East Tennessee State University Digital Commons @ East Tennessee State University
Electronic Theses and Dissertations Student Works
12-2013 An Examination of the Inhibitory Effects of Antibiotic Combinations on Ribosome Biosynthesis in Staphylococcus aureus Justin Beach East Tennessee State University
Follow this and additional works at: https://dc.etsu.edu/etd Part of the Biochemistry Commons
Recommended Citation Beach, Justin, "An Examination of the Inhibitory Effects of Antibiotic Combinations on Ribosome Biosynthesis in Staphylococcus aureus" (2013). Electronic Theses and Dissertations. Paper 2287. https://dc.etsu.edu/etd/2287
This Dissertation - Open Access is brought to you for free and open access by the Student Works at Digital Commons @ East Tennessee State University. It has been accepted for inclusion in Electronic Theses and Dissertations by an authorized administrator of Digital Commons @ East Tennessee State University. For more information, please contact [email protected]. An Examination of the Inhibitory Effects of Antibiotic Combinations on Ribosome
Biosynthesis in Staphylococcus aureus
______
A dissertation
presented to the faculty of The Department of Biomedical Sciences
East Tennessee State University
In partial fulfillment
of the requirements for the degree
Doctor of Philosophy in Biomedical Sciences
______
by
Justin Michael Beach
December 2013
______
W. Scott Champney, Ph.D., Chair
Alok Agrawal, Ph.D.
Donald Hoover, Ph.D.
Antonio Rusinol, Ph.D.
Doug Thewke, Ph.D.
Keywords: Ribosome Biosynthesis, Protein Synthesis, Antibiotic Combinations,
Azithromycin, Rifampicin, Ciprofloxacin, Staphylococcus aureus ABSTRACT
An Examination of the Inhibitory Effects of Antibiotic Combinations on Ribosome
Biosynthesis in Staphylococcus aureus
by
Justin Michael Beach
Bacteremia initiated by Staphylococcus aureus infections can be a serious medical problem. Although a number of different antibiotics are used to combat staphylococcal infections, resistance has continued to develop. Combination therapy for certain infections has been used to reduce the emergence of resistance when a single agent has become ineffective. We hypothesize that the use of rifampicin and ciprofloxacin in combination with azithromycin, known for its inhibitory effects on the bacterial ribosome, can create potential synergistic effects resulting from indirect effects on ribosomal subunit synthesis.
To determine this we measured the effects of single and multiple antibiotics on cell growth rates, cell viability, and synthesis rates for DNA, RNA, and protein.
We then measured synthesis rates of ribosomal subunits and the amounts of gyrase and RNAP. Effects of the antibiotic combinations on 70S ribosomes was assayed and the amounts of RNA and degradation was measured. We lastly
2 studied the effects of these antibiotic combinations on mutation frequency in
Staphylococcus aureus.
Our data have shown support not only for the use of antibiotic combination therapy but have provided strong evidence of an increase in the inhibition of bacterial ribosome assembly in Staphylococcus aureus. The reduction of 50S ribosomal subunit synthesis and 23S ribosomal RNA in cells grown in the presence of azithromycin, already known for it’s inhibitory effects on the 50S subunit synthesis, in combination with rifampicin or in combination with rifampicin and ciprofloxacin was observed. This also resulted in a reduction or elimination in the frequency of resistant cells when grown in the presence of these combinations.
These studies have shed light on the mechanism of action involved and synergistic effects occurring in combination antibiotic treatments and how ribosomal subunit assembly is affected. The insights gained through this research provide necessary information needed for the design of more potent antibiotic combinations. This will create a better understanding and new methods for eliminating the spread of harmful pathogens such as
Staphylococcus aureus.
3 DEDICATION
This manuscript is dedicated to:
Garrett: You’re too young to understand this now, but I hope that one day you’ll pick this up and remember that this and everything else I do has always been, and will always be, for you. I love you, son.
4 ACKNOWLEDGEMENTS
Thank you to Dr. Champney for all of your guidance and support. Not many graduate advisors or people in general would have been as patient and understanding during these last few years.
I would like to thank my committee members: Dr. Alok Agrawal, Dr.
Donald Hoover, Dr. Antonio Rusinol, and Dr. Doug Thewke for their time and advice.
Thank you to Beverly Sherwood and Angela Thompson for always going above and beyond what is necessary and for the countless times you’ve been there to listen and help me for anything I have needed.
Thank you to my family, friends, fellow lab mates and graduate students for your advice, support, and absolute kindness during all of this. I certainly could not have made it this far without some of you.
A special thank you to Ward Rodgers for his contributions not only to this work, but to my now extensive recognition of 80s rock and endless football knowledge.
Brigitte Browe, this * is for you. Thank you for everything.
5
This work was supported by the National Institutes of Health AREA grant awarded to Dr. W. Scott Champney and the ETSU Graduate School Research grant awarded to Justin M. Beach.
6 TABLE OF CONTENTS
Page
ABSTRACT ...... 2
LIST OF TABLES ...... 10
LIST OF FIGURES ...... 11
LIST OF ABBREVIATIONS ...... 16
Chapter
1. INTRODUCTION ...... 18
Antibiotic Overview ...... 18
Antibiotic Targets ...... 21
Azithromycin ...... 23
Rifampicin ...... 25
Ciprofloxacin ...... 26
Combination Therapy ...... 27
Model ...... 30
Research Hypothesis ...... 31
Specific Research Aims ...... 32
2. MATERIALS AND METHODS ...... 33
Analysis of Cellular Growth and Viability ...... 33
DNA Synthesis Assays ...... 33
RNA Synthesis Assays ...... 34
Protein Synthesis Assays ...... 34
7 Uridine Pulse and Chase Labeling ...... 34
70S Ribosome Synthesis Assay ...... 35
Preparation of Cellular Lysates ...... 35
Western Blot Analysis ...... 36
Agilent Bioanalysis of Total Cellular RNA ...... 37
Northern Blot Hybridization ...... 38
Mutation Frequency Assays ...... 39
Statistical Analysis ...... 39
3. RESULTS ...... 40
IC50 Determination ...... 40
Effects of Antibiotic Combinations on Cellular Growth Rates ...... 43
Effects of Antibiotic Combinations on Cellular Viability ...... 44
Effects of Antibiotic Combinations on DNA Synthesis Rates ...... 46
Effects of Antibiotic Combinations on RNA Synthesis Rates ...... 49
Effects of Antibiotic Combinations on Protein Synthesis Rates ...... 52
Effects of Antibiotic Combinations on Pulse and Chase Labeling ...... 56
Effects of Antibiotic Combinations on 70S Ribosome Synthesis ...... 70
Effects of Antibiotic Combinations on Western Blot Analysis ...... 80
Effects of Antibiotic Combinations on Agilent Bioanalysis of Total Cellular
RNA ...... 87
Effects of Antibiotic Combinations on Northern Blot Hybridization ...... 91
Effects of Antibiotic Combinations on Mutation Frequency Assays ...... 97
4. DISCUSSION ...... 98
8 IC50 Determination ...... 99
Cellular Growth Rates ...... 99
Cellular Viability ...... 99
DNA Synthesis Rates ...... 99
RNA Synthesis Rates ...... 99
Protein Synthesis Rates ...... 99
Pulse and Chase Labeling ...... 101
70S Ribosome Synthesis ...... 101
Western Blot Analysis ...... 100
Agilent Bioanalysis of Total Cellular RNA ...... 103
Northern Blot Hybridization ...... 103
Mutation Frequency Assays ...... 104
Summary ...... 105
REFERENCES ...... 107
VITA ...... 117
9 LIST OF TABLES
Table Page
1. Antibiotics used in combination studies with their targets and their mechanism of action...... 23
2. The percent of control rate for viable cell counts and cellular doubling time at
IC50 for single or multiple antibiotic growths...... 46
3. The percent of control rate for DNA synthesis, RNA synthesis, and Protein synthesis...... 55
4. Pulse/chase rates are based on the percent of the control amounts of ribosomal subunits at 60 minutes in the presence of different antibiotic combinations...... 69
5. 70S ribosome synthesis for all samples represented as a percent of total gradient CPM for the top fractions, the subunits and the 70S ribosome...... 80
6. Western blot analysis for total cellular protein from Staphylococcus aureus under different antibiotic condition and probed for RNAP β, DNA gyrase A, DNA gyrase B, and GAPDH and normalized as a percentage of the control...... 86
7. Agilent chip data...... 90
8. Northern blot hybridization analysis taken as a percentage of the control total area signal for RNA from Staphylococcus aureus grown in the presence of different antibiotic combinations at IC50 and probed for 16S and 23S RNA...... 96
9. Mutation frequencies for different antibiotic combinations. Percent of single antibiotic control shown in parentheses...... 97
10 LIST OF FIGURES
Figure Page
1. Overview of Antibiotic Use ...... 20
2. Structure of Azithromycin (An Azalide) ...... 25
3. Structure of Rifampicin (A Rifamycin family member) ...... 26
4. Structure of Ciprofloxacin (A Fluoroquinolone) ...... 27
5. A model showing how a decrease in 50S ribosomal subunit amounts caused by azithromycin inhibition can lead to reduced levels of RNA polymerase and
DNA gyrase (topoisomerase II), making them more sensitive to rifampicin or ciprofloxacin...... 30
6a. Growth rates of Staphylococcus aureus at different azithromycin concentrations...... 40
6b. Growth rates of Staphylococcus aureus at different rifampicin concentrations...... 41
6c. Growth rates of Staphylococcus aureus at different ciprofloxacin concentrations...... 42 42
7a. Growth rates of cells grown in the presence of azithromycin, rifampicin, or ciprofloxacin at their IC50...... 43
7b. Growth rates of cells grown in the combinations of azithromycin + rifampicin, rifampicin + ciprofloxacin, azithromycin + ciprofloxacin or azithromycin + rifampicin + ciprofloxacin at each of the IC50 for each antibiotic ...... 44
8. Staphylococcus aureus cell viability in the presence of antibiotic combinations. 45
11 9a. Incorporation of 3H thymidine (1 µCi/mL) in Staphylococcus aureus cells after two cellular doublings in the presence of single antibiotics at the IC50...... 47
9b. Incorporation of 3H thymidine (1 µCi/mL) in Staphylococcus aureus cells after two cellular doublings in the presence of multiple antibiotics at the IC50...... 48
10a. Incorporation of 3H uridine (1 µCi/mL) in Staphylococcus aureus cells after two cellular doublings in the presence of single antibiotics at the IC50...... 50
10b. Incorporation of 3H uridine (1 µCi/mL) in Staphylococcus aureus cells after two cellular doublings in the presence of multiple antibiotics at the IC50...... 51
11a. Incorporation of 3H alanine (1 µCi/mL) in Staphylococcus aureus cells after two cellular doublings in the presence of single antibiotics at the IC50...... 53
11b. Incorporation of 3H alanine (1 µCi/mL) in Staphylococcus aureus cells after two cellular doublings in the presence of multiple antibiotics at the IC50...... 54
12a. Sucrose gradient profiles showing distribution of 3H-uridine in lysates from control cells, collected after 10 minutes and 60 minutes of labeling...... 57
12b. Sucrose gradient profiles showing distribution of 3H-uridine in lysates from azithromycin treated cells, collected after 10 minutes and 60 minutes of labeling. . 58
12c. Sucrose gradient profiles showing distribution of 3H-uridine in lysates from rifampicin treated cells, collected after 10 minutes and 60 minutes of labeling. .... 59
12d. Sucrose gradient profiles showing distribution of 3H-uridine in lysates from ciprofloxacin treated cells, collected after 10 minutes and 60 minutes of labeling. 60
12e. Sucrose gradient profiles showing distribution of 3H-uridine in lysates from azithromycin + rifampicin treated cells, collected after 10 minutes and 60 minutes of labeling...... 61
12 12f. Sucrose gradient profiles showing distribution of 3H-uridine in lysates from rifampicin + ciprofloxacin treated cells, collected after 10 minutes and 60 minutes of labeling...... 62
12g. Sucrose gradient profiles showing distribution of 3H-uridine in lysates from azithromycin + ciprofloxacin treated cells, collected after 10 minutes and 60 minutes of labeling...... 63
12h. Sucrose gradient profiles showing distribution of 3H-uridine in lysates from azithromycin + rifampicin +ciprofloxacin treated cells, collected after 10 minutes and 60 minutes of labeling...... 64
12i. Pulse/chase analysis of 30S subunit synthesis...... 65
12j. Pulse/chase analysis of 30S subunit synthesis...... 66
12k.Pulse/chase analysis of 50S subunit synthesis...... 67
12l. Pulse/chase analysis of 50S subunit synthesis...... 68
13a. 70S sucrose gradient profiles for 3H-uridine in lysates from control and azithromycin treated cells...... 72
13b. 70S sucrose gradient profiles for 3H-uridine in lysates from control and rifampicin treated cells...... 73
13c. 70S sucrose gradient profiles for 3H-uridine in lysates from control and ciprofloxacin treated cells...... 74
13d. 70S sucrose gradient profiles for 3H-uridine in lysates from control and azithromycin + rifampicin treated cells...... 75
13e. 70S sucrose gradient profiles for 3H-uridine in lysates from control and rifampicin + ciprofloxacin treated cells...... 76
13 13f. 70S sucrose gradient profiles for 3H-uridine in lysates from control and azithromycin + ciprofloxacin treated cells...... 77
13g. 70S Sucrose gradient profiles for 3H-uridine in lysates from control and azithromycin + rifampicin + ciprofloxacin treated cells...... 78
13h. Analysis of 70S subunit synthesis for all samples as a percent of the total gradient 3H CPM in the presence of different antibiotic combinations...... 79
14a. Western blot analysis for total cellular protein from Staphylococcus aureus under different antibiotic condition and probed for RNAP β, DNA gyrase A, DNA gyrase B, and GAPDH...... 81
14b. Western blot analysis for total RNAP β protein from Staphylococcus aureus under different antibiotic condition shown as a percentage of the control...... 82
14c. Western blot analysis for DNA gyrase A protein from Staphylococcus aureus under different antibiotic condition shown as a percentage of the control...... 83
14d. Western blot analysis for DNA gyrase B protein from Staphylococcus aureus under different antibiotic condition shown as a percentage of the control. . 84
14e. Western blot analysis for GAPDH protein from Staphylococcus aureus under different antibiotic condition shown as a percentage of the control...... 85
15a. Agilent chip analysis of Staphylococcus aureus RNA grown in the presence of different antibiotic combinations at IC50...... 88
15b. Agilent chip analysis of Staphylococcus aureus RNA grown in the presence of different antibiotic combinations at IC50 shown as a percentage of total area for small RNA, 16S RNA and 23S RNA...... 89
14 16a. Northern blot hybridization of RNA from Staphylococcus aureus grown in the presence of different antibiotic combinations at IC50 and probed for
16S RNA...... 92
16b. Northern blot hybridization analysis of RNA from Staphylococcus aureus grown in the presence of different antibiotic combinations at IC50 and probed for
16S RNA shown as a percentage of the control for total area signal...... 93
16c. Northern blot hybridization of RNA from Staphylococcus aureus grown in the presence of different antibiotic combinations at IC50 and probed for 23S RNA. ... 94
16d. Northern blot hybridization analysis of RNA from Staphylococcus aureus grown in the presence of different antibiotic combinations at IC50 and probed for
23S RNA shown as a percentage of the control for total area signal...... 95
15 LIST OF ABBREVIATIONS
AZI: Azithromycin
BSA: Bovine serum albumin
CFU: Colony forming units
CIP: Ciprofloxacin
CPM: Counts per minute
EDTA: Ethylenediaminetetraacetic acid
ETSH: β-mercaptoethanol
GAPDH: Glyceraldehyde 3-phosphate dehydrogenase
IC50: half maximal inhibitory concentration
MIC: minimum inhibitory concentration
PAGE: Polyacrylamide gel electrophoresis
PMSF: phenylmethanesulfonyl fluoride
RNAP: RNA polymerase
RIF: Rifampicin
SAS: Staphylococcus aureus S buffer
SDS: sodium dodecyl sulfate
SSC: saline-sodium citrate
TAE: Tris-acetate-EDTA
TCA: trichloroethanoic acid
TE: Tris EDTA
TRIS-HCL: trisaminomethane hydrochloride
16 TSB: Tryptic soy broth
TX-100: Triton X 100
17 CHAPTER 1
INTRODUCTION
Antibiotic Overview
As a growing threat to public health, antibiotic resistance is a prevalent and increasing concern in the medical field (1). Excessive use of antibiotics when treating humans, animals, or agriculture is thought to be a major contributor to this problem. Figure 1 shows a detailed diagram of antibiotic use in humans, animals, and the environment and shows how this overuse can lead to these organisms becoming resistant to the antimicrobial chemicals used to combat them (2-5).
Bacteremia initiated by staphylococcal infections, particularly
Staphylococcus aureus infections, can be a serious cause for alarm. Urgent and thorough elimination of the infection is critical to the well being of patients with infection (6). Antibiotic resistance in species such as Staphylococcus aureus was thought to be hospital acquired, but many studies have now shown that community-acquired infections are becoming more prevalent (7, 8). Just a few years after the first antibiotics were used to fight the spread of pathogens, resistance to penicillin began occurring. In the 1990s methicillin resistant
Staphylococcus aureus was found to no longer be nosocomial but was now community-acquired and spread more often (8).
18 In order to fight this serious problem, novel antibiotics, new antibiotic targets, and new methods to combat resistance are necessary (9, 10). Areas of research on new targets showing no current resistance are highly sought, and researchers are desperately attempting to discover these new targets every day.
Antibiotic resistance occurs through several different mechanisms, such as modification of targets, acquisition of resistant genes, spontaneous mutations and up-regulation of genes encoding cellular efflux pumps (8). Knowledge of these and other mechanisms can create a better understanding of current ways to treat antibiotic resistance and allow for increased response and success when fighting this global problem.
19 Overview of Antibiotic Use
Aquaculture Seas/Lakes Swimming
Drinking Water Rivers/Streams Drinking Water
Soil Industrial Household Manure Antimicrobial Spreading Chemicals Wildlife Dead Stock Vegetables, seeds, fruits
Animal FOOD Handling HUMANS Feeds ANIMALS Processing Meat Preparation Consumption
DIRECT Companion CONTACT Animals
Figure 1. Overview of antibiotic use
20 Antibiotic Targets
The bacterial ribosome consists of a small 30S and a large 50S subunit
(11). The 16S ribosomal RNA (rRNA) and 21 proteins make up the 30S subunit, while 23S rRNA and 34 proteins make up the 50S subunit (12). In order to create the bacterial ribosome, both subunits must be present and are essential to translation that uses specific centers for each subunit. The decoding center is located in the 30S subunit, essential to the A binding site, with the peptidyl- transferase center, essential to the P binding site, located in the 50S subunit
(13). A substantial amount of research has shown that antibiotics targeting the
30S and 50S subunits inhibit both bacterial protein synthesis and subunit assembly, indicating that inhibition of ribosomal subunit assembly may be a synergistic process with translational inhibition (11, 14-17).
Translational inhibition is the target for many antibiotics, such as the macrolides (11, 12, 14). During translation, mRNA transfers a genetic code to the ribosome, and tRNA carries the amino acids to the ribosome. Both the mRNA and tRNA must move through the ribosome in order for the process to continue. The progression of this is from the A site to the P site and lastly through the E site of the ribosome. Thus, the ribosome serves as a platform for the tRNA to read the mRNA and create a nascent polypeptide chain. This elongation cycle must include the decoding of the mRNA at the small ribosomal subunit by tRNA (within the A site), the formation of a peptide bond (the P site),
21 and the release of the tRNA molecule at the peptidyl-transferase center of the large ribosomal subunit (18). After decoding the mRNA at the A site, the tRNA carrying the nascent polypeptide chain moves to the P site for peptide bond formation. The tRNA that is ready to exit the ribosome is then moved to the E site after transferring the amino acid to the nascent peptide chain, leaving it uncharged (12). In order to repeat this cycle once the mRNA has been read, the ribosomal subunits of the 70S ribosome must be recycled (6, 14, 18-21). This is the final step in the protein synthesis cycle. Antibiotics can act by targeting the decoding and PTC centers in order to inhibit protein synthesis (12). In addition to this, another target of many antibiotics is the assembly and formation of the bacterial ribosome (11, 22). When this assembly of ribosomal subunits is inhibited, ribonucleases degrade ribosomal assembly intermediates (11) (see
Table 1).
Other targets for antibiotics include DNA synthesis and the transcription process (23). One group of antibiotics that inhibit DNA synthesis is the fluoroquinolones (24). They act by targeting DNA gyrase (topoisomerase II activity), which is involved in DNA negative supercoiling and are thus involved with the replication of the chromosome. This is necessary and essential for the survival of bacteria not only because of replication but also because of repair,
RNA transcription, and the recombination of DNA. DNA gyrase causes the relaxation of DNA and when inhibited by an antibiotic such as ciprofloxacin, DNA synthesis is inhibited causing bacteriostatic and eventually bactericidal effects to
22 occur (23). Other antibiotics inhibit the transcription of DNA to RNA as their target (25). Rifamycins have the ability to bind to and inhibit bacterial DNA- dependent RNA polymerase. These antibiotics have a bacteriostatic activity due to binding to the β subunit of the RNAP and preventing the holoenzyme from initiating RNA synthesis (23) (see Table 1).
Table 1. Antibiotics used in combination studies with their targets and their mechanisms of action
Antibiotic Target Inhibitory Effect
Azithromycin 50S ribosomal subunit Inhibitor of translation exit tunnel (23S RNA) and ribosomal subunit assembly Ciprofloxacin DNA gyrase (subunit A) Inhibitor of replication (Activity of Topoisomerase II) Rifampicin RNA Polymerase (β Inhibitor of subunit) transcription initiation
Azithromycin
Azithromycin, used primarily for pathogens causing middle ear infections, strep throat, pneumonia, and bronchitis, is one of the most prescribed antibiotics worldwide (23, 26, 27). An azalide derivative of erythromycin, it has an altered, more flexible 15 membered ring structure that allows it to occupy more space in the exit tunnel of the 50S ribosome when compared to other macrolides (28-32).
23 By binding to the upper portion of the peptide exit tunnel below the PTC of the
50S ribosome, this antibiotic blocks any newly made peptide chains from elongating (6). The use of azithromycin instead of other macrolides allows for a shorter peptide chain to form because of the larger size of azithromycin and is, thus, a more effective antibiotic. This occurs with only a single molecule of azithromycin being able to bind to a single ribosome at one time (33). Macrolides including azithromycin have also been shown to bind to an intermediate of the
50S subunit, the 32S precursor particle. During growth in the presence of azithromycin, there is an accumulation of the 32S precursor . This is indicative of stalling of the assembly of the 50S ribosomal subunit (34-36). Macrolide selectivity has also been determined based on the adenine at position 2058 of
23S rRNA—conserved in bacteria, but in eukaryotes there is a guanine residue
(14, 37, 38) (see Fig.2 Table 1).
24
Figure 2. Structure of Azithromycin (An Azalide). A 15 membered macrolactone ring with an azide in the ring. The desosamine sugar is essential for binding to
23S RNA.
Rifampicin
Rifampicin is a member of the rifamycin family and acts by binding to the beta subunit of the bacterial RNA polymerase, inhibiting transcription (25, 39). It is primarily used as part of treatment regimens for tuberculosis and meningitis.
The heavy use of rifampicin after it’s clinical introduction in the early 1960s resulted in resistance after just a few decades, due to monotherapy, especially in
25 common pathogens such as Staphylococcus aureus (23). Two mutational changes are responsible for high resistance levels in Staphylococcus aureus:
His526->Asn, and Ser574->Leu. Because of this high resistance, combinations of rifampicin with another antibacterial agents are commonly used to delay emergence of resistant strains (23, 40-43) (see Fig. 3 Table 1).
Figure 3. Structure of Rifampicin (A Rifamycin family member)
Ciprofloxacin
Ciprofloxacin is a fluoroquinolone and acts by targeting the topoisomerase
II activity of DNA gyrase and inhibits DNA replication (44). It is used to treat infections by many bacterial pathogens causing respiratory, urinary tract,
26 gastrointestinal, and abdominal infections. Since its introduction in 1987 it has been a largely successful antibiotic, but chromosome mutations are associated with resistance, especially in Staphylococcus aureus (23, 45). While some research has indicated an irreversibility to this resistance by fluoroquinolones in an antibiotic free environment, it is now also used in combination with other antibiotics such as rifampicin (46-49) (see Fig. 4 Table 1).
Figure 4. Structure of Ciprofloxacin (A Fluoroquinolone)
Combination Therapy
Although several different antibiotics have had success in treating staphylococcal infections, resistance has continued to plague any advances
27 made in the field (6). Methicillin-resistant Staphylococcus aureus (MRSA) and vancomycin-resistant Staphylococcus aureus are examples of the development of resistance to certain antibiotics that can lead to potentially life-threatening infections. The emergence of strains now frequently resistant to rifampicin and ciprofloxacin has lead to antibiotics being used in combination as a way to most effectively fight resistance (41, 50). Combination therapy for these types of infections has been used to prevent the emergence of resistance when a single agent has been rendered ineffective (2, 9, 51, 52). These dual-antibiotic therapies have shown to be useful in reducing the time of bacteremia and have become vital for treatment against multidrug resistant strains of bacteria, including MRSA and multidrug resistant tuberculosis(53) .
Along with helping to reduce the occurrence of resistant cells when antibiotics are used in combinations, this method of antibiotic use also allows for lower concentrations of each antibiotic being used because of the efficiency of using 2 or more antibiotics. This more effective way of treating infections caused by harmful pathogens also reduces other health concerns that have been associated with high antibiotic use (6, 54, 55).
Using two or more antibiotics targeting 2 or more essential cellular targets is a very effective way of eliminating the pathogen while also reducing or preventing the rate of recurrence (6). Using rifampicin, (a transcription inhibitor), ciprofloxacin (a replication inhibitor), and azithromycin (a translation inhibitor) in
28 combinations could have devastating effects for harmful pathogens by inhibiting the flow of genetic information in each of the essential process for protein synthesis in a biological system. Based on the prior research showing the inhibition of assembly of ribosomes by azithromycin, this use of antibiotics in combinations with azithromycin could also allow for synergistic effects on the assembly of the bacterial ribosome as well A model for this process is shown in
Figure 5.
29 Model
Figure 5. A model showing how a decrease in 50S ribosomal subunit amounts caused by azithromycin inhibition can lead to reduced levels of RNA polymerase and DNA gyrase (topoisomerase II), making them more sensitive to rifampicin or ciprofloxacin.
30 Research Hypothesis
Current research has shown that 2 important targets for several classes of antibiotics are the inhibition of bacterial ribosomal subunit assembly and translation (11, 56, 57). Azithromycin is an azalide derivative of erythromycin that inhibits translation by targeting the bacterial ribosome (28, 58). Two other antibiotics also have inhibitory effects on staphylococcal infections.
Ciprofloxacin, a fluoroquinolone, functions to inhibit DNA gyrase, inhibiting replication and rifampicin, a rifamycin, has an inhibitory effect on RNA polymerase, inhibiting transcription (23). (Table 1) Figure 5 shows my proposed model of the different targets for these 3 antibiotics. Their effects on target inhibition are shown to result from effects on ribosomal subunit synthesis. I hypothesize that the use of different antibiotics known for their inhibitory effects on Staphylococcus aureus in combinations with azithromycin, known for its inhibitory effects on the bacterial ribosome, can create potential synergistic, additive, or antagonistic effects. This can either improve or hinder the inhibition of protein synthesis via increased inhibition of subunit assembly leading to reduced levels of RNA polymerase and DNA gyrase as well (see Figure 5).
31 Specific Research Aims
Aim 1. Effects of single and multiple antibiotics on cell growth rates, cell viability, and synthesis rates for DNA, RNA, and protein in Staphylococcus aureus.
Aim 2. Effects of antibiotic combinations on synthesis rates of ribosomal subunits of Staphylococcus aureus.
Aim 3. Effects of antibiotic combinations on amounts of gyrase, RNAP, and 70S ribosomes in Staphylococcus aureus.
Aim 4. Effects of antibiotic combinations on RNA amounts and degradation in
Staphylococcus aureus.
Aim 5. Effects of antibiotic combinations on mutation frequency in
Staphylococcus aureus.
32 CHAPTER 2
MATERIALS AND METHODS
Analysis of Cellular Growth and Viability
Staphylococcus aureus (ATCC 29213) was grown at 37°C in tryptic soy broth (TSB). Growth rates were measured over time as an increase in cell density using a Klett-Summerson colorimeter in the presence or absence of antibiotics. At a Klett reading of 20, azithromycin, rifampicin, or ciprofloxacin were added in a single antibiotic treatment or in combinations of 2 or 3 antibiotics at each antibiotic’s measured IC50. At a Klett reading of 80, after 2 cellular doublings, cellular viability was determined by TSB agar plate colony counting following serial dilutions.
DNA Synthesis Assays
Staphylococcus aureus was grown as described in the presence or absence of the antibiotic combinations. After two cellular doublings, 1 µCi/mL of
3H thymidine was added. Following the addition of the radioisotope, three 0.2 mL samples were removed at 5-minute intervals and precipitated in 10% TCA with
100 µg of BSA. The samples were then vacuum collected and washed with 10%
TCA on Whatman GF/A glass fiber filters. The filters were placed into vials containing 3 mL Scintisafe gel. Radioactivity was measured by liquid scintillation counting.
33 RNA Synthesis Assays
Staphylococcus aureus was grown as described in the presence or absence of the antibiotic combinations. After 2 cellular doublings, 1 µCi/mL of 3H uridine was added. Following the addition of the radioisotope, three 0.2 mL samples were removed at 5-minute intervals and precipitated in 10% TCA with
100 µg of BSA. The samples were then vacuum collected and washed with 10%
TCA on Whatman GF/A glass fiber filters. The filters were placed into vials containing 3 mL Scintisafe gel. Radioactivity was measured by liquid scintillation counting.
Protein Synthesis Assays
Staphylococcus aureus was grown as described in the presence or absence of the antibiotic combinations. After 2 cellular doublings, 1 µCi/mL of 3H alanine was added. Following the addition of the radioisotope, three 0.2 mL samples were isolated at 5-minute intervals and precipitated in 10% TCA with
100 µg of BSA. The samples were then vacuum collected and washed with 10%
TCA on Whatman GF/A glass fiber filters. The filters were placed into vials containing 3 mL Scintisafe gel. Radioactivity was measured by liquid scintillation counting.
Uridine Pulse and Chase Labeling
Twelve mL cultures of Staphylococcus aureus were grown to a Klett of 20 and the previously mentioned antibiotic combinations were added. After one
34 cellular doubling, the cells were pulse labeled with 3H uridine (1 µCi/mL) for 90 seconds and then chased with uridine at a concentration of 25 µg/mL. At 5 time intervals, 2 mL samples were removed, collected by centrifugation (5,000 RPM,
15 minutes), and stored at -70°C before analysis by sucrose gradient centrifugation.
70S Ribosome Synthesis Assay
Staphylococcus aureus was grown as described in the presence or absence of the antibiotic combinations. After 15 minutes of growth with the antibiotics, 3H uridine (1 µCi/mL) and 2 µg/mL uridine were added. After 2 cellular doublings, 50 µg/mL uridine was added and the cells were grown for an additional 15 minutes. Cells were then collected by centrifugation (5,000 RPM,
15 minutes) and stored at -70°C before analysis by sucrose gradient centrifugation.
Preparation of cellular lysates
Cell lysates were prepared by a lysostaphin-freeze thaw method. SAS buffer (80 µL ) (10mM Tris-HCL pH 8.0, 0.2 mM Mg acetate, 50 mM NH4Cl, 0.2 mM mercaptoethanol), 25 µL lysostaphin (1 mg/mL), 25 µL lysozyme (1 mg/mL),
5 µL phenylmethylsulfonyl fluoride (PMSF), and 1 µL RNasin were added to each frozen sample and incubated at 37°C for 15 minutes. The lysates were then frozen at -70°C for 15 minutes and then thawed to room temperature. DNAse I
(2 µL ) and 3 µL Triton X-100 (TX-100) were then added and cell debris was
35 spun down at 6,000 RPM for 15 minutes. Lysates were centrifugated through 5-
20% sucrose gradients in SAS buffer in a SW41 rotor at 187813 x g for 4 hours for subunits. Following centrifugation, fractions were collected by pumping through an ISCO Model UA-5 absorbance monitor set at 254nm. There were 31 fractions collected into vials and mixed with 3 mL Scintisafe gel and radioactivity was measured by liquid scintillation counting.
Note: R buffer (S buffer + 10mM Mg acetate) was used for 70S lysis and centrifugation was at 3.5 hours.
Western Blot Analysis
Staphylococcus aureus was grown as above in the presence or absence of the previously mentioned antibiotic combinations. Following the lysis procedure described, 1 volume of TCA was added and samples were put on ice for 15 minutes. Samples were then spun at 14,000 RPM for 5 minutes. The supernatant was removed and 200 µL acetone was added. Samples were spun again, the supernatant was removed, and the protein was allowed to resuspend in sterile H2O. 1X NuPAGE LDS sample buffer was added to 60 µg of total protein for each sample and an SDS PAGE gel was run according to the manufacturer’s instructions for total protein (Invitrogen). Proteins were transferred to PVDF membranes (Santa Cruz, USA) and immunoblotting was performed with primary antibodies directed against RNAP β, DNA gyrase A and
B, and GAPDH (Abcam) followed by HRP-conjugated secondary antibodies
(Santa Cruz). The complexes were revealed using SuperSignal West Pico
36 Chemiluminescent Substrate (Thermo Scientific, Pierce). Quantification was performed with a Fugi phosphoimager.
Agilent Bioanalysis of Total Cellular RNA
Staphylococcus aureus was grown as described in the presence or absence of the antibiotic combinations. After 2 cellular doublings in the presence of the antibiotic combinations, the cells were collected by centrifugation and RNA was extracted from the cell pellet using a phenol/chloroform extraction procedure. After lysates were spun down as described, the lysates were then added to 250 µL TE buffer and 500 µL phenol, vortexed and spun down. The supernatant was then added to another 500 µL phenol and the steps were repeated. One 0.5 volume of chloroform IAA (24:1) was then added to the supernatant and spun down. The supernatant was then added to 2 volumes of absolute ethanol and was held at -70°C for 30 minutes. The RNA was then spun down and washed with 70% ethanol, dried, and 25 µL sterile H2O was added to the RNA. Concentration was measured by A260 reading from 1 µL. Total RNA was examined using an Agilent Bioanalyzer 2100 and the RNA 6000 chip. The sample preparation, loading procedure, and run were carried out according to the manufacturer’s instructions for total RNA analysis. For each sample, 0.5 to 1.0
µg of RNA was examined.
37 Northern Blot Hybridization
Staphylococcus aureus was grown as described in the presence or absence of the antibiotic combinations. After 2 cellular doublings in the presence of the antibiotic combinations, the cells were collected by centrifugation and total
RNA was extracted from the cell pellet using the phenol/chloroform extraction procedure described.
Biotinylated 16S and 23S specific probes were constructed by PCR. The
16S (241 bp) and 23S (101bp) DNA probes were amplified from plasmid pKK3535 DNA using the polymerase chain reaction with primers from Life
Technologies. The Staphylococcus aureus 23S primers used were (23MET-F)
GTAACGATTTGGGCACTGT and (23MET-R) AAGCTCCACGGGGTCT (nt nos.
2002-2013). The universal 16S primers used were (16U-F)
GGAGGAAGGTGGGGATGACG and (16U-R) ATGGTGTGACGGGCGGTGTG
(nt nos. 1173—1414). PCR products were purified by extraction with phenol and chloroform and precipitated with 2 volumes of ethanol. The DNA was resuspended in 30 µL of sterile water. The purified DNA probes were labeled with biotin using the Label-IT biotin labeling kit (Mirus).
Total RNA (20 µg) was denatured by heating at 55°C for 10 minutes and separated on a 5% TAE PAGE gel. RNA was transferred from the gel onto
Nytran nylon membranes using a Turbo Blot apparatus (S&S). The membranes were prehybridized in 15 mL of 1X prehybridization solution (5X SSC, 0.1 % sarkosyl, 0.02% SDS, 200 µg/mL BSA, H2O) at 42°C for 30 minutes. The membranes were hybridized over night at 42°C with 6 mL hybridization buffer, 1X
38 background quencher, and 2µL of the denatured 16S or 23S specific biotinylated probe.
After hybridization, the membranes were washed and the probe was detected by the North2South chemiluminescent hybridization kit (Pierce
Chemical co.) with streptavidin-conjugated horseradish peroxidase. Quantitative analysis of the rRNA fragmentation was determined by a Fugi phosphoimager.
Mutation Frequency Assays
Staphylococcus aureus (ATCC 29213) was grown at 37°C in tryptic soy broth (TSB). At a Klett reading of 20, azithromycin, rifampicin, or ciprofloxacin were added singly at increasing concentrations to measure the MIC for each.
Antibiotics at the MIC concentration were added to TSB agar plates and
Staphylococcus aureus was grown as described without antibiotics. At a Klett of
160 (4 cellular doublings with antibiotics) cells were centrifugated and concentrated 10 fold before plating 0.1 mL on antibiotic plates with antibiotics at
MIC. CFUs were counted after incubating at 37°C over night.
Statistical Analysis
A Student’s t-test has determined statistical differences in assays. An asterisk indicates a statistical significance with P < 0.05.
39 CHAPTER 3
RESULTS
IC50 Determination
After growing Staphylococcus aureus (ATCC 29213) with azithromycin, rifampicin, or ciprofloxacin at different concentrations, the IC50 for each antibiotic was determined. Fig 6a shows the IC50 for azithromycin (0.2 µg/mL), Fig 6b shows the IC50 for rifampicin (0.003 at µg/mL), and Fig 6c shows the IC50 for ciprofloxacin (1.0 µg/mL) (see Figures 6a-c).
Growth Rates at Multiple Azithromycin Concentrations 100
90
80
70
60
50
40
30
Percent of Control Growth Rate 20
10
0 0.0 0.2 0.4 0.6 0.8 1.0 Azithromycin (µg/mL)
Figure 6a. Growth rates of Staphylococcus aureus at different azithromycin concentrations. Dashed line shows an IC50 of 0.2 µg/mL. (N=3, bars=standard deviation)
40 Growth Rates at Multiple Rifampicin Concentrations 100
90
80
70
60
50
40
30
Percent of Control Growth Rate 20
10
0 0.000 0.002 0.004 0.006 0.008 0.010 Rifampicin (µg/mL)
Figure 6b. Growth rates of Staphylococcus aureus at different rifampicin concentrations. Dashed line shows an IC50 of 0.003 µg/mL. (N=3, bars=standard deviation)
41 Growth Rates at Multiple Ciprofloxacin Concentrations 100
90
80
70
60
50
40
30
Percent of Control Growth Rate 20
10
0 0.0 0.5 1.0 1.5 2.0 Ciprofloxacin (µg/mL)
Figure 6c. Growth rates of Staphylococcus aureus at different ciprofloxacin concentrations. Dashed line shows an IC50 of 1.0 µg/mL. (N=3, bars=standard deviation)
42 Effects of Antibiotic Combinations on Cellular Growth Rates
Cells were grown at the IC50 for each antibiotic for several hours to measure growth rates. Doubling times were measured for growth in the presence of single antibiotics or in combinations. Control cells had a doubling time of 32.5 minutes. Growth with single antibiotics showed a doubling time of approximately twice that of the control as expected (see Fig. 7a Table 2).
Staphylococcus aureus Single Antibiotic Growth Rates at 1000 IC50
100 Klett
10 Control Azithromycin (0.2 µg/mL) Rifampicin (0.003 µg/mL) Ciprofloxacin (1.0 µg/mL)
1 0 30 60 90 120 150 180 Time (minutes)
Figure 7a. Growth rates of cells grown in the presence of azithromycin, rifampicin, or ciprofloxacin at their IC50.
43 Growth in the presence of antibiotic combinations had doubling times from 51 minutes (Rif + Cip) to 140.9 minutes (Azi + Rif + Cip) (see Fig. 7b Table 2).
Staphylococcus aureus Antibiotic Combination Growth 1000 Rates at IC50
100 Klett
10 Control Azi/RIf Rif/Cip Azi/Cip Azi/Rif/Cip
1 0 30 60 90 120 150 180 Time (minutes)
Figure 7b. Growth rates of cells grown in the combinations of azithromycin + rifampicin, rifampicin + ciprofloxacin, azithromycin + ciprofloxacin or azithromycin
+ rifampicin + ciprofloxacin at each of the IC50 for each antibiotic.
Effects of Antibiotic Combinations on Cellular Viability
Measurements of the inhibitory effect of the antibiotics on cell viability revealed inhibition in all 3 single antibiotic conditions with no CFUs detected in ciprofloxacin treated cells. (Table 2) Combination treatments showed a sharp
44 decrease in cells grown in the presence of azithromycin and rifampicin (24%) when compared to those grown with azithromycin or rifampicin alone (92% and
66%). A further decrease was observed when ciprofloxacin was added along with azithromycin and rifampicin (7.5%). Ciprofloxacin in combination with only azithromycin, however, resulted in a slight increase when compared to cells grown with only ciprofloxacin (see Fig. 8 Table 2).
Effects of Antibiotics on Staphylococcus aureus Cell Viability
110 Control 100 Azithromycin 90 Rifampicin 80 Ciprofloxacin 70 Azi/Rif 60 Rif/Cip 50 Azi/Cip 40 Azi/Rif/Cip 30 Percent of Control (CFU) 20 10 0
Rif Con Azi Cip Azi/Rif Rif/Cip Azi/Cip Antibiotic Combinations Azi/Rif/Cip
Figure 8. Staphylococcus aureus cell viability in the presence of antibiotic combinations. (N=3 bars=standard deviation) Antibiotics were used at IC50 determined by cell growth. CFU were measured by dilution and plating on TSB pates after 2 cellular doublings in each case. 100% = 2.5 x 108 cells/mL
45 Table 2. The percent of control rate for viable cell counts and cellular doubling time at IC50 for single or multiple antibiotic growths.
6 Antibiotic Cell Growth (tD min) CFU (x10 /mL)
Control (No Drug) 32.5 253.7 ± 26.5
Azithromycin 67.1 233.7 ± 93.3 (48%) (92.1%) Rifampicin 70.9 167.0 ± 50.6 (46%) (65.8%) Ciprofloxacin 67.1 4.67± 2.9 * (48%) (1.8%) Azi + Rif 122.2 60.6 ± 46.3 * (27%) (23.9%) Rif + Cip 51.0 12.7 ± 1.5 * (64%) (5.0%) Azi + Cip 92.3 1.33 ± 1.5 * (35%) (0.5%) Azi + Rif + Cip 140.9 19.0 ± 3.0 * (23%) (7.5%) Percent of control in parentheses. (*) Statistically significant with a P value <
0.05.
Effects of Antibiotic Combinations on DNA Synthesis Rates
DNA synthesis rates showed a sharp decrease in cells grown with ciprofloxacin alone (6.5% of the control). Cells grown with azithromycin, rifampicin or a combination of both resulted in small changes in DNA synthesis rates when compared to the control. However, when in combination with ciprofloxacin for a triple antibiotic treatment, DNA synthesis rates increased when compared to cells grown in the presence of ciprofloxacin alone (6.1-54.5% of the control) (see Fig. 9a,b Table 3).
46 DNA Synthesis Rates in Staphylococcus aureus
3500 3250 3000 Control Azithromycin 2750 Rifampicin 2500 Ciprofloxacin 2250 2000 1750 1500
H-Thymidine (CPM) 1250 3 1000 750 500 250 0 0 5 10 15 Minutes
Figure 9a. Incorporation of 3H thymidine (1 µCi/mL) in Staphylococcus aureus cells after 2 cellular doublings in the presence of single antibiotics at the IC50.
Samples taken at 5, 10, and 15 minutes. (N=3, bars=standard deviation)
47 DNA Synthesis Rates in Staphylococcus aureus
3500 3250 3000 Control 2750 Azi/RIf Rif/Cip 2500 Azi/Cip 2250 Azi/Rif/Cip 2000 1750 1500
H-Thymidine (CPM) 1250 3 1000 750 500 250 0 0 5 10 15 Minutes
Figure 9b. Incorporation of 3H thymidine (1 µCi/mL) in Staphylococcus aureus cells after 2 cellular doublings in the presence of multiple antibiotics at the IC50.
Samples taken at 5, 10, and 15 minutes. (N=3, bars=standard deviation)
48 Effects of Antibiotic Combinations on RNA Synthesis Rates
RNA synthesis rates showed decreases in all 3 single antibiotic treated samples, with ciprofloxacin showing the largest decrease in synthesis rates (23% of control). The double antibiotic treated cells showed little change in the azithromycin and rifampicin treated cells and a slight increase in synthesis rates for cells grown in the presence of azithromycin and ciprofloxacin. The triple antibiotic treated cells showed the sharpest decrease for combination treated cells, but with a comparable rate to that of the cells grown with only ciprofloxacin
(28%) (see Fig. 10a,b Table 3).
49 RNA Synthesis Rates in Staphylococcus aureus
80000 Control Azithromycin 70000 Rifampicin Ciprofloxacin 60000
50000
40000 H-Uridine (CPM)
3 30000
20000
10000
0 0 5 10 15 Minutes
Figure 10a.Incorporation of 3H uridine (1 µCi/mL) in Staphylococcus aureus cells after 2 cellular doublings in the presence of single antibiotics at the IC50. Samples taken at 5, 10, and 15 minutes. (N=3, bars=standard deviation)
50 RNA Synthesis Rates in Staphylococcus aureus
80000 Control Azi/RIf 70000 Rif/Cip Azi/Cip 60000 Azi/Rif/Cip
50000
40000 H-Uridine (CPM)
3 30000
20000
10000
0 0 5 10 15 Minutes
Figure 10b. Incorporation of 3H uridine (1 µCi/mL) in Staphylococcus aureus cells after 2 cellular doublings in the presence of multiple antibiotics at the IC50.
Samples taken at 5, 10, and 15 minutes. (N=3, bars=standard deviation)
51 Effects of Antibiotic Combinations on Protein Synthesis Rates
Protein synthesis measurements showed decreases in rates for all 3 samples grown in the presence of a single antibiotic with the cells grown with azithromycin showing the sharpest decrease (41% of control). Rifampicin in combination with azithromycin resulted in a further decrease in synthesis with the triple antibiotic treated cells showing a comparable rate (20% of control).
Ciprofloxacin in combination with azithromycin resulted in a further reduction in synthesis (37%) when compared to cells grown in the presence of only ciprofloxacin, but was not as much of a decrease when compared to the azithromycin and rifampicin treated samples or the triple antibiotic samples (19%)
(see Fig. 11a,b Table 3).
52 Protein Synthesis Rates in Staphylococcus aureus
3500 3250 3000 Control Azithromycin 2750 Rifampicin 2500 Ciprofloxacin 2250 2000 1750 1500 H-Alanine (CPM) 3
1250 1000 750 500 250 0 0 5 10 15 Minutes
Figure 11a. Incorporation of 3H alanine (1 µCi/mL) in Staphylococcus aureus cells after 2 cellular doublings in the presence of single antibiotics at the IC50.
Samples taken at 5, 10, and 15 minutes. (N=3, bars=standard deviation)
53 Protein Synthesis Rates in Staphylococcus aureus
3500 3250 3000 Control 2750 Azi/RIf Rif/Cip 2500 Azi/Cip 2250 Azi/Rif/Cip 2000 1750 1500 H-Alanine (CPM) 3
1250 1000 750 500 250 0 0 5 10 15 Minutes
Figure 11b. Incorporation of 3H alanine (1 µCi/mL) in Staphylococcus aureus cells after 2 cellular doublings in the presence of multiple antibiotics at the IC50.
Samples taken at 5, 10, and 15 minutes. (N=3, bars=standard deviation)
54 Table 3. The percent of control rate for DNA synthesis, RNA synthesis, and
Protein synthesis.
Antibiotic DNA Synthesis RNA synthesis Protein synthesis
Control (No Drug) 211.6 ± 28.8 5275.0 ± 420.4 197.2 ± 21.7
Azithromycin 178.9 ± 30.6 4323.2 ± 873.7 81.5 ± 4.2 * (85%) (82%) (41.3%)
Rifampicin 194.6 ± 41.9 3322.7 ± 889.17 * 176.5 ± 57.2 (92%) (63%) (89.5%)
Ciprofloxacin 13.7 ± 5.8 * 1223.6 ± 135.6 * 100.2 ± 41.0 * (6.5%) (23.2%) (50.8%)
Azi + Rif 115.5 ± 21.7 * 3200.4 ± 784.1 * 39.0 ± 13.7 * (54.5%) (60.7%) (19.8%)
Rif + Cip 13.0 ± 3.9 * 131.2 ± 5.5 * 24.8 ± 1.9* (6.1%) (2.5%) (12.6%)
Azi + Cip 16.2 ± 2.6* 1967.9 ± 336.6* 72.9 ± 9.6* (7.7%) (37.3%) (37.0%)
Azi + Rif + Cip 39.6 ± 10.4 * 1493.6 ± 708.2* 38.2 ± 6.7* (18.7%) (28.3%) (19.4%)
Values are 3H-CPM/min from figures 9.1-11.2 (*) Statistically significant with a P
value < 0.05.
55 Effects of Antibiotic Combinations on Pulse and Chase Labeling
In order to determine the rates of ribosomal subunit synthesis in the presence or absence of antibiotics, pulse-chase labeling of ribosomal RNA was carried out.
Pulse-chase studies for control cells revealed a 2:1 ratio of 50S to 30S ribosomal subunit formation (28% and 16% of total gradient counts respectively).
Cells grown in the presence of azithromycin revealed a 10% and 15% decrease in 30S and 50S subunits, respectively. When grown in combination with rifampicin or ciprofloxacin, subunit synthesis rates for the 30S subunit both decreased by 13-17% when compared to the cells grown in the presence of azithromycin alone.
The 50S subunit synthesis rate for cells grown in the presence of azithromycin and ciprofloxacin resulted in a decrease from the rates for azithromycin alone (56% of control). The largest decreased was observed in cells treated with azithromycin along with rifampicin or ciprofloxacin, where a 20-
30% decrease for 50S subunit synthesis was observed when compared to cells grown in the presence of azithromycin alone (see Fig.12a-l Table 4).
56 Sucrose Gradient Profiles for Control
110000 100000 Control 10 Minutes Control 60 Minutes 90000 50S 80000 70000
60000 30S 50000
H-Uridine (CPM) 40000 3 30000 20000 10000 0 0 5 10 15 20 25 30 Fraction Number
Figure 12a. Sucrose gradient profiles showing distribution of 3H-uridine in lysates from control cells, collected after 10 minutes and 60 minutes of labeling.
57 Sucrose Gradient Profiles for Azithromycin
110000 100000 Azithromycin 10 Minutes Azithromycin 60 Minutes 90000 80000
70000 50S 60000 50000
H-Uridine (CPM) 40000 30S 3 30000 20000 10000 0 0 5 10 15 20 25 30 Fraction Number
Figure 12b. Sucrose gradient profiles showing distribution of 3H-uridine in lysates from azithromycin treated cells, collected after 10 minutes and 60 minutes of labeling.
58 Sucrose Gradient Profiles for Rifampicin
110000
100000 Rifampicin 10 Minutes Rifampicin 60 Minutes 90000 80000 70000 60000 50000
H-Uridine (CPM) 40000 3 30000 50S 20000 30S 10000 0 0 5 10 15 20 25 30 Fraction Number
Figure 12c. Sucrose gradient profiles showing distribution of 3H-uridine in lysates from rifampicin treated cells, collected after 10 minutes and 60 minutes of labeling.
59 Sucrose Gradient Profiles for Ciprofloxacin
110000
100000 Ciprofloxacin 10 Minutes 90000 Ciprofloxacin 60 Minutes 80000 70000 60000 50000 50S
H-Uridine (CPM) 40000 3 30000 30S 20000 10000 0 0 5 10 15 20 25 30 Fraction Number
Figure 12d. Sucrose gradient profiles showing distribution of 3H-uridine in lysates from ciprofloxacin treated cells, collected after 10 minutes and 60 minutes of labeling.
60 Sucrose Gradient Profiles for Azithromycin + Rifampicin
110000
100000 Azi/Rif 10 Minutes Azi/Rif 60 Minutes 90000 80000 70000
60000 50S 50000
H-Uridine (CPM) 40000 3 30000 30S 20000 10000 0 0 5 10 15 20 25 30
Fraction Number
Figure 12e. Sucrose gradient profiles showing distribution of 3H-uridine in lysates from azithromycin + rifampicin treated cells, collected after 10 minutes and 60 minutes of labeling.
61 Sucrose Gradient Profiles for Rifapmpicin + Ciprofloxacin
110000 100000 Rif/Cip 10 Minutes 90000 Rif/Cip 60 Minutes 80000 70000 60000 50000 50S
H-Uridine (CPM) 40000 3 30000 30S 20000 10000 0 0 5 10 15 20 25 30 Fraction Number
Figure 12f. Sucrose gradient profiles showing distribution of 3H-uridine in lysates from rifampicin + ciprofloxacin treated cells, collected after 10 minutes and 60 minutes of labeling.
62 Sucrose Gradient Profiles for Azithromycin + Ciprofloxacin
110000 100000 Azi/Cip 10 Minutes Azi/Cip 60 Minutes 90000 80000 70000 60000 50000 50S 40000 H-Uridine (CPM)
3 30S 30000 20000 10000 0 0 5 10 15 20 25 30 Fraction Number
Figure 12g. Sucrose gradient profiles showing distribution of 3H-uridine in lysates from azithromycin + ciprofloxacin treated cells, collected after 10 minutes and 60 minutes of labeling.
63 Sucrose Gradient Profiles for Azithromycin + Rifampicin + Ciprofloxacin
110000
100000 Azi/Rif/Cip 10 Minutes Azi/Rif/Cip 60 Minutes 90000 80000 70000 60000 50000 40000 50S H-Uridine (CPM) 3 30000 30S 20000 10000 0 0 5 10 15 20 25 30
Fraction Number
Figure 12h. Sucrose gradient profiles showing distribution of 3H-uridine in lysates from azithromycin + rifampicin + ciprofloxacin treated cells, collected after 10 minutes and 60 minutes of labeling.
64 30S Subunit Synthesis Rates +/- Antibiotics in Staphylococcus aureus 30
30S %T Control 25 30S %T Azithromycin 30S %T Rifampicin 30S %T Ciprofloxacin H CPM 3 20
15
10
Percent Total Gradient 5
0 0 10 20 30 40 50 60 Minutes
Figure 12i. Pulse/chase analysis of 30S subunit synthesis. Rates are shown as a percent of the total gradient 3H CPM for samples treated with single antibiotics.
3H radioactivity was summed for the 30S peak region (fractions 11-15).
65 30S Subunit Synthesis Rates +/- Antibiotics in 30 Staphylococcus aureus
30S %T Con 25 30S %T Azi/Rif 30S %T Rif/Cip 30S %T Azi/Cip H CPM
3 30S %T Azi/Rif/Cip 20
15
10
Percent Total Gradient 5
0 0 10 20 30 40 50 60 Minutes
Figure 12j. Pulse/chase analysis of 30S subunit synthesis. Rates are shown as a percent of the total gradient 3H CPM for samples treated in antibiotic combinations. 3H radioactivity was summed for the 30S peak region (fractions 11-
15).
66 50S Subunit Synthesis Rates +/- Antibiotics in Staphylococcus aureus 30
25 H CPM 3 20
15
10
50S %T Control Percent Total Gradient 5 50S %T Azithromycin 50S %T Rifampicin 50S %T Ciprofloxacin 0 0 10 20 30 40 50 60 Minutes
Figure 12k. Pulse/chase analysis of 50S subunit synthesis. Rates are shown as a percent of the total gradient 3H CPM for samples treated with single antibiotics.
3H radioactivity was summed for the 50S peak region (fractions 19-24).
67 50S Subunit Synthesis Rates +/- Antibiotics in Staphylococcus aureus 30
25 H CPM 3 20
15
10
50S %T Con
Percent Total Gradient 50S %T Azi/Rif 5 50S %T Rif/Cip 50S %T Azi/Cip 50S %T Azi/Rif/Cip 0 0 10 20 30 40 50 60 Minutes
Figure 12l. Pulse/chase analysis of 50S subunit synthesis. Rates are shown as a percent of the total gradient 3H CPM for samples treated in antibiotic combinations. 3H radioactivity was summed for the 50S peak region (fractions
19-24).
68 Table 4. Pulse/chase rates are based on the percent of the control amounts of
ribosomal subunits at 60 minutes in the presence of different antibiotic
combinations.
Antibiotic 30S Subunit 50S Subunit
Control (No Drug) 16.5 ± 0.8 28.4 ± 1.8
Azithromycin 14.9 ± 0.8 24.3 ± 1.3
(90.3%) (85.6%)
Rifampicin 7.6 ± 0.2 * 12.5 ± 1.1 *
(46.1%) (44.0%)
Ciprofloxacin 9.4 ± 0.3 * 20.5 ± 0.6 *
(57.0%) (72.2%)
Azi + Rif 12.7 ± 3.2 18.7 ± 1.8 *
(77.0%) (65.8%)
Rif + Cip 11.1 ± 1.2 * 22.3 ± 3.2
(67.3%) (78.5%)
Azi + Cip 11.9 ± 7.1 15.9 ± 6.6
(72.1%) (56.0%)
Azi + Rif + Cip 14.5 ± 2.2 22.9 ± 1.8
(87.9%) (80.6%)
(*) Statistically significant with a P value < 0.05.
69 Effects of Antibiotic Combinations on 70S Ribosome Synthesis
In order to determine the effects of antibiotics on target amounts, 70S ribosome synthesis, RNA polymerase, and DNA gyrase levels were measured under each antibiotic combination through 2 assays.
In order to determine the effects of the antibiotics on 70S ribosome synthesis, 70S formation was measured using 3H-uridine to measure the amounts of ribosomes. The 70S ribosome, the 30S and 50S subunits and any
RNA in the top gradient regions for each sample were quantified by summing 3H
CPM after sucrose gradient centrifugation.
Control cells were found to have 70S ribosomes + polysomes as 32.1% of the total gradient CPM. Samples that resulted in significant differences when compared to these control cells were cells grown with rifampicin (0.85% of total
CPM), cells grown with azithromycin + rifampicin or ciprofloxacin (0.55% and
0.45% respectively) cells grown with all 3 antibiotics (1.05% of the total gradient
CPM) (see Fig 13a-h Table 5).
Along with measuring 70S ribosome synthesis, the total gradient CPM of ribosomal subunits and the top gradient regions for each sample were determined. The same samples showing significant differences in 70S ribosome synthesis also showed significant differences in the amounts of both subunits
70 when compared to the control (13.1% total CPM for control, 1.7-6% for significantly different samples). The top gradient regions for these same samples showed significant increases in the amount of degraded RNA at the top of each gradient. (49.9% total gradient CPM for control, 92-98% for significantly different samples) (see Fig 13a-h Table 5).
71 70S Sucrose Gradient Profiles for Azithromycin
110000 100000 Control Azithromycin 90000 80000 70000 60000 70S 50000
H-Uridine (CPM) 40000 3 30000 50S 30S 20000 10000 0 0 5 10 15 20 25 30 Fraction Number
Figure 13a. 70S sucrose gradient profiles for 3H-uridine in lysates from control and azithromycin treated cells. Control 70S ribosome with polysomes, subunits, and 3H RNA in the top gradient region is shown.
72 70S Sucrose Gradient Profiles for Rifampicin
110000 100000 Control Rifampicin 90000 80000 70000 60000 50000 70S
H-Uridine (CPM) 40000 3 30000 50S 20000 30S 10000 0 0 5 10 15 20 25 30 Fraction Number
Figure 13b. 70S sucrose gradient profiles for 3H-uridine in lysates from control and rifampicin treated cells. Control 70S ribosome with polysomes, subunits, and
3H RNA in the top gradient region is shown.
73 70S Sucrose Gradient Profiles for Ciprofloxacin
110000
100000 Control Ciprofloxacin 90000 80000 70000 60000 70S 50000
H-Uridine (CPM) 40000 50S 3 30000 20000 30S 10000 0 0 5 10 15 20 25 30 Fraction Number
Figure 13c. 70S sucrose gradient profiles for 3H-uridine in lysates from control and ciprofloxacin treated cells. Control 70S ribosome with polysomes, subunits, and 3H RNA in the top gradient region is shown.
74 70S Sucrose Gradient Profiles for Aithromycin + Rifampicin
110000 100000 Control Azi/Rif 90000 80000 70000 60000 70S 50000
H-Uridine (CPM) 40000 3 30000 30S 50S 20000 10000 0 0 5 10 15 20 25 30 Fraction Number
Figure 13d. 70S sucrose gradient profiles for 3H-uridine in lysates from control and azithromycin + rifampicin treated cells. Control 70S ribosome with polysomes, subunits, and 3H RNA in the top gradient region is shown.
75 70S Sucrose Gradient Profiles for Rifampicin + Ciprofloxacin
110000
100000 Control Rif/Cip 90000 80000 70000 60000 70S 50000
H-Uridine (CPM) 40000 3 30000 30S 50S 20000 10000 0 0 5 10 15 20 25 30
Fraction Number
Figure 13e. 70S sucrose gradient profiles for 3H-uridine in lysates from control and rifampicin + ciprofloxacin treated cells. Control 70S ribosome with polysomes, subunits, and 3H RNA in the top gradient region is shown.
76 70S Sucrose Gradient Profiles for Azithromycin + Ciprofloxacin
110000
100000 Control 90000 Azi/Cip 80000 70000 60000 70S 50000 30S 50S
H-Uridine (CPM) 40000 3 30000 20000 10000 0 0 5 10 15 20 25 30 Fraction Number
Figure 13f. 70S sucrose gradient profiles for 3H-uridine in lysates from control and azithromycin + ciprofloxacin treated cells. Control 70S ribosome with polysomes, subunits, and 3H RNA in the top gradient region is shown.
77 70S Sucrose Gradient Profiles for Azithromycin + Rifampicin + Ciprofloxacin 110000
100000 Control Azi/Rif/Cip 90000 80000 70000 60000 70S 50000 40000 H-Uridine (CPM) 3 30000 30S 50S 20000 10000 0 0 5 10 15 20 25 30 Fraction Number
Figure 13g. 70S Sucrose gradient profiles for 3H-uridine in lysates from control and azithromycin + rifampicin + ciprofloxacin treated cells. Control 70S ribosome with polysomes, subunits, and 3H RNA in the top gradient region is shown.
78 70S Ribosome Synthesis in Staphylococcus aureus
100 90 80 H CPM 3 70 60 50 40 30 20
Percent Total Gradient 10 0 1 2 3 1 2 3 1 2 3 1 2 3 1 2 3 1 2 3 1 2 3 1 2 3 Antibiotic Combinations Control Azi/Rif 1. Top Fractions Azithromycin Rif/Cip 2. Subunits Rifampicin Azi/Cip 3. 70S Ribosome Ciprofloxacin Azi/Rif/Cip
Figure 13h. Analysis of 70S subunit synthesis for all samples as a percent of the total gradient 3H CPM in the presence of different antibiotic combinations.
Percentage of total gradient 3H in top fractions (1-10), 30S and 50S (11-20) subunits, and 70S subunits + polysomes (21-31) is shown.
79 Table 5. 70S ribosome synthesis for all samples represented as a percent of
total gradient CPM for the top fractions, the subunits and the 70S ribosome.
Antibiotic 70S Ribosome Subunits Top Fractions
Control (No Drug) 32.1 ± 4.6 13.1 ± 1.5 49.9 ± 7.0
Azithromycin 22.6 ± 4.9 19.4 ± 0.8 51.8 ± 6.9
Rifampicin 0.850 ± 0.1 * 6.00 ± 0.1 * 92.7 ± 0.7 *
Ciprofloxacin 24.3 ± 4.7 14.9 ± 2.0 51.0 ± 5.7
Azi + Rif 0.550 ± 0.1 * 2.60 ± 0.4 * 96.7 ± 0.3 *
Rif + Cip 0.450 ± 0.1 * 3.90 ± 0.2 * 95.4 ± 0.2 *
Azi + Cip 20.1 ± 2.3 20.1 ± 2.0 56.2 ± 0
Azi + Rif + Cip 1.05 ± 1.0 * 1.70 ± 0.4 * 98.2 ± 0.5 *
(n=3, bars=standard deviation) (*) Statistically significant with a P value < 0.05.
Effects of Antibiotic Combinations on Western Blot Analysis
To measure the amounts of total target protein in Staphylococcus aureus
grown in each of the antibiotic conditions described, Western blot analysis was
carried out. Antibodies specific to each of the cellular targets for each antibiotic
were used (see Fig. 14a). Samples probed for GAPDH as a control showed no
significant differences among any samples from cells grown in the presence or
absence of antibiotics (see Fig. 14a,e Table 6). Samples probed for RNAP β
showed no significant differences in cells in the presence or absence of drug
(see Fig 14a,b Table 6). Samples probed for DNA gyrase A showed statistically
80 significant differences in samples treated with azithromycin + rifampicin, and in the presence of all 3 antibiotics. A large increase was observed in samples treated with ciprofloxacin alone (see Fig. 14a,c Table 6). Samples probed for
DNA gyrase B showed statistically significant differences in samples grown in the presence of ciprofloxacin alone (see Fig 14a,d Table 6).
Western Blot Analysis
AZI RIF AR RC AC CON CIP ARC
RNAP β
GYR A
GYR B
GAPDH
Figure 14a. Western blot analysis for total cellular protein from Staphylococcus aureus under different antibiotic condition and probed for RNAP β, DNA gyrase
A, DNA gyrase B, and GAPDH.
81
Western Blot Data 25000
RNAP BETA 20000
15000 Signal 10000
5000
0
AZI/RIF RIF/CIP AZI/CIP CONTROL RIFAMPICIN AZI/RIF/CIP AZITHROMYCIN CIPROFLOXACINSamples
Figure 14b. Western blot analysis for total RNAP β protein from Staphylococcus aureus under different antibiotic condition shown as a percentage of the control.
(n=2, bars=standard deviation)
82 Western Blot Data 1000
DNA GYRASE A
750
500 Signal
250
0
AZI/RIF RIF/CIP AZI/CIP CONTROL RIFAMPICIN AZI/RIF/CIP AZITHROMYCIN Samples CIPROFLOXACIN
Figure 14c. Western blot analysis for DNA gyrase A protein from
Staphylococcus aureus under different antibiotic condition shown as a percentage of the control. (n=2, bars=standard deviation)
83 Western Blot Data 1000
DNA GYRASE B 800
600 Signal 400
200
0
AZI/RIF RIF/CIP AZI/CIP CONTROL RIFAMPICIN AZI/RIF/CIP AZITHROMYCIN Samples CIPROFLOXACIN
Figure 14d. Western blot analysis for DNA gyrase B protein from
Staphylococcus aureus under different antibiotic condition shown as a percentage of the control. (n=2, bars=standard deviation)
84 Western Blot Data 70000 GAPDH 60000
50000
40000
Signal 30000
20000
10000
0
AZI/RIF RIF/CIP AZI/CIP CONTROL RIFAMPICIN AZI/RIF/CIP AZITHROMYCIN Samples CIPROFLOXACIN
Figure 14e. Western blot analysis for GAPDH protein from Staphylococcus aureus under different antibiotic condition shown as a percentage of the control.
(n=2, bars=standard deviation)
85 Table 6. Western blot analysis for total cellular protein from Staphylococcus
aureus under different antibiotic condition and probed for RNAP β, DNA gyrase
A, DNA gyrase B, and GAPDH and normalized as a percentage of the control.
Antibiotic GAPDH RNAP β DNA Gyrase A DNA Gyrase B
Control (No Drug) 51390 ± 1240 15112 ± 3588 528 ± 36 224 ± 22
Azithromycin 53143 ± 2860 14728 ± 4903 448 ± 18 92 ± 20
(103%) (97%) (85%) (41%) Rifampicin 50229 ± 7751 21557 ± 4609 757 ± 108 202 ± 43
(98%) (142%) (143%) (90%) Ciprofloxacin 50130 ± 7383 18797 ± 6360 835 ± 100 857 ± 7 *
(98%) (124%) (158%) (383%) Azi + Rif 54852 ± 5751 17774 ± 1630 19 ± 9 * 72 ± 6
(107%) (118%) (3.6%) (32%) Rif + Cip 53639 ± 5745 17732 ± 1990 238 ± 55 214 ± 5
(104%) (117%) (45%) (96%) Azi + Cip 55075 ± 4761 15587 ± 839 497 ± 66 17 ± 8
(107%) (103%) (94%) (8%) Azi + Rif + Cip 54659 ± 5255 12044 ± 2178 146 ± 39 * 66 ± 34
(106%) (80%) (28%) (29%) Values are mean areas of scans of two blots. (*) Statistically significant with a P
value < 0.05.
86 Effects of Antibiotic Combinations on Agilent Bioanalysis of Total Cellular RNA
To determine and analyze the amounts of ribosomal RNA in cells grown under the different antibiotic combinations, Agilent chip electrophoresis was performed. The amounts of small degraded RNA, 16S RNA, and 23S RNA were quantitated.
The largest amounts of degradation were found in samples grown with azithromycin (159% compared to control), rifampicin (160%), and azithromycin + rifampicin (189%) as indicated by the amount of small RNA fragments in each of those samples (see Fig.15a,b Table 7).
In these samples a decrease in the amounts of 16S RNA was observed.
The same samples also showed the largest decrease in the amount of 23S RNA when compared to the control and were found to be statistically significant (see
Fig.15a,b Table 7).
87 Agilent Bioanalysis of Total Cellular RNA
AZI RIF AR RC AC CON CIP ARC F
23S RNA
16S RNA
Small RNA
Figure 15a. Agilent chip analysis of Staphylococcus aureus RNA grown in the presence of different antibiotic combinations at IC50. Increases in small rRNA were observed in antibiotic treated samples.
88 Agilent Gel Electrophoresis Analysis 50
40
30
20 Percent Total Area 10
0 1 2 3 1 2 3 1 2 3 1 2 3 1 2 3 1 2 3 1 2 3 1 2 3 Antibiotic Combinations Control Azi/Rif 1. Small RNA Azithromycin Rif/Cip 2. 16S RNA Rifampicin Azi/Cip 3. 23S RNA Ciprofloxacin Azi/Rif/Cip
Figure 15b. Agilent chip analysis of Staphylococcus aureus RNA grown in the presence of different antibiotic combinations at IC50 shown as a percentage of total area for small RNA, 16S RNA and 23S RNA.
89 Table 7. Agilent chip data.
Antibiotic Small RNA 16S RNA 23S RNA
Control (No Drug) 24.7 ± 3 19.8 ± 0.2 40.2 ± 1.3
Azithromycin 39.3 ± 0.1 * 23.8 ± 1.3 32.9 ± 0.7 *
(159%) (120%) (82%)
Rifampicin 39.6 ± 0.5 * 23.8 ± 0.1 * 32.3 ± 0.8 *
(160%) (120%) (80%)
Ciprofloxacin 38.2 ± 1.6 18.9 ± 0.2 39.5 ± 1.6
(155%) (95%) (98%)
Azi + Rif 46.7 ± 0.6 * 21.5 ± 0.2 * 26.2 ± 0.8 *
(189%) (109%) (65%)
Rif + Cip 31.4 ± 0.8 28.6 ± 0.2 * 40.1 ± 0.6
(127%) (144%) (100%)
Azi + Cip 38.4 ± 2.7 27.6 ± 1.5 * 34.0 ± 1.2
(155%) (139%) (85%)
Azi + Rif + Cip 36.9 ± 0.7 26.6 ± 0.1 * 36.6 ± 0.7
(149%) (134%) (91%)
Percentage of small RNA, 16S, and 23S RNA regions as a percent of the total
area. Values are areas of peaks from Agilent software. (*) Statistically
significant with a P value < 0.05.
90 Effects of Antibiotic Combinations on Northern Blot Hybridization
In order to observe the specific amounts of ribosomal RNA degradation in cells grown under the different antibiotic conditions, Northern blot hybridization was performed. Using 16S and 23S DNA probes to detect the RNA, 2 different blots were carried out. One with the total amount of RNA for each sample and one with the 16S and 23S bands removed in order for maximum detection of small RNA fragments.
In the 16S blots large amounts of degradation were observed in the azithromycin (125% of control), azithromycin + rifampicin (130%), rifampicin + ciprofloxacin (122%), azithromycin + ciprofloxacin (145%), and azithromycin + rifampicin + ciprofloxacin (133%) treated cells when total RNA was probed, and for the azithromycin + rifampicin treated samples (207%) once the 16S band was removed and the RNA was probed again (see Fig 16a,b Table 8).
In the 23S blots large amounts of degradation were observed in the azithromycin (258% of control), ciprofloxacin (339%), azithromycin + rifampicin
(300%), and rifampicin + ciprofloxacin (209%) treated cells once the 23S band was removed (see Fig 16c,d Table 8).
91 Northern Blot Hybridization for 16S RNA
AZI RIF AR RC AC CON CIP ARC
1500 nt
750
500
400
600 nt 500
400
300
200
Figure 16a. Northern blot hybridization of RNA from Staphylococcus aureus grown in the presence of different antibiotic combinations at IC50 and probed for
16S RNA. Small rRNA fragments with 16S RNA removed are shown below for each. RNA fragment increases were seen in antibiotic treated samples.
92 16S RNA Northern Blot Data 175 16S Degradation 150 16S Total RNA
125
100
75 Total Area Signal Area Total 50
25
0
AZI/RIF RIF/CIP AZI/CIP AZI/RIF RIF/CIP AZI/CIP CONTROL CONTROL RIFAMPICIN AZI/RIF/CIP RIFAMPICIN AZI/RIF/CIP AZITHROMYCIN AZITHROMYCIN CIPROFLOXACIN CIPROFLOXACIN Samples
Figure 16b. Northern blot hybridization analysis of RNA from Staphylococcus aureus grown in the presence of different antibiotic combinations at IC50 and probed for 16S RNA shown as a percentage of the control for total area signal.
16S Degradation = area with 16S RNA removed.
93 Northern Blot Hybridization for 23S RNA
AZI RIF AR RC AC CON CIP ARC
2500 nt
1000 750
500
600 nt 500
400
300
250
200
Figure 16c. Northern blot hybridization of RNA from Staphylococcus aureus grown in the presence of different antibiotic combinations at IC50 and probed for
23S RNA. Small rRNA fragments with 23S RNA removed are shown below for each. RNA fragment increases were seen in antibiotic treated samples.
94 23S RNA Northern Blot Data 175 23S Degradation 23S Total RNA 150
125
100
75 Total Area Signal Area Total 50
25
0
AZI/RIF RIF/CIP AZI/CIP AZI/RIF RIF/CIP AZI/CIP CONTROL CONTROL RIFAMPICIN AZI/RIF/CIP RIFAMPICIN AZI/RIF/CIP AZITHROMYCIN AZITHROMYCIN CIPROFLOXACIN CIPROFLOXACIN Samples
Figure 16d. Northern blot hybridization analysis of RNA from Staphylococcus aureus grown in the presence of different antibiotic combinations at IC50 and probed for 23S RNA shown as a percentage of the control for total area signal.
23S Degradation = area with 23S RNA removed.
95 Table 8. Northern blot hybridization analysis taken as a percentage of the control
total area signal for RNA from Staphylococcus aureus grown in the presence of
different antibiotic combinations at IC50 and probed for 16S and 23S RNA.
Antibiotic 16S Small RNA 16S Total RNA 23S Small RNA 23S Total RNA
Control (No Drug) 49.8 ± 23.6 100.8 ± 10.7 24.6 ± 4.7 57.5 ± 29.9
Azithromycin 93.2 ± 21.8 126.1 ± 8.3 * 63.5 ± 8.0 * 90.2 ± 31.5
(187%) (125%) (258%) (157%)
Rifampicin 63.1 ± 20.9 97.9 ± 13.9 37.7 ± 4.9 95.7 ± 25.0
(127%) (97.1%) (153%) (166%)
Ciprofloxacin 105.3 ± 26.4 119.5 ± 12.8 83.4 ± 11.3 * 108.2 ± 30.0
(211%) (119%) (339%) (188%)
Azi + Rif 103.1 ± 20.9 * 130.6 ± 5.6 * 73.9 ± 8.0 * 102.3 ± 21.9
(207%) (130%) (300%) (178%)
Rif + Cip 73 ± 24.6 123.0 ± 4.3 * 51.5 ± 6.0 * 86.3 ± 25.4
(147%) (122%) (209%) (150%)
Azi + Cip 78.8 ± 30.3 146.0 ± 8.3 * 40.9 ± 3.9 87.3 ± 19.6
(158%) (145%) (166%) (152%)
Azi + Rif + Cip 66.2 ± 29.1 134.0 ± 12.8 * 34.8± 3.5 86.0 ± 15.1
(133%) (133%) (141%) (150%)
(*) Statistically significant with a P value < 0.05.
96 Effects of Antibiotic Combinations on Mutation Frequency Assays
Mutation frequency measurements were carried out to determine the
levels of resistance occurring in cells grown in the presence of different antibiotic
combinations. Cells grown on plates containing 2 or 3 antibiotics showed
decreases in the frequency of resistant cells. When compared to cells grown in
the presence of rifampicin or ciprofloxacin alone, cells grown under antibiotic
combinations showed a significant decrease in resistant colonies. No triply
resistant mutants were found.
Table 9. Mutation frequencies for different antibiotic combinations. Percent of
single antibiotic control shown in parentheses.
Antibiotic Azithromycin Rifampicin Ciprofloxacin Azi + Rif + Cip
Azithromycin 1.8 x 10-8 1.8 x 10-9 3.7 x 10-10 < 10-10
100% 10% 2%
Rifampicin 1.8 x 10-9 6.3 x 10-8 1.9 x 10-9 < 10-10
3%* 100% 3%*
Ciprofloxacin 3.7 x 10-10 1.9 x 10-9 7.6 x 10-8 < 10-10
0.5%* 2.5%* 100%
N=3 (*) Statistically significant with a P value < 0.05.
97 CHAPTER 4
DISCUSSION
Current research from the lab of Champney has shown that 2 important targets for antibiotics are the inhibition of bacterial ribosomal subunit assembly and translation (11). Azithromycin is an azalide derivative of erythromycin that inhibits translation by targeting the bacterial ribosome. Two other antibiotics also have inhibitory effects on staphylococcal infections. Ciprofloxacin, a fluoroquinolone, functions to inhibit DNA gyrase, inhibiting replication and rifampicin, a rifamycin, has an inhibitory effect on RNA polymerase, inhibiting transcription (see Table 1). Figure 5 shows my proposed model of the different targets for these three antibiotics.
The use of these different antibiotics known for their inhibitory effects on
Staphylococcus aureus in combinations with azithromycin, known for its inhibitory effects on the bacterial ribosome, can create synergistic effects and improve the inhibition of protein synthesis via increased inhibition of subunit assembly leading to reduced levels of RNA polymerase and DNA gyrase as well.
98 IC50 Determination, Cellular Growth Rates and Cellular Viability
After IC50 values were determined for each antibiotic used, cells were grown in the described antibiotic combinations. Growth rates for cells grown in the presence of a single antibiotic verified the concentrations used with doubling times roughly double that of the control and was consistent with previous data
(59-61). When grown in combination with 1 or 2 other antibiotics, slower growth resulted in doubling times increasing from 65 to 75% of the control. Cells were then plated to determine viability and significant decreases were most prevalent in cells grown in the presence of multiple antibiotics. In some cases viable cells were reduced to less than 10% of the control cells observed. Compared to the doubly treated cells, treatment with all 3 antibiotics only resulted in a further reduction when compared to cells grown with azithromycin and rifampicin. Cells treated with ciprofloxacin singly or doubly resulted in the fewest viable cells (see
Fig 6a-c, 7a,b, 8, Table 2).
DNA, RNA, and Protein Synthesis Rates
DNA, RNA, and protein synthesis rates were determined and showed significant decreases in synthesis rates, most noticeably in all assays for cells grown in the presence of multiple antibiotics.
99 A significant decrease in DNA synthesis rate was also observed in cells grown in the presence of ciprofloxacin alone, and given its inhibition of replication, this was expected. There were also significant decreases in RNA synthesis and protein synthesis for the same combinations, indicating a strong inhibition of most cellular activity due to the effects of ciprofloxacin alone (see
Fig. 9a,b Table 3).
For RNA synthesis, growth in the presence of rifampicin alone was the most effective single antibiotic treated condition to have a significant inhibitory effect. Growth in the presence of ciprofloxacin alone was the other single antibiotic condition resulting in a significant decrease in protein synthesis, due to low amounts of DNA replication, resulting in low amounts of transcription (see
Fig. 10a,b Table 3).
Synergistic effects from the antibiotics in combination are evident by the strong decreases in the synthesis rates of RNA, DNA, and protein in cells grown in the presence of multiple antibiotics. In most assays the triply treated cells showed large reductions in rates. However, ciprofloxacin showed to have some antagonistic effects with used in combination with azithromycin. In some cases rates were down to less than 5% of the control and for protein synthesis rates, cells grown with azithromycin and rifampicin or grown with all 3 antibiotics showed a greater than 50% reduction when compared to cells grown in the presence of azithromycin alone. Results validate the idea presented in the
100 model (Fig. 5) of synergistic effects of combination antibiotic treatment (see Fig.
11a,b Table 3).
Pulse and Chase Labeling
Azithromycin contributed to a reduction of ribosomal subunits similar to previous work (11, 62).The rates of ribosomal subunit formation were determined and a significant reduction in the 50S subunit levels was observed in cells grown in the presence of azithromycin and rifampicin in combination. Although other antibiotic combinations showed significant differences, this sample was of most importance as it shows an additive effect due to the inhibition of subunit synthesis and assembly with cells grown in the presence of not only an antibiotic already known for it’s inhibitory effects on the 50S subunit, but in this case rifampicin as well. This is due to the inhibition of rRNA transcription in combination with translation inhibition (see Fig. 12a-l Table 4).
70S Ribosome Synthesis and Western Blot Analysis
The 70S ribosome synthesis measurements showed large increases in small RNA species in lysates from cells grown in the presence of multiple antibiotics, indicating significant degradation of rRNA. This was supported by the significant decreases in the amounts of 70S ribosomes in the samples treated with one or more antibiotics. Cells treated with single antibiotics all resulted in an
101 increase in 30S and 50S ribosomal subunits and an increase in degradation, with a reduction of 70S ribosomes. Cells grown in the presence of azithromycin in combination with one or two other antibiotics showed a further increase the amount of degradation and resulted in very little 70S ribosome or subunits, showing an additive effect for an antibiotic that already has a strong effect on the ribosome (see Fig. 13a-h, Table 5).
Looking at the 2 other targets, RNAP and DNA gyrase by Western immunoblotting, there were significant decreases in protein amounts when DNA gyrase amounts were measured in 2 cases (Azi+Rif and Azi+Rif+Cip for DNA gyrase A). There were, however, large increases in the amounts of DNA gyrase
A when grown in the presence of ciprofloxacin alone. Results were similar in
DNA gyrase B but not as significant with an exception for cells grown with ciprofloxacin alone. In this sample there was a significant increase in DNA gyrase B detected. As previous research suggests, because of the relatively low concentrations of antibiotics, an upregulation of transcription may have occurred given that ciprofloxacin treatments should target DNA gyrase, resulting in a reduction, not a large increase in protein produced (63). This was also the case when amounts of RNAP were measured. Samples grown in the presence of rifampicin or ciprofloxacin showed an increase in amounts of RNAP. Although this increase occurred, along with slight decreases in RNAP in samples grown in the presence of 2 or more antibiotics, results were not found to be significantly different from that of the control (see Fig. 14a-e Table 6).
102 Agilent Bioanalysis of Total Cellular RNA and Northern Blot Hybridization
Agilent analysis of rRNA supported previous results when measuring subunit synthesis. Samples from cells grown in the presence of single antibiotics showed increases in degradation, with small rRNA fragments observed. A further increase occurred in samples from cells grown in the presence of multiple antibiotics. The combination of azithromycin and rifampicin resulted in the largest amount of degradation and was found to be significantly greater than any degradation occurring in cells grown without antibiotics. As a result of the increase of degradation occurring, smaller amounts of 23S rRNA were observed in antibiotic treated samples (see Fig. 15a,b Table 7).
Northern blot hybridization and detection of 16S RNA showed degradation for samples treated with azithromycin and an increase in degradation observed in samples treated with azithromycin in combination with other antibiotics that was shown to be statistically significant (see 16a,b Table 8).
Northern blot hybridization and detection of 23S RNA showed degradation for samples treated with azithromycin or ciprofloxacin and a large increase in degradation observed in samples treated with azithromycin in combination with rifampicin and in samples grown with ciprofloxacin and rifampicin that were shown to be statistically significant (see 16c,d Table 8).
103 Analysis of rRNA provided additional evidence for an increase of inhibition of subunit synthesis when cells are grown with azithromycin in combination with other antibiotics. Samples determined to be significant different were also consistent with assays and measurements for subunit and 70S ribosome synthesis evaluated under the same antibiotic combinations.
Mutation Frequency Assays
Mutation frequencies were determined by growing cells in the absence of antibiotics and plating onto TSB agar containing antibiotic combinations at their determined MICs with results consistent with previous data (25, 45, 48, 64-70).
Very few colonies were observed in any sample with significant decreases in
CFUs observed in cases of cells grown on plates containing azithromycin + rifampicin and azithromycin + ciprofloxacin. No observable colonies were seen on plates containing all 3 antibiotics, providing strong evidence for a reduction in resistance when cells are grown in antibiotic combinations. For plates containing rifampicin or ciprofloxacin in combination with azithromycin this supports combination use considering the high resistance rates for pathogens treated with only rifampicin or ciprofloxacin (see Table 9).
104 Summary
In summary, these data show support not only for the use of antibiotic combination therapy but have shown evidence for an increase in the inhibition of bacterial ribosome assembly in Staphylococcus aureus. Strong evidence of the reduction of 50S ribosomal subunit synthesis and 23S ribosomal RNA in cells grown in the presence of azithromycin, already known for its inhibitory effects on the 50S subunit synthesis, in combination with rifampicin or in combination with rifampicin and ciprofloxacin was observed (28). This also resulted in a reduction or elimination in the frequency of resistant cells when grown in the presence of these combinations.
Antibiotic resistance remains an increasing threat due to many different reasons. Overuse of antibiotics has shown to contribute to this along with random genetic mutations contributing to this problem. Evidence has also shown possible selectivity for antibiotics within the ribosomal exit tunnel (71). The data provided here support the need for more insight into antibiotics that target ribosomal assembly as a means to inhibit protein synthesis and resistance involving the exit tunnel. If assembly were thoroughly inhibited, there would be no ribosomes to develop resistance. With recent warnings by the FDA for dangerous side effects of azithromycin use that could (in rare cases) result in abnormal heart rhythms, this work is further support for the use of antibiotics in combinations with azithromycin (72). This would allow for a more efficient way of
105 eliminating pathogens while also allowing for reduced concentrations of antibiotics administered to patients.
These studies have shed light on the mechanism of action involved and synergistic effects occurring in combination antibiotic treatments and how ribosomal subunit assembly is affected. The insights gained through this research provide necessary information needed for the design of more potent antibiotic combinations. This will create a better understanding and new methods for eliminating the spread of harmful pathogens such as
Staphylococcus aureus and warrants further investigation of this mechanism of inhibition.
106 REFERENCES
1. Anderson RM. 1999. The Pandemic of Antibiotic Resistance. Nat.
Med.2:147-149
2. Davies J, Davies D. 2010. Origins and Evolution of Antibiotic
Resistance. Microbiol. Mol. Biol. Rev. 74:417–433.
3. Giedraitienė A, Vitkauskienė A, Naginienė R. 2011. Antibiotic
Resistance Mechanisms of Clinically Important Bacteria. Medicina
(Kaunas). 47(3):137-46.
4. Rosen T. 2011. Antibiotic Resistance: An Editorial Review With
Recommendations. J Drugs Dermatol 10:724–733.
5. Tenover FC. 2001. Development and Spread of Bacterial Resistance
to Antimicrobial Agents: an overview. Clin. Infect. Dis. 33 Suppl
3:S108–115.
6. Yonath A. 2005. Antibiotics Targeting Ribosomes: Resistance,
Selectivity, Synergism and Cellular Regulation. Annu. Rev. Biochem.
74:649–679.
7. Hawkey PM, Jones AM. 2009. The Changing Epidemiology of
Resistance. J. Antimicrob. Chemother. 64 Suppl 1:i3–10.
8. Zinner SH. 2007. Antibiotic Use: Present and Future. New Microbiol.
30:321–325.
9. Walsh C. 2003. Where Will New Antibiotics Come From? Nat. Rev.
Microbiol.1:65-70
107 10. Walsh C. 2003. Antibiotics: Actions, Origins, Resistance. American
Society for Microbiology (ASM).
11. Champney WS. 2006. The Other Target for Ribosomal Antibiotics:
Inhibition of Bacterial Ribosomal Subunit Formation. Infect Disord
Drug Targets 6:377–390.
12. Wilson DN. 2009. The A–Z of bBacterial Translation Inhibitors. Critical
Reviews in Biochemistry and Molecular Biology 44:393–433.
13. Wilson DN. 2011. On the Specificity of Antibiotics Targeting the Large
Ribosomal Subunit. Ann. N. Y. Acad. Sci. 1241:1–16.
14. McCoy LS, Xie Y, Tor Y. 2011. Antibiotics That Target Protein
Synthesis. Wiley Interdiscip Rev RNA 2:209–232.
15. Siibak T, Peil L, Dönhöfer A, Tats A, Remm M, Wilson DN, Tenson T,
Remme J. 2011. Antibiotic-Induced Ribosomal Assembly Defects
Result From Changes in the Synthesis of Ribosomal Proteins. Mol.
Microbiol. 80:54–67.
16. Piir K, Paier A, Liiv A, Tenson T, Maiväli U. 2011. Ribosome
Degradation in Growing Bacteria. EMBO Rep. 12:458–462.
17. Shajani Z, Sykes MT, Williamson JR. 2011. Assembly of Bacterial
Ribosomes. Annu. Rev. Biochem. 80:501–526.
18. Kaczanowska M, Rydén-Aulin M. 2007. Ribosome Biogenesis and
the Translation Process in Escherichia coli. Microbiol. Mol. Biol. Rev.
71:477–494.
108 19. Borovinskaya MA, Pai RD, Zhang W, Schuwirth BS, Holton JM,
Hirokawa G, Kaji H, Kaji A, Cate JHD. 2007. Structural Basis for
Aminoglycoside Inhibition of Bacterial Ribosome Recycling. Nat.
Struct. Mol. Biol. 14:727–732.
20. Poehlsgaard J, Douthwaite S. 2005. The Bacterial Ribosome as a
Target for Antibiotics. Nat. Rev. Microbiol. 3:870–881.
21. Ramakrishnan V. 2002. Ribosome Structure and the Mechanism of
Translation. Cell 108:557–572.
22. Champney WS. 2001. Bacterial Ribosomal Subunit Synthesis: a
Novel Antibiotic Target. Curr Drug Targets Infect Disord 1:19–36.
23. Bryskier A. 2005. Antimicrobial Agents: Antibacterials and
Antifungals. ASM Press.
24. Oliphant CM, Green GM. 2002. Quinolones: A Comprehensive
Review - February 1, 2002 - American Family Physician. Am. Fam.
Physician. 65(3):455-64.
25. Campbell EA, Korzheva N, Mustaev A, Murakami K, Nair S, Goldfarb
A, Darst SA. 2001. Structural Mechanism for Rifampicin Inhibition of
Bacterial RNA Polymerase. Cell 104:901–912.
26. Alvarez-Elcoro S, Enzler MJ. 1999. The Macrolides: Erythromycin,
Clarithromycin, and Azithromycin. Mayo Clinic Proceedings 74:613–
634.
27. Peters DH, Friedel HA, McTavish D. 1992. Azithromycin. Drugs
44:750–799.
109 28. Silvers JA, Champney WS. 2005. Accumulation and Turnover of 23S
Ribosomal RNA in Azithromycin-Inhibited Ribonuclease Mutant
Strains of Escherichia coli. Arch. Microbiol. 184:66–77.
29. Bogdanov AA, Sumbatyan NV, Shishkina AV, Karpenko VV,
Korshunova GA. 2010. Ribosomal Tunnel and Translation
Megulation. Biochemistry Mosc. 75:1501–1516.
30. Kannan K, Mankin AS. 2011. Macrolide Antibiotics in the Ribosome
Exit Tunnel: Species-Specific Binding and Action. Ann. N. Y. Acad.
Sci. 1241:33–47.
31. Sutcliffe JA. 2005. Improving on Nature: Antibiotics That Target he
ribosome. Current Opinion in Microbiology 8:534–542.
32. Tenson T, Mankin A. 2006. Antibiotics and the Ribosome. Mol.
Microbiol. 59:1664–1677.
33. Petropoulos AD, Kouvela EC, Starosta AL, Wilson DN, Dinos GP,
Kalpaxis DL. 2009. Time-Resolved Binding of Azithromycin to
Escherichia coli Ribosomes. J. Mol. Biol. 385:1179–1192.
34. Pokkunuri I, Champney WS. 2007. Characteristics of a 50S
Ribosomal Subunit Precursor Particle as a Substrate for ermE
Methyltransferase Activity and Erythromycin Binding in
Staphylococcus aureus. RNA Biol 4:147–153.
35. Usary J, Champney WS. 2001. Erythromycin Inhibition of 50S
Ribosomal Subunit Formation in Escherichia coli cells. Mol. Microbiol.
40:951–962.
110 36. Champney WS, Chittum HS, Tober CL. 2003. A 50S Ribosomal
Subunit Precursor Particle is a Substrate for the ErmC
Methyltransferase in Staphylococcus aureus Cells. Curr. Microbiol.
46:453–460.
37. Mankin AS. 2008. Macrolide myths. Current Opinion in Microbiology
11:414–421.
38. Starosta AL, Karpenko VV, Shishkina AV, Mikolajka A, Sumbatyan
NV, Schluenzen F, Korshunova GA, Bogdanov AA, Wilson DN. 2010.
Interplay Between the Ribosomal Tunnel, Nascent Chain, and
Macrolides Influences Drug Inhibition. Chem. Biol. 17:504–514.
39. Wichelhaus TA, Böddinghaus B, Besier S, Schäfer V, Brade V,
Ludwig A. 2002. Biological Cost of Rifampin Resistance from the
Perspective of Staphylococcus aureus. Antimicrobial Agents and
Chemotherapy. 11:3381-3385.
40. J D Hayes CRW. 1990. Molecular Mechanisms of Drug Resistance.
Biochemical Journal 272:281-295
41. Perlroth J, Kuo M, Tan J, Bayer AS, Miller LG. 2008. Adjunctive Use
of Rifampin for the Treatment of Staphylococcus aureus Infections: A
Systematic Review of the Literature. Arch Intern Med 168:805–819.
42. Littlewood-Evans A. 1997. Effect of Combination Therapy of
Rifampicin and Azithromycin on TNF Levels During a Rat Model of
Chronic Osteomyelitis. Journal of Antimicrobial Chemotherapy
39:493–498.
111 43. Shirtliff ME, Mader JT, Calhoun J. 1999. Oral Rifampin Plus
Azithromycin or Clarithromycin to Treat Osteomyelitis in Rabbits.
Clinical Orthopaedics and Related Research 359:229-236
44. Chin NX, Neu HC. 1984. Ciprofloxacin, a Quinolone Carboxylic Acid
Compound Active Against Aerobic and Anaerobic Bacteria.
Antimicrobial agents and Chemotherapy. 3:319-326
45. Campion JJ, McNamara PJ, Evans ME. 2004. Evolution of
Ciprofloxacin-Resistant Staphylococcus aureus in In Vitro
Pharmacokinetic Environments. Antimicrob. Agents Chemother.
48:4733–4744.
46. Jones ME, Boenink NM, Verhoef J, Köhrer K, Schmitz FJ. 2000.
Multiple Mutations Conferring Ciprofloxacin Resistance in
Staphylococcus aureus Demonstrate Long-Term Stability in an
Antibiotic-Free Environment. J. Antimicrob. Chemother. 45:353–356.
47. Smith SM, Eng RH, Tecson-Tumang F. 1989. Ciprofloxacin Therapy
for Methicillin-Resistant Staphylococcus aureus Infections or
Colonizations. Antimicrobial agents and Chemotherapy. 2:181-184
48. Didier J-P, Villet R, Huggler E, Lew DP, Hooper DC, Kelley WL,
Vaudaux P. 2011. Impact of Ciprofloxacin Exposure on
Staphylococcus aureus genomic Alterations Linked With Emergence
of Rifampin Resistance. Antimicrob. Agents Chemother. 55:1946–
1952.
112 49. Ruble MW, Gilbert DH, Zinner SH. 1996. In-Vitro Interaction of
Azithromycin and Fluoroquinolones Against Gram-Positive and Gram-
Negative Bacteria. Clinical Microbiology and Infection 1:183–189.
50. Wood K, Nishida S, Sontag ED, Cluzel P. 2012. Mechanism-
Independent Method for Predicting Response to Multidrug
Combinations in Bacteria. Proc. Natl. Acad. Sci. U.S.A. 109:12254–
12259.
51. Hagihara M, Crandon JL, Nicolau DP. 2012. The Efficacy and Safety
of Antibiotic Combination Therapy for Infections Caused by Gram-
Positive and Gram-Negative Organisms. Expert Opin. Drug Saf.
11:221–233.
52. Steigbigel RT, Greenman RL, Remington JS. 1975. Antibiotic
Combinations in the Treatment of Experimental Staphylococcus
aureus Infection. Journal of Infectious Diseases 131:245–251.
53. Schmitz F-J, Fluit AC, Hafner D, Beeck A, Perdikouli M, Boos M,
Scheuring S, Verhoef J, Köhrer K, Eiff Von C. 2000. Development of
Resistance to Ciprofloxacin, Rifampin, and Mupirocin in Methicillin-
Susceptible and -Resistant Staphylococcus aureus Isolates.
Antimicrobial Agents and Chemotherapy. 11:3229-3231
54. Korzeniowski O. 1982. Combination Antimicrobial Therapy for
Staphylococcus aureus Endocarditis in Patients Addicted to
Parenteral Drugs and in Nonaddicts. Ann Intern Med 97:496-503
113 55. Conway SP, Brownlee KG, Denton M, Peckham DG. 2012. Antibiotic
Treatment of Multidrug-Resistant Organisms in Cystic Fibrosis. Am J
Respir Med 2:321–332.
56. Champney WS. 2003. Bacterial Ribosomal Subunit Assembly is an
Antibiotic Target. Curr Top Med Chem 3:929–947.
57. Champney WS, Tober CL. 2000. Specific Inhibition of 50S Ribosomal
Subunit Formation in Staphylococcus aureus Cells by 16-membered
Macrolide, Lincosamide, and Streptogramin B Antibiotics. Curr.
Microbiol. 41:126–135.
58. Champney WS, Burdine R. 1998. Azithromycin and Clarithromycin
Inhibition of 50S Ribosomal Subunit Formation in Staphylococcus
aureus Cells. Curr. Microbiol. 36:119–123.
59. Meyer AP, Bril-Bazuin C, Mattie H, van den Broek PJ. 1993. Uptake
of Azithromycin by Human Monocytes and Enhanced Intracellular
Antibacterial Activity Against Staphylococcus aureus. Antimicrob.
Agents Chemother. 37:2318–2322.
60. Easmon CS. 1979. The Effect of Antibiotics on the Intracellular
Survival of Staphylococcus aureus In Vitro. British journal of
experimental pathology 60:24.
61. Easmon CSF, Crane JP, Blowers A. 1986. Effect of Ciprofloxacin on
Intracellular Organisms: In-Vitro and In-Vivo Studies. Journal of
Antimicrobial Chemotherapy. Suppl. D:43-48
114 62. Frazier AD, Champney WS. 2012. The Vanadyl Ribonucleoside
Complex Inhibits Ribosomal Subunit Formation in Staphylococcus
aureus. J. Antimicrob. Chemother. 67:2152–2157.
63. Davies J, Spiegelman GB, Yim G. 2006. The World of Subinhibitory
Antibiotic Concentrations. Current Opinion in Microbiology 9:445–453.
64. O'Neill AJ, Cove JH, Chopra I. 2001. Mutation Frequencies for
Resistance to Fusidic Acid and Rifampicin in Staphylococcus aureus.
J. Antimicrob. Chemother. 47:647–650.
65. Zhou W, Shan W, Ma X, Chang W, Zhou X, Lu H, Dai Y. 2012.
Molecular Characterization of Rifampicin-Resistant Staphylococcus
aureus Isolates in a Chinese Teaching Hospital From Anhui, China.
BMC Microbiol. 12:240-245
66. Prunier A-L, Malbruny B, Tandé D, Picard B, Leclercq R. 2002.
Clinical Isolates of Staphylococcus aureus With Ribosomal Mutations
Conferring Resistance to Macrolides. Antimicrob. Agents Chemother.
46:3054–3056.
67. Prunier A-L, Malbruny B, Laurans M, Brouard J, Duhamel J-F,
Leclercq R. 2003. High Rate of Macrolide Resistance in
Staphylococcus aureus Strains From Patients With Cystic Fibrosis
Reveals High Proportions of Hypermutable Strains. J. Infect. Dis.
187:1709–1716.
115 68. Saiman L, Chen Y, Gabriel PS, Knirsch C. 2002. Synergistic activities
of Macrolide Antibiotics Against Pseudomonas aeruginosa,
Burkholderia cepacia, Stenotrophomonas maltophilia, and
Alcaligenes xylosoxidans Isolated From Patients With Cystic Fibrosis.
Antimicrob. Agents Chemother. 46:1105–1107.
69. López E, Elez M, Matic I, Blázquez J. 2007. Antibiotic-Mediated
Recombination: Ciprofloxacin Stimulates SOS-Independent
Recombination of Divergent Sequences in Escherichia coli. Mol.
Microbiol. 64:83–93.
70. Sreedharan S, Oram M, Jensen B, Peterson LR, Fisher LM. 1990.
DNA Gyrase gyrA Mutations in Ciprofloxacin-Resistant Strains of
Staphylococcus aureus: Close Similarity With Quinolone Resistance
Mutations in Escherichia coli. Journal of Bacteriology. 12:7260-7262
71. Kannan K, Vázquez-Laslop N, Mankin AS. 2012. Selective Protein
Synthesis by Ribosomes With a Drug-Obstructed exit tunnel. Cell
151:508–520.
72. Ray WA, Murray KT, Hall K, Arbogast PG, Stein CM. 2012.
Azithromycin and the Risk of Cardiovascular Death. N Engl J Med
366:1881–1890.
116 VITA
JUSTIN MICHAEL BEACH
Personal Data: Date of Birth: September 26, 1986 Place of Birth: El Paso, Texas Marital Status: Single
Education: PhD Biomedical Sciences, concentration Biochemistry (8/2009--‐12/2013) East Tennessee State University, James H. Quillen College of Medicine (Johnson City, TN)
BS Biology (8/2005--‐5/2009) The University of Tennessee at Chattanooga (Chattanooga, TN)
Professional PhD Graduate Student, East Tennessee State University, Department of Biomedical Sciences, Johnson City, TN Experience: (8/2009– 12/2013)
Publications: Beach J.M., and Champney W.S. (2013) “An Examination of the Inhibitory Effects of Antibiotic Combinations on Ribosome Biosynthesis in Staphylococcus aureus” Antimicrobial Agents and Chemotherapy: In Submission
Honors and Awards Grant – ETSU School of Graduate Studies Graduate Student Research Grant (2013) Grant – ETSU Biomedical Sciences Department Student Travel Grant (2013)
Award – Third Place Poster Presentations, Appalachian Research Forum (2013)
Award – First Place Poster Presentations, Appalachian Research Forum (2011)
117