- - * -sii.-* J ^ . r ---- *--■*- * ^g>ggrn(j»wy.irs !»*• w » 3 > m n ! ! fi> i l i^iJu^Wii'l^iiriiiWjpj; A m i “ ‘ *" ~ < C»; <% JHMiMr ’:il^'r% ' u m n i ■ 1 1 1 ! . rl- v:'^?1 ■i -'vs

UNIVERSITY OF ILLINOIS

Mav 8 1990

:SS

THIS IS TO CERTIFY THAT THE THESIS PREPARED UNDER MY SUPERVISION BY

Elisabeth C. Scharl

ENTITLED Mlj.fc8X.BSt. t i l l . .Throht Mutas

Signal Sequence

IS APPROVED BY ME AS FULFILLING THIS PART OF THE REQUIREMENTS FOR THE * -^4

DEGREE OF......

■* • • .-v*

T .slS r i

O MM M1STARGETING OF MITOCHONDRIAL MnSOD THROUGH

MUTAGENESIS OF Till- SIGNAL SEQUENCE

BY

ELIZABETH ('. SCI1AR1.

I III SIS

for the

DEGREE OF BACI IEI.OR OF SCU-NCT

BIOC.’I IEMISTRY

Collette of Liberal Arts :uul Sciences University of Illinois Urbana, Illinois TABLE OF CONTENTS

Page Number

I. Introduction 1

II. Materials and Methods 4

III. Results 7 IV. Discussion 11

V. Acknowledgements 13

VI. References 14

VII. Figures 15 INTRODUCTION

Aerobic metabolism leads to a number of reduced oxygen by-products which are toxic to the organism (3,8). Among these reactive intermediates are superoxide radicals

(02*')> hydrogen peroxide (Hj Oj ), and hydroxyl radiculs (HO ). Superoxide radicals

have been implicated in DNA breakage, erythrocyte lysis, and hyaluronate depolymerization (12).

Superoxide dismutases (SOD's) are a family of enzymes which catalyze the

reaction 0 2 '' + 0 2 *' +2H + -» I I2 Os + G> thereby ridding the organism of the

potentially harmful O2 '' product and its by products (11). SOD has been found in a wide variety of aerobic organisms and animal tissues. These enzymes presumably help protect

cells from the potentially damaging effects of the superoxide radical by catalyzing its

dismutation; this reaction results in the reduction of oxidative stress of the cell and

organism (1,3).

Although this hypothesis was proposed in 1969, it is still being debated since

research indicates that elevated oxygen concentrations increase not only SOD, but also

the levels of many other proteins (12). In addition, other cellular reductants, which are

far more abundant than SOD, arc known to exist. Although the cnzymology of SOD is

known, its cellular function is stil unknown; i.e., it is not known what cellular components

are most susceptible to oxidative damage (12).

Superoxide dismutases are metalloproteins and categorized into three types

according to their metal binding specificities. Iron binding metalloproteins are primarily

found in prokaryotes while copper/zinc binding proteins are localized in the cytosol of

eukaryotes. The third type is manganese-SOD (MnSOD) which is found in the cytosol of

prokaryotes and the mitochondrial matrix of eukaryotes (3,10).

1 2

The manganese and iron containing SOD show similarities in their primary, secondary, and tertiary structures while the eukaryotic copper/zinc protein is distinctly different from the other two enzymes (3). The N-terminal sequences of the iron and manganese proteins show a high degree of homology which suggest that they came from a common ancestor. They apparently share the same set of ligands since the iron protein from Bacteroides fragilis can be reconstituted as a manganese-containing enzyme (4). The secondary structures of both enzymes contain a large number of beta turns which are conserved in position and amount in SODs isolated from evolutionary different organisms (4). The similarity between the bacterial and manganese SOD and distinct differences of the copper/zinc protein supports the hypothesis that mitochondria evolved from an aerobic prokaryote which entered into an endocellular symbiosis with a protoeukaryote (10). If this is true, then much of the mitochondrial genome was transferred to thal of the host or lost during evolution since greater than ninety percent of mitochondrial proteins are encoded in the nucleus (9).

Most mitochondrial proteins are encoded by the nuclear genome, synthesized as a larger precursor in the cytosol, and then targeted to the mitochondria via a signal sequence at the N-terminus of the protein (2,7). Mitochondrial signal sequences do not appear to have a consensus sequence but do show high amounts of basic and hydroxylated amino acids (4,13). Manganese superoxide dismutase has a 27 amino acid presequence that targets the protein to the mitochondria (4). After synthesis on free ribosomes in the cytosol, the mitochondrial protein is transported across the inner and outer mitochondrial membranes to the matrix where the presequence is cleaved b) a matrix localized protease.

The presence of two physically distinct enzymes, catalyzing the same reaction, suggests that their activities may protect specific components in their respective cellular compartments. Preliminary data suggests that a yeast strain lucking copper/zinc SOD 3 may be auxotrophic for specific amino acids ( 16V Other macromolecuies may be protected by MnSOD in the mitochondria. The location of these two enzymes may also be the result of their biosynthesis. For instance, the copper/ zinc and MnSOD pools may be significantly different in the cytosol vs. the mitochondria requiring that these enzymes be "matured" in these compartments.

The purpose of this project is to test whether these activities may be functionally interchanged. The first goal was to mistarget MnSOD to the cytosol by site-directed mutagenesis of the signal sequence. With this mutant, the effects of compartmentulization of MnSOD will be tested. This experiment will serve to answer the questions of why multiple and different SOD's are present in eukaryotes which have identical functions and what effect will mistargeting MnSOD to the cytosol in a copper/zinc SOD deficient strain of Succharomycex cerevisiae will have on growth, With this data, new insight will be gained on the possible roles of manganese superoxide dismutase MATERIALS AND METHODS

Materials pGem3zf( +) and pGem5z( +) vectors were obtained from Promega Biotec

(Madison, WI). The oligonucleotides were generously provided by K. Jayaranian,

Eastman Kodak Laboratory (Rochester, NY). The restriction enzymes and other DNA modification enzymes were from New England Biolabs (Beverly, MA), Bethesda

Research Laboratories (Gaithersbury, MD) and Promega Biotech. All other chemicals were reagent grade. Cells strains used were: JM109 (recA/, endAJ, $rA(J6t thi, hsdR17(rk-mk-)H supE44, relA 1, (Lambda-), k(lac-proAB), /F\ traD36, proAB, lacflZkM15/); NM522 (sup E, thi, t(laC'proAB), khsdS (r-,m-), ff, proAB, lacl^ZkM15))\ CJ236 (dut-ung-)(20); Jmr- (recA-

Suhdomng imao(k m5zf( +) The MnSOD gene was originally obtained from A.P.G.M. van Loon (Basel,

Switzerland). A fragment containing the signal sequence of MnSOD was "shotgun” cloned. The pGetn3zf( + )SOD recombinant (obtained from N. Chu, University of

Illinois) plasmid was digested with Nco I and Sue I restriction enzymes generating an 870 base pair fragment which included the signal sequence of MnSOD and part of the polylinker sequence of the pare:.: vector. These fragments were ligated using T4 DNA ligase (3:1 molar ratio of insert to vector) into a pGcm5zf( +) vector that was digested at the Nco 1 and Sacl sites in the multiple cloning region. Cells were transformed using the calcium chloride procedure found in Molecular Cloning (15).

4 5

The ligation mixture was transformed into 0236, NM522, and JM 109 £ Coli cell strains that were made competent with CaClj (21) and plated on LB (10 grams tryptone,

5 grams yeast, 10 grams NaCI) containing 100 ug/ml 'mpicillin. Individual colonies were isolated and grown in 2 ml LB broth. The DNA was isolated using the alkaline lysis method (15). A restriction digest using Nco\ and Sac I was done to screen for the correct recombinant.

KunkeL01igt?nucleoiiderI>ii^cted Mutagenesis of MnSQD The Kunkel mutagenesis procedure involves incorporating uridine into the parental DNA so that a wild type E. Coli cells will degrade the in vivo produced uridine strand leaving the in vitro synthesized mutant strand. The two oligonucleotides used for deletion mutagenesis were designed by Nancy Chu (formerly of University of Illinois).

One hybridizes to nucleotides -9 to 3 and 80-92 deletes the entire signal sequence resulting in a met-val amino terminus while the other oligonucleotide binds -9 to 3 and

79-91 (deletes all of the signal sequence and the first amino acid of the mature protein resulting in a met-val amino terminus) (14).

The pGem vectors are phagmids containing the intragenic region of bacteriophage fl. These vectors can be propagated as phage when cells harboring the plasmid are infected with helper phage. The helper phage supplies the genes necessary for the synthesis and packaging of the plasmid as single stranded DNA (17). The single stranded undine template was produced by incubating 0236 transformed with p(iem3Zf( +) in LB media containing 0.126 ug/ml uridine and 100 ug/ml umpicillin, and infecting with helper phage. The 0 2 3 6 was dut-ung- in order to allow uridine incorporation into the DNA and to prevent its removal from the DNA. 0236 was maintained on LB plates supplemented with 10 ug/ml chloramphenicol to maintain an episome encoding genes for the sex pili.

Single strand phagmid DNA was isolated by the following procedures: 200 ul of 20% PE0-2.SM NaCI was added per ml of phage suspension followed by low speed centrifugation (1S00 rpm). The pellet was resuspended in 400 ul 20 mM Tris HCI-O.lntM

EDTA-lOmM NaCI and extracted with phenol-chloroform (1:1). The aqueous phase was ethanol precipitated and suspensed in 25 ul 20mM Tris HCMMmM EDTA-lOmM NaCI for storage. Typical yields were 25-100 ug of DNA from 250 ml of culture.

it*!jtfiQi.for Mulagenc&la of MnSQD Batt's protocol was done to construct signal sequence mutants of MnSOD( 18). 5* methylated-dCTP incorporation into DNA was used to differentiate between the parental and mutant strand. Following in vitro synthesis, Msp\ and Hhal are added to the reaction products. Msp\ will cut only non-methylated sites and Hha\ is also unable to cleave methylated DNA, Therefore, digestion with Msp 1 and Hhal results in the selective cleavage of the parental strand (18). The DNA was then transformed into Jmr- cells s’nce they lack methyiation and restriction activities.

Polymerase Chain Reaction fPCRl Mutagenesis trf MnSQD

A basic PCR protocol was followed using linearised pGem5zf(+ )SOD signal sequence DNA, the mutant oligonucleotides, and Spo primers. The PCR reaction mixture consisted of 10 mM Tris-HCl, 1.5 mM MgCI, 50 mM KCI, 50 uM dNTP, 0.2 uM of each printer, 1 ng or 0.1 ng template, and I unit Taq polymerase per reaction tube. Each cycle consisted of a 92°C incubation for two minutes to denature the DNA, a one minute 50°C incubation to hybridize the primers, and a one minute 72°C incubation to synthesize the DNA. Twenty-five rounds of PCR were performed to obtain a "megaprimer" (19). This megaprimer and the T7 primer will be used in unother 25 rounds of PCR to amplify the 5' flanking control regions of the MnSOD gene. RESULTS

The goal of this project was to misdirect the MnSOD protein from the mitochondrial matrix to the cytosol. To do this, the sequence directing import into the mitochondria must be deleted from the MnSOD gene. The Kunkel mutagenis protocol was chosen because it had been sucessfully used in the Kaput laboratory. Two mutant primers were used separately for the protocol. One mutant oligonucleotide binds from sites -9 to 3 and 82-92 while the other oligonucleotide binds from -9 to 3 and 79-91

(Figure 1). The first oligonucleotide will delete residues from the initiating methionine to lysine which is the amino terminus of the mature protein. However, methionine is often removed following translation which wouid leave a lysine at the umino terminus. Model proteins containing lysine at the amino terminus have short half lives (estimated at three minutes). Therefore a second oligonucleotide was used which deletes the signal sequence plus the lysine leaving a valine terminated protein. Proteins with valine at the amino terminus have half-lives of greater than 20 hours.

pGem3Zf(+)SOD (Figure 2) was transformed into 0236, infected with helper phage, and the single stranded DNA isolated by the phage prep protocol. The isolated

DNA was analyzed on a 1% agarose gel; only the helper phage DNA was present. 1711$ result was unexpected since the cells were grown in the presence of umpicillin which would select for the presence of the phagemid. To confirm that the phagemid was still present in 0236, double stranded phagemid DNA was isolated using a mini prep

procedure (13) and digested with Bam HI. Bam HI cuts on either side of the MnSOD gene generating fragments of 1705 and 3199 nucleotides. Both of the expected fragments were present (Figure 3, lanes 2-5,8-11). Hence the failure to obtain single stranded phagemid DNA was not due to the loss or rearrangement of the recombinant phagemid encoding MnSOD. 8

Since the MnSOD gene was present and no single stranded DNA was isolated, it was possible that the cell strain was incapable of replicating, packaging, or secreting the phagemid DNA in phage particles. Therefore, pGem3Zf( + )SOD was transformed into

NM522 and single stranded DNA was isolated. Again, no single stranded phagemid DNA was isolated even though a large amount of helper phage DNA was purified (Figure 4). This suggests that the failure to produce single stranded phagemid DNA encoding

MnSOD may not be due to the cell strains.

Another possibility for the absence of single stranded phagmid DNA might be that some sequences in MnSOD could not be replicated or packaged. In order to test this hypothesis, a fragement of SOD2 containing the 5’ untranslated region, the signal sequence, and a portion of the gene encoding the mature protein was subcloned into pGemSZf (Figure 5). Deletion of unnecessary sequences might increase the possibility of isolating single stranded phagemid DNA. However, this strategy requires an additional sucloning step to reconstruct the mutated MnSOD gene.

The signal sequence in the pGcm3Zf( + )SOD vector is flanked by single Nco 1 and

Sac 1 restriction sites(Figure 2). pGem5Zf( +) was chosen for subcloning since there are only single Nco\ and S ad sites in the multiple cloning region of this vector. The

“shotgun” method of cloning was utilized. Both vectors were digested with Nco 1 and Sad in seperate reactions, mixed in a 3:1 molar ratio of insert to vector, and ligated with T4

DNA ligase. The products were then transformed into JM 109IL Coli. At least four products were possible from this cloning reaction (religated pGem3Zf( + )SCD vector and pGem5Zf( +) vector, pGem3Zf( +) plus the 57 base-pair fragment of pGeni5Zf( +), and pGem5Zf( +) plus the 870 base-pair fragment containing signal sequence fragment of

SOD) and the appropriate construct was identified by restriction digestion with Nco\ and

S ad (Figure 6), The resulting recombinant was termed pGsgSOD (Figure 5). 9

Transfection and single strand DNA isolation were performed and a hand corresponding to both helper phage DNA and single stranded MnSOD DNA were present (Figure 7). pGsgSOD DNA was transformed into CJ236 because a dut-ung- cell strain was required for the production of uridine substituted phagemid DNA that could be used in the Kunkel mutagenesis protocol. However, pGsgSOD single stranded phagemid DNA was not isolated from the 0 2 3 6 cells. The results showed helper phage

DNA and an additional smear at the dye front. This experiment was repeated several times with identical results. Since a uridine substituted template was not obtained, Batt’s mutagenesis protocol was adapted.

Ball's Batt's protocol uses 5'-methyl-dCTP encorporation to distinguish between the parental and mutant strands of DNA. Single stranded pGemsgSOD isolated from JM109 was used as a template for DNA synthesis with the mutant oligonucleotides as primers.

The resultant hemimethylated DNA was digested with Mspl and HhaU the mutated DNA strand which contains 3-methyI-dCTP is resistant to these enzymes. The treated DNA was transformed into Jmr- E. Coli cells since these cells are methylation and restriction minus. This mutagenesis procedure was done three times and only two colonies were formed. Neither of these clones contained the mutant sequence as judged by restriction digests. A 75 base-pair shift between parental and mutated DNA was expected. One of the isolated DNAs was identical to wild type pGsgSOD and the second apparently contained a large deletion (Figure 8, lanes 1,3). It is not clear why the Batt s protocol did not work, but a new method was published which involves PCR site-directed mutagenesis

(19). 10

PCR Mutagenesis of MnSQD A mutant oligonucleotide and another primer are used in the first round of PCR to amplify the mutated DNA region. The resulting DNA is called a megaprimer and is used along with a third primer in a second PCR amplification round to amplify the 5* flanking region of pGsgSOD. A reaction mixture containing PCR buffe:*, dNTPs, primers, and pGsgSOD as the template was cycled through twenty-five rounds of PCR amplification. The DNA was run on an agarose gel and no hand was seen. This result was not completely unexpected since the mutant primer is not completely homologous to the pGsgSOD and therefore may not bind stabily at 50°C. Other hybridization temperatures and with various primer:template ratios will be tested. DISCUSSION

Eukaryotic ceils evolved and maintained two different radical metabalizing enzymes, MnSOD and copper/zlnc SOD. Although these enzymes are located in different cellular compartments, they catalyze the same reaction. To study the effects of

MnSOD in vivo and the possible cellular comparments it might protect from oxidative stress, the MnSOD gene product will be misdirected to the cytosol. This will be done by deleting the signal sequence of MnSOD. A signal sequence ueficient MnSOD protein should remain in the cytosol. After inserting the mutated gene into yeast strains lacking either the mitochondrial, cytosolic, or both enzymes, specific effects on mitochondrial and cytosolic compartments will be assayed by biochemical and genetic methods.

The Kunkel mutaeenis protocol was used to mutate the signal sequence of

MnSOD. The vector was transformed into CJ236 (dunuig-) and infected with helper phage to produce single stranded DNA. However, no MnSOD single stranded DNA was produced even though the protocol was done several times and helper phage was isolated.

Three possibilities existed for the failure to obtain single stranded MnSOD DNA. To test for the presence of phagemid, double stranded phagemid DNA was isolated by mini prepping individual colonies. A low resolution restriction map was done. The restriction map demonstrated that the vector was present in 0236 cells.

Second, the failure to produce single stranded MnSOD DNA may have been strain specific. However, infection of NM522 cells carrying pGem3Zf( + )SOD DNA did not result in theproduction of single stranded phagemid DNA. This result suggests that

MnSOD contains a sequence that prevents some step in phage maturation. Third, there may be a packaging and secretion problem perhaps due to the three-dimensional structure of the MnSOD gene. To test this hypothesis, an 870 base-pair fragment (out of

1705 base-pairs) containing the signal sequence of MnSOD was subcloned into pGem5Zf( +) to decrease the amount of foreign DNA in the vector. 11 12

The resultant subclone was transformed into CJ236, NM522, and JM109 £. Coli cell strains and single stranded MnSOD DNA was produced only from the JM109 cells.

The problem of isolating single stranded SOD seemed to be a combination of cell strain specificity and some sequence in the 3' end of the MnSOD gene. Since no single stranded MnSC D DNA was isolated from GI23o, the Kunkel protocol could not be used for in vitn mutagenesis procedures. Therefore the Balt protocol was adapted which utilized in vitro incorporation of 5-methyl-dCTP into mutant strand of DNA. Although this procedure was repeated several times, only two mutant colonies were found. These colonics were tested but did not encode the correct deletion,

A PCR mutagenesis protocol using the two mutant oligonucleotides also was attempted. A megaprimer containing the mutation is produced by amplification using the mutagenic primer and a primer 3' of the gene. This megaprimer is used for a second amplification step which generates the 5’ end of the gene. I lowever, after 25 rounds of

PCR amplification, no band was seen on a V/i agarose gel. Since the oligonucleotide sequence is not contiguous with the MnSOD gene sequence, the optimal temperature for hybridization with the primer was not known. Hence, the lack of DNA might have resulted from the inability to prime the first strand. Different hybridization temperatures and DNA to template ratios will be tried in the next PCR experiment to optimize the reaction conditions and obtain the mutant DNA.

This signal sequence deletion MnSOD gene will be cloned into yeast to determine whether the altered protein is mistargeted to the cytosol. In addition, the gene will be transformed into a copper/zinc SOD strain to see if it compliments the deficiency of the copper/zinc protein. New insights into the role of MnSOD. These experiments may also address why SOD's are compartmentalized in two cellular compartments. ACKNOWLEDGEMENTS

I would like (o thank Dr. Jim Kaput for giving me the opportunity to "experience science" in his laboratory and for putting up with all the fumbles of a "beginning scientist." Many thanks also go to Denise Ekberg and Sandy Kirchner for their endless patience in answering all my questions, and for all their deep insights into what graduate school is all about.

13 REFERENCES

1. McCord, J.M., and Fridovich, I. (1989)/ NIH Research 1, 111-120

2. White, J.A., and Scandalios, J.G. (1989) Proa Nail. Acad. U.S.A. 86, 3534- 3538

3. Bowler, C., Alliotte, T., Van Den Bulcke, M., Bauw, G., Vandekerckhove, J., Van Montagu, M., and Inze, D. (1989) Proc. Natl. Acad. U.S.A. 86, 3237-3241

4. Marres, C.A.M., Van Loon, A.P.G.M., Oudshoorn, P., Van Steeg, H., Grivell, L.A., and Slater, E.C. (1985) Ear. J. Biochem. 147, 153-161 5. Barra, D., Schinina, M.E., Bannister, J.V., Bannister, W.H., Rotilio, G., and Bossa, F. (1984)/ Biot. Chem. 259, 12595-12601 6. Weisiger, R.A., and Fridovich, I. (1973)/ Biol Chem. 248, 4793-4796

7. Autor, A.P. (1982)/ Biol. Chem. 257, 2713-2718

8. Imlay, J.A., Chin, S.M., and Linn, S. (1988) Science 240, 640-642

9. Bibus, C.R., Lemire, B.D., Suda, K., and Schatz, G. (1988)/ Biol Chem. 263, 13097-13102 10. Ravindranath, S.D., and Fridovich, I. (1975)/ Biol. Chem. 250,6107-6112

11. Weisiger, R.A., and Fridovich, I. (1973)/ Biol Chem. 248, 3582-3592 12. Van Loon, A.P.G.M., Pesold-ilurt, B., and Schatz, G. (1986) Proc. Natl. Acad. Sci. 83, 3820-3824

13. Schatz, G. (1987) Ear. J. Biochem. 165,1-6

14. Chu, N.Y. (1989) Senior Thesis: Mitochondrial Superoxide l)ismutuse, Construction of a Mutant Lacking the Presequence

15. Maniatis, T., Fritisch E.F., and Sambrook, J. (1982) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor 16. Chang, E.C., and Kosman, D.J. (1989)/ Biot. Chem. 264, 12172-12178

17. Mead, D.A., and Kemper, B. (1988) Vectors: Sumy of Molecular Cloning Vectors and Their Uses, Butterworth Publishers, Woburn, MA 85-102

18. Vandeyar, M.A., Weiner, M.P., Hutton, C.J., and Batt, C.A. (1988) Gene 65, 129-133

19. Sarkar, G., and Sommer, S.S. (1990) BioTechniques 8,404-407

20. Tye, B. Chien, J., Lehman, I., Duncan, B„ and Warner, II. (1978) Proc. Natl. Acad. Sci. U.S.A. 75,233-237 -, 15

FIGURE 1

MFAKTAAANLT

12 AAACGTACCAGGATGTTCGCGAAAACAGCAGCTGCTAATTTAACC

KKGGLSI.LSTTARRT

4*3 4 AAGAAGGGTGGTTTGTCATTGCTCTCCACCACAGCAAGGAGAACC

K V T L P D

4*7 9 AAAGTCACCTTGCCAGAC

FIGURE 1: Partial nucleotide sequence of MnSOD. Lines show sequences where the two mutant oligonucleotides hybridize. The sequence is numbered relative to the A (4* l) in the translation-initiation ATG (14). Numbers on left refer to the first nucleotide of that line. One oligonucleotide ( ------) will produce a MK amino terminus. The other oligonucleotide ( ) will produce a MV amino terminus. See text for discussion. 16

T7 (1)

♦

SOD Gene INSERT-1.0KB

FIGURE 2: pGem3Zf( + )SOD. The MnSOD gene was cloned in a Bam HI site of pGem3Zf(+). The BarnHl restriction site on cither side of the MnSOD gene was reconstructed during cloning. The SOD gene insert is 1705 nucleotides producing a total plasmid length of 4904 base-pairs. This plasmid was constructed by N. Chu. 17

Figure 3: Restriction digestion of p(lom3Zf( + )SOD transformants. Lanes are:

2-5: the pGem3Zf( + )SOD DNA was isolated from CJ236 cells 8-11: the pGem3Zf( + )SOD DNA was isolated from MN522 cells 1. pGem3Zf( + )SOD 2. pGem3Zf( + )SOD colony 1 digested with Bam HI 3. pGem3Zf( + )SOD colony 2 digested with Bam HI 4. pGem3Zf( + iSOD colony 3 digested with Bam HI 5. pGem3Zf( + )SOD colony 4 digested with Bam III 6. Lambda digested with Haul III 7. pGem3Zf( + )SOD 8. pGem3Zf(+ )SOD colony 1 digested with Bam HI 9. pGem3Zf( + )SOD colony 2 digested with Bam HI 10. pGem3Zf( + )SOD colony 3 digested with Bam HI 11. pGem3Zf( + )SOD colony 4 digested with Bam III 18

Figure 4: Single standed pC»em3Zf( )S()I) isolation. I lines are:

1,2 IR1 helper phage l)NA 3,4 pGem3Zf( +) DNA isolated from CJ236 cells 5,6 pGem3Zf( +) DNA isolated from NM522 cells 19

FIGURE 5; The pGsgSOD recombinant plasmid. The backbone vector is pGem5Zf( + ) with the 870 base-pair signal sequence containing fragment of MnSOD cloned into the Ncol and Sacl restriction sites. 20

FIGURE 6: Restriction digestion to screen for subclone pGsgSOD. Lanes are:

1. Colony 6 digested with Nco I and Sac I 2. pGsgSOD digested with Nco I and Sac 1 3. Colony 20 digested with Nco I and Sac / 4. Colony 28 digested with Nco I and Sac I 5. pGem 5Zf( + )SOD 6. pGem 5Zf( + )SOD digested with Nco I and Sac l 7. pGem3Zf( + )SOD digested with Nco i and Sac 1 8. pGem3Zf(+)SOD 9. Lambda digested with Hind III 21

FIGURE 7: Single stranded pGsgSOD DNA. Lanes are:

1. IR helper phage DNA 2. Single stranded DNA isolated from pGsgSOD 22

FIGURE 8: Restriction digestion using Nco l and Sac I. The two colonies from the Butt mutagenesis protocol were screened. Lanes arc:

1. pGsgSOD digested with Nco / and Sac I 2. pGsgSOD 3. Mutant colony 1 digested with Nco I and Sac I 4. Mutant colony 1 5. Mutant colony 2 digested with Nco 1 and Sac l 6. Mutant colony 2 7. Lambda digested with Hind III

: . s§ia