tamala obtusifolium

Shape of Tetragonal Irregular Tetragonal Irregular epidermal cell

Shape of Polygonal with Polygonal with Irregular Polygonal with subsidiary cells irregular undulating undulating margins margins margins

Stomata type Absent Anomocytic Anomocytic Anomocytic

Possibility of Present Absent Present Absent trichome

Nature of Glabrous - Glabrous - trichomes

Table 4.2d: Quantitative leaf epidermal anatomical comparison between Cinnamomum tamala and Cinnamon obtusifolium

Characters Adaxial surface Abaxial surface

Cinnamomu Cinnamomum Cinnamomum Cinnamomum m tamala obtusifolium tamala obtusifolium

Length of 52.6 47.1 53..9 48.5 epidermal cells (µm)

Width of 41.7 34.5 42.4 32.4 epidermal cells (µm)

Size of stomatal - 10.3 17.2 9.7 aperture (µm)

Length of guard - 19.6 35.3 19.7 cells (µm)

Width of guard - 12.7 21.8 13.8 cells (µm)

Table 4.2e: Quantitative and qualitative palynological comparison between Cinnamomum tamala and Cinnamon obtusifolium

Cinnamomum Cinnamomum Characters tamala obtusifolium

Pollen shape Round Sub-spheriodal

Pollen polar length (µm) 30 34

Pollen Equitorial length (µm) 24 29

P/E ratio 1.11 1.3

Exine thickness (µm) 1 1.2

Intine thickness (µm) 0.9 1.1

Colpi length (µm) - -

Inter specific difference (µm) 0.4 0.3

Pollen fertility % 90 81

Table 4.2f: Solubility analysis of different samples of Cinnamomum tamala in various solvents

Plant name Solubility in Color of Solubility in HCl Color of Solubility in Color of Solubility in Water Color of H2SO4 sample sample Acetic acid sample sample

Cold test Hot test After Cold test Hot test After Cold test Hot test After Cold test Hot test After boiling boiling boiling boiling Sample 1 Partially Soluble Dark Insoluble Insoluble Dark Insoluble Insoluble Avocado Insoluble Insoluble Pale Soluble brown brown cream Sample 2 Partially Soluble Dark Insoluble Insoluble Sedona Insoluble Insoluble Golden Insoluble Insoluble Tangerine Soluble brown brown juice Sample 3 Partially Soluble Dark Insoluble Insoluble Green Insoluble Insoluble Primrose Insoluble Insoluble Tangerine Soluble brown drab juice Sample 4 Partially Soluble Dark Insoluble Insoluble Brown Insoluble Insoluble Avocado Insoluble Insoluble Molten Soluble brown bronze Sample 5 Partially Soluble Blackish Insoluble Insoluble Military Insoluble Insoluble Primrose Insoluble Insoluble Pale Soluble brown brown cream Sample 6 Partially Soluble Blackish Insoluble Insoluble Afrika Insoluble Insoluble Avocado Insoluble Insoluble Mehndi soluble brown mustard Sample 7 Partially Soluble Reddish Insoluble Insoluble Leather Insoluble Insoluble avocado Insoluble Insoluble Golden soluble brown yellow Sample 8 Partially Soluble Dark Insoluble Insoluble Avocado Insoluble Insoluble Avocado Insoluble Insoluble Pale soluble brown cream Sample 9 Partially Soluble Reddish Insoluble Insoluble Avocado Insoluble Insoluble Golden Insoluble Insoluble Random soluble brown brown tan Sample 10 Partially Soluble Flat Insoluble Insoluble Avocado Insoluble Insoluble Avocado Insoluble Insoluble Butter soluble black crime Sample 11 Partially Soluble Flat Insoluble Insoluble Avocado Insoluble Insoluble Golden Insoluble Insoluble Random soluble black brown tan Sample 12 Partially Soluble Flat Insoluble Insoluble Avocado Insoluble Insoluble Golden Insoluble Insoluble Random soluble black brown tan 68

Figure 4.2a: Quantitative morphological comparison between Cinnamomum tamala and Cinnamon obtusifolium

Figure 4.2b: Quantitative leaf epidermal anatomy comparison between Cinnamomum tamala and Cinnamon obtusifolium

Figure 4.2c: Quantitative palynological comparison between Cinnamomum tamala and Cinnamon obtusifolium

4.3a: Gymnema sylvestre (Retz.) R.Br. ex Sm. vs Gymnema lactiferum (L.) R.Br. ex Schult.

Characters Gymnema sylvestre Gymnema lactiferums

Nomenclature English name: Sugar destroyer English name: Cylon cow plant Trade name: Gurmar boti Trade name: Gurmar boti Local name: Gurmar boti Local name: Gurmar boti Worldwide Tiwan, yumman, Indonesia, India, , Japan, Srilanka, India, sri lanka, Malaysia, Assam and Malay peninsula distribution Malaysia and Africa Habitat or Tropical forest, Changa manga forest and Chitral Dry evergreen or dry deciduous forest Occurrence national park Morphology Stem sparsely lenticellate, 8m tall, pubescent Woody tree 10-12m tall, twining, young plant parts tomentose to branchlets. Petiole 3-12mm, obovate to ovate leaf puberlous, 0.5-1.5cm long petiole, leaf glabrous, leaf blade 8cm long, blade, 1-9.5cm × 0.5-5.5cm, thick papery, adaxially 4cm wide, inflorescence cymes umbel like, flower 10-12mm, 0.4-0.5cm pubescent to glabrous except midrib, leaf glabrous corolla. Merocaps glabrous, 5-7cm long, and 2cm diameter. except veins, 4 to 5 pairs of lateral vein, cymes shorter than leaves, peduncle 2-5mm, pubescent, closely spaced spiral pedicel, scars on rachis, sepals ovate, ciliated. Greenish white corolla, glabrous, ovate, lobes. Stigma head exserted. Solitary follicle, broadly lanceollate. Glabrous, seed ovate. Leaf Anatomy Abaxial surface: Shape of epidermal cells cubical to Abaxial surface: Shape of epidermal cells irregular length of epidermal 71

rectangular, length of epidermal cell 46.7(45- cell 38.9(35-42.8) µm, width of epidermal cell 29.2(27-31.4) µm, length 48.4)µm, width of epidermal cell 31.4(29.5-33.3)µm, of guard cell 22.5 µm, width of guard cell 17.1 µm, size of stomatal length of guard cell 20.9 µm, width of guard cell 14.1 aperature 14.8 µm, and type of stomata cyclocytic. Shape of epidermal µm, size of stomatal aperture 12.1 µm, stomatal type cells irregular and thick walled, rosette calcium oxalate crystals, thick anomocytic, trichome uniseriate and multicellular, walled multicellular insert trichomes present rosette calcim oxalate crystals Adaxial surface: length of epidermal cell 40.0(35-45) µm, width of Adaxial surface: length of epidermal cell 45.8(40.5- epidermal cell 29.3(25-33.6) µm, Shape of epidermal cells irregular, no 51.1) µm, width of epidermal cell 32.7(30.4-35) µm, stomata present on upper surface. Shape of epidermal cells tetragonal, surface glabrous, septate trichomes, stomata absent on upper epidermis, Palynology Spheroidal pollens, amb rounded, Pollen size in polar Pollen shape circular, Pollen size in polar view 32(28-36)µm, pollen view 27.9(23.5-32.5)µm pollen equatorial diameter diameter in equatorial view 28.5(25.5-31.5)µm, exine thickness 1.1 µm, 23(21-25)µm, costate, aperture trizonoporate, circular intine thickness 0.9µm, tricolporate, narrow colpi, length of colpi 1.4 µm, pori with diameter of 7.9µm, annulus 1.6µm. Exine reticulate sculpturing, intraspecific difference 0.5µm and pollen fertility thickness 1.3µm, intine thickness 1.0µm distinct the 81% sexine and nexine, colpi length 2.8µm, interspecific difference 0.75 µm sculpturing reticulate, pollen fertility 92%. Organoleptic Powder samples Yellowish green to light brown, Color slightly green, better taste, pleasant aromatic odour. analysis pleasant aromatic odour, bitter taste Solubility analysis The obtained results of solubility analysis were presented in Table no. 4.3f. 72

Part traded Aerial parts and Leaves Aerial parts and Leaves Medicinal Eye complains, jaundice, heart diseases, curing Anorexia, Piles and cancers importance stomach ailment, asthma, bronchitis, leukoderma, cardiotonic and laxative Herbal recepies Specific dosage of Gymnema leaves was stimulated Leaves were taken in powder form twice a day for 4 weeks to treat the pancreatic islets of Langerhans to release the diabetes insulin.

Gymnema sylvestre Gymnema lactiferum

(Retz.) R.Br. ex Sm. (L.) R.Br. ex Schult.

Plate 3a: ovate leaves Plate 3b: ovate but pubescent leaves

Plate 3c: Anomocytic type of Plate 3d: Cyclocytic type of stomata (LM) stomata (LM)

Plate 1e: Anomocytic type of Plate 1f: Cyclocytic type of stomata (SEM) stomata (SEM)

Plate 3g: Spheroidal pollen Plate 3h: Circular pollen shape shape (LM) (LM)

Plate 3i: Trizonoporate Pollen Plate 3j: Tricolporate reticulate aperture (SEM) sculpturing of Pollen (SEM)

Table 4.3a: Qualitative morphological comparison between Gymnema sylvestre and Gymnema lactiferum

Characters Gymnema sylvestre Gymnema lactiferum

Habit of plant Climber Climbing shrub

Stem/Bark Cylindrical & brown bark Brown color

Inflorescence Corymbose cymes Cymes umbel like

Phyllotaxis Opposite Opposite

Leaf shape Elliptic, Obovate to ovate Ovate, acute at the base

Leaf color Glabrous Glabrous

Leaf venation Reticulate with 4-5 pairs lateral Reticulate veins

Flower Yellow, small Yellow

Sepal Ovate, greenish white Puberulous on back

Petal Ovate, glabrous Yellow, campanulate

Anther Erect connective anther, 2 pollinia Stamens 5, yellow

Carpel Solitary, head exerted, broadly Long, linear, lanceolate lanceollate

Fruit Single, fusiform, smooth and Merocarp smooth glabrous

Table 4.3b: Quantitative morphological comparison between Gymnema sylvestre and Gymnema lactiferum

Characters Gymnema sylvestre Gymnema lactiferum

Height of plant 8m 10-12m

Diameter of stem 2-10mm 20cm

Petiole 3-12mm 0.5 -1.5cm

Leaf length 1-9.5cm long 8cm long

Width of leaf 0.5-5.5wide 4cm wide

Flower 8-12mm 10-12mm

Sepal 2mm 1.5-2mm

Petal 3.5mm 0.4-0.5cm

Anther 2.5mm 2.9mm

Ovary 2mm 2.5mm

Fruits 5.1-7.5 5-7cm long

Table 4.3c: Qualitative leaf epidermal anatomical comparison between Gymnema sylvestre and Gymnema lactiferum

Characters Adaxial surface Abaxial surface

Gymnema Gymnema Gymnema Gymnema sylvestre lactiferum sylvestre lactiferum

Shape of Cubical to irregular or Cubical to irregular or epidermal rectangular somehow rectangular somehow cell rectangular rectangular

Shape of Cubical polygonal Cubical Polygonal subsidiary cells

Stomata type Absent Absent Anomocytic Cyclocytic

Possibility of Trichome Trichome Trichome Trichome trichome present present present present

Nature of Multicellular Multicellular Multicellular Multicellular trichome and uniseriate and uniserreiate uniseriate and uniserreiate

Table 4.3d: Quantitative leaf epidermal anatomical comparison between Gymnema sylvestre and Gymnema lactiferum

Characters Adaxial surface Abaxial surface

Gymnema Gymnema Gymnema Gymnema sylvestre lactiferum sylvestre lactiferum

Length of 45.8 40.0 46.7 38.9 epidermal cells (µm)

Width of 32.7 29.3 31.4 29.2 epidermal cells (µm)

Size of - - 12.1 14.8 Stomatal aperture (µm)

Length of - - 20.9 22.5 guard cells (µm)

Width of guard - - 14.1 17.1 cells (µm)

Table 4.3e: Qualitative and quantitative palynological comparison between Gymnema sylvestre and Gymnema lactiferum

Characters Gymnema sylvestre Gymnema lactiferum

Shape of pollen Spheroidal Circular

Pollen polar length (µm) 27.9 32

Pollen equitorial length (µm) 23 28.5

P/E ratio 1.21 1.12

Exine thickness (µm) 1.3 1.1

Intine thickness (µm) 1 0.9

Colpi length (µm) 2.8 1.4

Inter specific difference (µm) 0.75 0.5

Pollen fertility % 92 81

Table 4.3f : Solubility analysis of different samples of Gymnema sylvestre in various solvents

Plant Solubility in Color Solubility in HCl Color of Solubility in Color of Solubility in Water Color of name H2SO4 of sample Acetic acid sample sample sample Cold test Hot test After Cold test Hot test After Cold Hot test After Cold test Hot test After boiling boiling test boiling boiling Sample 1 Partially Soluble Rust Insoluble Insolubl Avocado Insolubl Insoluble Avocado Insoluble Insoluble Hopsack Soluble color e e Sample 2 Partially Partially Golden Insoluble Insolubl Light green Insolubl Insoluble Avocado Insoluble Insoluble Primrose soluble Soluble drown e e Sample 3 Partially Soluble Dark Insoluble Insolubl Green drab Insolubl Insoluble Field drab Insoluble Insoluble Mehndi soluble brown e e Sample 4 Partially Soluble Golden Insoluble Insolubl Green drab Insolubl Insoluble Field drab Insoluble Insoluble Mehndi soluble brown e e Sample 5 Partially Soluble Dark Insoluble Insolubl Sac bombae Insolubl Insoluble Field drab Insoluble Insoluble Primrose Soluble brown e green e

Sample 6 Partially Soluble Dark Insoluble Insolubl Field drab Insolubl Insoluble Avocado Insoluble Insoluble Primrose soluble brown e e Sample 7 Partially Soluble Dark Insoluble Insolubl Primrose Insolubl Insoluble Avocado Insoluble Insoluble Mehndi soluble brown e e Sample 8 Partially Soluble Dark Insoluble Insolubl Avocado Insolubl Insoluble Field drab Insoluble Insoluble Primrose soluble brown e e Sample 9 Partially Soluble Gross Insoluble Insolubl Sac bomber Insolubl Insoluble Avocado Insoluble Insoluble Clay soluble black e green e Sample 10 Partially Soluble Dark Insoluble Insolubl Sac bomber Insolubl Insoluble Avocado Insoluble Insoluble Primrose soluble brown e tan e 81

Sample 11 Partially Soluble Dark Insoluble Insolubl Olive green Insolubl Insoluble Avocado Insoluble Insoluble Light sea soluble brown e e gray Sample 12 Partially Soluble Gross Insoluble Insolubl Sac bomber Insolubl Insoluble Gold Insoluble Insoluble Clay soluble black e tan e metallic 82

Figure 4.3a: Quantitative morphological comparison between Gymnema sylvestre and Gymnema lactiferum

Figure 4.3b: Quantitative leaf epidermal anatomical comparison between Gymnema sylvestre and Gymnema lactiferum

Figure 4.3c: Qualitative and quantitative palynological comparison between Gymnema sylvestre and Gymnema lactiferum

4.4a: Sphaeranthus indicus Linn. vs Sphaeranthus africanus L.

Characters Sphaeranthus indicus Sphaeranthus africanus

Nomenclature English name:east Indian globe thistle English name: African globe thistle Trade name: Gul mundi Trade name: Gul mundi Local name: mundi booti Local name: Mundi, Chhagul nudi Worldwide Yunnan, Bhutan, Cambodia, India, Laos, Malaysia, Yunnan, Tiwan, Malaysia, Thailand, Tropical Africa, Australia, distribution Thailand, Vietnam, Africa and Astralia China, South East Asia and Northern Australia Habitat or Along River sandy banks and grassland Waste fields and grassy slopes Occurrence Morphology Stem tall, 10-45 cm, sharply, 4 irregular toothed wings, Stem tall, 40-50cm tall, pubescent, glabrous, usually robust, minutely glandular stipitate, white pubescent. Leaves ascending, curved, branched, entire wings. Leaves cauline, spatulate or oblanceolate, 2.4-6×1-2.5cm, stipitate obovate-oblong, 3.5×1.5-2.3cm less pubescent or glabrescent, glandular, white lanate on both surfaces, semiamplexicaul narrowed base, rounded apex. Capitula clustered, ovoid to base and decurrent, irregular margins biserrate-dentate, globose, 8mm in diameter, winged, glabrous peduncle, bract acute or obtuse apex, attenuate, apiculate. capitula clusters, acuminate, slender,campanulate capitula, 3×2.5mm involucer, 12×10.5mm, ovoid to globose, capitulum bracts linear to unequal phyllaries, oblanceolate, glabrous, abaxillary lanceolate, ciliate, 4.5-5.5mm, glandular stipitate, finely glandular. Naked receptacle. Numerous florets, corolla acuminate apex. 12 phyllaries, linear spatulate to linear marginal, 15mm, obtuse style apex. 3 central florets, 1.5mm oblong, less. glandular and more scarious than bracts. 10-15 corolla, 5 dentated, entire anther base, dilated filaments, marginal florets, 2-3 central florets, corolla purple 2.5mm, glabrous, short bifid style, cylindrical. cylindric achenes, 1mm, 85

dotted gland. Leaf Anatomy Abaxial surface: Abaxial surface : shape of epidermal cells irregular, length of shape of epidermal cells irregular with undulating walls, epidermal cell 61.3(58-64.6) µm, width of epidermal cell length of epidermal cell 53.3 (50-56.6)µm, width of 37.4(34-40.8) µm, length of guard cell 35 µm, width of guard epidermal cell 44.7 (40-49.4)µm, length of guard cell 22. 9 cell 15.6 µm, size of stomatal aperature 19.4 µm, Anomocytic µm, width of guard cell 15.0 µm, size of stomatal aperature type of stomata. Non glandular trichome present. 17.2 µm, Anomocytic type of stomata, shape of subsidiary cells different from epidermal cell, subsidiary cells 4, subsidiary cells not surround the guard cells. Anticlinal walls of epidermis cells were extremely wavy and lobed. Adaxial surface: length of epidermal cell 61.8 (57-66.6)µm, Cell wall thin, non-glandular trichome present width of epidermal cell 36.9(34-39.8) µm, length of guard cell Adaxial surface 34.7 µm, width of guard cell 16.0 µm, size of stomatal Shape of epidermal cells irregular and lobed, length of aperature 18.7 µm, Anomocytic type of stomata, Non glandular epidermal cell 52.6(47-58.2) µm, width of epidermal cell trichome present. 45.1(41-49.2) µm, length of guard cell 23.1 µm, width of guard cell 15.7 µm, size of stomatal aperature 16.8 µm, and type of stomata anomocytic. glandular trichome present Palynology Shape of pollen spheroidal, Amb diameter 18.5µm, length Pollen grain 3-zonocolporate, shape of pollen oblate to of pollen polar view 28(25-31)µm, length of pollen in spheroidal, pollen size in polar view 25.5(22.5-28.5), pollen equatorial view 24(20-28)µm, tricolporate. Colpi linear, size in equatorial view 22.8(20-25.6) µm, acute ectocolpi ends, 13.3µm long, 2.2µm wide, acute tips, longate ora. Exine 3.1 broad from middle, endocolpi longate, size of endocolpi 3.87 × 86

µm thick, intine thickness 1.8 µm, sculpturing echinate, 4.50 µm, round lateral ends, exine surface echinate, exine Each echinae 4.5-5µm long and 3.2 µm broad at its base. thickness 7.5 µm Organoleptic Leaf powder light green or yellowish dry color, pungent Light yellowish color, pungent smell analysis taste Solubility The obtained results of solubility analysis were presented in Table no. 4.4f. analysis Part traded Inflorescence Inflorescence Medicinal Anthelmintic, anti-microbial, anxiolytic, antioxidant, anti- Migraine, epilepsy, cough, fever, jaundice, hemorrhoids, skin importance arthritics, wound healing, Chest pain, bowel complaints, diseases stamachic, cough Herbal Decoction of fresh leaves of sphaeranthus indicus is Eaves decoction is effective to lower the blood pressure recepies effective for the cough and jaundice

Sphaeranthus indicus Sphaeranthus africanus

Linn. L.

Plate 4a: Small toothed leaves Plate 4b: large pubescent leaves

Plate 4c: Anomocytic type of Plate 4d: Paracytic type of stomata (LM) stomata (LM)

Plate 4e: Anomocytic type of Plate 4f: Paracytic type of stomata (SEM) stomata (SEM) 88

Plate 4g: Spheroidal pollen Plate 4h: Oblate to spheroidal shape (LM) pollen (LM)

Plate 4i: Echinate Pollen Plate 4j: Acute ectocolpi Pollen sculpturing (SEM) (SEM)

Table 4.4a: Qualitative morphological comparison between Sphaeranthus indicus and Sphaeranthus africanus

Characters Sphaeranthus indicus Sphaeranthus africanus

Habit of plant Medium size tree Large Tree

Stem/Bark cylindrical toothed, green & Curved, ascending, branched & brown greenish brown

Inflorescence Terminal Head campanulate 8mm

Phyllotaxis Alternate Alternate

Leaf shape Spatulate or oblanceolate, Oblovate, oblong, rounded tip dentated, serrate

Leaf color Sub glabrous Glabrous

Leaf venation 3-4 collateral Obscure veins

Flower Globular, heads of purple White globose to ovoid flower flower head

Sepal Absent Absent

Petal 5 toothed corolla Tubular corolla

Anther 5anthers, slender, tubular, dark Entire anther base, dilated filament yellow

Carpel Filiform and corky Cylindrical style, bifid

Fruit Achenes Achenes

Table 4.4b: Quantitative morphological comparison between Sphaeranthus indicus and Sphaeranthus africanus

Characters Sphaeranthus indicus Sphaeranthus africanus

Height of plant 10-45cm 40-50cm

Diameter of stem 1-3cm 3-5cm

Petiole 2-5mm 7-12mm

Leaf length 2.4-6cm 2-10cm

Width of leaf 1-2.5cm 0.8-3.5cm

Flower 8-15mm 3 x 2.5mm

Sepal Absent Absent

Petal 2.5mm 1.5mm

Anther 5-8mm 0.6-0.8mm

Ovary 4-5mm Style 1.8-2.8mm

Fruits 0.7-1.5mm 0.4-0.6mm

Table 4.4c: Qualitative leaf epidermal anatomical comparison between Sphaeranthus indicus and Sphaeranthus africanus

Characters Adaxial surface Abaxial surface

Sphaeranthus Sphaeranthus Sphaeranthus Sphaeranthus indicus africanus indicus africanus

Shape of Irregular or Irregular Irregular or Irregular epidermal lobed shape lobed shape cell margins margins

Shape of Irregular with polygonal Irregular with Polygonal subsidiary deep undulating deep undulating cells walls walls

Stomata Anomocytic Anomocytic Anomocytic Anomocytic type

Possibility of Present present Present present trichomes

Nature of Uniserriate Non-Glandular Whiplike Non- Non-glandular trichomes glandular glandular

Table 4.4d: Quantitative leaf epidermal anatomical comparison between Sphaeranthus indicus and Sphaeranthus africanus

Characters Adaxial surface Abaxial surface

Sphaeranthus Sphaeranthus Sphaeranthus Sphaeranthus indicus africanus indicus africanus

Length of 52.6 61.8 53.3 61.3 epidermal cells (µm)

Width of 45.1 36.9 44.7 37.4 epidermal cells (µm)

Size of 16.8 18.7 17.2 19.4 stomatal aperture (µm)

Length of 23.1 34.7 22.9 35 guard cells (µm)

Width of 15.7 16.0 15.0 15.6 guard cells (µm) 93

Table 4.4e: Qualitative and quantitative palynological comparison between Sphaeranthus indicus and Sphaeranthus africanus

Characters Sphaeranthus indicus Sphaeranthus africanus

Pollen shape Spheriodal Oblate to spheroidal

Pollen polar length (µm) 28 25.5

Pollen equitorial length (µm) 24 22.8

P/E ratio 1.16 .1.11

Exine thickness (µm) 3.1 7.5

Intine thickness (µm) 1.8 3.1

Colpi length (µm) 13.3 4.5

Inter specific difference (µm) 1 1.9

Pollen fertility % 95 83 94

Table 4.4f: Solubility analysis of different samples of Sphaeranthus indicus in various solvents

Plant name Solubility in Color of Solubility in HCl Color of Solubility in Color of Solubility in Water Color of H2SO4 sample sample Acetic acid sample sample

Cold test Hot test After Cold test Hot test After boiling Cold test Hot After Cold test Hot test After boiling boiling test boiling Sample 1 Partially Soluble Dark Insoluble Insoluble Shamp color Insoluble Insolub Golden Insoluble Insoluble Mehndi Soluble brown le needle Sample 2 Partially Soluble Dark Insoluble Insoluble Dull golden Insoluble Insolub Golden Insoluble Insoluble Primrose Soluble brown le needle Sample 3 Partially Soluble Dark Insoluble Insoluble Interior green Insoluble Insolub Golden Insoluble Insoluble Golden Soluble brown le needle needle Sample 4 Partially Soluble Dark Insoluble Insoluble Sac bomber Insoluble Insolub Beige Insoluble Insoluble Golden Soluble brown tan le needle

Sample 5 Partially Soluble Dark Insoluble Insoluble Afrika Insoluble Insolub Golden Insoluble Insoluble Golden Soluble brown mustard le needle needle

Sample 6 Partially Soluble Dark Insoluble Insoluble Field drab Insoluble Insolub Avocado Insoluble Insoluble Primrose soluble brown le Sample 7 Partially Soluble Dark Insoluble Insoluble Sac bombar Insoluble Insolub Golden Insoluble Insoluble Golden soluble brown tan le needle needle

Sample 8 Partially Soluble Dark Insoluble Insoluble Green zinc Insoluble Insolub Beige Insoluble Insoluble Golden soluble brown chromate le needle Sample 9 Partially Soluble Panzer Insoluble Insoluble Light brown Insoluble Insolub Golden Insoluble Insoluble Butter crime soluble gray le needle Sample 10 Partially Soluble Panzer Insoluble Insoluble Golden needle Insoluble Insolub Golden Insoluble Insoluble Golden soluble gray le needle needle 95

Sample 11 Partially Soluble Panzer Insoluble Insoluble Golden needle Insoluble Insolub Golden Insoluble Insoluble Golden soluble gray le needle needle Sample 12 Partially Soluble Panzer Insoluble Insoluble Gold metallic Insoluble Insolub Golden Insoluble Insoluble Golden soluble gray le needle needle 96

Figure 4.4a: Quantitative morphological comparison between Sphaeranthus indicus and Sphaeranthus africanus

Figure 4.4b: Quantitative leaf epidermal anatomical comparison between Sphaeranthus indicus and Sphaeranthus africanus

Figure 4.4c: Quantitative palynological comparison between Sphaeranthus indicus and Sphaeranthus africanus

4.5a: Artemisia maritima Linn. vs Artemisia absinthium L.

Characters Artemisia maritima Artemisia absinthium

Nomenclature English name: Afsathin, spirah tarkha, kirmani ajvayan, English name: southernwood, Nagdaun, mugwort darmina Trade name: Afsantin Trade name: Afsathine Local name: Vilayati afsathtine, Local name: Afsathine Worldwide High altitude of Kashmir Himalayas, Baluchistan, Southern Europe, Spain and Italy distribution Chitral, Afganistan, India and Pakistan Habitat or Sand of dried salt marshes Herb garden, along paths or walks Occurrence Morphology Perennial Shrub, 1.5-2m tall, slender, striate stem. Perennial, subshrub, strongly aromatic, woody branching stem, 3- Branched rootstock. Leaves simple, linear, 2.5-4cm, 2 4.5m tall, erect, numerous branched, brown, glabrous, sparsely hairy. pinnasect with many segments, small and obtuse. medium or light green leaves, cauline, broadly ovate blades, pinnately Numerous Flowheads, homogamous, ellipsoid, ovoid and dissected in threadlike segments, glabrous, sparsely hairy. oblong, 2.4mm long, 3-10 flowered in axial of leaf present Inflorescence head widely branched, 10-30×2-10cm, involucres in spike shaped clusters. Nacked receptacles. ovoid. Phyllaries elliptic, oblong, sparsely hairy. 4-8 Florets pistillate, bisexual, yellow corolla, 0.5-1.2mm, glandular. Cypselae 0.5-1mm, ellipsoid, glabrous 99

Leaf Abaxial length of epidermal cells 31.1(28.5-33.7) µm, width of length of epidermal cells 26.1(23.5-28.5) µm, width of epidermal cell surface: epidermal cell 27.5(21.5-33.5) µm, type of stomata: 21.5 (20.5-22.5) µm, type of stomata: anomocytic, length of stomatal Anatomy anisocytic, length of stomatal aperture 19.8, length of aperture 14.5, length of guard cells 21.5µm, width of guard cells guard cells 27.6µm, width of guard cells 11.07 µm, 7.85µm, T shape trichome present. number of subsidiary cells 3-4, uniseriate and Adaxial surface: length of epidermal cells 26.9(23.6-30.2)µm, width multicellular trichome present. of epidermal cell 21(18.5-23.5) µm, type of stomata anomocytic, Adaxial surface: length of epidermal cells 30.3(29.7- length of stomatal aperture 17.2 µm, length of guard cells 22.7µm, 30.9) µm, width of epidermal cell 25(24.5-25.5) µm, type width of guard cells 9.07 µm of stomata: anisocytic, length of stomatal aperture 19.5 µm, length of guard cells 29.1µm, width of guard cells 12.7µm, number of subsidiary cells 3, Palynology Globular shape of Pollen, pollen size large and broad, Pollen shape sub-sphaeriodal, dense spinules arrangement, exine dense arrangement of spinules, exine sculpturing sculpturing sinuolate, spinule base normal, pollen size in polar view granular, spinules broads from base, pollen length in polar 15(10-20)µm, pollen equatorial length 16(15-17)µm, exine thickness view 18.8(15-22.6))µm, pollen equatorial length 15.5(13- 2.7µm, intine thickness 2.1µm, colpi length 11.9 µm, pollen fertility 18) µm, exine thickness 2.8 µm, intine thickness 1.5 µm, 89% colpi length 11.8 µm

Organoleptic Sharp aroma, bitter taste Sweet aroma, taste bitter 100

analysis Solubility The obtained results of solubility analysis were presented in Table no. 4.5f. analysis Part traded Flower head & branches Flower head & branches Medicinal Anthelminitic, vermifug, antispasm. Whooping cough, nausea, diarrhea, avoid during pregnancy, cause Seizure disorder, importance bed-wetting prolonged use is very toxic Herbal Plant decoction is helpful in malaria treatment Leaves and whole plant decoction were used for stomaich problems. recepies Leaves decoction is effect in throat inflammation. 101

Artemisia maritima Artemisia absinthium L. Linn.

Plate 5a: dull green leaves Plate 5b: bright green leaves

Plate 5c: Anisocytic type of Plate 5d: Anomocytic type of stomata (LM) stomata (LM)

Plate 5e: Anisocytic type of Plate 5f: Anomocytic type of stomata (SEM) stomata (SEM)

102

Plate 5g: Globular pollen shape Plate 5h: sub-spheroidal pollen (LM) shape (LM)

Plate 5i: Exine sculpturing Plate 5j: Sinuolate exine granular (SEM) sculpturing (SEM)

103

Table 4.5a: Qualitative morphological comparison between Artemisia maritima and Artemisia absinthium

Characters Artemisia maritime Artemisia absinthium

Habit of plant Perennial shrub Perennial subshrub

Stem/bark Slender, striated & Light Woody branching stem & Brown brown bark bark

Inflorescence Capitulum Capitula

Phyllotaxis Alternately Spiral

Leaf shape Small, obtuse, lanceolat, many Ovate blades, pinnately dissected segments in a thread like segments

Leaf color Whitish cottony green Silver green leaves, glabrous

Leaf venation Not distinct Not distinct

Flower Numerous, homogamous, Small, spherical form elliptic

Sepal Absent Absent

Petal united petals, Yellow or green Yellow, glandular sometime brown color

Anther 5 anther attached with Dentated anther Dentated tube

Carpel Filiform Florets pistillate

Fruit Cypsela, oblong to obvoid Cypsela

104

Table 4.5b: Quantitative morphological comparison between Artemisia maritima and Artemisia absinthium

Characters Artemisia maritima Artemisia absinthium

Height of plant 1.5-2 m 70-150cm

Diameter of stem 5-10cm 8-10cm

Petiole 1-5cm 6-12cm

Leaf length 2.5-10cm 2-6cm long

Width of leaf 2.5-4cm 9.5-12cm × 7.5-9cm

Flower 3-10 flowers, 2.4mm 3.5-4mm long

Sepal Absent Absent

Petal 1-1.5mm 0.5-1.2mm

Anther 1.8mm 2mm

Ovary 1.7mm 1.6mm

Fruits 0.8-1.2mm 0.5-1mm

Seeds 0.8-1mm 1mm

105

Table 4.5c: Qualitative leaf epidermal anatomical comparison between Artemisia maritima and Artemisia absinthium

Characters Adaxial surface Abaxial surface

Artemisia Artemisia Artemisia Artemisia maritima absinthium maritima absinthium

Shape of Pentagonal Irregular Pentagonal Irregular epidermal cell

Shape of Polygonal shape Polygonal Polygonal shape Polygonal subsidiary undulating undulating cells margins margins

Stomata type Anisocytic Anomocytic Anisocytic Anomocytic

Possibility of Present Present Present Present trichome

Nature of Uniseriate and Uniseriate Uniseriate and Uniseriate and trichomes multicellular and multicellular unicellular T unicellular shape

106

Table 4.5d: Quantitative leaf epidermal anatomical comparison between Artemisia maritima and Artemisia absinthium

Characters Adaxial surface Abaxial surface

Artemisia Artemisia Artemisia Artemisia maritima absinthium maritima absinthium

Length of 30.3 26.9 31.1 26.1 epidermal cells (µm)

Width of 25 21 27.5 21.5 epidermal cells (µm)

Length of 19.5 17.2 19.8 14.5 stomatal aperture (µm)

Length of guard 29.1 22.7 27.9 21.5 cells (µm)

Width of guard 12.7 9.07 11.07 7.85 cells (µm)

107

Table 4.5e: Qualitative and quantitative palynological comparison between Artemisia maritima and Artemisia absinthium

Characters Artemisia maritima Artemisia absinthium

Pollen shape Globular Sub-spheroidal

Pollen polar length (µm) 18.8 15

Pollen equitorial length (µm) 15.5 16

P/E ratio 1.21 0.93

Exine thickness (µm) 2.8 2.7

Intine thickness (µm) 1.5 2.1

Colpi length (µm) 11.8 4.5

Inter specific difference (µm) 0.7 1.9

Pollen fertility % 91 79

108

Table 4.5f: Solubility analysis of different samples of Artemisia maritima in various solvents

Plant Solubility in Color Solubility in HCl Color of Solubility in Color Solubility in Color name H2SO4 of sample Acetic acid of Water of sample sample sample Cold test Hot test After Cold test Hot test After boiling Cold test Hot test After Cold test Hot test After boiling boiling boiling Sample 1 Partially Soluble October Insoluble Insoluble Light brown Insoluble Insolubl Mehndi Insoluble Insoluble Mehndi Soluble brown e Sample 2 Partially Soluble October Insoluble Insoluble Dirt brown Insoluble Insolubl Mehndi Insoluble Insoluble Primrose Soluble brown e Sample 3 Partially Soluble October Insoluble Insoluble Field drab Insoluble Insolubl Gold Insoluble Insoluble Primrose Soluble brown e metallic Sample 4 Partially Soluble October Insoluble Insoluble Dull golden Insoluble Insolubl Golden Insoluble Insoluble Golden Soluble brown e needle needle Sample 5 Partially Soluble Dark Insoluble Insoluble Field drab Insoluble Insolubl Gold Insoluble Insoluble Mehndi Soluble brown e metallic Sample 6 Partially Soluble Dark Insoluble Insoluble Buck skin Insoluble Insolubl Golden Insoluble Insoluble Golden soluble brown e needle needle Sample 7 Partially Soluble Dark Insoluble Insoluble Sac bombar Insoluble Insolubr Clay Insoluble Insoluble Golden soluble brown tan le needle Sample 8 Partially Soluble Dark Insoluble Insoluble Red oxide Insoluble Insolubl Golden Insoluble Insoluble Golden soluble brown e needle needle Sample 9 Partially Soluble Blackish Insoluble Insoluble Golden Insoluble Insolubl Mehndi Insoluble Insoluble Mehndi soluble brown brown e Sample 10 Partially Soluble Dark Insoluble Insoluble Wood Insoluble Insolubl Mehndi Insoluble Insoluble Mehndi soluble brown e Sample 11 Partially Soluble Dark Insoluble Insoluble Molten Insoluble Insolubl Light sea Insoluble Insoluble Golden soluble brown bronze e gray needle Sample 12 Partially Soluble Dark Insoluble Insoluble Molten Insoluble Insolubl Butter Insoluble Insoluble Mehndi soluble brown bronze e crime 109

Figure 4.5a: Quantitative morphological comparison between Artemisia maritime and Artemisia absinthium

Figure 4.5b: Quantitative leaf epidermal anatomical comparison between Artemisia maritime and Artemisia absinthium 110

Figure 4.5c: Quantitative palynological comparison between Artemisia maritima and Artemisia absinthium 111

4.6a: Butea monosperma (Lam.) Taub. vs Averrhoa carambola L.

Butea monosperma Averrhoa carambola Nomenclature English name: Forest fire English name: Kamarj Trade name: Kamarkus Trade name: Kamarkus Local name: Dhak Local name: Kamaraj Worldwide Yunnan, Bhutan, Indonesis, India, Nepal, Sri lanka, China, Burma, Malaysia, America, Madagascar, India and Pakistan. distribution Thailand and Pakistan Habitat or Forests, near roads, wet places and cultivated Tropical and subtropical areas, parks and garden Occurrence Morphology Tall tree, 10-20m, trunk diameter 30cm, grayish black Tall tree, 4-6m long, shoots and younger branches tomentose. Imparipinnate bark, petiole 10cm, vigorous, subulate stipels, 1.5mm, leaves, leaflets subsessile, opposite to subopposite, ovate to elliptic, 5-8cm unequal leaflets, thick leathery, both surfaces rough, broad, largest terminal leaf, acuminate, glabrous upper leaf surface, lower abaxially puberlulent along the veins, glabrous adaxially, surface sparsely pubescent. axillary tomentose panicles, long bract, 1.5mm, 6-7 pairs of lateral veins, midrib raised abaxially, distinct ovate, pedicel 2mm long, sepals imbricate, 3.5mm long, persistent. Oblong, reticulate veins, conspicuous aeroles abaxially, broadly elliptic petals, 8-9.2mm long, slightly connate, lilac to purple color. Stamens obovate or suborbicular terminal leaflet, leaf length 14-17 10, 5 anther inferious often alternating with 5 staminodes, 2mm long 12.5- 15cm broadly cuneate base, rounded or emarginated filaments, curved, base dialated, persistent, sterile short stamen, 1-2 fertile, apex. less racemes, axillary panicles at leafless branches, anther basifixed, obvate to ovate. Ovary pubescent , glandular, 1.8mm long, pedicels and calyx densely brown to blackish brown. 5 styles, capitate stigma, 5 acute lobes, 6-7cm long berry, narrow, oblong, 112

Calyx 1- 1.2cm, both surfaces silver gray, inside light yellow. Seeds arillate. brown puberulent. Orange red Corolla, yellow in later, as long as calyx, narrowly ovate standard, 4-4.5cm, recurved, wings falcate, 4cm keel with rounded auricles, broadly falcate keel, 5-5.6cm, arcuate ridge, silver gray velutinous. Oblong anthers. Ovary velutinous. Leggumes 12-15× 3.5- 4.5 cm, apex rounded, 12-15mm stipe, reddish brown seed, broadly reniform, compressed, 2.73.3-3.5cm Leaf Abaxial surface: Shape of epidermal cell tetragonal to Abaxial surface: Shape of epidermal cells hexagonal, length of epidermal Anatomy pentagonal, length of epidermal cell 38.1(35-41.2)µm, cell 47.0(45-50) µm, width of epidermal cell 39.4 (35-43.8)µm, length of width of epidermal cell 25.0(22-28) µm, length of guard guard cell 31.0µm, width of guard cell 14.8µm, size of stomatal aperature cell 23.8 µm, width of guard cell 19.0 µm, size of stomatal 21.4 µm, Anisocytic type of stomata. Non glandular trichome present. aperture 9.4µm, stomata abundant, stomata type paracytic, Adaxial surface: shape of epidermal cells hexagonal, length of epidermal non-glandular trichome, trichome size 365 µm cell 47.9(45-50.8) µm, width of epidermal cell 39.8(35-44.6)µm, length of Adaxial surface: length of epidermal cell 38.9(36- guard cell 31.9µm, width of guard cell 15.2 µm, size of stomatal aperature 41.8)µm, width of epidermal cell 25.5(23-28)µm stomata 20.8 µm, Anisocyticc type of stomata. absent, secretory trichomes present. Palynology Pollen Shape oblate-sphaeroidal, Colporate, prolate, Pollen shape prolate to sphaeroidal & oblate, surface ornamentation surface pattern obscure, pollen bilaterally symmetrical, reticulum, areola & fossulate to perforate, pollen length in polar view 21(18- triporate, pollen length in polar view 34(30-38) µm, pollen 24)µm, pollen length in equatorial view 20(18-22)µm, P/E ration 1.05, exine 113

size in equatorial plane is 30(25-35)µm, P/E ratio 1.13, thickness 2.1µm, intine thickness 1.3 µm , Tricolpate, length of colpi 6.1 µm, exine thickness 2.9µm, intine thickness 2.5µm, length of circular pollen aperture, interspecific difference 0.5, pollen fertility 93% colpi 9.1µm, interspecific difference 1.7 µm, pollen fertility 81%. Organoleptic Aromatic, Slightly bitter taste, dark green color, uneven Not specific taste, slightly aromatic analysis size of coarse powder

Solubility The obtained results of solubility analysis were presented in Table no. 4.6f. analysis Part traded Resin crystals Resin crystals Medicinal longterm use cause kidney failure, anemia, dangerous antibacterial, antimicrobial, Laxative, anti-inflammatory, skin disorder, fever, importance during pregnancy and brest feeding hypoglycemi Herbal Resin crystals are effective in relieve of backbone pain Fruit is used as laxative recipes

114

Butea monosperma Averrhoa carambola L. (Lam.) Taub.

Plate 6a: Orangish red flower Plate 6b: Purplish pink flower

Plate 6c: Paracytic type of Plate 6d: Anisocytic type of stomata (LM) stomata (LM)

Plate 6e: Paracytic type of Plate 6f: Anisocytic type of stomata (SEM) stomata (SEM) 115

Plate 6g: Oblate to Spheroidal Plate 6h: Prolate to spheroidal pollen (LM) and oblate pollen shape (LM)

Plate 6i: Pollen surface patteren Plate 6j: reticulate and prolate obscure (SEM) Pollen surface (SEM)

116

Table 4.6a: Qualitative morphological comparison between Butea monosperma and Averrhoa carambola

Characters Butea monosperma Averrhoa carambola

Habit of plant Tree Tree

Stem/Bark Irregular, vigrous & grayish Woody branchming stem & black bark grey or brown bark

Inflorescence Recemes Panicle opposite or subopposite

Phyllotaxis Spiral Alternate

Leaf shape Rounded or emarginated apex Ovate with entire margins

Leaf color Glabrous Glabrous

Leaf venation Reticulate Pinnate

Flower Orange red Purple, axillary

Sepal Dark brown to blackish brown Green

Petal Orange red, ovate standard, Oblong, elliptic recurved wings, falcate keel, arcuate ridge

Anther Oblong anther Sterile short stamen 2 fertile stamen, obvate to ovate, basifixed

Carpel Velutinous, Pubescent

Fruit Legume reddish brown Yellow, oblong berry

117

Table 4.6b: Quantitative morphological comparison between Butea monosperma and Averrhoa carambola

Characters Butea monosperma Averrhoa carambola

Height of plant 10-20m 4-6m

Diameter of stem 30cm 6-7m

Petiole 10cm 1.5-2cm

Leaf length 14-17cm 5-8cm

Width of leaf 12.5-15cm 3-5cm

Flower 6-8cm 2.5-8mm

Sepal 1-1.2cm 3.5mm

Petal Standard 4-4,5cm, keel 4cm, keel 8-9.2mm 5-5.6cm falcat

Anther 5.7cm 10, 1-2 short anther fertile

Ovary 5.04cm 18mm

Fruits 12-15.5×3-4.5cm 6-7cm

118

Table 4.6c: Qualitative leaf epidermal anatomical comparison between Butea monosperma and Averrhoa carambola

Characters Adaxial surface Abaxial surface

Butea Averrhoa Butea Averrhoa monosperma carambola monosperma carambola

Shape of Tetragonal or Hexagonal Tetragonal or Hexagonal epidermal cell rarely pentagonal rarely pentagonal

Shape of - Polygonal Polygonal Polygonal subsidiary cells

Stomata type - Anisocytic Paracytic Anisocytic

Possibility of Present Absent Present Absent trichome

Nature of Secretory - Non glandular - trichome trichome trichome

119

Table 4.6d: Quantitative leaf epidermal anatomical comparison between Butea monosperma and Averrhoa carambola

Characters Adaxial surface Abaxial surface

Butea Averrhoa Butea Averrhoa monosperma carambola monosperma carambola

Length of 38.9 47.9 38.1 47.0 epidermal cells (µm)

Width of 25.5 39.8 25.0 39.4 epidermal cells (µm)

Length of - 20.8 9.4 21.4 stomatal aperture (µm)

Length of guard - 31.9 23.8 31.0 cells (µm)

Width of guard - 15.2 19.0 14.8 cells (µm)

120

Table 4.6e: Qualitative and quantitative palynologcial comparison between Butea monosperma and Averrhoa carambola

Characters Butea monosperma Averrhoa carambola

Prolate to spheroidal and Pollen shape Oblate to spheroidal oblate

Pollen polar length (µm) 34 21

Pollen equitorial length (µm) 30 20

P/E ratio 1.13 1.5

Exine thickness (µm) 2.9 2.1

Intine thickness (µm) 2.5 1.3

Colpi length (µm) 9.1 6.1

Inter specific difference (µm) 1.7 0.5

pollen fertility % 81 93

121

Table 4.6f : Solubility analysis of different samples of Butea monosperma in various solvents

Plant name Solubility in Color Solubility in HCl Color Solubility in Color Solubility in Water Color of H2SO4 of of Acetic acid of sample sample sample sample Cold test Hot test After Cold test Hot test After Cold test Hot test After Cold test Hot test After boiling boiling boiling boiling Sample 1 Partially Partially Crane Insoluble Insoluble Red Insoluble Insoluble Red Insoluble Insoluble Burnt Soluble soluble berry oxide oxide orange Sample 2 Partially Partially Red Insoluble Insoluble Roof tile Insoluble Insoluble Red Insoluble Insoluble Red oxide Soluble Soluble oxide oxide Sample 3 Partially Soluble Red Insoluble Insoluble Red Insoluble Insoluble Red Insoluble Insoluble Crimson Soluble oxide oxide oxide Sample 4 Partially Soluble Red Insoluble Insoluble Red Insoluble Insoluble Red Insoluble Insoluble Crimson Soluble oxide oxide oxide Sample 5 Partially Soluble Dark Insoluble Insoluble Red Insoluble Insoluble Red Insoluble Insoluble Red oxide soluble brown oxide oxide Sample 6 Partially Soluble Crane Insoluble Insoluble Red Insoluble Insoluble Red Insoluble Insoluble Red oxide soluble berry oxide oxide Sample 7 Partially Soluble Red Insoluble Insoluble Red Insoluble Insoluble Red Insoluble Insoluble Red oxide soluble oxide oxide oxide Sample 8 Partially Soluble Red Insoluble Insoluble Red Insoluble Insoluble Red Insoluble Insoluble Red oxide soluble oxide oxide oxide Sample 9 Partially Soluble Crane Insoluble Insoluble Red Insoluble Insoluble Red Insoluble Insoluble Red oxide soluble berry oxide oxide Sample 10 Partially Soluble Red Insoluble Insoluble Red Insoluble Insoluble Red Insoluble Insoluble Red oxide soluble oxide oxide oxide Sample 11 Partially Soluble Red Insoluble Insoluble Red Insoluble Insoluble Red Insoluble Insoluble Red oxide soluble oxide oxide oxide Sample 12 Partially Soluble Red Insoluble Insoluble Red Insoluble Insoluble Red Insoluble Insoluble Red oxide soluble oxide oxide oxide 122

Figure 4.6a: Quantitative morphological comparison between Butea monosperma and Averrhoa carambola

Figure 4.6b: Quantitative leaf epidermal anatomical comparison between Butea monosperma and Averrhoa carambola

123

Figure 4.6c: Qualitative and quantitative palynologcial comparison between Butea monosperma and Averrhoa carambola 124

4.7a: Achillea millefolium L. vs Adhatoda vasica Nees

Achillea millefolium Adhatoda vasica

Nomenclature English name: Yarrow English name: Malabar nut Trade name: Biranjasaif Trade name: Biranjaasf Local name: Biranjasaif Local name: Adhosa Worldwide North America, China, India, Pakistan, , Hazara, Swat, Asia, Nepal, India, Sri lanka and Pakistan distribution Peshawar and Kaghan, Hazara, swat, gilgit, Muree, Naran and Shogran. Habitat or Terristial Parks and roadside Occurrence Morphology Perennial herb, 1m tall, erect woody stem with obtuse Dense shrub, 1.2-2.5m tall, sometime 6m high. Opposite ascending angled, glandulose, punctate, wolly pilos twings. Long branches, yellowish glabrous bark, 10-20 leave at each branch, 8- petiolate leaves, oblong, sessile, lenceolate, 2-3 9cm long, elliptic, lanceolate, acuminate, puberulous when young, pinnatisect, densely villous at abaxial, glandular and become glabrous at maturity, margins entire, leaves dark green densely depressed, lanceolate segmented to linear, above, leaves beneath paler, tapering base, 10-12 pairs of main cartilaginous mucronate at apex. Synflorescence, top nerves, reticulate venation, 1-2.5cm petiole, flowers produced terminal flat panicle, 2.5-6cm in diameter, multiple dense axillary, 2-8cm pedunculate spikes, 3-10cm long peduncle, capitum. Oblong to subovoid invloucres, 3 rows of 1-2 bracts, 0.5-1.3cm long, subacute, elliptic, nearly glabrous, 5-7 125

phyllaries, oblong, elliptic, 1.5-3× 1-1.5mm, margins pale nerves, veins reticulate, bracteoles 0.3-0.4mm long, oblong, yellow or sometime brown, scarious, convex midrib, lanceolate acute margins, single nerved, reticulately veined, 1.1- oblong elliptic palea, yellow dotted glands at abaxial, 5 1.3cm long calyx, slightly pubescent or glabrous, imbricate sepals, Ray florets, pink, white or violet lamina, suborbicular 1.5- acute, oblong-lanceolate, 3 nerved with reticulate venation. White 3.2× 2.2- 2.5mm, 2-3 apex denticulate. yellow disk florets, corolla with irregular pinkishbars, 2.5-3cm long, pubescent from 2-3mm, tubular, exterior dotted gland, 5 lobed apex. outside, 1-2cm long tube, lower part cylindrical, obtuse, oblong, Greenish achenes, 2mm oblong, lateral ribs white. curved, notched. Long hairy filament at the base, curved, anther Toothed Corolla, tube shaped. Oblong cypselas, 2- 2.5mm cell at the base minutely apiculate. Pubescent ovary, pubescent long, glabrous. lower part of style. 0.5-0.8cm long capsules, calvate, shortly and bluntly pointed, puberscent . flattened solid stalk, 1cm long. 5- 6mm long seeds, oblong, orbicular and glabrous. Leaf Abaxial surface: Irregular shape of epidermal cells, Abaxial surface: Epidermal cells polygonal length of epidermal Anatomy length of epidermal cell 46.1(45-47.2)µm, width of cell 54.9(50-59.8)µm, width of epidermal cells 38.1(35-41.2) µm, epidermal cells 32.2(30-34.4) µm, length of guard cell length of guard cell 25.3 µm, width of guard cells 18.8 µm, size of 22.8 µm, width of guard cells 16.4 µm, size of stomatal stomatal aperture 13.9 µm thin layer, 2 subsidary cells surrounded aperture 11.9 µm Trichome elongated, non-glandular, the guard cells, trichome 2-4 celled, sessile and blunt, stomatal type uniseriate, terminal cells pointed, stomata type diacytic. anomocytic, calcium oxalate crystals not present Adaxial surface: epidermal cells polygonal, length of epidermal Adaxial surface: : length of epidermal cell 45.4(44- cell 53.7(50-57.4)µm, width of epidermal cells 37.9(40.8) µm, 46.8)µm, width of epidermal cells 30.8(25-36.6) µm, length of guard cell 24.7 µm, width of guard cells 19.1 µm, size of 126

length of guard cell 23.9 µm, width of guard cells 16.9 stomatal aperture 14.2 µm few stomata present, stomatal type, µm, size of stomatal aperture 13.3 µm trichome Glandular, diacytic. compositous, with 4 cell pairs, Palynology Pollen monad, medium size 26-50µm, pollen shape Triporate, oblate, bilateral symmetry, size of pollen in polar view circular to spheroidal, radial symmetery, size of pollen in 41(40-42) µm, size of pollen in equitorial view 23(21-25)µm. P/E polar diameter 28(25-31) µm, size of pollen in equatorial ratio 1.96, exine thickness 1.7 µm, intine thickness 2.3 µm, length view 21(20-22)µm, P/E ratio 1.2 µm, exine thickness 2.7 of colpi 3.2 µm, inter specific difference 0.6, pollen fertility value µm, intine thickness 1.5µm, colporate, colpi length 5.9µm, 79%, microreticulate prolate, lobate, 3 sunken aperture, colporus, tricolporate, echinate, spines 1.2 µm, microreticulate, inter specific difference 0.9µm and pollen fertility 95% Organoleptic Fragrant odour, bitter taste Bitter taste analysis Solubility The obtained results of solubility analysis were presented in Table no. 4.7f analysis Part traded Branches and leaves Branches and leaves Medicinal Gastrointestinal ailment, laxative, burn wounds, genital Whooping cough, asthma, bronchitis, piles, relief bleeding cough, importance herpes peptic ulcer Herbal Decocotion is effective in delivery pain, diarrhea and Leaves decoction are used to facilitate child birth and induce recipes fever abortion 127

Achillea millefolium L. Adhatoda vasica Nees.

Plate 7a: Narrow pointed leaves Plate 7b: long broad leaves

Plate 7c: Anomocytic type of Plate 7d: Diacytic type of stomata (LM) stomata (LM)

Plate 7e: Anomocytic type of Plate 7f: Diacytic type of stomata (SEM) stomata (SEM)

128

Plate 7g: Circular to Spheroidal Plate 7h: Oblate pollen shape pollen shape (LM) (LM)

Plate 7i: Sunken aperture of Plate 7j: Microreticulate Pollen (SEM) surface patteren of Pollen (SEM)

129

Table 4.7a: Qualitative morphological comparison between Achillea millefolium and Adhatoda vasica

Characters Achillea millefolium Adhatoda vasica

Habit of plant Perennial herb Dense shrub

Stem/Bark Erect woody stem & Greenish bark Erect, cylindrical

Inflorescence Synflorescence top terminal flat Terminal paniculate to panicle recemoid cymes

Phyllotaxis Alternate Opposite

Leaf shape Oblong, sessile, lanceolate, toothed Elliptic, lanceolate, acuminate margins

Leaf color Green Dark green, glabrous

Leaf venation Not distinct Reticulate venation

Flower 5 ray florets Axillary

Sepals Few, racemosely arranged Imbricate sepals, acute, oblong, lanceolate

Petals Toothed corolla, tube shaped Irregular pinkish bar, obtuse, oblong, curved

Anther Cylindrical anther Curved anther cell, long hairy filament

Carpel Glabrous Pubescent ovary

Fruit Oblong, cypselas Capsules

130

Table 4.7b: Quantitative morphological comparison between Achillea millefolium and Adhatoda vasica

Characters Achillea millefolium Adhatoda vasica

Height of plant 1m tall 1.2-2.5m tall sometime 6 m high

Diameter of stem 5mm 15-25cm

Petiole 35mm 1-2.5cm

Leaf length 5-14cm long 5-7 nerves

Width of leaf 2.5-5cm wide 8-9cm

Flower 3-5mm 3cm

Sepal 2.5-6cm 2-8cm

Petal 2.3-2.5 1.1-1.3cm long

Anther 2-2.5mm 0.5-0.8cm

Ovary 2mm 5-6mm

Fruits 1.8-2mm 2.5cm

131

Table 4.7c: Qualitative leaf epidermal anatomical comparison between Achillea millefolium and Adhatoda vasica

Characters Adaxial surface Abaxial surface

Achillea Adhatoda Achillea Adhatoda millifolium vasica millifolium vasica

Shape of Irregular shape Polygonal Irregular shape Polygonal epidermal cell

Shape of Irregular with Cubical Irregular with Cubical subsidiary undulating wall undulating wall cells

Stomata type Anomocytic Diacytic Anomocytic Diacytic

Possibility of Present Present Present Present trichome

Nature of Non glandular Sessile, blunt Non glandular Sessile, blunt trichomes uniseriate and uniseriate and trichome multicellular trichome multicellular

132

Table 4.7d: Quantitative leaf epidermal anatomical comparison between Achillea millefolium and Adhatoda vasica

Characters Adaxial surface Abaxial surface

Achillea Adhatoda Achillea Adhatoda vasica millifolium vasica millifolium

Length of 45.4 53.7 46.1 54.9 epidermal cells (µm)

Width of 30.8 37.9 32.2 38.1 epidermal cells (µm)

Length of 13.3 14.2 11.9 13.9 stomatal aperture (µm)

Length of guard 23.9 24.7 22.8 25.3 cells (µm)

Width of guard 16.9 19.1 16.4 18.8 cells (µm)

133

Table 4.7e: Qualitative and quantitative palynological comparison between Achillea millefolium and Adhatoda vasica

Characters Achillea millefolium Adhatoda vasica

Pollen shape Circular to spheroidal Oblate

pollen polar length (µm) 28 41

pollen equitorial length (µm) 21 23

P/E ratio 1.33 1.78

exine thickness (µm) 2.7 1.7

intine thickness (µm) 1.5 2.3

colpi length (µm) 5.9 3.2

inter specific difference (µm) 0.9 0.6

pollen fertility % 95 79

134

Table 4.7f : solubility analysis of different samples of Achillea millifolium in various solvents

Plant name Solubility in Color of Solubility in HCl Color of Solubility in Color of Solubility in Water Color of H2SO4 sample sample Acetic acid sample sample

Cold test Hot test After Cold test Hot test After Cold test Hot test After Cold test Hot test After boiling boiling boiling boiling Sample 1 Partially Soluble Dark Insoluble Insoluble Field Insoluble Insoluble Golden Insoluble Insoluble Primrose Soluble brown drab metallic Sample 2 Partially Soluble Dark Insoluble Insoluble Sac Insoluble Insoluble Golden Insoluble Insoluble Yellow Soluble brown bomber metallic tan Sample 3 Partially Soluble Dark Insoluble Insoluble Dark Insoluble Insoluble Mehndi Insoluble Insoluble Hopsack Soluble brown brown Sample 4 Partially Soluble Blackish Insoluble Insoluble Chrome Insoluble Insoluble Golden Insoluble Insoluble Primrose Soluble brown yellow needle Sample 5 Partially Soluble Black Insoluble Insoluble Dark Insoluble Insoluble Mehandi Insoluble Insoluble Mehndi soluble brown Sample 6 Partially Soluble Dark Insoluble Insoluble Sac Insoluble Insoluble Golden Insoluble Insoluble Pale soluble brown bomber needle cream tan Sample 7 Partially Soluble Dark Insoluble Insoluble Afrika Insoluble Insoluble Clay Insoluble Insoluble Golden soluble brown mustard needle Sample 8 Partially Soluble Dark Insoluble Insoluble Sac Insoluble Insoluble Golden Insoluble Insoluble Golden soluble brown bomber needle needle tan Sample 9 Partially Soluble Euro I Insoluble Insoluble Brass Insoluble Insoluble Golden Insoluble Insoluble Primrose soluble gray metallic Sample 10 Partially Soluble Euro I Insoluble Insoluble Saffron Insoluble Insoluble Golden Insoluble Insoluble Mehndi soluble gray metallic Sample 11 Partially Soluble Euro I Insoluble Insoluble Brass Insoluble Insoluble Golden Insoluble Insoluble Armor soluble gray metallic sand Sample 12 Partially Soluble Blackish Insoluble Insoluble Golden Insoluble Insoluble Golden Insoluble Insoluble Primrose soluble brown yellow metallic 135

Figure 4.7a: Quantitative morphological comparison between Achillea millefolium and Adhatoda vasica

Figure 4.7b: Quantitative leaf epidermal anatomical comparison between Achillea millefolium and Adhatoda vasica

136

Figure 4.7c: Quantitative palynological comparison between Achillea millefolium and Adhatoda vasica 137

4.8a: Morus nigra L. vs Morus alba L.

Morus nigra Morus alba

Nomenclature English name: Black mulberry English name: Red mulberry Trade name: Toot siyah Trade name: Shahtoot Local name: Shahtoot Local name: Toot Worldwide Pakistan, Asia, Central and south Europe, north Africa, Native ti chaina, temperate Asia, China, japan, Burma, distribution introduced to U.S.A and Iran, Malaya, Africa, Europe and Indo-Pak subcontinent Habitat or Woodland, garden, sunny edge and dappled shade Moist places along mountain and rivers Occurrence Morphology Medium sized tree, 10m tall, monoecious or dioecious, Monoecious tree, usually 8-15 m tall sometime reached wide spreading crown. I-2m trunk circumference, rough 20m, dense leafy crown, trunk circumference 1.5-2m, bark, reddish brown twings, densely hair. Striated leaves, twigs dark grey brown, glabrescent, rough, fissured bark. 2-3.5cm long, petiole hairy, broad ovate lamina, 6-12.5cm Leaves filiform, crisped hairy, petiole 1-3.5cm long, long and broad, leaf lower surface pubescent, ultimate narrow to broad lamina, ovate, 5-15cm long, 4-12cm veinlets, 4-5.5 costate, crenate to dentate margins, 2-5 wide, glabrous from upper surface, midrib pubescent, lobed apex, acuminate, stipulate 6-10mm log, lanceolate, secondary veins and veinlets glabrous, irregularly serrate hairy, pale brown, male catkins 22-35mm long, densely margins, obtuse apex, shortly acuminate, lanceolate hair, broadly oval shaped stamens, anther exerted, female stipules, hairy, brown memberanous. 138

catkins, oval shaped, 15-30mm wide, peduncle hairy, In Male catkins 10-20mm long, slender, hairy peduncle, female flower broadly elliptic sepals, 2.5-3mm broad, 3- broad 5.5mm, laxative flowers. Male flower: free sepals, 3.5mm long, white ad densely hair, divergent style, ovoid broad, ovate, 2.5mm long, obtuse, glabrous, hairy, oblong sorosis, 15-25mm long, dark purple to blackish staminal filament, ovate, exerted anthers. Female catkins color, edible at maturity. 5-10mm long, ovoid, irregularly long. Female flowers: suborbicular sepals, slightly longer than male flower, ciliated on margins, glabrous, ovary with free style. Ovoid sorosis, 15.5-25mm long, white to purple black, sweet and edible Leaf Abaxial surface: Shape of epidermal cells various Abaxial surface: Shape of epidermis cell irregular, Anatomy shaped, length of epidermal cell 25.5(22.5-28.5), width of length of epidermal cell 22.9(18.1-27.7) µm, width of epidermal cell 16.1(12.8-19.4) µm, length of stomata 18.1 epidermal cell 18.5(17.5- 19.5)µm, size of stomatal µm, width of stomata 8.9µm. size of stomatal aperture is aperture 12.1 µm, length of guard cell 16.2 µm, width of 10.1 type of stomata anomocytic, peltate glands & hooked guard cell 13.9 µm, stomata type anomocytic to hair present, unicellular trichomes present, size of desmocytic, pellate gland & hooked hairs present, trichome is 40.8(7.5- 13) µm, base of trichome is rounded, Adaxial surface: Shape of epidermal cell irregular, length Adaxial surface: Length of epidermal cell 24.5(22-27) of epidermal cell 23.1(21-25.2) µm, width of epidermal µm width of epidermal cell 17.8(16-19.6) µm. stomata cell 18.8(15-22.6) µm, stomata absent, unicellular, non - absent, non-glandular and glandular unicellular trichomes glandular trichomes present, size of trichome 165(80-250) present, hookes hairs also present. Size of glandular µm, trichome base is rounded 139

trichome 17.5(12.5-22.5) µm with rounded base. While non-glandular trichome size 215 (80-350)µm, base rounded. Palynology Pollen in monad, medium sized 26-55µm, size of pollen in Pollen in monad, medium sized, pollen length in polar polar view 30(25-35)µm, size of pollen in equatorial view view 27(25-29) µm, pollen length in equitorial view 21 25(21-29)µm, P/E ratio 1.45, exine thickness 1.2µm, (20-22)µm, P/E ratio 1.13, sub-sphaeroidal shape f pollen, intine thickness 1.9 µm, circular shape in polar view, exine thickness 3.1 µm, intine thickness 2.8 µm, surface irregularly infolded surface pattern, aperture 3, porus, pattern scabrate, diporate or sometimes monoporate, porate, triporate, interspecific difference 0.9µm and pollen Circular aperture. Inter specific difference 1.3 and pollen fertility 77%. fertility 71%. Organoleptic Sweet and tasty Sweet and tasty analysis Solubility The obtained results of solubility analysis were presented in Table no. 4.8f analysis Part traded Fruits Fruits Medicinal Effective in throat infection, cough, cold, influenza, eye Allay thirst, laxative, control burning sensation and importance infection, nosebleed, diuretic, hypotensive, constipation temperature, asthma, pectoral, diuretic Herbal fibre is obtained from its bark used in weaving, dark Leaves decoction is useful in thickening and inflammation recipes purple or red- violet dye is synthesized from its fruits, of vocal cords. yellow-green dye from the leaves. 140

Morus nigra L. Morus alba L.

Plate 8a: Leaves of Morus Plate 8b: Leaves of Morus alba nigra

Plate 8c: Anomocytic type of Plate 8d: Paracytic type of stomata (LM) stomata (LM)

Plate 8e: Unicellular trichomes Plate 8f: unicellular and non (SEM) glandular trichmes (SEM) 141

Plate 8g: circular shape of Plate 8h: sub-spheroidal pollen pollen (LM) shape (LM)

Plate 8i: irregular surface Plate 8j: circular aperture of patteren of pollen (SEM) Pollen (SEM)

142

Table 4.8a: Qualitative morphological comparison between Morus nigra and Morus alba

Characters Morus nigra Morus alba

Habit of plant Medium sized tree Tree

Stem/Bark Tall main stem, wide spreading Tall main trunk, densely leafy crown & Rough bark crown & Dark brown

Inflorescence Catkin Catkin

Phyllotaxis Alternate Alternate

Leaf shape Broad, ovate Oblong, ovate

Leaf color Pubescent at lower surface Glabrous

Leaf venation Reticulate Pinnate

Flower Male and female flower Male & female flower on same produced separately on same plant plant

Sepal Free, broadly ovate Free, Broad, ovate

Petal Absent Absent

Anther Broad oval shape stamens, 4 Ovate exerted anther,

exerted anther 3-3.5mm

Carpel Broadly elliptic, divergent style Ovary green, broadly ellipsoid or obovoid

Fruit Fleshy, dark purple to black Fleshy

143

Table 4.8b: Quantitative morphological comparison between Morus nigra and Morus alba

Characters Morus nigra Morus alba

Height of plant 10m 8-12m sometimes 20m

Diameter of stem 1-2 m 1.5-2m

Petiole 1.3-5cm 2- 3.3cmlong

Leaf length 2-3.5cmlong 5-15cm long

Width of leaf 1.5cm 4-12cm wide

Flower Female catkins, 15-28mm, 6- Male catkins, 2.5-3.5cm,

8mm wide. Pistillate catkins, 1- Male catkins, 25-35mm long 2.5cm

Calyx 4.5-5mm 5.5mm

Corolla Absent Absent

Anther 15-25mm 13.5-25mm

Ovary 1.5-2mm 1-2cm

Fruits 1.6cm 1-2.5cm

144

Table 4.8c: Quanlitative morphological comparison between Morus nigra and Morus alba

Characters Adaxial surface Abaxial surface

Morus nigra Morus Morus nigra Morus alba alba

Shape of Polygonal Irregular Polygonal Irregular shape epidermal shape cell

Shape of Absent Absent Polygonal Not distinct subsidiary cells

Stomata type Absent Absent Anomocytic Anomocytic to desmocytic

Possibility of Present Present Present present trichome

Nature of Unicellular Hooked Unicellular Unicellular, Non trichome trichome cell Glandular and glandular present present non-glandular trichomes present trichome

145

Table 4.8d: Quantitative leaf epidermal anatomical comparison between Morus nigra and Morus alba

Characters Adaxial surface Abaxial surface

Morus Morus Morus Morus nigra alba nigra alba

Length of epidermal 24.5 23.1 25.8 22.9

cells (µm)

Width of epidermal 17.8 18.8 16.1 18.5 cells (µm)

Length of stomatal - - 10.1 12.1

perture (µm)

Length of guard cells - - 18.1 16.2 (µm)

Width of guard cells (µm) - - 8.9 13.9

No of subsidiary cells - - 5-6 5

146

Table 4.8e: Qualitative and quantitative palynological comparison between Morus nigra and Morus alba

Characters Morus nigra Morus alba

Pollen shape Circular Sub-sphaeroidal

Pollen polar length (µm) 30 27

Pollen equitorial length (µm) 25 21

P/E ratio 1.2 1.28

Exine thickness (µm) 1.2 3.1

Intine thickness (µm) 1.9 2.8

Colpi length (µm) absent Absent

Inter specific difference (µm) 0.9 1.3

Pollen fertility % 83 71 147

Table 4.8f: solubility analysis of different samples of Morus nigra in different solvents

Plant name Solubility in Color Solubility in HCl Color of Solubility in Color of Solubility in Water Color H2SO4 of sample Acetic acid sample of sample sample Cold test Hot test After Cold test Hot test After Cold test Hot test After Cold test Hot test After boiling boiling boiling boiling Sample 1 Partially Soluble Red Insoluble Insoluble Crane Insoluble Insoluble Golden Insoluble Insoluble Dark Soluble oxide berry metallic brown Sample 2 Partially Soluble Red Insoluble Insoluble Crane Insoluble Insoluble Golden Insoluble Insoluble Red Soluble oxide berry metallic oxide Sample 3 Partially Soluble Red Insoluble Insoluble Brass Insoluble Insoluble Golden Insoluble Insoluble Red Soluble oxide metallic oxide Sample 4 Partially Soluble Red Insoluble Insoluble Crane Insoluble Insoluble Golden Insoluble Insoluble Red Soluble oxide berry metallic oxide Sample 5 Partially Soluble Field Insoluble Insoluble Brass Insoluble Insoluble Red oxide Insoluble Insoluble Red soluble drab oxide Sample 6 Partially Soluble Field Insoluble Insoluble Brass Insoluble Insoluble Red oxide Insoluble Insoluble Red soluble drab oxide Sample 7 Partially Soluble Brown Insoluble Insoluble Crane Insoluble Insoluble Red oxide Insoluble Insoluble Dark soluble berry brown Sample 8 Partially Soluble Brown Insoluble Insoluble Crane Insoluble Insoluble Primrose Insoluble Insoluble Dark soluble berry brown Sample 9 Partially Soluble Field Insoluble Insoluble Crane Insoluble Insoluble Primrose Insoluble Insoluble Dark soluble drab berry brown Sample 10 Partially Soluble Field Insoluble Insoluble Crane Insoluble Insoluble Primrose Insoluble Insoluble Dark soluble drab berry brown Sample 11 Partially Soluble Brown Insoluble Insoluble Crane Insoluble Insoluble Red oxide Insoluble Insoluble Dark soluble berry brown Sample 12 Partially Soluble Brown Insoluble Insoluble Brass Insoluble Insoluble Red oxide Insoluble Insoluble Dark soluble brown 148

Figure 4.8a: Quantitative morphological comparison between Morus nigra and Morus alba

Width of guard cells µm

Length of guard cells µm Abaxial surface Morus alba Size of stomatal aperture Abaxial surface Morus nigra µm Adaxial surface Morus alba

Width of epidermal cells µm Adaxial surface Morus nigra

Length of epidermal cells µm

0 10 20 30

Figure 4.8b: Quantitative leaf epidermal anatomical comparison between Morus nigra and Morus alba 149

Figure 4.8c: Quantitative palynological comparison between Morus nigra and Morus alba

150

DNA Analysis

For the DNA barcoding of marketed and fresh plant samples, list of seven pairs of primers (Table 3.7) (matK, rbcL, nrITS, TrnH, PsbA, CO1 and trnH-psbA ) were selected through literature review. Among these COI and PsbA did not show PCR amplification at gradient temperature 50ᵒ, 52ᵒ, 54ᵒ, 56, 58ᵒ and even on 60ᵒc. while trnH-psbA was used in combination with trnH. All these primers showed positive amplification results at different temperatures.

Out of seven, four primers i.e. matK, nrITS, rbcL and TrnH-PsbA showed good results of PCR based amplification of conserved regions of marketed as well as its fresh plant sample. All four pairs of primers gave the specific size of amplicon as matK (≤900 BP), nrITS (≤750BP), rbcL (≤750BP) and TrnH-PsbA (≥700) for each plant sample. DNA sequences were cleaned by using Blast and contigs were constructed using DNAstar applications (Lasergen Inc. USA).

151

4.1b: Cinnamomum verum `

In the case of Cinnamomum verum, all four pairs of primers gave the specific size of amplicon as matK (950BP), nrITS ( 770BP), rbcL (750BP) and TrnH-PsbA (580BP).

The phylogenetic tree was constructed by using matK primer along with most similar sequences retrieved from database. This tree was split in two clade A, B and clade A was divided into A1 and A2. Fresh sample of C. verum was showed its resemblance with database C. verum (Accession # KP318142). In A1 sample 5 and 12 clustered together which were also grouped with sample 10 and all of three samples showed their association with Pulchea species (Accession # MF963766). However in clade B sample 1 exhibited its linkage different species of Prunus (Accession # KY419991, KX255667, MF621234) (Figure 4.1d).

Figure 4.1d: Phylogenetic analysis of matK sequences of marketed samples of Cinnamomum verum. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for the phylogenetic tree construction in Mega 6 software tool. 152

The following tree of Cinnamomum verum formed by nrITS primer represented tree division into two clades i.e., A and B. Both of these clades were further categorized into multiple subclades. Results demonstrated that nrITs primer was not worthwhile for amplification of fresh sample DNA. However sample 1 was associated with Vigna radiata (Accession # HQ148145) and sample 10 was found allied with Spharenthus indicus (Accession # LN607576) (Figure 4.1e).

Figure 4.1e: Phylogenetic analysis of nrITS sequences of marketed samples of Cinnamomum verum. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for the phylogenetic tree construction in Mega 6 software tool.

153

The phylogenetic tree was constructed by using rbcL primer along with most similar sequences retrieved from database. This tree segmented into two clades A and B in which A was further divided and subdivided. In clade A1 sample 1 showed its relationship with two accessions of Vigna radiata (Accession # X89403, MG946875). Moreover sample 10 and 3 also lie in clade A1 but sample 10 was linked with Phaseolus coccineus (Accession# LT576851) and 3 was found associated with Ericameria nauseosa (Accession# KY584327). However sample 11 and fresh sample showed their association with the database retrieved C. verum (Accession # KF744230) (Figure 4.1f).

Figure 4.1f: Phylogenetic analysis of rbcL sequences of marketed samples of Cinnamomum verum. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for the phylogenetic tree construction in Mega 6 software tool.

154

The phylogenetic tree of Cinnamomum verum amplified by trnH -psbA primer divided into clades A and B. The fresh C. verum sample was linked with available database accession # KF978093 of C. verum. It was observed that this primer did not show significant amplification with marketed sample except sample 11. Moreover this sample 11 was found to be non-genuine (adulterated) because it grouped with two accessions of Buddleja lindleyana (Accession # KP095524, KP095525) (Figure 4.1g).

Figure 4.1g: Phylogenetic analysis of psbA-trnH sequences of marketed samples of Cinnamomum verum. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for the phylogenetic tree construction in Mega 6 software tool.

155

A B

C D

Figure 4.1h: PCR amplification of Cinnamomum verum fressh sample and market sample with matK primers (Panel A). Lane A, B, C, D showing amplified fragment from market sample (1,5,10 and 12). Lane Fr showing fresh sample and Lane NC is Negative Control. Lane L is showing 1kb Ladder (Thermo Fisher Scientific, USA). With nrITS primers (Panel B). Lane A and B showing from market samples (1, 10). Lane NC for Negative Control and Lane L is showing 1kb Ladder (Thermo Fisher Scientific, USA). With rbcL primers (Panel C). Lane A, B, C and D showing amplified PCR band from market samples (1,3,10,11 and 12 respectively). Lane Fr showing fresh sample fragment and Lane L is showing 1kb Ladder (Thermo Fisher Scientific, USA). With TrnH-PsbA primers (Panel D). Lane A showing amplified PCR band from market samples (11). Lane Fr showing fresh sample fragment, Lane NC for Negative Control and Lane L is showing 1kb Ladder (Thermo Fisher Scientific, USA).

These 12 market samples and one fresh sample of C.verum as positive control were analysed by DNA barcode sequences and found that out of 12 marketed samples none showed closed relationship with C.verum using four different barcode sequences. Fresh sample of C. verum analysed with 3 different barcode sequences (matK, rbcL and trnH -psbA) and it proved as C. verum with all three barcode sequences.

156

4.2b: Cinnamomum tamala

These primer pairs matK, nrITS, rbcL, TrnH-PsbA presented the specific amplicon size i.e. matK (930BP), nrITS ( 700BP), rbcL (760BP) and TrnH-PsbA (320BP).

The phylogenetic tree was constructed by using matK primer along with most similar sequences retrieved from database. The tree showed fresh sample resemblance with database Cinnamomum tamala (Accession # MF685880). Moreover sample10 was found related with two accessions (EU153829 and GU135093) of C. camphora, while sample 6 was lied in a separate subclade of clade A and it was also clustered with C. camphora (Accession # EU153829). Similarly sample 3, 5, 8 were also found in separate subclade of A but clustered together and linked with different accessions of Prunus species (Accession # KX238385, KX2383851). The sample 12 was linked with Budleja utahensis (Accession # MF963475) and Oftia africana (Accession # FN77355). However, sample 8 and 9 exhibited their relationship with Prunus armenica (Accession # KP89842) and P. sibirica (Accession # KP089853) (Figure 4.2d).

Figure 4.2d: Phylogenetic analysis of matK sequences of marketed samples of Cinnamomum tamala. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for the phylogenetic tree construction in Mega 6 software tool. 157

The phylogenetic tree was constructed by using nrITS primer along with most similar sequences retrieved from database. Tree represented that sample 1 and 6 closely related to each other and laid in a separate subclade of A. However sample 10 resembled with two accessions of Foeniculum vulgare (Accession # HQ377210, HQ377212) and sample 2 also linked with the similar species of Foeniculum but different accession (Accession # HQ377209). The fresh sample was clustered with C. tamala of database (Accession # KX822088). Sample 7 and 11 of C. tamala were grouped together but branch in separate clade (Figure 4.2e).

Figure 4.2e: Phylogenetic analysis of nrITS sequences of marketed samples of Cinnamomum tamala. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for the phylogenetic tree construction in Mega 6 software tool.

158

Following tree of rbcL primer exhibited that sample 5 was isolated in subclade of A. Similarly sample 3, 4 and 10 were also grouped in distinct suclades of A but sample 3 and 4 somehow showed resemblances with each other, whereas sample 10 showed a little bit linkage with C. micaranthum (Accession # KP833081). However the fresh sample was clustered with database available C. tamala (Accession # KY945251). Furthermore sample 1 showed its associations with two accessions of Vigna radiata (Accession # MG946875 and X89403), whereas sample 2 and 7 were grouped together and linked with different species of Prunus (Figure 4.2f).

Figure 4.2f : Phylogenetic analysis of rbcL sequences of marketed samples of Cinnamomum tamala. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for the phylogenetic tree construction in Mega 6 software tool.

159

The following tree of trnH-psbA reported the association of sample 5 with multiple species of Artemisia (Accession # KU555805, KU555808, KX581943 and MG947068). Sample 4 and 5 were found in distinctive subclades of A but somewhat related to each other. Furthermore sample 2 showed its linkage with Prunus incisa (Accession # AB254603), while 9 was clustered with two accessions of Laurus nobilis (Accession # KU160272 and HM019399). Sample 6 was also associated with Laurus nobilis but to a different accession i.e. HG96685 (Figure 4.2g).

Figure 4.2g : Phylogenetic analysis of psbA-trnH sequences of marketed samples of Cinnamomum tamala. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for the phylogenetic tree construction in Mega 6 software tool.

160

A B

C D

Figure 4.2h: PCR amplification of Cinnamomum tamala fresh sample and market sample with matK primers (Panel A). Lane A, B, C, D, E, F, G, H and I showing amplified fragment from market sample (2, 3, 5, 6, 8, 9, 10 and 12). Lane Fr showing fresh sample and Lane NC is Negative Control. Lane L is showing 1kb Ladder (Thermo Fisher Scientific, USA). With nrITS primers (Panel B). Lane A, B, C, D, showing from market samples (1, 10). Lane NC for Negative Control and Lane L is showing 1kb Ladder (Thermo Fisher Scientific, USA). With rbcL primers (Panel C). Lane A, B, C and D showing amplified PCR band from market samples (1,3,10,11 and 12 respectively). Lane Fr showing fresh sample fragment and Lane L is showing 1kb Ladder (Thermo Fisher Scientific, USA). With TrnH- PsbA primers (Panel D). Lane A showing amplified PCR band from market samples (11). Lane Fr showing fresh sample fragment, Lane NC for Negative Control and Lane L is showing 1kb Ladder (Thermo Fisher Scientific, USA).

Overall results showed that fresh sample of C. tamala was amplified with three barcodes (matK, nrITS and rbcL) which confirmed that fresh sample of C. tamala was genuine. Moreover none of the marketed samples had showed association with C. tamala.

161

4.3b: Gymnema sylvestre

In the case of Gymnema four pairs of primers showed the specific amplicon sizes like matK (950BP), nrITS ( 970BP), rbcL (670BP) and TrnH-PsbA (550BP).

Phylogenetic analysis of marketed sample and fresh plant sample amplified by matK primer and maximum similarity showing sequence downloaded from database showed that all the sequence were grouped into two clades which were further subdivided. Clade “A” showed that fresh sample of Gymnema sylvestre was close to G. sylvestre (accession KX911179) available in the database. Moreover market samples 2, 9 and 11 also resembled with G. sylvestre (Accession # KX911179). It revealed that these samples (2, 9 and 11) were genuine. However adulteration had been observed in market sample 4 as it showed its association with Dregea sinesis (Accession # Z98188). Whereas sequences derived from database were grouped in clade “B” (Figure 4.3d).

Figure 4.3d : Phylogenetic analysis of matK sequences of fresh and marketed samples of Gymnema sylvestre. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for the phylogenetic tree construction in Mega 6 software tool. 162

The phylogenetic tree of the fresh, marketed and database samples were constructed by nrITS primer which showed that all the samples were divided in two clades A and B. Clade B was further divided into B1 and B2. Clade B1 showed sample 6 of Gymnema sylvestre while in clade B2 all the data base sequence were grouped separately. Similarly clade A was also subdivided into clade A1 and A2. The clade A2 showed fresh sample of G. sylvestre while clade A1 was further subdivided into subclade. G. sylvestre sample 1 segregate separately and sequence derived from database further segregate separately (Figure 4.3e).

Figure 4.3e: Phylogenetic analysis of nrITS sequences of fresh and marketed samples of Gymnema sylvestre. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for the phylogenetic tree construction in Mega 6 software tool.

163

This the phylogenetic tree was divided into two clades “A” and “B”. Clade A was further divided into subclade A1 and A2 which were subdivided into many subclades. Sample 11 was closely grouped with fresh sample of Gymnema sylvestre and both of these were also related to data base available G. sylvestre (Accession # KX346051). Similarly sample 9 also showed close relation with Accession # KX346051 but sample 5 was found to be associated with Accession # KJ667632 of G. sylvestre. However Sample 7, 8 were grouped with different species of Gymnema i.e G. caspidatum (Accession # HG530554), whereas sample 6 was felled in separate clade B1 and linked with two accessions of Vigna radiata (Accession # X89403, MG94687) (Figure 4.3f).

Figure 4.3f: Phylogenetic analysis of rbcL sequences of fresh and marketed samples of Gymnema sylvestre. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for the phylogenetic tree construction in Mega 6 software tool.

164

The phylogenetic tree was constructed by using psbA-trnH primer along with most similar sequences retrieved from database. This tree represented that sample 1 of Gymnema sylvestre showed its resemblance with G. sylvestre from database (Accession # KX910859) while sample 2, 4, 11 clustered together and have close relation with Telosoma africana (Accession AM231773). Similarly sample 6 of G. sylvestre closely grouped with two cultivars of Vigna radiate (Accession # KT224676 and KT224683). However, fresh sample of G. sylvestre did not show amplification with this primer (Figure 4.3g).

Figure 4.3g: Phylogenetic analysis of psbA-trnH sequences of fresh and marketed samples of Gymnema sylvestre. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for the phylogenetic tree construction in Mega 6 software tool.

165

A B

C D

Figure 4.3h: PCR amplification of Gymnema sylvestre fresh sample and market sample with matK primers (Panel A). Lane A, B, C and D showing amplified fragment from market sample (2, 4, 9 and 11). Lane Fr showing fresh sample and Lane NC is Negative Control. Lane L is showing 1kb Ladder (Thermo Fisher Scientific, USA). With nrITS primers (Panel B). Lane A and B showing from market samples (1and 6). Lane Fr showing fresh sample and NC for Negative Control. Lane L is showing 1kb Ladder (Thermo Fisher Scientific, USA). With rbcL primers (Panel C). Lane A, B, C, D, E and F showing amplified PCR band from market samples (5,6,7,8,9 and 11 respectively). Lane Fr showing fresh sample fragment, lane NC for negative control and Lane L is showing 1kb Ladder (Thermo Fisher Scientific, USA). With TrnH-PsbA primers (Panel D). Lane showing amplified PCR band from market samples (). Lane Fr showing fresh sample fragment, Lane NC for Negative Control and Lane L is showing 1kb Ladder (Thermo Fisher Scientific, USA).

It can be concluded from the results that fresh sample of Gymnema sylvestre was authentic because it showed its association with database retrieved Gymnema sylvestre by using 3 barcodes (matk, nrITS and rbcL). Moreover sample 1, 2, 5, 9 and 11 were also closely related to database retrieved Gymnema sylvestre which confirmed their authenticity. However remaining all samples were adulterated with different species. 166

4.4b: Sphaeranthus indicus

All four pairs of primers gave the specific size of amplicon as matK (930BP), nrITS ( 710BP), rbcL (690BP) and TrnH-PsbA (630BP).

The matk primer based phylogenetic tree exhibited that this primer was not recommended in case of S. indicus DNA amplification because it amplified only one sample out of twelve. Moreover this sample 8 did not match with any of the database available accessions and found in a separate clade (Figure 4.4d).

Figure 4.4d: Phylogenetic analysis of matK sequences of marketed samples of Sphaeranthus indicus. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used forconstruction in Mega 6 software tool.

167

The tree formed by nrITS primer represented that fresh sample and sample 2, 6, 7, 8 were genuine because of their close relationship with Sphaeranthus indicus of database (Accession # LN607576). While sample 5 was matched with two accessions of Averrhoa carambola i.e. Accession # MF349621 and AY935743 (Figure 4.4e).

Figure 4.4e: Phylogenetic analysis of nrITS sequences of fresh and marketed samples of Sphaeranthus indicus. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for the phylogenetic tree construction in Mega 6 software tool.

168

The rbcL phylogentic tree displayed that 2, 8, 9, 10 and 12 were showed close relations with Sphaeranthus indicus (Accession # IQ933489). The sample 6 and 7 resembled with Diplostephium hippophae (Accession # KX063944). Moreover fresh sample showed its linkage with database mentioned Sphaeranthus indicus (Accession # JQ933489) (Figure 4.4f).

Figure4.4f: Phylogenetic analysis of rbcL sequences of fresh and marketed samples of Sphaeranthus indicus. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for the phylogenetic tree construction in Mega 6 software tool.

169

The phylogenetic tree of trnH-psbA exhibited that sample 6 and 7 were grouped with the different species of Pulchea (Accession # LN607359, LN607358 and LN607346). Results also demonstrated that sample 8 linked with S. flexuosus (Accession # LN607393) and fresh sample associated with S. indica (Accession # MG947106) (Figure 4.4g)

Figure 4.4g: Phylogenetic analysis of psbA-trnH sequences of fresh and marketed samples of Sphaeranthus indicus. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for the phylogenetic tree construction in Mega 6 software tool.

170

A B

C D

Figure 4.4h: PCR amplification of Sphaeranthus indicus fresh sample and market sample with matK primers (Panel A). Lane A showing amplified fragment from market sample (8). Lane Fr showing fresh sample and Lane NC is Negative Control. Lane L is showing 1kb Ladder (Thermo Fisher Scientific, USA). With nrITS primers (Panel B). Lane A, B, C, D and E showing from market samples (2,5,6,7 and 8). Lane NC for Negative Control and Lane L is showing 1kb Ladder (Thermo Fisher Scientific, USA). With rbcL primers (Panel C). Lane A, B, C, D, E, F and G showing amplified PCR band from market samples (2,6,7,8,9,10 and12 respectively). Lane Fr showing fresh sample fragment and Lane L is showing 1kb Ladder (Thermo Fisher Scientific, USA). With TrnH-PsbA primers (Panel D). Lane A, B and C showing amplified PCR band from market samples (6,7 and 8 respectively). Lane Fr showing fresh sample fragment, Lane NC for Negative Control and Lane L is showing 1kb Ladder (Thermo Fisher Scientific, USA).

On the whole five marketed samples i.e. sample 2,6,8,9 and 12 were regarded as the original Sphaeranthus indicus, whereas reaming samples showed adulteration. Furthermore the fresh sample was amplified with all primers (rbcL, nrITS, trnH - psbA) except matK and it was also found related to database Sphaeranthus indicus which assured its authenticity.

171

4.5b: Artemisia maritima

The specific amplicon size in the case of Artemisia maritima was observed, i.e. matK (910BP), nrITS ( 790BP), rbcL (770BP) and TrnH-PsbA (380BP).

The phylogenetic tree of Artemisia maritima based on matK primer showed that sample 7, 8, 9 were grouped together and they represented a close relationship with Chrysanthemum indicum (Accession # JN867589) and A. gmelinii (Accession # KY085890). The sample 10 was linked with two accessions of Coriandum sativum (Accession # KP900778 and MG946959) (Figure 4.5d).

Figure 4.5d: Phylogenetic analysis of matK sequences of fresh and marketed samples of Artemisia maritima. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for the phylogenetic tree construction in Mega 6 software tool.

172

The phylogenetic tree of Artemisia maritima formed by nrITS primer represented that fresh sample was closely related to database available Artemisia maritima (Accession # KC493077). However sample 9 was associated with three accessions of A. absinthium i.e. JX051763, HQ019033 and KX581789. The sample 5 also showed its relationship with the similar accession of A. absinthium (Accession # KX581789). The sample 11 and 8 were showed their association with A. absinthium accessions # KX581790 and HQ019033 respectively. However sample 7 was linked with three accessions of A. absinthium (Accession # EF577289, KX581787, KX581788). Furthermore the Accession # KX581788 also resembled with sample 4 (Figure 4.5e).

Figure 4.5e: Phylogenetic analysis of nrITS sequences of fresh and marketed samples of Artemisia maritima. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for the phylogenetic tree construction in Mega 6 software tool. 173

The rbcL amplified phylogenetic tree of Artemisia maritima was segmented into two main clades A and B, which again divided into A1, A2 and B1, B2 respectively. Results demonstrated that sample 7 was closely linked with sample 11 and both of these were associated with A. myriantha (Accession # LT576796). Moreover sample 6 and 9 were related to two accessions of A.vulgaris i.e. KX58204 and KM360653. Whereas sample 12 resembled to three accessions of Achillea millefolium (Accession # EU384938, L13641, MH360739) and sample 10 were found to be associated with three accessions of Coriandum sativum (Accession # MG946829, KR002656 and KP974252) (Figure 4.5f).

Figure 4.5f: Phylogenetic analysis of rbcL sequences of fresh and marketed samples of Artemisia maritima. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for the phylogenetic tree construction in Mega 6 software tool.

174

Phylogeny of Artemisia maritima amplified by trnH-psbA primer showed that tree was divided into clades A and B, in which A was further categorized into subclades while B was remained undivided. In this tree sample 5 was found to be linked with A. grgyi (Accession # KU555784), similarly both sample 7 and 11 were also showed their relationship with A. grgyi (Accession # KU555809) (Figure 4.5g).

Figure 4.5g: Phylogenetic analysis of psbA-trnH sequences of marketed samples of Artemisia maritima. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for the phylogenetic tree construction in Mega 6 software tool.

175

A B

C D

Figure 4`.5h: PCR amplification of Artemisia maritima fresh sample and market sample with matK primers (Panel A). Lane A,B,C and D showing amplified fragment from market sample (7,8,9 and 10). Lane NC is Negative Control and lane L is showing 1kb Ladder (Thermo Fisher Scientific, USA). With nrITS primers (Panel B). Lane A, B, C, D, E and F showing from market samples (4,5,7,8,9 and 11). Fr showing fresh sample fragment and Lane NC for Negative Control. Lane L is showing 1kb Ladder (Thermo Fisher Scientific, USA). With rbcL primers (Panel C). Lane A, B, C, D, E and F showing amplified PCR band from market samples (6,7,9,10,11 and12 respectively). Lane NC for Negative Control and lane L is showing 1kb Ladder (Thermo Fisher Scientific, USA). With TrnH-PsbA primers (Panel D). Lane A, B, C and D showing amplified PCR band from market samples (5,7, 9 and 11 respectively). Lane Fr showing fresh sample fragment, Lane NC for Negative Control and Lane L is showing 1kb Ladder (Thermo Fisher Scientific, USA).

For this medicinal species only nrITS primer was capable for amplification of fresh sample and it was proved as Artemisia maritima. This plant also showed high level of adulteration because none of the 12 samples were associated with database retrieved Artemisia maritima.

176

4.6: Butea monosperma

Kamarkah or kamarkus is a famous herbal product for backache treatment and it sold in herbal markets in the form of resin crystals. The authenticity of these resin crystal is quite challenging and under high risk of adulteration. As the resin crytals are acellular in their nature, therefore they cannot be authenticate via DNA barcoding. Hence, the whole plant material was demanded from the herbalist in order to pursue the DNA analysis. The provided plant material from the herbalist then subject for DNA barcoding procedures and obtained results were presented as followed.

The amplicon size for these four primers was calculated as matK (930BP), nrITS ( 770BP), rbcL (650BP) and TrnH-PsbA (350BP).

The phylogenetic tree of matK primer divided into two clade A and B. The clade A was divided into A1 and A2 subclades while clade B was undivided. Result revealed that fresh sample of B. monosperma was grouped with two database accessions of B. monosperma i.e Accession # JN008175, KY628018. However the plant sample provided by the herbalist was found to be adulterated with Morus alba (JN407155) and Morus indica (Accession # KF96164) (Figure 4.6d).

Figure 4.6d: Phylogenetic analysis of matK sequences of fresh and marketed samples of Butea monosperma. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for the phylogenetic tree construction in Mega 6 software tool. 177

Results represented that the phylogenetic tree amplified by nrITS primer was divided into clades A and B, which were further subdivided multiple sublcades. It exhibited a close relationship between fresh sample and B. monosperma (Accession # JX856412) already given in database. Whereas the plant provided by the herbalist was associated with two species of Morus (Accession # KJ606377 and KU355297). This indicated adulteration in marketed sample of this medicinal herb (Figure 4.6e).

Figure 4.6e: Phylogenetic analysis of m sequences of fresh and marketed samples of Butea monosperma. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for the phylogenetic tree construction in Mega 6 software tool.

178

Phylogeny of Butea monosperma amplified by rbcL primer displayed fresh sample association with B. monosperma (Accession # MG946938). Conversely herbalist provided plant sample was grouped with three different accessions of Averrhoa carambola i.e. KX364202, KU569488 and FJ670180. This affirmed that marketed samples were not genuine source of medicine (Figure 4.6f).

Figure 4.6f: Phylogenetic analysis of rbcL sequences of fresh and marketed samples of Butea monosperma. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for the phylogenetic tree construction in Mega 6 software tool.

179

The particular phylogenetic tree formed by TrnH-psbA primer was distributed in two main clades A and B. Clade A was further categorized into A1 and A2, in which A1 was again subdivided, whereas clade B was split into B1 and B2. Moreover this tree explained that fresh B.monosperma sample was ressembled to Accession # KY628024. It was also observed that herbalist provided sample was not in its original form as it showed resemblances with Averrhoa carambola (Accession # KX364202 and MF38551) (Figure 4.6g).

Figure 4.6g: Phylogenetic analysis of TrnH-psbA sequences of fresh and marketed samples of Butea monosperma. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for the phylogenetic tree construction in Mega 6 software tool.

180

A B

C D

Figure 4.6h: PCR amplification of Butea monosperma fresh sample and herbalist provided sample with matK primers (Panel A). Lane A showing amplified fragment from market sample (herbalist provided). Lane Fr showing fresh sample fragment and lane L is showing 1kb Ladder (Thermo Fisher Scientific, USA). With nrITS primers (Panel B). Lane A showing from market samples (herbalist provided). Fr showing fresh sample fragment and Lane NC for Negative Control. Lane L is showing 1kb Ladder (Thermo Fisher Scientific, USA). With rbcL primers (Panel C). Lane A showing amplified PCR band from market samples (herbalists provided sample). Lane Fr for fresh sample fragment and lane L is showing 1kb Ladder (Thermo Fisher Scientific, USA). With TrnH-PsbA primers (Panel D). 181

Lane A showing amplified PCR band from market samples (herbalists provided sample). Lane Fr showing fresh sample fragment, Lane NC for Negative Control and Lane L is showing 1kb Ladder (Thermo Fisher Scientific, USA).

In case of this medicinal species, the two kinds of fresh samples (provided by herbalist and collected from its habitat) were compared on the basis of DNA analysis. Results presented that fresh sample which was collected from its original habitat showed amplification with all of the studied barcodes and it was also proved genuine. Whereas the herbalist provided fresh sample regarded as non-genuine source of drug because it did not showed any association with database Butea monosperma.

182

4.7b: Achillea millefolium

All four pairs of primers gave amplification of Achillea millefoliumt and produced specific size of amplicon, i.e. matK (910 BP), nrITS (679 BP), rbcL (709 BP) and TrnH-PsbA (548).

Phylogenetic results showed that matK sequences of fresh sample Achillea millefolium L. was closely grouped with Achillea millefolium already available in the databases (Accession # EU385315), and market sample 1, 2, 5 and 8 have closely related to Prunus species, Justicia adhatoda (Accession # KY828464), Deinbollia kilimandscharica (Accession # JN191116) and different species of Morus genus respectively (Figure 4.7d).

Figure 4.7d: Phylogenetic analysis of matK sequences of fresh and marketed samples of Achillea millefolium. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for the phylogenetic tree construction in Mega 6 software tool. 183

Amplified samples with nrITS primer sequence phylogenetic analysis showed that market sample 1 and 9 are closely related with Vigna radiata (Accession # LC193790), sample 7 with Foeniculum vulgare cultivar (Accession # HQ377210), sample 8 with Morus alba (Accession # HQ144172) and sample 11 closely related with Foeniculum vulgare (Accession # FJ980395) (Figure 4.7e).

Figure 4.7e: Phylogenetic analysis of nrITS sequences of marketed samples of Achillea millefolium. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for the phylogenetic tree construction in Mega 6 software tool. 184

While in case of rbcL fresh sample showed closely relation with Achillea millefolium (Accession # KM360610) and other market samples 3, 5, 6, 8, 9, 10 and 11 showed their closely/ relation with Monechma (Accession # AB586154), Sphaeranthus indicus voucher (Accession # JQ933489), Sorbaria sorbifolia (Accession # KY419928), Morus australis (Accession # KY420004), Vigna radiata (Accession # AP014692), Justicia adhatoda voucher (Accession # JQ231000) and Sorbaria sorbifolia (Accession # KY419928) respectively (Figure 4.7f).

Figure 4.7f: Phylogenetic analysis of rbcL sequences of marketed samples of Achillea millefolium. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for the phylogenetic tree construction in Mega 6 software tool. 185

By using TrnH-PsbA primers we amplified one fresh and two market samples. Fresh sample showed closely relation with Achillea millefolium (Accession # MF348813), market sample 9 and 10 closely related with Vigna radiata cultivar (Accession # KT224678) and Justicia candicans voucher (Accession # KT161342) (Figure 4.7g).

Figure 4.7g: Phylogenetic analysis of TrnH-psbA sequences of marketed samples of Achillea millefolium. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for the phylogenetic tree construction in Mega 6 software tool.

186

Figure 4.7h: PCR amplification of Achillea millifolium L fresh sample and market sample with matK primers (Panel A). Lane A, B showing amplified fragment from market samples (1 and 2 respectively). Lane Fr showing fresh sample and Lane NC is Negative Control. Lane L is showing 1kb Ladder (Thermo Fisher Scientific, USA). With nrITS primers (Panel B). Lane A, B, C, D and E showing from market samples (1, 7, 8, 9 and 11 respectively). Lane NC for Negative Control and Lane L is showing 1kb Ladder (Thermo Fisher Scientific, USA). With rbcL primers (Panel C). Lane A, B, C, D, E, F and G showing amplified PCR band from market samples (3,5,6,8,9,10 and 11 respectively). Lane Fr showing fresh sample fragment, Lane NC for Negative Control and Lane L is showing 1kb Ladder (Thermo Fisher Scientific, USA). With TrnH-PsbA primers (Panel D). Lane A and B showing amplified PCR band from market samples (9 and 10 respectively). Lane Fr showing fresh sample fragment, Lane NC for Negative Control and Lane L is showing 1kb Ladder (Thermo Fisher Scientific, USA).

These 12 market samples and one fresh sample of Achillea millefolium as positive control were analysed by DNA barcode sequences and found that out of 12 marketed samples none showed closed relationship with Achillea millefolium using four different barcode sequences. Fresh sample of Achillea millefolium analysed with 3 different barcode sequences and it proved as Achillea millefolium with all three barcode sequences. 187

4.8b: Morus nigra

Morus nigra amplified with these four pairs of primers and gave specific amplicon size, i.e. matK (930BP), nrITS ( 790BP), rbcL (760BP) and TrnH-PsbA (750BP).

The following tree of Morus nigra samples (formed by matK primer) was branched into two clades A and B. In clade A, both samples 9 and 10 were showed their relation with Morus indica (Accession # KJ606382). Moreover the sample 11 was resembled to M. australis (Accession # KY420004) and M. indica (Accession # KJ606375). In clade B sample 2 showed its association with M. alba (Accession # JN07155) and M. nigra (Accession # JX495737). However, fresh sample was correlated with M. nigra (Accession # JX495737) of database (Figure 4.8d).

Figure 4.8d: Phylogenetic analysis of matK sequences of marketed samples of Morus nigra. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for the phylogenetic tree construction in Mega 6 software tool.

188

The phylogenetic tree based on nrITS primer showed that fresh sample was linked with the database listed M. nigra (Accession # AM042002). Sample 6 found to be associated with M. australis (Accession # AY345152) whereas both sample 10 and 11 were showed their relation with M. alba (Accession # FJ599759). However sample 12 was observed to be solitary in clade B (Figure 4.8e).

Figure 4.8e: Phylogenetic analysis of nrITS sequences of marketed samples of Morus nigra. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for the phylogenetic tree construction in Mega 6 software tool.

189

The tree formed by rbcL primer exhibited that sample 6 and 12 were closely related with M. rubra (Accession # U06812) and M. alba (Accession # JN40732). Furthermore sample 5 showed its relationship with M. notabilis (Accession # KO939360). However both sample 10 and 11 were found genuine as it resembled with the database available M. nigra (Accession # DQ22651). The fresh sample also linked with database M. nigra (Accession # AB194400) (Figure 4.8f).

Figure 4.8f: Phylogenetic analysis of rbcL sequences of marketed samples of Morus nigra. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for the phylogenetic tree construction in Mega 6 software tool.

190

The tree formed by psbA primer represented two main clades A and B in which A further segmented into A1 and A2. In this tree sample 6 showed linkages with M. alba (Accession # KC584956), while sample 10 and 12 resembled to M. indica (Accession # DQ226511). However, fresh sample was associated with M. nigra (Accession # KU306840) (Figure 4.8g).

Figure 4.8g: Phylogenetic analysis of TrnH-psbA sequences of marketed samples of Morus nigra. Other sequences were retrieved from the databases based on BLAST analysis. Neighbour joining algorithm was used for the phylogenetic tree construction in Mega 6 software tool.

191

A B

C D

Figure 4.8h: PCR amplification of Morus nigra fresh sample and market sample with matK primers (Panel A). Lane A,B,C and D showing amplified fragment from market sample (2,9,10 and 11 ). Lane NC is Negative Control and lane L is showing 1kb Ladder (Thermo Fisher Scientific, USA). With nrITS primers (Panel B). Lane A, B, C and D showing from market samples (6,10,11 and 12). Fr showing fresh sample fragment and Lane NC for Negative Control. Lane L is showing 1kb Ladder (Thermo Fisher Scientific, USA). With rbcL primers (Panel C). Lane A, B, C, D and E showing amplified PCR band from market samples (5, 6,10,11 and12 respectively). Lane Fr showing fresh sample fragment, Lane NC for Negative Control and lane L is showing 1kb Ladder (Thermo Fisher Scientific, USA). With TrnH-PsbA primers (Panel D). Lane A, B and C showing amplified PCR band from market samples (6, 10 and 12 respectively). Lane Fr showing fresh sample fragment, Lane NC for Negative Control and Lane L is showing 1kb Ladder (Thermo Fisher Scientific, USA).

Generally the fresh samples of Morus nigra was amplified with all of barcodes and also ascertained as Morus nigra because of its close association with database Morus nigra. Among all 12 marketed samples only sample no. 2, 10, and 11 were found to be genuine.

192

In the present study, 12 different samples of each selected medicinal plants (Cinnamomum verum, Cinnamomum tamala, Gymnema sylvestre, Sphaeranrhus indicus, Artemisia maritima, Achillea millefolium, Butea monosperma and Morus nigra) were purchased from different shops of local herbal markets (Akbari and Asghari mandi) of Lahore Pakistan. As these marketed medicinal plants are sold in dried form therefore they usually faced authentication problems. Therefore current study was undertaken not only to highlight adulteration issue in herbal markets of Lahore but also to provide some basic and advanced markers for the identification of these valuable medicinal plants. 5.1: Authentication of selected medicinal plants on the basis of classical markers

5.1.1: Authentication of Cinnamomum verum vs Canella winterana

The morphological distinctions hold an important position in order to answers the elementary questions about plant identification (Ge and Hong, 1995 and Mirahmadi et al., 2012). They play key role in catogerization of several taxa into different genera and in tribes (Andrew and Kellogg, 2002). Willis (2005) stated that morphological features can be supportive in distinguishing medicinal species from each other by variances in their habit, habitat, inflorescence and floral morphology etc. These morphological characters provide basic differentiation between Cinnamomum verum from its adulterant plant Canella winterana. Habit of plant, stem and bark, inflorescence and phyllotaxis were proved to be significant and distinct variable character (Figure 4.1a). Such as axillary inflorescence type and opposite phyllotaxis in C. verum was observed whereas panicle type of inflorescence and alternate cluster phyllotaxis were found in C. winterana. Whereas leaf shape, color, leaf venation, flower and parianth were overlapping characters between these two species (Table 4.1a, 4.1b).

Anatomical characters were also found helpful in distinguishing medicinally important plant Cinnamomum verum from its adulterant Canella winterana. As shape and length of epidermal cell showed remarkable variation, i.e. larger size (80.4 µm) with irregular cell shape was observed in C. verum while smaller cell size (40.5 µm) and pentagonal shape was found in C. winterana (Figure 4.1b). The results of the

193 present study were in accordance to the results of Ravindran et al. (2005). Similarly, type of stomata was also different in both the species i.e. anomocytic stomatal type was found in C. verum while paracytic type was observed in C. winterana. Ravindran et al. (2005) in his studies concluded that stomata type was an important diagnostic tool to identify the Cinnamomum species. Length of guard cells and stomatal aperture also showed significant variation, both the values of stomatal aperture and length of guard cells was greater 10.1 µm and 30.7 µm respectively in C. verum and their least value 7.6 µm and 24.3 µm were calculated in C. winterana. Number of subsidiary cells also varied in both the species, as 4 subsidery cells were observed in C. verumn whereas 2 cells were observed in C. winterana. Presence of trichomes was an insignificant character to distinguish both the species (Table 4.1c, 4.1d).

Cinnamomum verum can easily be distinguished by inaperturate and smaller sized pollen (30 µm) in comparison to its adulterant i.e. Canella winterana which had relatively large size (39 µm) with distal aperture. Moreover shape of pollen was spheroidal in C. verum while sub-spheroidal pollen was observed in C. winterana. Perveen (2006) supported this fact that pollen shape is an important character in delimitation of taxa (Figure 4.1c). The thickness of exine and intine also showed great variation i.e. 2.1 µm exine thickness in C. verum in contrast to 1.1 µm in C. winterana. Similarly value of intine thickness also varied among them as high value (2.7 µm) was observed in C. winterana whereas least value was found in C. verum. Furthermore spinate exine ornamentation was observed in C. verum.in contrast to C. winterana that showed smooth exine ornamentation. Pollen fertility was also significantly varied in both the species i.e. 89% in C. verum and 74% in C. winterana. However exine thickness, intine thickness and interspecific difference of pollen were less varied characters between these two species. Moreover P/E ratio was also minutely differing in both the plant species (Table 4.1e).

The solubility of all the collected samples of Cinnamomum verum had been determined in various solvents i.e. H2SO4, HCl, Acetic acid and water. The results revealed that all the twelve samples of C. verum showed partial solubility in H2SO4 in cold condition while became completely soluble on heating. All samples showed color variations in H2SO4 solvents i.e. sample number 1, 3, 7 and 9 showed dark brown color, while sample 2, 5, 6, 8, 10, 11 and 12 showed blackish brown color only sample number 4 showed brown color. Similarly, all the Cinnamomum samples

194 remain insoluble in HCl in cold and hot form and showed a great range of color variation, i.e. sample 1, 2 and 5 showed golden brown color, sample 3 and 4 showed red oxide, sample 6 and 7 showed panzer gray, sample 8 terracotta while in sample 9, 10, 11 and 12 roof tile color appeared. However, in acetic acid all the Cinnamomum samples remained insoluble in both cold and hot condition and only sample 11 and 12 showed distinct color i. e. sample 11 showed eau de nil color and sample 12 showed cameo color while sample 1-10 showed color desert dawn. All Cinnamomum samples showed insolubility in Water in both cold and hot form and observed color variation, i.e. sample 1,4,6, 8,9,10,11 and 12 showed molten bronze color, sample 3 and 7 showed golden brown color, sample 2 showed roof tile color while sample 5 showed a desert down color (Table 4.9).

5.1.2: Authentication of Cinnamomum tamala vs Cinnamomum obtusifolium

On the morphological basis Cinnamomum tamala can be differentiated from its adulterant plant Cinnamomum obtusifolium. As C. tamala was medium sized tree (10m) with terminal or axillary inflorescence and had dark grey aromatic bark while C. obtusifolium was large tree (5-25m) with pseudoterminal inflorescence and greish brown to white bark. Both plants were also distinct in phyllotaxis and leaf shape i.e. oblong to lanceolate leaf with alternate to spiral phyllotaxis was observed in C. tamala whereas obtuse, elliptic or acuminate leaf shape with opposite to subopposite or alternate phyllotaxis was observed in C. obtusifolum (Figure 4.2a) Whereas other morphological characters i.e leaf length, flower, calyx, corolla, stamen and carpel were not proved as distinct characters to distinguish both plant species. Ravindran et al. (2005) also identified Cinnamomum by using similar anatomical markers (Table 4.2a, 4.2b).

Size and shape of epidermal cells was important taxonomic character to discriminate the Cinnamomum tamala from its adulterant Cinnamomum obtusifoium. As tetragonal and large sized epidermal cells (53.9 µm) were observed in C. tamala while irregular epidermal cells with smaller size (48.5 µm) were found in C. obtusifoium (Figure 4.2b). According to the Nwachukwu and Mbagwu (2006), length and width of leaf epidermis cells was considered useful taxonomic tool to distinguish the different plant species of flowering plants. Likewise length of guard cells and

195 stomatal aperture also showed remarkable variations i.e. large sizes of guard cells (35.3 µm) and stomatal aperture (17.2 µm) was calculated in C. tamala whereas smaller size of guard cells (19.7 µm) and aperture (9.7 µm) was found in C. obtusifoium. Similarly presence of trichomes was also important diagnostic character in both plants because trichomes were only observed in slides of C. tamala but absent in adulterant plant, C. obtusifoium. The insignificant characters observed in both species were stomatal type and number of subsidiary cells (Table 4.2c, 4.2d). Bakker et al. (1992) elaborated the comparative anatomical characters of various Cinnamomum species to identify them.

The pollen of Cinnamomum tamala was varied from its adulterant by smaller size of pollen (30 x 24) and presence of multiple apertures in contrast to the Cinnamomum obtusifolium that had large sized (34 x 29) and inaperturate pollen. Shape of pollen was also varied in both species. Round shape pollen was observed in C. tamala while C. obtusifolium showed sub-spheroidal shape of pollen (Figure 4.2c). Pollen fertility showed slight variation in both plant species i.e. 90% in C. tamala and 81% in C. obtusifolium. Results reported the less variability in exine and intine thickness and interspecific differences of these two species (Table 4.2e).

Solubility analysis of collected marketed samples of Cinnamomum tamala was performed. These samples showed partial solubility in H2SO4 in cold form, but became completely soluble on heating and different colors appeared, i.e. sample 1, 2,3, 4 and 8 showed dark brown color, sample 5 and 6 showed blackish brown color, sample 7 and 9 indicated reddish brown color whereas sample 10, 11 and 12 represented flat black color. Likewise, all C. tamala samples remained insoluble in HCl in both cold and hot form and showed great color range, sample 1dark brown, sample 2 sedona, sample3 green drab, sample 4 brown, sample 5 miltary brown, sample 6 afrika Mustard, sample 7 leathers and sample 8-12 showed Avocado color. Similarly, all the samples remained insoluble in acetic acid in both the conditions, i.e. cold and hot form. Sample 1, 4, 6, 7, 8,10 showed avocado color, sample 2, 9, 11 and 12 presented golden brown color, sample 3 and 5 exposed primrose color. In solvent water all the samples remained insoluble in cold and hot form and exhibited different colors. Sample 1, 5 and 8 showed pale cream color, sample 2 and 3 tangerine juice, sample 4 molten ronze, sample 6 Mehandi color, sample 7 yellow, sample 9, 11 and 12 random tan and sample 10 showed butter cream color (Table 4.10).

196

5.1.3: Authentication of Gymnema sylvestre vs Gymnema lactiferum

Gymnema sylvestre can be distinguished from its adulterant plant Gymnema lactiferum on the basis of length and width of leaf i.e. 1-9.5cm length and 0.5-5cm leaf width was calculated in G. sylveatre while in its adulterant plant 8cm leaf length and 4 cm leaf width was recorded (Figure 4.3a). Both plants can also be distinct on the basis of type of inflorescence as corymbose cyme was present in G. sylvestre while Cyme umbel like inflorescence was observed in G. lactiferum. However habit of plant, stem, bark and floral character were overlapping characters between them (Table 4.3a, 4.3b).

Gymnema sylvestre can easily be discriminated from its adulterant plant Gymnema lactiferum on the basis of taxonomic parameters. In this context shape and size of epidermal cells play key role to distinguish the both plant species as cubical to rectangular shape with large sized (46.7 µm) epidermal cell was examined in G. sylvestre while somehow rectangular form with small sized (38.9 µm) epidermal cell was found in G. lactiferum (Figure 4.3b). Similarly number and shape of subsidiary cells also vary in both species i.e.5 subsidiiary cells with cubical shape were examined in G. sylvestre while 3 subsidiary cells and polygonal shape was found in adulterant plant G.lactiferum. Both the species showed variation in type of stomata. Anomocytic stomata type was examined in G. sylvestre whereas cyclocytic type was found in G. lactiferum. Size of stomatal aperture and length of guard cell also showed great variation as greater values 14.8 µm and 22.5 µm for both the characters was calculated in G. lactiferum while least values 12.1 µm and 20.9 µm was found in G. sylvestre. However, trichomes showed insignificant variation in both the species. The important fact regarding the results of Gymnema was absence of stomata on adaxial surfaces of both the plant species (Table 4.3c, 4.3d). Pramanick (2016) had identified and characterized the G. sylvestre plant on the basis of anatomical characters.

Shape and size of pollen are striking character to differentiate the Gymnema sylvestre from its adulterant Gymnema lactiferum as sphaeroidal shape and small pollen size (27.9 µm) was observed in G. sylvestre and sub-spheroidal pollen with large size (32 µm) was found in G. lactiferum (Figure 4.3c). These results were closely related with the results given by Prabhakar and Ramakrishna (2014). Moreover colpi length was also a variable character in both the plant species i.e.2.8 µm length was observed in G. sylvestre and 1.4 µm length was observed in G.

197 lactiferum. Furthermore pollen fertility also showed variation in both these species. High pollen fertility value was calculated in G. sylvestre (92%) and least value was recorded in G. lactiferum (81%) (Table 4.3e).

Marketed samples of Gymnema sylvestre showed their partial solubility in

H2SO4 in cold form and complete solubility in hot form and showed different colors, i.e. sample 1 rust color, sample 2 and 4 golden drown, sample 3,5,6,7, 8, 10 and

11dark brown, sample 9 and 12 showed gross black color in H2SO4. While all the Gymnema samples remained insoluble in HCl in hot and cold condition and showed a variety of colors, sample1 and 8 avocado color, sample 2 light green, sample 3,4 green drab, sample 5,9,10 and 12 sac bomber, sample 6 field drab, sample 7 primrose and sample 11 showed olive green color. Similarly, all samples remained insoluble in acetic acid and represent the color variation. Sample 1,2,6,7,9,10, 11 showed avocado color, sample 3,4,5,8 field drab and sample 12 showed gold metallic color. The same results were shown in water solvent and revealed various colors, i.e. hopsack color was shown by sample 1, sample 2, 5,6,8,10 primrose, sample 3,4 and 7 mehandi color sample 9, 12 clay and sample 11 showed light sea gray color (Table 4.11).

5.1.4: Authentication of Sphaeranthus indicus vs Sphaeranthus africanus

On the basis of stem shape and type of inflorescence, Sphaeranthus indicus can be differentiated from its adulterant plant Sphaeranthus africanus as cylindrical toothed stem with terminal inflorescence was observed in S. indicus while curved ascending branched stem with head campanulate was observed in S. africanus (Figure 4.4a). Both plant species also varied in leaf shape and flower color i.e. oblenceolate to dentated serrate leaf with purple flower color was observed in S. indicus while oblovate to oblong with rounded tip and white flower color was found in S. africanus. However leaf size, color, and other floral characters were considered insignificant to recognize the genuine plant (Table 4.4a,4.4b).

On the basis of shape and size of epidermal cells, Sphaeranthus indicus can be differentiated from its adulterant plant Sphaeranthus africanus. Irregular to lobed shape margins with smaller sized (53.3 µm) epidermal cells were examined in S. indicus while particularly irregular shape with large sized cell was found in S. africanus (Figure 4.4b). The results of following studies were in accordance with the

198 discoveries of venkatachalam et al. (2018). Both species showed a lot of variation in size of stomatal aperture and length of guard cells i.e. large sized stomatal aperture (19.4 µm)and larger length (35 µm) of guard cells was calculated in S. africanus whereas least values 17.2 µm and 22.9 µm were observed in S. indicus. Shape and number of subsidiary cells also showed significant variation, 4 subsidiary cells with deep lrregular undulating walls were observed in S. indicus while 3, subsidiary cell with polygonal shape were found in S. africanus. The insignificant results for stomatal type and trichomes were examined in both the plant species (Table 4.4c, 4.4d).

A valuable plant, Sphaeranthus indicus can be easily distinguished from its adulterant Sphaeranthus africanus on the basis of shape and size of pollen. As small size (18.8 µm) with sphaeroidal pollen shape was observed in S. indicus while large pollen size (25.5 µm) with oblate to spheroidal shape was found in S. africanus (Figure 4.4c). Values of exine and intine thickness also varied in both these species i.e. exine thickness in S. indicus was 3.1 µm whereas 7.5 µm value was calculated in S. africanus. Value of intine thickness in S. indicus was 1.8 µm and 3.1 µm value was calculated in S. africanus. The variations in exine and intine thickness was supportive character that could be helpful in species isolation and identification (Meo et al., 1988). Furthermore colpi length was also significantly varied in these studied plants. Large size colpi (13.3 µm) were observed in S. indicus while small sized colpi (3.87 µm) were found in S. africanus (Figure 4.4c). Moreover pollen fertility was also differing in both the plants as high fertility value (95%) was calculated in S. indicus and lesser fertility was observed in S. africanus (83%) (Table 4.4e).

All Collected samples of Sphaeranthus indicus remained partial soluble in

H2SO4 in cold condition and became complete soluble on heating and different colors appeared in H2SO4 i.e. dark brown color in sample 1,2,3,4,5,6,7,8 and panzer gray color in sample 9, 10,11 and 12. While all the Sphaeranthus samples remained insoluble in cold and hot form in HCl and color variation was also observed, i.e. sample 1showed shamp color, sample 2 dull golden color, sample 3 interior green, sample 4, 7 sac bomber color, sample 5 sac afrika mustard, sample 6 field drab, sample 8 green zinc chromate, sample 9 light brown and sample 10,11,12 showed gold metallic color. Similarly, all the samples showed insolubility in acetic acid in cold and hot conditions and showed different colors, i.e. sample 1,2,3,5,7,9,10,11,12 sowed golden needle, sample 4, 8 beige color and sample 6 avocado color in acetic

199 acid. In solvent water all the samples remained insoluble in both conditions and exposed different colors, sample 1 mehandi color, sample 2, 6 primrose color, sample 3,4,5,7,8,10,11,12 golden needle while sample 9 as butter crime (Table 4.12).

5.1.5: Authentication of Artemisia maritima vs Artemisia absinthium

Leaf shape and leaf color were significantly varying character to distinguish the Artemisia maritima from its adulterant Artemisia absinthium. As small, abtuse many segmented leaves with whitish cottony green color were observed in A. maritima while ovate blades pinnately divided into thread like segment with light green color were found observed in A. absinthium (Figure 4.5a). Furthermore leaf length and size of flower were also important character to differentiate both these species. i.e 2.4-4cm leaf length and 2.4mm flower size was calculated in A. maritima whereas 9.5-12 cm leaf lamina length and 3.5-4mm flower size was observed in A. absinthium. But plant habit, inflorescence type, floral character, seed and fruit were showing overlapping morphology (Table 4.5a, 4.5b).

Artemisia maritima an important medicinal plant was adulterated with Artemisia absinthium. Both plants can be identified on the basis of shape of epidermal cells and subsidiary cells as pentagonal epidermal cells and polygonal shape with undulating margins of subsidiary cells was observed in A. maritima while irregular shape epidermal cells and polygonal shape subsidiary cells were found in A. absinthium (Figure 4.5b). Hayat et al. (2010) investigated the variation in epidermal cells of A. absinthium and A. maritima. The findings of the present study regarding shapes and arrangements of epidermal cells were according to their results however few variations were observed in quantitative measurements due to the environmental changes. Length of epidermal cells and length of guard cells also showed remarkable variation i.e. 31.1µm length of epidermal cells and 27.9 µm length of guard cells was calculated in A. maritima whereas 26.1µm length of epidermal cells and 21.5µm length of guard cells was observed in A. absinthium. Similarly type of stomata and size of stomatal aperture was also variable character in both the species. Anisocytic stomata type with 19.8µm stomatal apertures was observed in A. maritima while anomocytic stomata type with 14.5µm stomatal aperture sizes was examined in A. absinthium. Less variable character observed in both species was number of subsidiary cells as 3-4 stomata in A. maritima while 5 stomata in A. absinthium were

200 observed. However trichome showed insignificant variation in both the species (Table 4.5c, 4.5d).

Exine sculpturing was proved to be important striking character in order to distinguish the Artemisia maritima from its adulterant plant Artemisia absinthium. It was observed that granular, dense arrangement of spinules with broader base was in A. maritima while sinuolate with normal base spinule was in A. absinthium (Figure 4.5c). Clark et al. (1960) specified that pollen sculpturing and exine ornamentation can be utilized as microscopic marker to recognized very closely related species. Similar research was given by Ahmad et al. (2010) on pollen sculpturing to identify the herbal plant i.e. Matricaria chamomilla (Gul-e-Baboona) morphologically resembled with Anthemis nobilis and Catulea aurea. Moreover shape and size of pollen was inconstant character between these two adulterants as large size pollen (18.8 µm) with globular shape was observed in Artemisia maritima and small size pollen with sub-spheroidal shape was observed in Artemisia absinthium. Value of colpi length was also significantly varied in these plants i.e. large size colpi (11.8 µm) was observed in A. maritima while small size colpi (4.5 µm) was examined in Artemisia absinthium. Pollen fertility value was also significantly varied as high pollen fertility (91%) value was calculated in A. maritima and least value (79%) was in A. absinthium (Table 4.5e). Martin et al. (2001) recommended that pollen morphology is a diagnostic character for Artemisia and recognized it as an excellent taxonomic marker.

Solubility analysis of Artemisia samples was performed in cold and hot condition in different solvents and color variations were examined. All the samples in cold condition were partial soluble in H2SO4 and became completely soluble in hot form and showed various colors, i.e. sample 1, 2, 3, 4 october brown, sample 9 blackish brown and sample 5, 6, 7, 8, 10, 11, 12 showed dark brown color. All Artemisia samples remained insoluble in both conditions and great range of color variation was observed. Sample 1 showed light brown, sample 2 dirt brown, sample 3, 5 field drab, sample 4 dull golden color, sample 6 buckskin, sample 7 sac bomber tan, sample 8 red oxide, sample9 golden brown, sample 10 wood color and sample 11, 12 molten bronze color. Similar results were shown by Artemisia samples in acetic acid and all samples varied in color, i.e. sample 1, 2, 9, 10 showed mehndi color, sample 3, 5 gold metallic, sample 4, 6, 8 of golden needle, sample 7 clay color, sample 11 light sea

201 gray sample 12 buuter crime color. Similarly all samples showed insolubility in water solvent and color variation was observed. Sample 1, 5, 9, 10, 12 of mehndi color, sample 2, 3 primrose and sample 4, 6, 7, 8, 11 of golden needle colorle (Table 4.13).

5.1.6: Authentication of Butea monosperma vs Averrhoa carambola

Butea monosprma on basis of stem and inflorescence can be distinguished from adulterant plant Averrhoa carambola. Irregular vigorous stem and racemes inflorescence type was observed in B. monosperma while woody branching stem and opposite to subopposite inflorescence type was examined in A. carambola (Figure 4.6a). Similarly leaf length and flower size also showed distinct variations i.e. 12.5- 15cm leaf length and 6-8cm flower size were observed in B. monosperma whereas 5- 8cm leaf length and 2.5-8mm flower size was found in A. carambola. B. monosperma can also be recognized on the basis of distinct petal arrangement i.e. standard, keel and falact. However other characters were insignificantly variable (Table 4.6a,4.6b).

In relation to leaf anatomy the secretory trichomes were reported as an important diagnostic character in distinguishing the original plant B. monsperma from its adulterant plant A. carambola. Trichomes were seen in B. monosperma while absent in adulterant plant A. carambola. Length of epidermal cell and length of guard cell showed remarkable variation i.e. greater value (47.0µm) of epidermal cell and guard cell (31.0µm) was calculated in A. carambola whereas least values of these characters 38.1µm and 23.8µm were observed in B. monsperma (Figure 4.6b). Stomata type and size of stomatal aperture also showed significant variation i.e. paracytic type with 9.4µm stomatal aperture size was found in B. monsperma while anisocytic type and 21.4µm stomatal aperture size was observed in A. carambola. Kumar and Malik (2011) investigated the anatomical characters of B. monosperma and found stomata were absent on adaxial surface of Butea and these finding were related with results of present studies. However shape of epidermal cell and shape of subsidiary cell showed insignificant variation in both plant species (Table 4.6c, 4.6d).

Shape of pollen is important diagnostic character to differentiate the Butea monosperma from its adulterant plant Averrhoa carambola as oblate to sphaeroidal pollen shape was found in B. monosperma while prolate to sphaeroidal pollen shape was observed in A. carambola. Pollen also showed variation in their size i.e. small sized pollen (21µm) was found in A. carambola while large pollen size (34 µm) was

202 observed in B. monosperma. According to the Parveen and Qaiser (2010), palynological characters i.e. shape of pollen type of aperture as well as exine ornamentation are remarkable significant characters to identify particular plant species. Moreover length of colpi was varied significantly i.e. large colpi sized pollen was observed in B. monosperma (9.1µm) and smaller sized colpi (6.1 µm) was found in A. carambola. Intine thickness is also variable character as value of intine thickness was greater (2.5µm) in B. monosperma and smaller (1.3µm) in A. carambola (Figure 4.6c). Moreover both the plant species were differentiated by inter specific distance of pollen, B. monosperma showed larger value (1.7µm) of inter specific distance while A. carambola showed least value (0.5µm). Along these characters pollen fertility was significantly varied in both plants, less fertility value (81%) was observed in B. monosperma (93%) and higher value was calculated in A. carambola. In these plants few characters were insignificantly varied i.e exine thickness and P/E ratio (Table 4.6e).

Resin crystal of Butea monosperma traded in the name of “kamarkus” were procured from different shops of herbal market and their solubility in different solvents was observed i.e. All the samples showed partial solubility in H2SO4 in cold form, sample 1 and 2 showed partial solubility while remaining all the samples showed complete solubility in H2SO4. Color variation was observed in this solvent i.e. sample 1, 6, 9 showed crane berry color, sample 2, 3, 4, 7, 8, 10, 11, 12 and sample 10 showed red oxide color. In HCl and acetic acid solvents, all samples remained insoluble in both cold and hot condition and no color variation was observed i.e. all samples showed red oxide color in HCl and acetic acid. Similar results were shown in water solvent but color variation was observed i.e. sample 1 showed blunt orange color, sample 3, 4 crimson color, sample 2, 5, 6, 12 showed red oxide color (Table 4.14).

5.1.7: Authentication of Achillea millefolium vs Adhatoda vasica

Both plants can be distinguished i.e Achillea millifolium and adulterant plant, Adhatoda vasica on the basis of plant habit, leaf shape and leaf venation. As A. millefolium is a perennial herb with oblong to lanceolate leaf shape and no distinct leaf venation whereas dense shrub, elliptic, lanceolate to acuminate leaf shape and reticulate venation was observed in A. vasica. Similarly, leaf length and flower size also showed distinct variation, i.e. 5-14cm leaf length and 2.5-6cm flower size was

203 calculated in A. millefolium (Figure 4.7a) while 8-9cm leaf length with 2-8cm flower size was observed in A. vasica (Table 4.7a, 4.7b).

Taxonomic markers were proved to be helpful to distinguish the Achillea millefolium from adulterant plant Adhatoda vasica. As irregular shape epidermal cells with 46.1 µm length were reported in A. millifolium while polygonal shaped with 54.9 µm length were reported in A. vasica. Grytsyk et al. (2016) worked on anatomical parameter of A. millefolium and this study supported that anatomical parameters were important tool for the characterization of particular plant species. Similarly type of stomata and size of stomatal aperture also varied in both plant species i.e. anomocytic stomatal type with 11.9µm aperture size was observed in A. millefolium whereas diacytic type with large aperture size (13.9µm) was found in A. vasica (Figure 4.7b). Length of guard cells also showed variations i.e. greater value (25.3µm) was calculated in A. vasica but least value (22.8µm) was examined in A. millefolium. However both species also showed great variation in shape and number of subsidiary cells, 4 irregular shaped with undulating walls of subsidiary cells were found in A. millefolium whereas 2 cubical subsidiary shaped cells were observed in A. vasica (Table 4.7c, 4.7d).

On the basis of Pollen symmetry, Achillea millefolium can be distinguished from its adulterant Adhatoda vasica as radial pollen symmetry was found in A. millefolium and bilateral symmetry was observed in A. vasica. Shape and Size of pollen were also significant identification character in these plant species. As small sized pollen (28µm) with circular to spheroidal shape was observed in A. millefolium while large pollen size (41µm) with oblate shape was found in A. vasica. Moreover P/E ratio and colpi length were also significantly varied in both plants i.e. P/E ratio was larger (1.96 µm) in A. vasica and smaller (1.2µm) in A. millefolium while large colpi size (5.9µm) was calculated in A. millefolium and least value (3.2µm) was observed in A. vasica. Meo and Khan (2004) explored two species of Achillea on the basis of spines between the colpi i.e. A. millefolium and Achillea santolina. They efficiently compared both of Achillea species by light microscopy. Furthermore exine and intine thickness also varied in these species as larger value (2.7 µm) of exine thickness was observed in A. millefolium and smaller value (1.7µm) was found in A. vasica (Figure 4.7.c). Similarly larger value (2.3µm) of intine thickness was found in A. vasica and least value (1.5µm) was observed in A. millefolium. A commendable

204 difference in pollen fertility was also observed between both plants i.e. peak value (95) was in A. millefolium and least value (79%) in A. vasica (Table 4.7e).

Achillea millifolium powdered samples were showed different solubility in different solvents. i.e. in H2SO4 all the samples remained partial soluble in cold condition but became completely soluble in hot condition and color variation was also observed i.e. sample 1, 2, 3, 6, 7, 8 dark brown, sample 4, 12 blackish brown color, sample 5 black color and sample 9, 10, 11 showed Euro I gray color. Likewise all the samples remained insoluble in cold and hot test in HCl and appeared different colors i.e. sample 1 field drab, sample 2, 6, 8 sac bomber tan, sample 3, 5 dark brown, sample 7 afrika mustard sample 9 brass, sample 10 saffron, sample 11 brass and sample 12 showed golden yellow color. Similar results were shown by the samples in acetic acid solvent i.e sample 1, 2, 4, 6, 8, 9, 10, 11, 12 showed golden needle color, sample 3, 5 of mehandi color and sample 7 showed clay color. Same results were shown by samples in water solvent and color variation was observed. As sample 1, 4, 9, 12 appeared primrose color, sample 2 yellow color, sample 3 hopsack color, sample 5, 10 mehandi color, sample 6 pale cream, sample 7, 8 golden needle and sample 11 armor sand (Table 4.15).

5.1.8: Authentication of Morus nigra vs Morus alba

Morus nigra and adulterant plant Morus alba can be distinguished on the basis of plant habit, plant height and stem diameter. As 10m tall, medium size tree with 1- 2m stem diameter was observed in M. nigra while 12-20m tall, large tree with 1.5-2m stem diameter was observed in M. alba. Similarly petiole length and leaf length also showed distict variations, 1.3-5cm petiole length with 2-3.5cm leaf length was observed in M. nigra whereas 2- 3.3cm petiole length and 5-15cm leaf length was observed in M. alba (Figure 4.8a). However leaf length, leaf venation, sepals and petals showed overlapping morphology (Table 4.8a, 4.8b).

Morus nigra can easily be distinguished from its adulterant plant Morus alba on the basis of anatomical characters i.e large sized epidermis cells (25.8µm) with polygonal shape were observed in M. nigra while smaller sized (22.9µm) and irregular shape epidermal cells were found in M. alba. Similarly size of stomatal aperture and length of guard cell also revealed great variation i.e, 12.1µm value of stomatal aperture and 16.2µm length of guard cell was recorded in M. albs whereas

205

10.1 µm stomatal aperture and 18.1µm length of guard cell was recorded in M. nigra (Figure 4.8b). These values of anatomical marker i.e. shape and length of epidermis cells, size of guard cells and size of stomatal aperture were close to the range given by Munir et al. 2011. However number of guard cells and stomata type were insignificant characters in both the plant species (Table 4.8c, 4.8d).

Pollen surface pattern was found to be an important outstanding character to discriminate the Morus nigra from its adulterant plant Morus alba. As irregular infolding surface pattern was observed in M. nigra while scabrate surface pattern was found in M. alba. Moreover pores on pollen surface was valuable character i.e. triporte pollen was observed in M. nigra whereas Monoporate to diporate pollen was found in M. alba. Size and shape of pollen were diagnostic characters as large sized pollen (54µm) with circular shape was found in M. nigra while small sized pollen (35µm) with sub-sphaeroidal shape was observed in M. alba (Figure 4.8c). Exine and intine thickness were also significantly variable characters i.e. large value of exine and intine thickness was observed in M. alba while least values for both the characters were found in M. nigra. Furthermore pollen fertility value was also varied in these plant species i.e. higher fertility value (83%) was calculated in M. nigra while smaller value (71%) was observed in M. alba. The interspecific distance of the pollen of these species showed insignificant values. (Table 4.8e).

Solubility of Morus nigra samples were performed in H2SO4 in cold form but became completely soluble in hot condition and color variation was observed, i.e. sample 1, 2, 3, 4 red oxide, sample 5, 6 9, 10 field drab color and sample 7, 8, 11, 12 showed brown color. In HCl all samples remained insoluble in cold and hot form but color variation was observed, i.e. sample 1, 2, 4, 7, 8, 9, 10, 11 crane berry color and sample 3, 5, 6, 12 showed brass color. Similar results were shown by the samples dissolved in acetic acid and different colors appeared, i.e. sample 1, 2, 3, 4 golden metallic, sample 5, 6, 7, 11, 12 red oxide and sample 8, 9, 10 showed primrose color. All samples of Morus were showed insolubility in water in cold and hot form but showed different colors. Like sample 1, 7, 8, 9, 10, 11, 12 showed dark brown color while sample 2, 3, 4, 5 and 6 indicated red oxide color (Table 4.16).

206

5.2: Authentication of selected medicinal plants on the basis of advanced markers (DNA barcoding)

Morphological based species identification usually faces multiple limitations such as genotypic variability, phenotypic plasticity, life stage and also gender (Hebert et al., 2003; Jarman and Elliott 2000; Knowlton 1993). Therefor molecular identification is considered as the most authentic and free of human biasness, instead of morphological identification (Hollingsworth et al., 2009; Ma et al., 2010; Chen et al., 2010; Liu et al., 2012; Hartvig et al., 2015; Luo et al., 2010 and Pang et al., 2010). Typically the molecular techniques have standardization issues but DNA barcoding is relatively new and more reliable approach in solttttttttttttt55ving species identification disputes (Cowan et al., 2006; Jinbo et al., 2011). Using multiple barcodes (matK, nrITS, rbcL and psbA-trnH) makes the results more reliable and this method is helpful in genotyping of medicinal plants in the international trades (Lahaye et al., 2008; Kress & Erickson, 2007; Fazekas et al., 2008; Newmaster et al. 2008; Devey et al., 2009). Around the world DNA barcoding had been in practice for herbal drug authentication (Kress and Erickson, 2007; Fazekas et al., 2008; Newmaster et al., 2008; Devey et al., 2009; Seethapathy et al., 2014; Vassou et al., 2015) Market samples (n=12) of all selected medicinal plants and their respective fresh samples (positive control) were analyzed by DNA barcode sequences. The obtained results expressed their relationships with fresh samples and other database sequences which helped in determination of authentic herbal market samples.

5.2.1: Cinnamomum verum (Darchini)

It was observed that fresh sample of C. verum was amplified with three primers i.e. matK, rbcL and psbA-trnH. Results of all these primers revealed the maximum similarity of fresh sample with database available C. verum. The sample 1 was positively amplified with matK, nrITS, rbcL barcodes, in which matK primer exhibited this sample relationship with Prunus species but other two primers suggested its association with Vigna radiate (Figure 4.1d, e, f). Sample 3 and 5 were only amplified with rbcL and matK primers respectively. Sample 10 was amplified with all three primers except psbA-trnH and showed relationship with Pulchea and Sphaeranthus indicus. The sample 11 (amplified with rbcL and psbA-trnH) was found to be associated with Budleja lindleyana (Figure 4.1g). Furthermore sample 12

207

(amplified with only two primers rbcL and matK) was observed in close relation with Pulchea species. The remaining sample 4, 6, 7, 8 and 9 were not amplified with any of the primer (Figure 4.1h). Overall results suggested that none of the sample which used to sold under the name of C. verum was genuine and probably adulterated with other different species may or may not have medicinal value.

5.2.2: Cinnamomum tamala (Tezpath)

Fresh sample of Cinnamomum tamala was amplified with matK, nrITS and rbcL primer; moreover it showed close relation with C. tamala of database. Sample 1 gave results with nrITS and rbcL primer and both primers revealed its relation with Vigna radiata. Sample 2 of C. tamala was positively amplified with all of four primers (matK, nrITS, rbcl and psbA-trnH) and its relation was observed with Foeniculum vulgare and different Prunus species (Figure 4.2d, e, f, g). Sample 3 was amplified with two primers i.e. matK and rbcL while sample 4 showed results with rbcL and psbA-trnH primers. However sample 5 was amplified with matK, rbcL and psbA-trnH primers and observed in close relation with Artemisia species. Sample 6 (amplified with matK and psbA-trnH) represented its association with Laurus nobilis. The sample 7 was amplified with two primers (nrITS and rbcL) and showed maximum similarity with Prunus species. However sample 7 and 8 only showed its amplification with matk primer and similarity with Prunus sibirica. Sample 9 of C. tamala gave amplification with all primers except rbcL primer and resembled with L. nobilis. Moreover sample 10 (amplified with matK, nrITS and rbcL primer) was found to be linked with C. camphora, F. vulgare and C. micaranithum, while sample 12 showed amplification with only matK primer and suggested its relation with Budleja utahensis and Oftia africana. However sample 11 was not amplified with any of these four primers (Figure 4.2h)

5.2.3: Gymnema sylvestre (Gurmar booti)

Fresh sample of Gymnema sylvestre showed results with all the primers except psbA-`trnH and it linked with database available G. sylvestre. Sample 1 was amplified with matK, psbA primer and showed its association with Telosoma africana (Figure 4.3d, g). Similarly Sample 4 was also amplified with primer matK and psbA primer and associated with Dregea sinesis and Telosoma africana. Sample 5 was only amplified with rbCl primer and its maximum similarity was with G. sylvestre

208 retrieved from database. Sample 6 showed their relationship with Vigna radiata (amplified with nrITS, rbcL and psbA-trnH) (Figure 4.3e, f and g). Sample 7 and 8 were only amplified with rbcL and both of these linked with G. caspidatum. However sample 9 and 11 gave amplification with matK and rbcl primer and showed positive relation with database G. sylvestre. Sample 3, 10 and 12 showed any amplification with any of these selected barcode. Overall similarity of sample 5, 9 and 11 with database G. sylvestre were suggested authenticity of these samples (Figure 4.3h).

5.2.4: Sphaeranthus indicus (Gul mundi)

Results demonstrated that matK primer was not suggested for S. indicus amplification because of limited efficiency in the case of this plant species (Figure 4.4d). Fresh sample was amplified with nrITS, rbcL and psbA-trnH primer and associated with database S. indicus. Sample 2 was amplified with nrITS and rbcL primer and showed association with S. indicus (Figure 4.4e, f). Sample 5 was amplified only with nrITS primer and showed its linkage with Averrhoa crambola. However sample 6 and 7 were showed its amplification with all primers except matK and associated with S. indicus, Diplostephium hippophae and Pulochea species respectively. Similarly sample 8 was amplified with all of these four primers and showed positive association with S. indicus and S. hexusas. Moreover sample 9 and 12 (amplified only with rbcL) linked with the S. indicus retrieved from database. Overall results repesenred that sample 1, 3, 4 10 and 11 donot showed amplification with any of the primers (Figure 4.4h).

5.2.5: Artemisia maritima (Afsathine)

Results of Artemisia maritima revealed that fresh sample was amplified only with nrITS primer and showed maximum similarity with database Artemisia maritima (Figure 4.5e). Sample 4 showed amplification only with nrITS primer and exhibited its similarity with A. absinthium. Sample 5 was amplified with nrITS, rbcL and psbA- trnH primer and showed its positive association with A. absinthium, A. vulgaris and A. grgyi (Figure 4.5e, f, g). However sample 7 gave amplification with all of these four primers and closely linked with Chrysanthemum indicum, A. absinthium, A. vulgaris and A. grgyi respectively. Moreover sample 8 showed its amplification with matK, nrITS barcodes and resembled with Chrysanthemum indicum, A. absinthium. While sample 9 gave amplification with all of four primers and positive relation was

209 shown with Chrysanthemum indicum, A. absinthium, A. vulgaris and A. indica. Sample 10 was amplified with matK, rbcL primer and both were linked with Coriandum sativum (Figure 4.5d, f). Furthermore amplification was shown by sample 11 with all primers except matK primer and suggested its relation with A. absinthium, A. myriantha and A. indica respectively. Sample 12 of A. maritima (amplified only with rbcL) showed its linkage with A. millefolium. It is obvious from the results that most of the samples (including fresh sample) were amplified with nrITS primer (Figure 4.5h). This fact was well supported by Goa et al. 2010) who recommended that this barcode is best for family of Artemisia i.e asteraeae.

5.2.6: Butea monosperma (Kamarkus)

In herbal markets this particular plant product is sold in the form of resin crystals, as it is already mentioned in results. It is known that resins are cell secretions of plant, so they lack DNA and cannot use for DNA analysis. Therefore to confirm the authenticity of resin source, DNA barcoding was applied on two types of fresh samples i.e. sample collected from field and sample provided by the herbalist on demand. Both of these samples successfully showed amplification with all of four barcodes (matK, nrITS, rbcL and psbA-trnH) but not any association was observed among them in phylogenetic trees (Figure 4.6d, e, f, g). Results revealed that fresh sample was in association with the database available Butea monosperma. However sample provided by the herbalist was found to be related to Morus species (reterived by matK and nrITS) and Averrhoa carambola (reterived by rbcL and psbA-trnH) (Figure 4.6h). These results confirmed the adulteration in the source of herbal product.

5.2.7: Achillea millefolium (Branjasaf)

Phylogenetic results of fresh sample with matK primer, rbcL primers and trnH-psbA primers showed that amplified sequence have closely relation with Achillea millefolium (Figuure 4.7d, f, g). Market sample 1 showed amplification with matK and nrITS showed their closely relation with different species of genus Prunus and Vigna radiata respectively. Market sample 2 was amplified with matK primers and showed its relation with Justicia adhatoda. Sample 3 have positive amplification with rbcL primers and in phylogenetic analysis showed relation with Monechma. In phylogenetic analysis sample 5 was closely related with Deinbollia kilimandscharica

210

(amplified by matK primer) and Sphaeranthus indicus voucher (amplified by rbcL primer). Market sample 6 amplified by rbcL primer showed highest similarity with Sorbaria sorbifolia. Sample 7 gave amplification with nrITS primers and showed its relation with Foeniculum vulgare cultivar (Figure 4.7e). Market sample 8 amplified with three primers (matK, nrITS and rbcL) showed their relation with different species of Morus australis. Sample 9 which was amplified by three universal primers i.e. nrITS, rbcL and TrnH-PsbA showed maximum similarity with Vigna radiata. Market sample 10 which amplified by rbcL and TrnH-PsbA primers showed closely its relationship with Vigna radiata. Sample 11 amplified with nrITS and rbcL showed closely relation with Foeniculum vulgare and Sorbaria sorbifolia respectively. Overall results suggested high level of adulteration in marketed samples of Achillea millefolium (Figure 4.7h) . Similar findings also had been reported by Newmaster et al. (2013) during authentication and standardization of herbal products in North America.

5.2.8: Morus nigra (Toot siyah)

Sample of fresh Morus nigra plant was amplified with primers (matK, nrITS, rbcL and psbA-trnH) and showed maximum similarity with database reterived M. nigra (Figure 4.8d, e, f, g). Sample 2 was amplified with matK primer and gave positive relation with M. nigra while sample 5 (amplified with only rbcL primer) showed relation with M. notabilis. Sample 6 showed its amplification with nrITS, rbcL, psbA-trnH primer and seems to be associated with M. australis, M. rubra and M. alba respectively. Sample 9 was only amplified with matK primer and represented the M. indica species. However sample 10 of M. nigra gave amplification with all of these four primers and shared its similarities with M. indica, M. alba and M. nigra. Similarly sample 11 (amplified with all primers except psbA-trnH primer) gave its relation with M. australis, M. alba and M. nigra. Furthermore sample 12 was amplified with nrITS, rbcL and psbA-trnH primer showed their close relation with M. rubra and M. indica (Figure 4.8h).

211

5.3: Conclusion

Adulteration is a burning issue of modern civilization which impose harmful effect directly or indirectly on human health. People in developed and under developing countries still rely on medicinal plants as a traditional mode of treatment for their primary health care system. This study was conducted to sort out the adulteration issue by employing classical and molecular parameters. Classical parameters (morphology, anatomy and palynology) were considered fundamental identification tools to make correct identification of particular medicinal plants but these techniques faced some limitations. As most of marketed samples were in dry and broken form. Hence it was difficult to find out the detailed study of selected medicinal plants in order to combat their adulteration. In this context, molecular techniques, i.e. DNA Barcoding played a key role to sort out this major problem. Seven barcode primers were selected for current study but only four primers (matK, nrITS, rbcL and psbA-trnH) gave good amplification for plant DNA sample while the remaining primer did not showed significant amplification. It had been observed that most successful primer was rbcL followed by nrITS and matK primer whereas psbA- trnH produced least number of amplification. The probable reason for this poor amplification was problem in primer sequence or primer quality. Moreover the authenticity of all the fresh samples of studied medicinal plants was confirmed by checking the similarity with database retrieved respective accessions. It can be concluded that maximum adulteration was observed in all market samples of Cinnamomum verum, Cinnamomum tamala, Artemisia maritima and Butea monosperma. However less adulteration was found in few samples of Gymnema sylvestre followed by Sphaeranrhus indicus, Morus nigra and Achillea millefolium.

212

5.4: Future recommendation

The current research is worthwhile in the field of plant taxonomy with special reference to medicinal plant identification and proposed some recommendations;

 To develop DNA barcode-based standard testing measures and a reference material library for herbal species marketed in Lahore, Pakistan.  To recommend the herbal industries for integration of DNA barcoding technique for identification of raw materials and value reassurance of herbal medicines.

213

Abeysinghe, P. D., Wijesinghe, K. G. G., Tachida, H., Yoshda, T. and Thihagoda, M. 2009. Molecular characterization of Cinnamon (Cinnamomum verum Presl) accessions and evaluation of genetic relatedness of Cinnamon species in Sri Lanka based on trnL intron region, intergenic spacers between trnT-trnL, trnL-trnF, trnH-psbA and nuclear ITS. Research Journal of Agriculture and Biological Sciences, 5(6): 1079-1088.

Abouzid, S. A. 2014. Authentication of Silybum marianum Varieties Using RAPD Analysis. Plant Tissue Culture and Biotechnology, 24(1): 57-63.

Ahmad, M., Khan, M. A. and Qureshi, R. A. 2003. Ethnobotanical study of some cultivated plants of chhuchh region (District Attock). Journal of Hamdard Medicus, XLVI (3): 15-19.

Ahmad, M., Khan, M. A., Zafar, M., Arshad, M., Sultana, S. and Abbasi, B. H. 2010. Use of chemotaxonomic markers for misidentified medicinal plants used in traditional medicines. Journal of Medicinal Plants Research, 4(13): 1244-1252.

Ahmed, S. and Hasan, M. M. 2015. Crude drug adulteration: a concise review. World Journal of Pharmacy and Pharmaceutical Sciences, 4(10): 274-83.

Akbar, S., Hanif, U., Ali, J. and Ishtiaq, S. 2014. Pharmacognostic studies of stem, roots and leaves of Malva parviflora L. Asian Pacific journal of tropical biomedicine, 4(5): 410-415.

Akcin, O. E., Kandemir, N. and Akcin, Y. 2004. A morphological and anatomical study on a medicinal and edible plant Trachystemon orientalis (L.) G. Don (Boraginaceae) in the Black Sea Region. Turkish Journal of Botany, 28(4): 435-442.

Alves, T. M. D. A., Silva, A. F., Brandao, M., Grandi, T. S. M., Smânia, E. D. F. A., Smânia Júnior, A., & Zani, C. L. (2000). Biological screening of Brazilian medicinal plants. Memórias do Instituto Oswaldo Cruz, 95(3): 367-373.

Ammara, H., Salma R., Farah, D. and Shahid, M. 2009. Antimicrobial activity of some plant extracts having hepatoprotective effects. Journal of Medicinal Plant Research, 3(1): 020-023.

Andrew, N. D. and Kellogg, E. A. 2002. Inflorescence diversification in the panicoid "bristle grass" clade (Paniceae, Poaceae): evidence from molecular phylogenies and developmental morphology. American Journal of Botany, 89: 1203-1222.

Anonymous. 2006. Agricultural marketing statisticl abstract. National school of agriculture marketing (A Govt of India Organisation- Ministry of Agriclture), Kota road, Bambala Jaipur- 302033.

Anselem, A. 2004. Herbs for healing pax herbals Edo State, Nigeria.

Asmussen, C. B. and Chase, M. W. 2001. Coding and noncoding plastid DNA in palm systematics. American journal of botany, 88: 1103-1117.

Bakker, M. E., Gerritsen, A. F. and Van Der Schaaf, P. J. 1992. Leaf anatomy of Cinnamomum Schaeffer (Lauraceae) with special reference to oil and mucilage cells. Blumea-Biodiversity, Evolution and Biogeography of Plants, 37(1): 1-30.

214

Baruah, A. and Nath, S. C. 2007. Systematics and diversities of Cinnamomum species used as" Cinnamon" species in North East India. Journal of Economic and Taxonomic Botany, 31 (4): 872-887.

Baytop, T. 1999. Turkiyede bitkilerle tedavi. İstanbul Eczacılık Fakultesi Yayınları, İstanbul, pp. 444.

Bhatt, V. P. and Negi, G. C. S. 2006. Ethnomedicinal plant sources of Jaunsari tribe of Garhwal Himalaya, Uttaranchal. Indian journal of traditional Knowledge. 5(3): 331-335.

Biswas, K. & Biswas, R. 2013. Identification of medicinal plants using PCR-RFLP in Dasamula-an Ayurvedic drug. Journal of Pharmaceutical and BioSciences, 3: 93-98.

Biswas, K. and Biswas, R. 2014. DNA Molecular Markers Based Authentication of Herbal Drugs - A Review. International Journal for Pharmaceutical Research Scholars, 3(I-1): 2277 – 7873.

Bundock, P. C., Eliott, F. G., Ablett, G., Benson, A. D., Casu, R. E., Aitken, K. S. and Henry, R. J. 2009. Targeted single nucleotide polymorphism (SNP) discovery in a highly polyploid plant species using 454 sequencing. Plant biotechnology journal, 7(4): 347-354.

Burge, D. O., Mugford, K., Hastings, A. P. and Agrawal, A. A. 2013. Phylogeny of the plant genus Pachypodium (Apocynaceae). PeerJ, 1: e70.

Carlini, E. A. 2003. Plants and the central nervous system. Pharmacology Biochemistry and Behavior, 75(3): 501-512.

Chen, S., Yao, H., Han, J., Liu, C., Song, J., Shi, L., Zhu, Y., Ma, X., Gao, T., Pang, X., Luo,Y., Li, Y., Li, X., Jia, X., Lin, Y. and Leon, C. 2010. Validation of the ITS2 region as a novel DNA barcode for identifying medicinal plant species. PloS one, 5(1): e8613.

Chopra, R. N., Nayar, S. L. and Chopra, I. C. 2002. Glossary of Indian medicinal plants. NISCIR, CSIR, Delhi.

Clark, J. 1960. Preparation of leaf epidermis for topographic study. Stain. Technology, 35: 35-39.

Cotton, R. 1974. Cytotaxonomy of the genus Vulpia. Ph. D. Thesis, Uni. Manchester, USA.

Cowan, R.S., Chase, M. W., Kress, W. J and Savolainen, V. 2006. 300,000 species to identify: problems, progress, and prospects in DNA barcoding of land plants. Taxon, 55(3): 611–616.

Devey, D. S., Chase, M. W. and Clarkson, J. J. 2009. A stuttering start to plant DNA barcoding: microsatellites present a previously overlooked problem in non-coding plastid regions. Taxon, 58: 7-15.

Dhar, U., Manjkhola, S., Joshi, M., Bhatt, A. A., Bisht, K. and Joshi, M. 2002. Current status and future strategy for development of medicinal plant sector in ttaranchal, India. Current Science, 83(8): 956-964.

215

Dickson, R. A., Houghton, P. J. and Hylands, P. J. 2007. Antibacterial and antioxidant cassane diterpenoids from Caesalpinia benthamiana. Phytochemistry, 68(10): 1436-1441.

Doyle, J. J. and Doyle, J. L. 1990. Isolation of plant DNA from fresh tissue. Focus, 12:13–15.

Dubey, N. K., Kumar, R. and Tripathi, P. 2004. Global promotion of herbal medicine: India's opportunity. Current science, 86(1): 37-41.

Dubey, R. B. and Savant, B. S. 2015. Current scenario of adulterants and substitutes of medicinal plants. A review. Journal of Pharmaceutical and Scientific Innovation, 4: 5.

Dymock,W. 1972. Pharmacographia Indica. Hamdard Press, Karachi 1: 528.

Edwards, D.M. 1993. The Marketing of Non-Timber Forest Products from the Himalayas: The trade between East Nepal and India. Rural Development Forestry Network Paper No. 15b. London: Overseas Development Institute.

Ellegren, H. 2004. Microsatellites: simple sequences with complex evolution. Nature reviews genetics, 5(6): 435.

FAO. 1995. Food and Agriculture organization of the United Nations. Chapter 2- Cinnamomum oils (including cinnamon and cassia). “Flavours and Fragances of plant origin” Non wood Forest products 1 FAO- Food and Agriculture organization of the united nations M-37, IS BN 92-5-103648-9,(c) FAO.

Fazal, H., Ahmad, N. and Haider Abbasi, B. 2013. Identification, characterization, and palynology of high-valued medicinal plants. The Scientific World Journal, 2013.

Fazekas, A. J., Burgess, K. S., Kesanakurti, P. R., Graham, S. W., Newmaster, S. G., Husband, B. C., Percy, D. M., Hajibabaei, M. and Barrett, S. C. H. 2008. Multiple Multilocus DNA Barcodes from the Plastid Genome Discriminate Plant Species Equally Well. PLoS ONE, 3(7): e2802.

Ford, C. S., Ayres, K. L., Toomey, N., Haider, N., Van Alphen Stahl, J., Kelly, L. J., Wikstrom, N., Hollingsworth, P. M., Duff, R. J. and Hoot, S. B. 2009. Selection of candidate coding DNA barcoding regions for use on land plants. Botanical Journal of the Linnean Society, 159: 1-11.

Ganie, S. H., Upadhyay, P., Das, S. and Sharma, M. P. 2015. Authentication of medicinal plants by DNA markers. Plant Gene, 4: 83-99.

Ganie, S. H., Yadav, D., Ahmad, A., Chadhry, A. and Asif, M. 2013. Authentication of traditional crop Kalongi (Nigella sativa L.) by LAMP marker. Indian Journal of Research in Pharmacy and Biotechnology, 1(6): 765.

Gao, T., Yao, H., Song, J. Y., Zhu, Y. J., Liu, C. and Chen, S. L. 2010. Evaluating the feasibility of using candidate DNA barcodes in discriminating species of the large Asteraceae family. BMC Evolutionary Biology, 10: 324.

216

Gaur, R. D. 2008. Traditional dye yielding plants for Uttarakhand, India. Natural products Radiance, 27(2): 154-165.

Ge, S. and Hong, D. Y. 1995. Genetic variation and taxonomic value of morphological characters. Acta Phytotaxonomica Sinica, 33 (5): 433–443.

Gerasopoulos, D. and Stavroulakis, G. 1997. Quality characteristics of four mulberry (Morus sp) cultivars in the area of Chania, Greece. Journal of the Science of Food and Agriculture, 73(2): 261-264.

Gowda, B., Chandrika, K., Prasanna, K. T. and Kirana, V. C. 2010. AFLP authentication of Embelia ribes Burm.F and Embelia tsjeriam cottama. DC. International Journal of Science and Nature, 1(1): 58-60.

Grytsyk, A. R., Neiko, O. V. and Melnyk, M. V. 2016. Morphological-anatomical study of Achillea L. species in western region of Ukraine. The Pharma Innovation, 5(1, Part B): 71- 73.

Guan, F., Jin, Y. T., Zhao, J., Xu, A. C. and Luo, Y. Y. 2018. A PCR Method That Can Be Further Developed into PCR-RFLP Assay for Eight Animal Species Identification. Journal of analytical methods in chemistry, 2018: 1-6.

Gupta, P., Chandra, N. and Bhot, M. 2016. Anatomical and Phytochemical study of plant parts of Butea monosperma (Lamk.) Taub. International Journal of Life Sciences, 4(2): 227- 234.

Gutteridge, A. and Burns, M. 2013. The application of DNA molecular approaches for the identification of herbal medicinal products. Journal of the Association of Public Analysts, 41: 53-66.

Hartvig, I., Czako, M, Kjaer, E. D., Nielsen, L. R.a and Theilade, I. 2015. The use of DNA barcoding in identification and conservation of rosewood (Dalbergia spp.). PLOS ONE, 10 (9):e0138231

Hayat, M. Q., Ashraf, M., Jabeen, S., Shaheen, N., Yasmin, G., and Khan, M. A. 2010. Taxonomic implications of foliar epidermal characteristics with special reference to stomatal variations in the genus Artemisia (Asteraceae). International Journal of Agriculture and Biology, 12 (2): 221-226.

Hebert, P. D., Cywinska, A. and Ball, S. L. 2003. Biological identifications through DNA barcodes. Proceedings of the Royal Society of London B: Biological Sciences, 270 (1512): 313 -321.

Hill, A. F. 1989. Economic botany. A textbook of useful plant and plants product, 2nd ed. Newyork, McGraw hill book company, Inc.

Hollingsworth, P. M., Forrest, L. L., Spouge, J. L., Hajibabaei, M., Ratnasingham, S., and Fazekas, A. J. 2009. A DNA barcode for land plants. Proceedings of the National Academy of Sciences, 106(31): 12794-12797.

217

Hon, C. C., Chow, Y. C., Zeng, F. Y. and Leung, F. C. C. 2003. Genetic authentication of ginseng and other traditional Chinese medicine. Acta Pharmacologica Sinica, 24(9): 841- 846.

Hooker, J. D. and KCSI. 1885. Flora of British India. Asclepideae to Amarantaceae. Vol. IV: 65-76.

Hooker, J. D. and KCSI. 1894. Flora of British India, Orchideae to Cyperaceae. Vol. 4:99- 102.

Hubert, N. and Hanner, R. 2015. DNA barcoding, species delineation and taxonomy: a historical perspective. DNA barcodes, 3(1): 44-58.

Idu, M., Omogbai, E. K. I., Aghimien, G. E. I., Amaechina, F., Timothy, O. and Omonigho, S. E. 2007. Preliminary phytochemistry, antimicrobial properties and acute toxicity of Stachytarpheta jamaicensis (L.) Vahl. Leaves. Trends in Medical Research, 2: 193- 198.

Inglis, P. W., Mata, L. R., da Silva, M. J., Vieira, R. F., de BN Alves, R., Silva, D. B. and Azevedo, V. C. 2018. DNA Barcoding for the Identification of Phyllanthus Taxa Used Medicinally in Brazil. Planta medica, 84 (17): 1300-1310.

Iqbal, M. 1993. International trade in non-wood forest products. An overview.

Iwu, M. W., Duncan, A. R. and Okunji, C. O. 1999. New antimicrobials of plant origin. Perspectives on new crops and new uses. ASHS Press, Alexandria, VA, 457-462.

Jarman, S. and Elliott, N. 2000. DNA evidence for morphological and cryptic Cenozoic speciations in the Anaspididae, living fossils' from the Triassic. Journal of Evolutionary Biology , 2000 ; 13(4): 624 -633.

Jinbo, U., Kato, T. and Ito, M. 2011. Current progress in DNA barcoding and future implications for entomology. Entomological Science , 14(2): 107 -124.

Joharchi, M. R and Amiri, M. A. 2012. Taxonomic evaluation of misidentification of crude herbal drugs marketed in Iran. Avicenna Journal of Phytomedicines, 2: 105-112.

Kapoor, I. P. S., Singh, B. & Singh, G. 2008. Essential oil and oleoresins of Cinnamomum tamala (tejpat) as natural food preservatives for pineapple fruit juice. Journal of food processing and preservation, 32(5): 719-728.

Khan, M. A., Ahmad, M., Zafar, M., Sultana, S., Marwat, S. K., Shaheen, S., Leghari, M. K., Jan, G., Ahmad, F. and Nazir, A. 2011. Medico-botanical and chemical standardization of pharmaceutically important plant of Tricholepis chaetolepis (Boiss) Rech. f. Journal of Medicinal Plants Research, 5(8): 1471-1477.

Kiran, U., Khan, S., Mirza, K. J., Ram, M. and Abdin, M. Z. 2010. SCAR markers: a potential tool for authentication of herbal drugs. Fitoterapia, 81(8): 969-976.

Kirtikar, K. R. and Basu, B. D., Eds. 1984. Indian Medicinal Plants. Vol. III, Bishen Singh and Mahendra Pal Singh, Dehradun, Allahabad, 1664-1666.

218

Knowlton, N. 1993. Sibling species in the sea. Annual review of ecology and systematics, 24(1):189 -216.

Kojima, T., Nagaoka, T., Noda, K. and Ogihara, Y. 1998. Genetic linkage map of ISSR and RAPD markers in Einkorn wheat in relation to that of RFLP markers. Theoretical and Applied Genetics, 96(1): 37-45.

Kokate, C. K., Purohit, A. P and Gokhele, S. B. 2007. Pharmacognosy, 39th ed. Nirali Prakashan, Pune; 97-98.

Kool, A., de Boer, H. J., Kruger, A., Rydberg, A., Abbad, A., Bjoork, L. and Martin, G. 2012. Molecular identification of commercialized medicinal plants in Southern Morocco. PloS one, 7(6): e39459.

Kress, J. W. and Erickson, D. L. 2007. A two-locus global DNA barcode for land plants: The coding rbcL gene complements the non-coding trnH-psbA spacer region. PLoS ONE, 2(6): e508.

Kumar, M. and Malik, J. 2012. Pharmacognostical studies and evaluation of quality parameters of Butea frondosa leaves. International journal of pharmacy and pharmaceutical sciences, 4(1): 610-614.

Kumar, R. 2014. Research Methodology: A Step-by-Step Guide for Beginners. 4th Edition, SAGE Publications Ltd., London.

Kumar, S. P. 2014. Adulteration and substitution in endangered ASU medicinal plants of India: a review. International Journal of Medicine and Aromatic Plants, 4(1): 56-73.

Lahaye, R., van der Bank, M., Bogarin, D., Warner, J., Pupulin, F., Gigot, G., Maurin, O., Duthoit, S., Barraclough, T.G. and Savolainen, V. 2008. DNA barcoding the floras of biodiversity hotspots. Proceedings of the National Academy of Sciences, 105: 2923-2928.

Lwin, M. M. 2008. Morphological, Micoscopical Studies and Elemental analysis of Polygonum Chinese L. and Rhoeo discolor Hance. 42(31): 265-279.

Ma, X.Y., Xie, C. X., Liu, C., Song, J.Y., Yao, H., Lun, K., Zhu, Y., Gao. T., Pang, H., Qian. and Chen, S. L. 2010. Species identification of medicinal pteridophytes by a DNA barcode marker, the chloroplast psbA-trnH intergenic region. Biological and Pharmaceutical Bulletin, 33: 1919-1924.

Mahmood, T., Akhtar, N. and Khan, B. A. 2010. The morphology, characteristics and medicinal properties of Camellia sinensis tea. Journal of Medicinal Plants Research, 4(19): 2028-2033.

Mallya, S., Nesari, T. and Kumar Zha, P., 2014. Phyto-Pharmacognostical study of Mundi (Sphaeranthus indicus Linn.). Journal of Ayurveda and olistic Medicine. 2(2): 13- 20.

Mankga, L. T, Yessoufou, K., Moteetee, A. M., Daru, B. H., and van der Bank, M. 2013. Efficacy of the core DNA barcodes in identifying processed and poorly conserved plant materials commonly used in South African traditional medicine. Zookeys, 365: 215-233.

219

Martin, J., Torrell, M. and Valles, J. 2001. Palynological features as a systematic marker in Artemisia L. and related genera (Asteraceae, Anthemideae). Plant Biology, 3(4): 372-378.

Meo, A. A. and Khan, M. A. 2004. Diversity of Pollen morphology in the family Compositae (Asteraceae) from northern areas of Pakistan. In International Symposium on Biodiversity in Northern Areas of Pakistan, pp. 8-10.

Meo, A. A., Hafiz, H. M. I., Baig, F. and Baig, N. A. 1988 .Studies of Pollen morphology of some Graminaceous (Poaceae) species . Sarhad Journal of Agriculture, 4: 99–103.

Mirahmadi, S. F., Hasandokht, M. R., Hassani, M. E and Sefidkon, F. 2012. Evaluation of genetic diversity among some wild populations of Achillea bieberstenii Afan. From Iran using morphological and agronomical traits. International Journal of Forest, Soil and Erosion, 2(1): 8-17.

Misra, A. and Srivastava, S. 2016. Chemotaxonomy: An Approach for Conservation & Exploration of Industrially Potential Medicinal Plants. Journal of Pharmacognosy and Natural Product, 2: e108.

Mitra, S. K. and Kannan, R. 2007. A note on unintentional adulterations in Ayurvedic herbs. Ethnobotanical leaflets, 11(1): 11-15.

Morgan, JAT. Blair, D. 1998. Relative merits of nuclear ribosomal internal transcribed spacers and mitochondrial CO1 and ND1 genes for distinguishing among Echinostomaspecies (Trematoda). Parasitology, 116:289 –297.

Munir, M., Khan, M. A., Ahmed, M., Seema, N., Ahmed, S. N., Tariq, K., Tabassum, S., Mukhtar, T., Ambreen, M. and Bashir, S. 2011. Foliar epidermal anatomy of some ethnobotanically important species of wild edible fruits of northern Pakistan. Journal of Medicinal Plants Research, 5(24): 5873-5880.

Muthu, C., Ayyanar, M., Raja, N. and Ignacimuthu, S. 2006. Medicinal plants used by traditional healers in Kancheepuram District of Tamil Nadu, India. Journal of Ethnobiology and ethnomedicine, 2(1): 43.

Nasir, E. and Ali, S. I. 1982. Flora of Pakistan, Poaceae. Thomas, A. Cope. Herbarium Royal Botanical Garden Kew, England. Vol 143. pp.680.

Neelam, K. N., Dwivedi, K. N. and Ram, B. 2014. Adulteration and substitution of medicinal plant: a burning problem in herbal industry. International journal of pharmaceutical and biological Archive, 5(3): 13-18.

Newmaster, S. G., Fazekas, A. J., Steeves, R. A. D. and Janovec, J. 2008. Testing candidate plant barcode regions in the Myristicaceae. Molecular Ecology Resources 8: 480-490.

Newmaster, S. G., Grguric, M., Shanmughanandhan, D., Ramalingam, S. and Ragupathy, S. 2013. DNA barcoding detects contamination and substitution in North American herbal products. BMC medicine, 11(1): 222.

220

Nwachukwu, C. U. and Mbagwu, F. N. 2006. Morphological features in some sp. of Indigofera L. Leguminosae-Papilionoideae. Journal of Fisheries International, 1(2-4): 50-54.

Parida, M., Sannarangaiah, S., Dash, P. K., Rao, P. V. L. and Morita, K. 2008. Loop mediated isothermal amplification (LAMP): a new generation of innovative gene amplification technique; perspectives in clinical diagnosis of infectious diseases. Reviews in medical virology, 18(6): 407-421.

Parvathy, V. A., Swetha, V. P., Sheeja, T. E., Leela, N. K., Chempakam, B. and Sasikumar, B. 2014. DNA barcoding to detect chilli adulteration in traded black pepper powder. Food Biotechnology, 28(1): 25-40.

Patel, D. K., Kumar, R., Laloo, D. and Hemalatha, S. 2012. Natural medicines from plant source used for therapy of diabetes mellitus: An overview of its pharmacological aspects. Asian Pacific Journal of Tropical Disease, 2(3): 239-250.

Perveen, A. 2006. A contribution to the pollen morphology of family Gramineae. World Applied Science Journal, 1(2): 60-65.

Perveen, A. and Qaiser, M. 2010. pollen flora of Pakistan. LXV. Berberidaceae. Pakistan Journal of botany, 42: 1-6.

Prabhakar, R. and Ramakrishna, H. 2014. Palynodiversity in Boath mandal forest division of Adilabad district, Telangana State, India. International Journal of Pharmacy & Life Sciences, 5(7): 3685-3693.

Pramanick, D. D. 2016. Anatomical studies on the leaf of Gymnema sylvestre (Retz.) R. Br. ex Schult.(Apocynaceae): A magical herbal medicine for diabetes. International Journal of Herbal Medicine, 4(1): 70-72.

Rabe, T. S. J. and Vanstoden, J. 2000. Isolation of an antimicrobial sesquiterpenoid from Warbugie salutaris. Journal of ethnopharmacology, 93: 171-174.

Raterta, R., Cabelin, V. L. D. and Alejandro, G. J. D. 2014. Molecularauthentication Of Selected Commercially sold Medicinal Plants In Quiapo, Manila, Philippines. International Journal of Scientific & Technology Research, 3(9): 22-26.

Ravindran, P. N., Nirmal, B. k. and Shylaja, M. Cinnamomum and Cassia. 2005. Edition published in Taylor & rancis e-Library.

Ren, B. Q., Xiang, X. G. and Chen, Z. D. 2010. Species identification of Alnus (Betulaceae) using nrDNA and cpDNA genetic markers. Molecular Ecology Resources, 10(4): 594–605.

Saidulu, C., Venkateshwar, C. and Rao, S. G. 2014. Morphological studies of medicinal plant of Withania somnifera (L.) Dunal grown in heavy metal treated (contaminated) soil. Journal of Pharmacognosy and Phytochemistry, 3(1): 37-42.

Saldanha, C. J. and Nicolson, D. H. 1976. Flora of Hassan District Karnataka, India, Amerind Publishing Co. Pvt. Ltd. New York.

221

Sang, T., Crawford, D. J. and Stuessy, T. F. 1997. Chloroplast DNA phylogeny, reticulate evolution, and biogeography of Paeonia (Paeoniaceae). American Journal of Botany, 84: 1120-1136.

Seethapathy, G. S., Ganesh, D., Santhosh Kumar, J. U., Senthilkumar, U., Newmaster, S. G., Ragupathy, S., Shaanker, R. U. and Ravikanth, G. 2014. Assessing product adulteration in natural health products for laxative yielding plants, Cassia, Senna, and Chamaecrista in Southern India using DNA barcoding. International Journal of Legal Medicine, 129: 693- 700.

Selvaraj, D., Shanmughanandhan, D., Sarma, R. K., Joseph, J. C., Srinivasan, R. V. and Ramalingam, S. 2012. DNA barcode ITS effectively distinguishes the medicinal plant Boerhavia diffusa from its adulterants. Genomics, proteomics & bioinformatics, 10(6): 364- 367.

Shaheen, S., Ahmad, M., Khan, F., Zafar, M., Sultana, S., Khan, M. A., Leghari, M. K., Jamil, M. and Fatima, H. 2011. Morpho-playnological and foliar epidermal anatomy of genus Cenchrus L. Journal of Medicinal Plants Research, 5(16): 3796-3802.

Shinwari, Z. K., Jan, S. A., Khalil, A. T., Khan, A., Ali, M., Qaiser, M. and Zahra, N. B. 2018. Identification and phylogenetic analysis of selected medicinal plant species from pakistan: dna barcoding approach. Pakistan Journal of Botany, 50(2): 553-560.

Shirasawa, K., Ishii, K., Kim, C., Ban, T., Suzuki, M., Ito, T. and Tabata, S. 2013. Development of Capsicum EST–SSR markers for species identification and in silico mapping onto the tomato genome sequence. Molecular Breeding, 31(1): 101-110.

Sofowora, A. 1982. Medicinal plants and traditional Medicine in West Africa. John Wiley & Sons Limited, New York, 256.

Spies, J. J. and Spies, P. 2018. Assessing Clivia taxonomy using the core DNA barcode regions, matK and rbcLa. Bothalia-African Biodiversity & Conservation, 48(1): 1-8.

Stanford, A. M., Harden, R. and Parks, C. R. 2000. Phylogeny and biogeography of Juglans (Juglandaceae) based on matK and ITS sequence data. American Journal of Botany, 87: 872- 882.

Subhose, V., Srinivas, P., & Narayana, A. 2005. Basic principles of pharmaceutical science in Ayurvĕda. Bulletin of the Indian Institute of History of Medicine (Hyderabad), 35(2): 83-92.

Sultana, S. and Zafar, M. 2013. Authentication of herbal medicine henna ( Lawsonia innermis L.) by using taxonomic and pharmacognostic techniques. Pakistan Journal of Botany, 45: S165-S176.

Sultana, S., Ahmad, M., Zafar, M., Khan, M. A. and Arshad, M. 2012. Authentication of herbal drug Senna (Cassia angustifolia Vahl.): A village pharmacy for Indo-Pak Subcontinent. African journal of pharmacy and pharmacology, 6(30): 2299-2308.

222

Sultana, S., Khan, M. A., Ahmad, M., Bano, A., Zafar, M. and Shinwari, Z. K. 2011. Authentication of herbal medicine neem (Azadirachta indica A. Juss.) by using taxonomic and pharmacognostic techniques. Pakistan Journal of Botany, 43: 141-150.

Swetha, V. P., Parvathy, V. A., Sheeja, T. E., and Sasikumar, B. 2014. Isolation and amplification of genomic DNA from barks of Cinnamomum spp. Turkish Journal of Biology, 38(1): 151-155.

Tamir, S., Eizenberg, M., Somjen, D., Izrael, S. and Vaya, J. 2001. Estrogen-like activity of glabrene and other constituents isolated from licorice root. The Journal of steroid biochemistry and molecular biology, 78(3): 291-298.

Tate, J. A. 2002. Systematics and evolution of Tarasa (Malvaceae): An enigmatic Andean polyploid genus. Dissertation, The University of Texas at Austin, U.S.A. https://www.lib.utexas.edu/etd/d/2002/tateja026/tateja026.pdf

Tewari, N. N. 1991. Some crude drugs: source, substitute and adulterant with special reference to KTM crude drug market. Sachitra Ayurved, 44(4): 284-290.

Thormann, C. E., Ferreira, M. E., Camargo, L. E. A., Tivang, J. G. and Osborn, T. C. 1994. Comparison of RFLP and RAPD markers to estimating genetic relationships within and among cruciferous species. Theoretical and Applied Genetics, 88(8): 973-980.

Tripathi, N., Saini, N. and Tiwari, S. 2011. Assessment of genetic diversity among Aloe vera accessions using amplified fragment length polymorphism. International Journal of Medicinal and Aromatical Plants, 1: 115-121.

Tripathi, S. and Mondal, A. K. 2012. Taxonomic diversity in epidermal cells (stomata) of some selected Anthophyta under the order Leguminales (Caeselpiniaceae, Mimosaceae and Fabaceae) based on numerical analysis: A systematic approach. International Journal of Science & Nature, 3(4): 788-798.

Tutin, T. and Heywood, G. 1972. Flora of Europe. Vol. 3.Cambridge University Press.

Unnati, S., Shilpa, T., Daxa, T. and Mehul, B. 2014. Pharmacognostical and Phytochemical Evaluation of Adhatoda Vasica Leaf. International Journal of Research Studies in Biosciences, 2(11): 144-148.

Vassou, S. L., Kusuma, G. and Parani, M. 2015. DNA barcoding for species identification from dried and powdered plant parts: a case study with authentication of the raw drug market samples of Sida cordifolia. Gene, 559: 86–93.

Venkatachalam, D., Thavamani, S. and Muddukrishniah. 2018. Pharmacognostic and phytochemical evaluation of leaf of Sphaeranthus indicus Linn. International journal of Pharmact and Pharmaceutical research. 11(3): 186-206.

Vijayan, D., Cheethaparambil, A., Pillai, G. S. and Balachandran, I. 2014. Molecular authentication of Cissampelos pareira L. var. hirsuta (Buch.-Ham. ex DC.) Forman, the genuine source plant of ayurvedic raw drug „Patha‟, and its other source plants by ISSR markers. 3 Biotech, 4(5): 559-562.

223

Vijayan, K. and Tsou, C. H. 2010. DNA barcoding in plants: taxonomy in a new perspective. Current Science, 99(11): 1530-1541.

Walter, S. 2001. Non-wood forest products in Africa. A regional and national overview. Les produits forestiers non ligneux en Afrique. Un apercu regional et national. – Rome, FAO Forestry Department (Working Paper/Document de Travail FOPW/01/1).

Wang, Z. Y. and Nixon, D. W. 2001. Licorice and cancer. Nutrition and cancer, 39(1): 1-11.

Willis, N. J. 2005. Bistatic radar (Vol. 2). SciTech Publishing.

Yadav, A., Ahmad, J., Chaudhary, A. A. and Ahmad, A. 2012. Development of Sequence Characterized Amplified Region (SCAR) marker for the authentication of Bacopa monnieri (L.) Wettst. European journal of medicinal plants, 2(3): 186.

Yousaf, Z., Shinwari, Z. K. and Khan, M. A. 2010. Phenetic analysis of medicinally important species of the genus Solanum from Pakistan. Pakistan Journal of Botany, 42(3): 1827-1833.

Zabihullah, Q., Rashid, A. and Akhtar, N. 2006. Ethnobotanical survey in Kot- Manzaray Baba valley, Malakand Agency, Pakistan. Pakistan Journal of Political Science, 12: 115-121.

Zafar, M., Ahmad, M., Khan, M. A., Sultana, S., Jan, G., Ahmad, F., Jabeen, A., Shah, G.M., Shaheen, S., Shah, A. and Nazir, A. 2009. Chemotaxonomic clarification of pharmaceutically important species of Cyperus L. African Journal of Pharmacy and Pharmacology, 5(1): 67- 75.

Zafar, M., Asmat, T., Khan, M. A., Ahmed, M., Manzoor, F., Munir, M. and Ambreen, M. 2011. Pollen morphology of selected species of District Dir Upper, Pakistan. Journal of Medicinal Plants Research, 5(28): 6423-6428.

Zhou, J., Wang, W., Liu, M. and Liu, Z. 2014. Molecular authentication of the traditional medicinal plant Peucedanum praeruptorum and its substitutes and adulterants by DNA- barcoding technique. Pharmacognosy magazine, 10(40): 385.

xvii

Annexure I

Survey Questionnaire Sample

Department of Botany

Lahore College for Women University

1. What is the profession of respondent?

2. What is the age of respondent?

3. What is the gender of respondent?

4. How many herbal plants are present at your shop?

5. What kind of diseases can be treated by these available herbal plants?

6. How many herbal plants are sold daily basis?

7. Do you have ever heard about the term adulteration?

8. Which herbal most likely to have adulteration issue?

9. What is medicinal efficacy of actual herbal plant?

10. Which part of that plant possessed therapeutic effectiveness?

11. Which plant or plants commonly substituted with them?

12. What are the potential side effects of those adulterants?

13. Are these herbal plants native or imported?