Parental Diagnosis of Satsuma Mandarin (Citrus Unshiu Marc.) Revealed by Nuclear and Cytoplasmic Markers

Home , Citrus unshiu, Dancy (citrus), Hyuganatsu, Iyokan, Kabosu, Kiyomi

Breeding Science Preview This article is an Advance Online Publication of the authors’ corrected proof. doi:10.1270/jsbbs.16060 Note that minor changes may be made before final version publication.

Research Paper

Parental diagnosis of satsuma mandarin (Citrus unshiu Marc.) revealed by nuclear and cytoplasmic markers

Hiroshi Fujii*1), Satoshi Ohta1), Keisuke Nonaka1), Yuichi Katayose2), Toshimi Matsumoto2), Tomoko Endo1), Terutaka Yoshioka1), Mitsuo Omura3) and Takehiko Shimada1)

1) NARO Institute of Fruit Tree Science (NIFTS), National Agriculture and Bio-oriented Research Organization (NARO), Shizuoka, Shizuoka 424-0292, Japan 2) Agronomic Research Center, National Institute of Agrobiological Sciences (NIAS), Tsukuba, Ibaraki 305-8602, Japan 3) Faculty of Agriculture, Shizuoka University, Shizuoka, Shizuoka 422-8529, Japan

Satsuma mandarins (Citrus unshiu Marc.) are the predominant cultivated citrus variety in Japan. Clarification of its origin would prove valuable for citrus taxonomy and mandarin breeding programs; however, current information is limited. We applied genome-wide genotyping using a 384 citrus single nucleotide polymorphism (SNP) array and MARCO computer software to investigate the satsuma mandarin parentage. Genotyping data from 206 validated SNPs were obtained to evaluate 67 citrus varieties and lines. A total of five parent–offspring relationships were newly found by MARCO based on the 206 SNP genotypes, indicating that ‘Kishuu mikan’ type mandarins (Citrus kinokuni hort. ex Tanaka accession ‘Kishuu mikan’ and ‘Nanfengmiju’) and ‘Kunenbo’ type mandarins (Citrus nobilis Lour. var. kunip Tanaka accession ‘Kunenbo’ and ‘Bendiguangju’) are possible parents of the satsuma mandarin. Moreover, cleaved amplified polymorphic sequences analysis showed that the genotypes of four regions in chloroplast DNA of ‘Kishuu mikan’ type mandarins were identical to that of the satsuma mandarin. Considering the historical background, satsuma mandarins may therefore derive from an occasional cross between a ‘Kishuu mikan’ type mandarin seed parent (derivative or synonym of ‘Nanfengmiju’) and a ‘Kunenbo’ type mandarin pollen parent (derivative or synonym of ‘Bendiguangju’).

Key Words: citrus, satsuma mandarin, parentage, genotype, origin.

Introduction breeding of superior cultivars. Satsuma is the name of a former province, now Kagoshima Citrus fruits are the most commonly grown fruits world- Prefecture, on the southern tip of Kyushu Island, where sat- wide, with more than 25 species cultivated in Japan. Of sumas were originally described by Siebold (Hodgson these, satsuma mandarin (Citrus unshiu Marc.) is particular- 1967). During prehistoric and historical ages, many types of ly suited to the Japanese climate where it has been cultivat- citrus were introduced, or naturally migrated, to Japan, or ed for more than 100 years. Its fruits offer many favorable occurred as natural hybrids. It is likely that the parents or characteristics, including the fact that they are seedless, original varieties of satsuma mandarin were among these. easy to peel, mature early, and show disease resistance and a The highly distinctive satsuma mandarin is considered to high productivity. More than 200 cultivars have been regis- have been cultivated in Japan prior to 1600 A.D., which is tered for cultivar license since 1981 in Japan. The satsuma the time of its earliest known reference. Ogaki (1979) previ- mandarin is still the main cultivated variety of citrus, ac- ously described the existence of many mandarin varieties counting for 62.5% (45.5 kha) of all citrus acreage similar to the satsuma mandarin in China. Because the (72.6 kha) in 2014 in Japan. While its origins remain un- satsuma mandarin has never been found in China and as clear, clarification of these would provide valuable informa- its Japanese name Unshiu is thought to be a corruption of tion for understanding genetic diversity and aiding the Wenchow, an ancient Chinese province, it seems likely that it originated as a chance seedling from a fruit or form Communicated by Christophe Rothan imported from China, possibly from Wenchow Province. Received March 29, 2016. Accepted August 1, 2016. According to a report by Tanaka (1927), it may have derived First Published Online in J-STAGE on October 15, 2016. from Bendizao, Zaoju, or Manju mandarin varieties, which *Corresponding author (e-mail: [email protected]) share similar morphological characteristics. However, Xu

1 Breeding Science BS Preview Fujii, Ohta, Nonaka, Katayose, Matsumoto, Endo, Yoshioka, Omura and Shimada (1997) reported that the mandarin variety ‘Bendiguangju’ thors also developed MARCO computer software, which resembled the satsuma mandarin. ‘Bendiguangju’ seed was automatically performs calculations and estimates parent- originally brought by a Japanese monk from China, so could age based on DNA marker genotypes (Fujii et al. 2010). have been the origin of the satsuma mandarin. The application of these developments has enabled cultivar Parental diagnosis using molecular and biochemical parentage to be evaluated, areas of confusion regarding cer- markers has advanced rapidly in humans, animals, and tain cultivars to be resolved, and rights to be secured for plants following the remarkable progress of genome se- citrus breeders. For example, the parentage of Japanese do- quencing. Citrus species are diploid with a basic chromo- mesticated chestnuts was clarified based on SSR genotyping some number x = 9 (Krug 1943) and genome size of sweet data (Nishio et al. 2014). orange (C. sinensis Osbeck) and clementine (C. clementina In the present study, 67 citrus varieties and lines, related hort. ex Tanaka) are 370 Mb and 367 Mb/haploid, respec- to the satsuma mandarin derivation, underwent genome- tively (Ollitrault et al. 2003). The genomes of sweet orange wide genotyping using the citrus Illumina GoldenGate 384 (diploid) and clementine mandarin (haploid) have been se- SNP array. Based on validated data from the genotypes of quenced (Wu et al. 2014) and draft sequences are available 206 SNPs, four novel parent–offspring relationships were in a public database, such as Pytozome (http://phytozome. identified by MARCO. The possibilities of satsuma manda- jgi.doe.gov/pz/portal.html) and the Citrus Genome Data- rin parentage are discussed with reference to cpDNA geno- base (https://www.citrusgenomedb.org/). Several attempts typing by CAPS analysis. to explore the origin of citrus have been made based on molecular markers of nuclear DNA and chloroplast (cp) Materials and Methods DNA (Curk et al. 2016, Gulsen and Roose 2001, Li et al. 2015). This progress has extended not only to advances in Plant material and DNA preparation citrus molecular breeding and functional genomics, but also A total of 67 citrus varieties and lines related to the to phylogenetic studies involving the organization of multi- satsuma mandarin derivation were used for parental diagnosis ple citrus varieties. (Table 1). Sample accession numbers and species names Numerous DNA markers, such as restriction fragment were based on the National Institute of Agrobiological length polymorphisms (RFLPs), randomly amplified poly- Sciences (NIAS) Genebank. All plants were cultivated at morphic DNA, cleaved amplified polymorphic sequences Okitsu Citrus Research Station and Kuchinotsu Citrus Re- (CAPS), and polymerase chain reaction (PCR)-RFLP analy- search Station of NIFTS in Japan. Genomic DNA was ex- sis using chloroplast gene regions and chloroplast simple tracted from fresh and fully expanded leaves of these indi- sequence repeat (cpSSR), have been developed and applied viduals and their parent cultivars, according to the method to mandarin cultivar identification (Matsuyama et al. 1992, of Dellaporta et al. (1983). A total of 67 DNA samples were Ninomiya et al. 2015, Omura et al. 2003, Sugawara et al. then adjusted to concentrations of 50 ng/µl using distilled 2002, Ueda et al. 2003), and the evaluation of genetic diver- water. sity (Cheng et al. 2005, Coletta Filho et al. 1998, Li et al. 2006, Yamamoto et al. 2013). Yamamoto et al. (2013) eval- Illumina GoldenGate assay uated the diversity of 103 species of mandarin and related Illumina’s GoldenGate Assay utilizing a bead array plat- fruits using cpDNA polymorphisms by CAPS analysis, and form was carried out using the 384 SNP array for citrus classified them into seven groups. Similarly, Li et al. (2006) genotyping (Fujii et al. 2013). The assay was performed reported the genetic diversity of Chinese wild mandarins according to the manufacturer’s protocol (Illumina, San using nuclear simple sequence repeat and cpSSR markers Diego, CA) with help from the NIAS genome analysis sup- and separated them into two groups. While these reports port program to generate genotyping reports. Scores gener- provide valuable information for the organization of genetic ated by the SNP signal calling system software were used to resources and the improvement of breeding, the origin of validate SNP genotyping for each combination of DNA satsuma mandarins is still uncertain. sample and SNP according to the manufacturer’s description. Recently, Fujii et al. (2013) developed a 384 single nucleotide polymorphism (SNP) genotyping array using Data analysis for putative parent–offspring relationships Illumina’s GoldenGate assay system to genotype a hybrid by MARCO population of 88 progenies and 103 citrus accessions for Putative parent–offspring relationships were calculated Japanese breeding purposes. This is a useful tool to evaluate using the parent calculation program MARCO (Fujii et al. parentage because many of these markers have been 2010). MARCO detects possible parents from among the mapped onto a citrus framework genetic map (Shimada et genotypes in a pair of varieties. Genotypes were considered al. 2014) and provide a highly accurate diagnosis. Addition- to have a parent–offspring relationship if they shared at least ally, most SNPs derive from expression sequenced tags and one allele per SNP locus, with the exception that a discrep- are linked to the clementine genome sequence, which pro- ancy at a single SNP locus was permitted for possible geno- vides functional annotation and position information of typing errors, or the presence of null alleles or mutation, as clementine scaffolds ver.1.0. In an earlier study, these au- previously proposed (Boursiquot et al. 2009, Cipriani et al.

2 Breeding Science Parentage of satsuma mandarin (Citrus unshiu Marc.) Preview BS Table 1. Cultivars and strains genotyed by 206 SNP markers Common Conser- No. Plant namea Cultivar/Accession namea JP No.a Scientific nemea Origina genotyes vationb in all SNPsc 1 Sour orange Kabusu, Shiutou, Daidai 117365 C. aurantium L. Japan (Unknown) O 2 Mediterranean mandarin Chichukai mandarin, 117393 C. deliciosa Tenore China O Mediterranean mandarin, Willow Leaf Mandarin 3 Shaddock, Pummelo Hirado buntan 171507 C. grandis (L.) Osbeck Japan (Nagasaki) O 4 Shaddock, Pummelo Tanigawa buntan 117433 C. grandis Osbeck var. tanikawana hort. ex Tanaka Japan (Shizuoka) O 5 Juzu, Yuzud Yuzu 117380 C. junos Siebold hort. ex Tanaka Foreign (Unkown) O 6 Juzu, Yuzud Tadanishiki (Yuzu)d 113187 C. junos Siebold hort. ex Tanaka Japan (Tokushima) O 7 Kinokuni Kishuu mikan 171490 C. kinokuni hort. ex Tanaka China O 1 8 Kinokuni Sakurajima komikan 117495 C. kinokuni hort. ex Tanaka Japan (Kagoshima) O 1 9 Kinokuni Hirakishiu 117398 C. kinokuni hort. ex Tanaka Japan (Unknown) O 1 10 Kinokuni Kishuumikan-Iharaichijouji 117948 C. kinokuni hort. ex Tanaka Japan (Shizuoka) O 1 11 Kinokuni Mukaku kishiu 117399 C. kinokuni hort. ex Tanaka Japan (Unknown) O 1 12 Kinokuni Taka mikan 113181 C. kinokuni hort. ex Tanaka Japan (Wakayama) O 1 13 Kinokuni Nan-fen-mi-jie, Nanfengmijud 117731 C. kinokuni hort. ex Tanaka China O 1 14 Kinokuni Zao ju, Soukitsu, Zaojud 117400 C. kinokuni hort. ex Tanaka var. subcompressa hort. ex China O Tanaka 15 Calamondin Shikikitsu, Calamondin, 117409 C. madurensis Lour. China O Toukinkan 16 King orange, King mandarin 117386 C. nobilis Lour. USA O King mandarind 17 King orange, Kunenbod Kunenibo 117387 C. nobilis Lour. var. kunip Tanaka Foreign (Unkown) O 2 18 King orange, Kunenbod Kunenbo-Kagoshima 247450 C. nobilis Lour. var. kunip Tanaka Japan (Kagoshima) O 2 19 King orenge, Kunenbod Kunenbo-Kamikoshikijima 117950 C. nobilis Lour. var. kunip Tanaka Japan (Kagoshima) O 2 20 Binkitsu Binkitsu 113168 C. platymamma hort. ex Tanaka China O 21 Grapefruit Duncan grapefruit 168864 C. paradis Macfad. USA O 3 22 Grapefruit Triumph grapefruit 113255 C. paradis Macfad. USA K 3 23 Ponkan Ponkan F2428 113176 C. reticulata Blanco Taiwan O 4 24 Ponkan Ideyu (ponkan)d 113179 C. reticulata Blanco Japan (Shizuoka) O 4 25 Sweet orange Trovita orange 172154 C. sinensis (L.) Osbeck USA O 26 New Summer orange Hyuganatsu, Konatsu 117317 C. tamurana hort. ex Tanaka Japan (Miyazaki) O 27 Japnanese mandarin, Miyagawa-wase 117351 C. unshiu Marcov. var. praecox Tanaka, C. unshiu Japan (Fukuoka) O Satsuma, Marcov.d Satsuma mandarind 28 Citrus Hyoukan 113365 Citrus ampullacea hort. ex Tanaka Japan (Unknown) O 29 Citrus Kawabata 113344 C. aurea hort. ex Tanala Japan (Kagoshima) O 30 Citrus Shiikuwasha 117406 C. depressa Hayata Japan (Okinawa) O 31 Citrus Kobeni mikan, Chu Sha Chu 117397 C. erythrosa hort. ex Tanaka China O 32 Citrus Funadoko 117372 C. funadoko hort. ex Yu. Tanaka Japan (Kouchi) O 33 Citrus Genshokan 113159 C. genshokan hort. ex Tanaka China O 34 Citrus Kinukawa 117278 C. glaberima hort. ex Tanaka Japan (Okayama) O 35 Citrus Hassaku 117286 C. hassaku hort. ex Tanaka Japan (Hiroshima) O 36 Citrus Yamamikan 117359 C. intermedia hort. ex Tanaka Japan (Miyazaki) O 37 Citrus Iyo, Iyokan, Miyauchi iyokand 117373 C. iyo hort. ex Tanaka Japan (Yamaguchi) O 5 38 Citrus Iyo, Iyokan, Ootani iyokand 115518 C. iyo hort. ex Tanaka Japan (Ehime) O 5 39 Citrus Kabuchi 117390 C. keraji hort. ex Tanaka var. kabuchii hort. ex Tanaka Japan (Okayama) O 40 Citrus Keraji 117389 C. keraji hort. ex Tanaka Japan (Kagoshima) K 41 Citrus Kouji 113156 C. leiocarpa hort. ex Tanaka Japan (Unknown) O 42 Citrus Kabosu 117381 C. shaerocarpa hort. ex Tanaka Japan (Ooita) O 43 Citrus Ben di zao, Bendizaod 116116 C. succosa hort. ex Tanaka China O 44 Citrus Sudachi 117383 C. sudachi hort. ex Shirai Japan (Tokushima) O 45 Citrus Shikaikan 113165 C. suhuiensis hort. ex Tanaka China O 46 Citrus Sanboukan 117315 C. sulcata hort. ex I.Takah. Japan (Wakayama) O 47 Citrus Nian jie, Nianjud 116117 C. sunki (Hayata) hort. ex Tanaka China O 48 Citrus Sunan ju, Sankitsu, Sunki, 117403 C. sunki (Hayata) hort. ex Tanaka China O Suanjud 49 Citrus Tachibana 117405 C. tachibana (Makino) Tanaka Japan (Uknown) O 50 Citrus Tachibana-Ishinami No.1 117880 C. tachibana (Makino) Tanaka Japan (Ishinami) O 6 51 Citrus Tachibana-Toshashi 209687 C. tachibana (Makino) Tanaka Japan (Tosashi) O 6 52 Citrus Oobenimikan 117395 C. tangerina hort. ex Tanaka India O 7 53 Citrus Dancy tangerine, Dancy 117396 C. tangerina hort. ex Tanaka Foreign (Unkown) O 7 54 Citrus Ujukitsu 115519 C. ujyukitsu hort. ex Tanaka Japan (Unknown) O 55 Citrus Yuukunibu 113383 C. yanbaruensis Tanaka Japan (Okinawa) O 56 Citrus Yatsuhiro 117388 C. yatsushiro hort. ex Tanaka Japan (Unknown) O 57 Clementin, Hybridd Clementine 113161 C. clementina hort. ex Tanaka, Mediterranean mandarin Algeria O (C. deliciosa Tenore) × Sweet orange (C. sinensis (L.) Osbeck)de 58 Hybrid Encore mandarin 117421 C. sp., King mandarin (C. nobilis Lour.) × Mediterranean USA O mandarin (C. deliciosa Tenore)d 59 Hybrid Kara 113158 C. sp., Satsuma mandarin (C. unshiu Marc.) × King USA mandarin (C. nobilis Lour.)d 60 Hybrid Kiyomi 115521 C. sinensis × C. reticulata, (Satsuma mandarin (C. unshiu Japan (Shizuoka) O Marc.) × Sweet orange (C. sinensis (L.) Osbeck)d 61 Hybrid Minneola 113377 C. tangerina × C. grandis, Duncan grapfruit (C. paradis USA O Macf.) × Dancy tangerine (C. tangerina v. Dancy)d 62 Hybrid Orlando 113327 C. tangerina × C. grandis, Duncan grapfruit (C. paradis USA O Macf.) × Dancy tangerine (C. tangerina v. Dancy)d 63 Hybrid Seminole 113348 C. tangerina × C. grandis, Duncan grapfruit (C. paradis USA O Macf.) × Dancy tangerine (C. tangerina v. Dancy)d 64 Hybrid Wilking mandarin 117425 C. sp., King mandarin (C. nobilis Lour.) × Mediterranean USA K mandarin (C. deliciosa Tenore)d 65 Hybrid Murcott 113374 C. retuculata Blanco × C. sinensis (L.) Osbeck USA O 66 Hybrid Bendi guangju, Bendiguangjud 113459 C. sp. China O 2 67 Hybrid Baka mikan 117473 C. sp. Japan (Shizuoka) O a Discription by NIAS Genebank (http://www.gene.affrc.go.jp/databases-plant_search.php). b O: Okitsu Research Station of NIFTS, K: Kuchinotsu Research Station of NIFTS. c The same number shows that the genotype in all SNPs is the same. d Author complemented. e Ollitrault et al. 2012.

3 Breeding Science BS Preview Fujii, Ohta, Nonaka, Katayose, Matsumoto, Endo, Yoshioka, Omura and Shimada Table 2. Primer sequence used for PCR amplification of 4 coding and ex Tanaka) [37][38], and tachibana (Citrus tachibana non-coding regions in cpDNA (Makino) Tanaka) [49][50][51], were genotyped for 206 Primer Sequence (5′-3′) Refference SNPs by the GoldenGate Assay. trnT(a)-F CATTACAAATGCGATGCTCT Taberlet et al. 1991 Seven lines of Kinokuni mandarins (‘Kishuu mikan’ [7], trnL(b)-R TCTACCGATTTCGCCATATC ‘Sakurajima komikan’ [8], ‘Hira-kishiu’ [9], ‘Kishuumikan- trnL(e)-F GGTTCAAGTCCCTCTATCCC Taberlet et al. 1991 Iharaichijyoji’ [10], ‘Mukaku kishiu’ [11], ‘Taka mikan’ TrnF(f)-R ATI′TGAACTGGTGACACGAG rbcL-F TTGGCAGCATTCCGAGTAA Cipriani and Morgante 1993 [12], ‘Nanfengmiju’ [13]) except ‘Zaoju’ [14], three lines of rbcL-R TGTCCTAAAGTTCCTCCAC Kunenbo mandarins (‘Kunenbo’ [17], ‘Kunenbo-Kagoshima’ matK-F CCGAAATCTTGGTTCAAA Penjor et al. 2013 [18] and ‘Kunenbo-Kamikoshikijima’ [19]), two lines of matK-R GATGCCCTAATGCGTTAC grapefruit (‘Duncan’ [21] and ‘Triumph’ [22]), two lines of Ponkan mandarins (F2428 [23] and ‘Ideyu’ [24]) and two 2010, Di Vecchi-Staraz et al. 2007, Lacombe et al. 2013). lines of iyokan (‘Miyauchi’ [37] and ‘Otanni’ [38]), were Among 384 SNPs, 206 were chosen as reliable for genotyp- found to have identical genotypes for all 206 SNPs (Supple- ing according to previously reported criteria (Fujii et al. mental Table 1). This suggests that they are synonyms, orig- 2013). A database of genotypes for 206 SNPs in 67 citrus inate from nucellar seedlings, or are bud sport derivatives. varieties and lines was constructed (Supplemental Table 1). All genotypes were shared between Bendiguangju’ Genotypes with a discrepancy at none of the 206 SNPs were (C. sp) [66] and the ‘Kunenbo’ mandarin (C. nobilis Lour. considered to represent putative parent–offspring pairs var. kunip Tanaka) [17][18][19], as well as, between Oobeni (comprising one parent and one offspring) or trios (compris- mikan (C. tangerina hort. ex Tanaka) [52] and Dancy tanger ing two parents and one offspring). ine (C. tangerina hort. ex Tanaka) [53]. These varieties are therefore also expected to be synonyms or spontaneously CAPS analysis using four coding and noncoding regions occurring derivatives. By contrast, lines of tachibana and in cpDNA yuzu showed different genotypes. Three tachibana lines The noncoding region between trnL and trnF (trnL- [49][50][51] were subdivided into two groups by 11 SNP trnF), the noncoding region between trnT and trnL (trnT- genotypes, and the genotypes of three SNPs differed among trnL), and coding regions rbcL and matK were PCR- two yuzu lines [5][6]. Thus, a total of 53 independent geno- amplified using primer sets described in the reports of types were detected among the 67 citrus varieties and lines Taberlet et al. (1991), Cipriani and Morgante (1993), and examined. In a previous study (Fujii et al. 2013), four satsuma Penjor et al. (2013), and listed in Table 2. Amplification mandarins, ‘Miyagawa-wase’ [27], ‘Okitsu-wase’, ‘Kawada was performed in a total volume of 12.5 µl containing 10 pg unshiu’ and ‘Imamura unshiu’, were confirmed to share the genomic DNA, 2.5 pmol of each primer, 2.5 mM dNTPs, same SNP genotypes, but there was no identical genotype 5 mM MgCl2, 0.2 U of AmpliTaq Gold DNA polymerase with satsuma mandarin of ‘Miyagawa-wase’ [27] in the ex- (Applied Biosystems, Foster City, CA), and PCR buffer. amined citrus species of this study. PCR was carried out using an ABI 9700 thermal cycler (Applied Biosystems) under the following conditions: pre- Parent–offspring relationship estimated by MARCO liminary denaturation for 10 min at 94.5°C; 35 cycles of 40 s Parental diagnosis was carried out for the 53 citrus varie- at 94°C, 1 min at 52–62°C, and 2 min at 72°C; and an addi- ties and lines with independent genotypes using MARCO tional extension of 7 min at 72°C. PCR products were elec- computer software. The 206 SNP loci were covered on cit- trophoresed on a 1.5% agarose gel in TAE buffer and the rus major scaffold_01 to 09 of the clementine genome se- fragment pattern was visualized under UV light by ethidium quence that corresponded to the reference linkage map bromide staining. For the detection of restriction site poly- (Shimada et al. 2014) (Supplemental Table 2). Eight varie- morphisms, PCR products were subjected to digestion using ties of citrus had origin information for the parent–offspring 16 restriction enzymes: MspI, HaeIII, HincII, RsaI, PvuII, relationship from previous research (Cameron et al. 1965, StyI, HinfI, MulI, EcoRI, EcoRV, HhaI, Mbo I (NdeII), Frost 1935, Hodgson 1967, Nishiura et al. 1983, Olitrault et DraI, XbaI, HindIII, and BamHI. al. 2012) (Table 3). There was no discrepancy in parent– offspring diagnosis in 8 combinations for the set of 206 SNP Results genotypes, including offspring ‘Kiyomi’ [60] derived from the parent pair of a satsuma mandarin ‘Miyagawa wase’ SNP genotyping related to satsuma mandarin derivation (C. unshiu Marc) [27] and sweet orange ‘Trovita’ (Citrus A total of 67 citrus varieties and lines, including yuzu sinensis (L.) Osbeck) [25]. The clementine mandarin [57] (Citrus junos Siebold hort. ex Tanaka) [5 (refer Table 1)] had previously been shown to derive from a cross between [6], Kinokuni mandarins (Citrus kinokuni hort. ex Tanaka) the Mediterranean mandarin (Citrus deliciosa Tenore) [2] [7][8][9][10][11][12][13][14], Kunenbo mandarins (Citrus and sweet orange [25] from comparative mapping analysis nobilis Lour. var. kunip Tanaka) [17][18][19], grapefruit (Ollitrault et al. 2012). MARCO confirmed this parent– (Citrus paradisi Macfad.) [21][22], Ponkan mandarins offspring relationship based on genotyping data from the (Citrus reticulata Blanco) [23][24], iyokan (Citrus iyo hort. 206 validated SNPs. These data were also used to calculate

4 Breeding Science Parentage of satsuma mandarin (Citrus unshiu Marc.) Preview BS Table 3. 8 citrus varieties with the information on parent–offspring relationship Cultivar/ No.a Combination of parents Refference Accession namea 57 Clementine Mediterranean mandarin (C. deliciosa Tenore) [2] × Sweet orange (C. sinensis (L.) Osbeck) [25] Ollitrault et al. 2012 58 Encore King mandarin (C. nobilis Lour.) [16] × Mediterranean mandarin (C. deliciosa Tenore) [2] Cameron et al. 1965 59 Kara Satsuma mandarin ‘Owari’ (C. unshiu Marc.) [27] × King mandarin [16] Frost 1935 60 Kiyomi Satsuma mandarin ‘Miyagawa-wase’ (C. unshiu Marc.) [27] × Sweet orange ‘Trovita’ Nishiura et al. 1983 (C. sinensis (L.) Osbeck) [25] 61 Minneora Grapfruit ‘Duncan’ (C. paradis Macf.) [21] × Dancy tangerine (C. tangerina v. Dancy) [53] Hodgson 1967 62 Orlando Grapfruit ‘Duncan’ (C. paradis Macf.) [21] × Dancy tangerine (C. tangerina v. Dancy) [53] Hodgson 1967 63 Seminole Grapfruit ‘Duncan’ (C. paradis Macf.) [21] × Dancy tangerine (C. tangerina v. Dancy) [53] Hodgson 1967 64 Wilking King mandarin (C. nobilis Lour.) [16] × Mediterranean mandarin (C. deliciosa Tenore) [2] Frost 1935 a See Table 1.

Table 4. Parent–offspring relationships newly estimated by MARCO based on 206 SNP genotypes No.a Cultivar/Accession namea Candidate combination of parent varietiesb (No. × No.)a 27 Satsuma mandarin ‘Miyagawa-wase’ Kishuu mikan (C. kinokuni hort ex. Tanaka) [7] × Kunenbo (C. nobilis Lour. var. kunip Tanaka) [17] 14 Zaoju Kishuu mikan (C. kinokuni hort ex. Tanaka) [7] × Kobeni mikan (C. erythrosa hort. ex Tanaka) [31] 39 Kabuchi Kunenbo (C. nobilis Lour. var. kunip Tanaka) [17] × Yatsushiro (C. yatsushiro hort. ex Tanaka) [56] 40 Keraji Kunenbo (C. nobilis Lour. var. kunip Tanaka) [17] × Kabuchi (C. keraji hort. ex Tanaka var. kabuchii hort. ex Tanaka) [39] 67 Bakamikan Kunenbo (C. nobilis Lour. var. kunip Tanaka) [17] × Tachibana-Ishinami No.1 (C. tachibana (Makino) Tanaka) [50] a See Table 1. b It is unclear which variety is seed parent or pollen parent. parent–offspring relationships for the remaining six varie- ent from two parent varieties, the four coding and noncod- ties of citrus. ing regions in cpDNA were amplified using sequence-tagged Among the 53 varieties, MARCO also confirmed five sites (STS) primers from 12 varieties as follows: seven new potential parent–offspring relationships based on the ‘Kishuu mikan’ type mandarins (C. kinokuni hort. ex genotyping data, as summarized in Table 4. ‘Miyagawa Tanaka) of ‘Kishuu mikan’ [7], ‘Sakurajima komikan’ [8], wase’ [27], a typical cultivar of the satsuma mandarin, was ‘Hirakishiu’ [9], ‘Kishuumikan-Iharaichijyouji’ [10], possibly derived from a cross between ‘Kishuu mikan’ [7] ‘Mukaku kishiu’ [11], ‘Taka mikan’ [12] and ‘Nanfengmiju’ and ‘Kunenbo’ mandarins [17], ‘Zaoju’ (C. kinokuni hort. [13], and four ‘Kunenbo’ type mandarins of ‘Kunenbo’ [17], ex Tanaka var. subcompressa hort. ex Tanaka) [14] from ‘Kunenbo-Kagoshima’ [18], ‘Kunenbo-Kamikoshikijima’ ‘Kishuu mikan’ [7] and ‘Kobeni mikan’ (Citrus erythrosa [19], ‘Bendiguangju’ [66], and ‘Miyagawa wase’ [27]. The hort. ex Tanaka) [31], ‘Kabuchi’ (C. keraji hort. ex Tanaka approximate amplified fragment sizes of trnT-trnL, trnL- var. kabuchii hort. ex Tanaka) [39] from a cross between trnF, rbcL, and matK are 1.1 kbs, 500 bps, 1.1 kbs, and ‘Kunenbo’ [17] and ‘Yatsushiro’ (Citrus yatsushiro hort. 800 bps, respectively (Fig. 1A). All fragment sizes were ex Tanaka) [56], ‘Keraji’ [40] from ‘Kunenbo’ [17] and identical among the 12 varieties. ‘Kabuchi’ [39] and ‘Bakamikan’ (C. sp) [67] from CAPS analysis was carried out for these four amplified ‘Kunenbo’ [17] and ‘Tachibana-Ishinami No.1’ (C. tachibana regions using 16 restriction enzymes (Fig. 1B). In the trnT- (Makino) Tanaka) [50]. Interestingly, four parent–offspring trnL region, the Rsa I restriction site of ‘Kunenbo’ type relationship among the five newly suggested involved mandarins varied compared with those of ‘Miyagawa wase’ ‘Kunenbo’ [17] as a parent. This suggests that citrus germ [27], and ‘Kishuu mikan’ type mandarins [7][8][9][10][11] plasm might be derived from combination of relatively [12][13]. In the trnL-trnF region, the Mbo I (NdeII) restric- small number of ancestors, and ‘Kunenbo’ [17] is one of tion site of ‘Kunenbo’ type mandarins [17][18][19][66] important ones. varied in comparison with those of other varieties. In the rbcL region, Rsa I and Hha I restriction sites of ‘Kunenbo’ Analysis of the cpDNA polymorphism by CAPS type mandarins [17][18][19][66] differed from those of Parental diagnosis by MARCO indicated that the satsuma others. The Hinf I restriction site of ‘Kunenbo’ type manda- mandarin was possibly derived from a cross between the rins [17][18][19][66] varied in comparison with others in ‘Kishuu mikan’ [7][8][9][10][11][12][13] and ‘Kunenbo’ the matK region. Any polymorphism was not detected in the types of mandarin [17][18][19][66]. To assign the seed par- four regions of cpDNA by the remaining restriction enzymes.

5 Breeding Science BS Preview Fujii, Ohta, Nonaka, Katayose, Matsumoto, Endo, Yoshioka, Omura and Shimada

Fig. 1. PCR products of trnT-trnL, trnL-trnF, rbcL, and matK regions in cpDNA (A) and CAPS patterns (B). M: 200base DNA ladder of size marker, 1: ‘Mukaku kishiu’ [11]; 2: ‘Kishuu mikan’ [7]; 3: ‘Hira kishiu’ [9]; 4: ‘Sakurajima komikan’ [8]; 5: ‘Kishuu mikan-Iharaichijyouji’ [10]; 6: ‘Taka mikan’ [12]; 7: ‘Nanfengmiju’ [13]; 8: ‘Kunenbo’ [17]; 9: ‘Kunenbo-Kagoshima’ [18]; 10: ‘Kunenbo-Kamikoshikijima’ [19]; 11: ‘Bendiguangju’ [66]; 12: Satsuma mandarin (‘Miyagawa wase’) [27]. ‘Kyshuu mikan’ type mandarins including ‘Nanfengmiju’ [13] are lane 1–7 and ‘Kunenbo’ type mandarins including ‘Bendiguangju’ [66] are lane 8–11. Posithions of size markers are indicate (Kb, kilobase pairs) on the left side.

Identical genotypes were observed within ‘Kishuu mikan’ interspecific regions in cpDNA. They found that the cpDNA [7][8][9][10][11][12][13] and within ‘Kunenbo’ type man- genotype of the satsuma mandarin was similar to those of darins [17][18][19][66]. two lines of ‘Nanfengmiju’ sampled in Jiangxi and Guangxi Penjor et al. (2013) previously sequenced the chloroplast in China, ‘Sakurajima komikan’, but was different to that of matK gene of 135 citrus accessions and found that the geno- ‘Kunenbo’. In a study by Li et al. (2006), the cpDNA genotype of the satsuma mandarin was identical to that of type of ‘Bendiguangju’ was shown to be different from that ‘Kinokuni’ (C. kinokuni hort. ex Tanaka) and ‘Mukaku of the satsuma mandarin and ‘Nanfengmiju’. These results kishu’ mandarins but differed from that of ‘Kunenbo’ man- are in agreement with our own, indicating that the cpDNA darins. Yamamoto et al. (2013) evaluated the genetic diver- genotype of the satsuma mandarin is identical to that of sity of 97 citrus varieties including local accessions from ‘Kishuu mikan’ type mandarins. Japan, China, and Indonesia by the CAPS analysis of three

6 Breeding Science Parentage of satsuma mandarin (Citrus unshiu Marc.) Preview BS Discussion clear, but origin histories suggest that ‘Nanfengmiju’ was the origin of ‘Kishuu mikan’ type mandarins or a synonym. Parentage diagnosis by MARCO based on 206 SNP geno- ‘Kunenbo’ mandarins were introduced from Southeast types and CAPS genotypes of cpDNA indicated that the Asia through the Ryukyu islands, and probably were the or- seed parent of the satsuma mandarin is likely to be either of igin of many local citrus fruits on these islands (Yamamoto the ‘Kishuu mikan’ type mandarins [7][8][9][10][11][12] 2014). ‘Keraji’, ‘Kabuchii’, and ‘Oto’ (C. oto hort. ex Yu. [13], while the pollen parent is likely to be either of the Tanaka) appear to be closely related to ‘Kunenbo’ manda- ‘Kunenbo’ type mandarins [17][18][19][66]. Together with rins according to isozyme and DNA analyses (Yamamoto ‘Mukaku kishiu’, the satsuma mandarin has been used as a et al. 2011). Moreover, the cpDNA type of ‘Keraji’, source of seedless fruits in citrus breeding in Japan. How ‘Kabuchii’, ‘Tarogayo’ (C. tarogayo hort. ex Tanaka), and ever, seedlessness occurs through physiologically different ‘Oto’ is the same as that of ‘Kunenbo’ mandarins. These re- mechanisms between ‘Mukaku kishiu’ and the satsuma sults agree with the parental diagnosis by MARCO that the mandarin. ‘Mukaku kishiu’ is a seedless variety derived ‘Kunenbo’ mandarin [17] is the parent variety of ‘Kabuchi’ from a mutant of the native seeded variety ‘Kishuu mikan’. [39] and ‘Keraji’ [40]. ‘Bendiguangju’ mandarins are Its seedlessness is caused by an arrest in seed development thought to have been introduced to Japan from China by a at an early stage (Yamasaki and Kitajima 2007). By con- Japanese envoy during the Tang dynasty (Xu 1997). These trast, the seedlessness of the satsuma mandarin is mainly origin histories support the possibility that ‘Bendiguangju’ caused by cytoplasmic male sterility through pollen degra- and ‘Kunenbo’ derive from the same progenitor individual dation (Nesumi et al. 1997) combined with unidentified of ‘Kunenbo’ type mandarins, which agrees with their iden- nuclear factors that reduce the seed number. Genetic loci tical SNP and CAPS genotypes. controlling the seedlessness of ‘Mukaku kishu’ and anther Several hypotheses exist for the origin of satsuma man- development of the satsuma mandarin have previously been darins based on morphological features. Ogaki (1979) sup- characterized by linkage analysis. The seedless locus of posed that they were chance seedlings from mandarins ‘Mukaku kishu’ was mapped near Vs0015 and Edp005 in originating in China such as ‘Bendizao’, ‘Zaoju’, and linkage group 9 (LG-09) of the AGI map (Shimada et al. ‘Manju’, while Xu (1997) proposed that ‘Bendiguangju’ 2014). The anther development locus (AD1) related to the was the original variety of the satsuma mandarin. Our SNP satsuma mandarin regulating male sterility recessively was genotyping indicates that ‘Bendizao’ [43] and ‘Zaoju’ [14] found to be located near to the STS marker STS-D67-AD1 would never generate the satsuma mandarin [27] genotype on linkage group 8 of the ‘Kiyomi’ × ‘Okitsu 41’ population when hybridized with any other citrus variety genotype in- (Nakano et al. 2003), which showed linkage map co-linearity vestigated. Although ‘Bendiguangju’ [66] was one of the with LG-08 of the AGI map. Moreover, a quantitative trait candidate pollen varieties, it does not appear likely to be an locus influencing fewer seed number derived from the original variety of satsuma mandarin as a polyembryonic ‘Miyagawa wase’ satsuma mandarin was located on LG-06 derivative or synonym. (Omura et al. 2003). This makes ‘Mukaku kishiu’ a less In conclusion, the satsuma mandarin appears to derive likely candidate for the seed parent of the satsuma manda- from an occasional cross between the seed parent of the rin, taking into consideration the inheritance of seedlessness ‘Kishuu mikan’ type mandarins [7][8][9][10][11][12] (de- from ‘Mukaku kishiu’. rivative or synonym of ‘Nanfengmiju’ [13]) and the pollen In the GoldenGate assay of the present study, discrimina- parent of the ‘Kunenbo’ type mandarins [17][18][19] (deriv- tion within ‘Kunenbo’ type mandarins [17][18][19][66] as ative or synonym of ‘Bendiguangju’ [66]). Information well as within ‘Kishuu mikan’ type mandarins [7][8][9][10] about the parentage of the satsuma mandarin will further [11][12][13] was not possible. Polymorphic differences our understanding of citrus phylogeny, and help the produc- within the satsuma mandarin varieties are generally limited tion of a superior variety of satsuma mandarin by the cross in DNA markers because most varieties arose from sponta- hybridization of putative parents. Further research by com- neous mutations during bud, limb, and nucellar embryogen- prehensive genome-wide genotyping using resequencing esis. Indeed, an assessment of phylogenetic diversity in will be required to clarify the phylogenetic relationship be- Citrus species by SSR, using highly polymorphic and repro- tween ‘Kishuu mikan’ type mandarins [7][8][9][10][11][12] ducible co-dominant markers, also showed that satsuma and ‘Nanfengmiju’ [13], as well as ‘Kunenbo’ type manda- mandarin varieties have a uniform genetic background rins [17][18][19] and ‘Bendiguangju’ [66]. (Golein et al. 2012). The ‘Kishuu mikan’ mandarin is said to be a very old Acknowledgments species of Chinese origin and one of the earliest introduced into Japan (Hodgson 1967) where it was commercially culti- This work was partially supported by a grant from the vated during the Edo period. ‘Nanfengmiju’ is a major varie- Ministry of Agriculture, Forestry, and Fisheries of Japan ty cultivated in Jiangxi Province in China, which has several (Genomics-based Technology for Agricultural Improve- different lines that vary in seed number and fruit size. The ment, HOR-2003, DNA-marker breeding project) and the level of genetic diversity among ‘Nanfengmiju’ lines is un- genome analysis support program of NIAS.

7 Breeding Science BS Preview Fujii, Ohta, Nonaka, Katayose, Matsumoto, Endo, Yoshioka, Omura and Shimada Literature Cited analysis of natural citrus hybrid ‘Zhelong Zhoupigan’ based on nuclear and chloroplast SSR markers. Sci. Hort. 186: 24–30. Boursiquot, J.M., T. Lacombe, V. Laucou, S. Julliard, F.X. Perrin, N. Li, Y.Z., Y.J. Cheng, H.L. Yi and X.X. Deng (2006) Genetic diversity in Lanier, D. Legrand, C. Meredith and P. This (2009) Parentage of mandarin landraces and wild mandarins from China based on nu- Merlot and related winegrape cultivars of southwestern France: clear and chloroplast simple sequence repeat markers. J. Hortic. discovery of the missing link. Aust. J. Grape Wine Res. 15: 144– Sci. Biotechnol. 81: 371–378. 155. Matsuyama, M., R. Motohashi, T. Akihama and M. Omura (1992) DNA Cameron, J.W., R.K. Soost and H.B. Frost (1965) Encore and Pixie— fingerprinting in citrus cultivars. Breed. Sci. 42: 155–159. two new mandarin hybrids with unusually late seasons of use. Nakano, M., H. Nesumi, T. Yoshioka, M. Omura and T. Yoshida (2003) Calif. Agr. Exp. Sta. Bul. 814: 8 pp. Linkage analysis between male sterility of citrus and STS markers. Cheng, Y., M. Carmen de Vicente, H. Meng, W. Guo, N. Tao and X. Proc. Intl. Soc. Citricult. IX Congr. 2000: 179–180. Deng (2005) A set of primers for analyzing chloroplast DNA diver- Nesumi, H., M. Nakano, T. Yoshida, T. Yoshioka and Y. Ito (1997) Effect sity in Citrus and related genera. Tree Physiol. 25: 661–672. of plasmon on segregation of male sterile traits in citrus. J. Japan. Cipriani, G. and M. Morgante (1993) Evidence of chloroplast DNA Soc. Hort. Sci. 66 (Suppl. 2): 164–165. variation in the genus Actinidia revealed by restriction analysis of Ninomiya, T., T. Shimada, T. Endo, K. Nonaka, M. Omura and H. Fujii PCR amplified fragments. J. Genet. Breed. 47: 319–326. (2015) Development of citrus cultivar identification by CAPS Cipriani, G., M.T. Marrazzo and E. Peterlunger (2010) Molecular char- markers and parentage analysis. Hort. Res. 14: 127–133. acterization of the autochthonous grape cultivars of the region Nishio, S., H. Iketani, H. Fujii, T. Yamamoto, S. Terakami, N. Takada Friuli Venezia Giulia—North-Eastern Italy. Vitis 49: 29–38. and T. Saito (2014) Use of population structure and parentage anal- Coletta Filho, H.D., M.A. Machado, M.L.P.N. Targon, M.C.P.Q.D.G. yses to elucidate the spread of native cultivars of Japanese chest- Moreira and J. Pompeu Jr. (1998) Analysis of the genetic diversity nut. Tree Genet. Genomes 10: 1171–1180. among mandarins (Citrus spp.) using RAPD markers. Euphytica Nishiura, M., T. Shichijo, I. Ueno, M. Iwamasa, T. Kihara, Y. Yamada, 102: 133–139. T. Yoshida and T. Iwasaki (1983) New citrus cultivar ‘Kiyomi’ Curk, F., F. Ollitrault, A. Garcia-Lor, F. Luro, L. Navarro and P. Ollitrault Tangor. Bull. Fruit Tree Res. Stn. B 10: 1–9. (2016) Phylogenetic origin of limes and lemons revealed by cyto- Ogaki, T. (1979) Chinese citrus, Chapter 1. In: Kondo, Y. and T. Ogaki plasmic and nuclear markers. Ann. Bot. 117: 565–583. (eds.) Chinese citrus. Sanbi Press, pp. 9–31. Dellaporta, S.L., J. Wood and J.B. Hicks (1983) A plant DNA mini- Ollitrault, P., C. Jacquemond, C. Dubois and F. Luro (2003) Citrus. In: preparation. Version II. Plant Mol. Biol. Rep. 1: 19–21. Hamon, P., M. Seguin, X. Perrier and J.C. Glaszmann (eds.) Genetic Di Vecchi-Staraz, M., R. Bandinelli, M. Boselli, P. This, J.M. Boursiquot, diversity of cultivated tropical plants. CIRAD, Montpellier, 193– V. Laucou, T. Lacombe and D. Vares (2007) Genetic structuring and 217. parentage analysis for evolutionary studies in grapevine: kin group Ollitrault, P., J. Terol, C. Chen, C.T. Federici, S. Lotfy, I. Hippolyte, and origin of the cultivar Sangiovese revealed. J. Am. Soc. Hortic. F. Ollitrault, A. Berard, A. Chauveau, J. Cuenc et al. (2012) A refer- Sci. 132: 514–524. ence genetic map of C. clementina hort. ex Tan.; citrus evolution Frost, H.B. (1935) Four new citrus varieties—the Kara, Kinnow and inferences from comparative mapping. BMC Genomics 13: 593. Wilking mandarins and Trovita orange. Calif. Agr. Exp. Sta. Bul. Omura, M., T. Ueda, T. Shimada, T. Endo, H. Fujii, H. Nesumi and 597: 14 pp. T. Yoshida (2003) Graphical genotype of citrus cultivars by co- Fujii, H., H. Yamashita, F. Hosaka, S. Terakami and T. Yamamoto dominant CAPS markers. Abst. Plant & Animal genome XI Con- (2010) Development of a software to presume the parent-child ference p.22. January 11–15, San Diego, CA. relationship using the result of DNA marker typing. J. Japan. Soc. Penjor, T., M. Yamamoto, M. Uehara, M. Ide, N. Matsumoto, R. Hort. Sci. abst. 9: 34. Matsumoto and Y. Nagano (2013) Phylogenetic relationships of Fujii, H., T. Shimada, K. Nonaka, M. Kita, T. Kuniga, T. Endo, Y. Ikoma Citrus and its relatives based on matK gene sequences. PLoS ONE and M. Omura (2013) High-throughput genotyping in citrus acces- 8: e62574. sions using an SNP genotyping array. Tree Genet. Genomes 9: Shimada, T., H. Fujii, T. Endo, T. Ueda, A. Sugiyama, M. Nakano, 145–153. M. Kita, T. Yoshioka, T. Shimizu, H. Nesumi et al. (2014) Construc- Golein, B., M. Nazeryan and B. Babakhani (2012) Assessing genetic tion of a citrus framework genetic map anchored by 708 gene- variability in male sterile and low fertile citrus cultivars utilizing based markers. Tree Genet. Genomes 10: 1001–1013. simple sequence repeat markers (SSRs). Afr. J. Biotechnol. 11: Sugawara, K., T. Wakizuka, A. Oowada, T. Moriguchi and M. Omura 1632–1638. (2002) Histogenic identification by RAPD analysis of leaves and Gulsen, O. and M.L. Roose (2001) Chloroplast and nuclear genome fruit of newly synthesized chimeric citrus. J. Am. Soc. Hortic. Sci. analysis of the parentage of lemons. J. Am. Soc. Hortic. Sci. 126: 127: 104–107. 210–215. Taberlet, P., L. Giely, G. Pautou and J. Bouvet (1991) Universal primers Hodgson, R.W. (1967) Horticultural Varieties of Citrus, Chapter 4. In: for amplification of three non-coding regions of chloroplast DNA. Reuther, W., H.J. Webber and L.D. Bachelor (eds.) The Citrus Plant Mol. Biol. 17: 1105–1109. Industry. University of California Press, Vol. 1, pp. 431–611. Tanaka, T. (1927) On the origin, affinity and scientific name of the Krug, C.A. (1943) Chromosome numbers in the subfamily Aurantioideae satsuma orange (2): reprinted from Studia Citrologica, Vol. 1, no. 2. with special reference to the genus Citrus. Bot. Gaz. 104: 602–611. Ueda, T., F. Ikeda, M. Kita, T. Shimada, T. Endo and M. Omura (2003) Lacombe, T., J.M. Boursiquot, V. Laucou, M. Di Vecchi-Staraz, J.P. Evaluation of a CAPS method based on ESTs in Citrus. Proc. Intl. Peros and P. This (2013) Large-scale parentage analysis in an Soc. Citricult. IX Congr. 2000: 116–117. extended set of grapevine cultivars (Vitis vinifera L.). Theor. Appl. Wu, G.A., S. Prochnik, J. Jenkins, J. Salse, U. Hellsten, F. Murat, X. Genet. 126: 401–414. Perrier, M. Ruiz, S. Scalabrin, J. Terol et al. (2014) Sequencing of Li, H., X. Yang, L. Zhu, H. Yi, L. Chai and X. Deng (2015) Parentage diverse mandarin, pummelo and orange genomes reveals complex

8 Breeding Science Parentage of satsuma mandarin (Citrus unshiu Marc.) Preview BS history of admixture during citrus domestication. Nat. Biotechnol. A. Yamasaki, S. Inafuku-Teramoto, X. Yang, X. Yang, G. Zhong et 32: 656–662. al. (2013) Diversity of chloroplast DNA in various mandarins Xu, J. (I997) Origin of satsuma mandarin. In: Ren, Y. and S. Chen (Citrus spp.) and other citrus demonstrated by CAPS analysis. J. (eds.) In The Huangyan citrus history. Learning and Historical & Japan. Soc. Hort. Sci. 82: 106–113. Cultural Data Committee of CPPCC, Taizhou, pp. 276–280. Yamamoto, M. (2014) Citrus Genetic Resources Grown on the Ryukyu Yamamoto, M., R. Kouno, T. Nakagawa, T. Usui, T. Kubo and S. Islands, Japan. OCCASIONAL PAPERS No. 54: 9–15. Tominaga (2011) Isozyme and DNA analyses of local Citrus germ Yamasaki, A. and A. Kitajima (2007) Histological study of expression plasm on Amami islands, Japan. J. Japan. Soc. Hort. Sci. 80: 268– of seedlessness in Citrus kinokuni ‘Mukaku Kishu’ and its proge- 275. nies. J. Am. Soc. Hortic. Sci. 132: 869–875. Yamamoto, M., Y. Tsuchimochi, T. Ninomiya, T. Koga, A. Kitajima,