Modulation of

Dendritic Cell Behaviour

Dissertation

zur Erlangung des akademischen Grades eines

Doktors der Naturwissenschaften (Dr. rer. nat.)

des Fachbereiches Biologie an der

Universität Konstanz

vorgelegt von

Markus Bruckner

Konstanz, 2011

Tag der mündlichen Prüfung: 16. September 2011

Referent: PD Dr. Daniel F. Legler Referent: Prof. Dr. Marcel Leist

…to my family

Danksagung

Diese Dissertation wurde am Biotechnologie Institut Thurgau an der Universität Konstanz (BITg), Kreuzlingen, Schweiz, unter der Leitung von Herrn PD Dr. Daniel F. Legler erstellt und betreut.

Mein besonderer Dank gebührt:

Meinem Doktorvater PD Dr. Daniel F. Legler für die freundschaftliche Aufnahme am BITg, die Überlassung des Themas, die unermüdliche Hilfs- und Diskussionsbereitschaft und das entgegengebrachte Interesse.

Prof. Dr. Marcus Gröttrup für das entgegengebrachte Interesse, die Hilfs- und Diskussionsbereitschaft.

Prof. Dr. Marcel Leist für die bereitwillige Übernahme der Zweitgutachtertätigkeit.

Dr. Eva-Maria Boneberg für die technische und wissenschaftliche Unterstützung, die Diskussionen, die aufheiternden Anekdoten und für ihr stets offenes Ohr.

Dr. Eva Singer und Dr. Marc Müller für die verlässliche und komplikationslose Durchführung der Blutspenden.

Dr. Petra Krause und Nicola Catone für die Bereitschaft ihr Wissen und ihre Erfahrung zu teilen.

Denise Dickel für ihren hochmotivierten Einsatz.

Dr. Michael Basler & Dr. Margit Richter für die vielen kleinen Unterstützungen beim Erstellen dieser Arbeit.

Allen Mitarbeitern des BITg und des Lehrstuhls Immunologie für das konstruktive und angenehme Arbeitsklima.

Meiner Familie.

List of publications

Publications integrated in this thesis:

Krause P*, Bruckner M*, Uermösi C, Singer E, Groettrup M, Legler DF 2009 Prostaglandin

E2 enhances T cell proliferation by inducing the costimulatory molecules OX40L, CD70, and 4-1BBL on dendritic cells. Blood 113(11):2451-60

Legler DF, Bruckner M, Uetz-von Allmen E, Krause P 2010 Prostaglandin E2 at new glance: novel insights in functional diversity offer therapeutic chances. Int J Biochem Cell Biol 42(2):198-201. Review

Schumann K*, Lämmermann T*, Bruckner M, Legler DF, Polleux J, Spatz JP, Schuler G, Förster R, Lutz MB, Sorokin L, Sixt M 2010 Immobilized chemokine fields and soluble chemokine gradients cooperatively shape migration patterns of dendritic cells. Immunity 32(5):703-13

Bruckner M, Dickel D., Singer E., Legler DF 2011 Opposing forces – Prostaglandin E2 counteracts liver X receptor  activation in human dendritic cells. submitted

Bruckner M, Dickel D., Singer E., Legler DF 2011 Distinct modulation of chemokine expression patterns in human monocyte derived dendritic cells. submitted

* contributed equally

Table of contents

CHAPTER I - INTRODUCTION 1

DENDRITIC CELLS IN TOLERANCE AND IMMUNITY 1 PROSTAGLANDIN E2 AT NEW GLANCE: NOVEL INSIGHTS IN FUNCTIONAL DIVERSITY OFFER THERAPEUTIC CHANCES 7 LIPIDS MODULATE DC BEHAVIOUR 14 AIM OF THE STUDY 16

CHAPTER II 17

DISTINCT MODULATION OF CHEMOKINE EXPRESSION PATTERNS IN HUMAN MONOCYTE-DERIVED DENDRITIC CELLS BY PROSTAGLANDIN E2

ABSTRACT 17 INTRODUCTION 18 RESULTS 19 DISCUSSION 24 MATERIALS AND METHODS 26

CHAPTER III 29

OPPOSING FORCES – PROSTAGLANDIN E2 COUNTERACTS LIVER X RECEPTOR  ACTIVATION IN HUMAN DENDRITIC CELLS

ABSTRACT 29 INTRODUCTION 30 RESULTS 31 DISCUSSION 38 MATERIALS AND METHODS 40 SUPPLEMENTS 43

CHAPTER IV 45

PROSTAGLANDIN E2 ENHANCES T-CELL PROLIFERATION BY INDUCING THE COSTIMULATORY MOLECULES OX40L, CD70 AND 4-1BBL ON DENDRITIC CELLS

ABSTRACT 45 INTRODUCTION 46 RESULTS 48 DISCUSSION 56 MATERIALS AND METHODS 60

CHAPTER V 63

IMMOBILIZED CHEMOKINE FIELDS AND SOLUBLE CHEMOKINE GRADIENTS COOPERATIVELY SHAPE MIGRATION PATTERNS OF DENDRITIC CELLS

ABSTRACT 64 INTRODUCTION 64 RESULTS 66 DISCUSSION 76 MATERIALS AND METHODS 78 SUPPLEMENTS 82

CHAPTER VI - GENERAL DISCUSSION 85

SUMMARY 93

ZUSAMMENFASSUNG 95

REFERENCES 97

RECORD OF CONTRIBUTIONS 117

Chapter I - Introduction

Chapter I Introduction

Immune responses are achieved by orchestrated events of the non-specific innate and antigen-specific adaptive immune system guided by Dendritic cells (DCs). The heterogeneous population of DCs consists of distinct functional subsets with tailored functions and tasks meeting the requirements of different immunologic scenarios in health and disease [1, 2]. As professional antigen-presenting cells (APCs), DCs sample their environment, acquire antigenic information and start communicating with the innate and adaptive immune system to orchestrate immune responses [3-5]. Thus, the understanding and modulation of DC behaviour in health and disease is of central interest in immunology and offers therapeutic chances.

Dendritic Cells in tolerance and immunity

DCs are the most potent APCs capable of sensing, acquiring, transferring and presenting antigenic information to cells of the adaptive immune system. Their unique ability to induce antigen-specific primary T cell responses enables them to establish an immunological memory. These features and their ability to regulate the type and magnitude of primary and secondary T cell responses highlight their crucial role in mediating immunity and tolerance [6].

Dendritic cell origins and functions

Throughout the body, DCs are distributed in various tissues as precursors or fully differentiated cells in an either immature or mature state [7]. DC precursors arise from hematopoetic progenitor stem cells (HSPCs) in the bone marrow [8] in response to fms-like tyrosine kinase-3 ligand (Flt3L) [9, 10] or granulocyte-macrophage colony stimulating factor (GM-CSF) [11] and enter the bloodstream. Blood circulating immature DCs and precursors are characterized as HLA-DR+ and lineage- and almost replenish the pool of circulating blood as well as tissue resident DCs [2, 6, 12]. Alternatively, DCs can also arise from tissue- and organ-patrolling HSPCs or circulating CD14+ blood monocytes [8]. In human blood, DC subsets can be distinguished by their reciprocal surface expression of CD11c on myeloid

1 Chapter I - Introduction

DCs and the Interleukin (IL)-3 receptor  chain (CD123) on plasmacytoid DCs (pDCs) [13, 14]. pDCs are a specialized DC subset, primarily localized in lymphoid-tissue associated T cell zones and the blood, and are very efficient in mediating anti-viral immune responses facilitated by their ability to produce large amounts of type I interferons [15]. Moreover, they own a special antigen-processing machinery which is optimized to combat viral infections [16]. Myeloid DCs are usually termed by their tissue distribution and are classified into circulating blood DCs, lymphoid-tissue resident DCs, and migratory or non-lymphoid tissue resident DCs, such as dermal associated interstitial DCs (intDCs) or C-type lectin Langerin expressing epidermal Langerhans cells (LCs) [7, 17, 18]. Unlike pDCs, myeloid DCs are very efficient in the capture and presentation of extracellular antigens [19, 20]. Lymphoid tissue resident DCs play key roles in maintaining tolerance under steady state conditions [21] but participate in triggering specific immunity by capturing antigens in conduits of secondary lymphoid organs (SLOs) [22]. In contrast to lymphoid-tissue resident DCs, migratory, non- lymphoid tissue (peripheral) DCs play a major role in the perception and transport of peripheral acquired antigens into lymphatic tissue, thus being key in adaptive immunity and peripheral tolerance [14, 23].

Dendritic cell activation

Numbers of non-activated DCs fulfil sentinel functions in tissues that are in contact with the environment, respectively portals of invading pathogens, such as skin and mucosa [8]. Non- activated DCs, herein after called immature DCs, exhibit a high endocytic activity in taking up antigens, but do not own the complete properties to efficiently prime antigen specific naive T cells, a unique feature of mature DCs [3, 24]. Using receptor-dependent or -independent endocytosis, phagocytosis or pinocytosis, immature DCs ingest apoptotic or necrotic cells, proteins, immune complexes and pathogen derived particles [4]. However, antigen uptake per se is not sufficient to convert immature DCs to professional T and B cell-educating APCs. A second stimulus, designating the subsequent outcome of the immune response, is required for activation [4]. Amongst others, pattern recognition receptors (PRRs), such as Toll like receptors (TLRs) [25, 26], cell surface C-type lectin receptors (CLRs) [27], intracytoplasmic nucleotide oligomerization domain (NOD)-like receptors (NLRs) [28] and RIG-I like receptors (RLRs) [29] provide the required stimulus upon activation with pathogen- associated molecular patterns (PAMPs) derived from microbes. Beside PAMPs, molecules harbouring danger associated molecular patterns (DAMPs), i.e. cell derived heat-shock proteins (HSPs) [30-32] or the high mobility group box protein 1 (HMGB1) [33, 34], opsonized particles captured by Fc-domain binding receptors [35, 36] as well as inflammatory cytokines [37] activate DCs. Moreover, CD40L (CD154), a member of the TNF

2 Chapter I - Introduction family expressed by a variety of cell types and originally described on activated CD4+ T helper (Th) cells [38], activates DCs via its cognate receptor CD40 expressed on DCs [39- 42]. After activation, often referred as maturation, DCs undergo a dramatic morphologic and functional transition accompanied by a switch in migratory responsiveness [43-45], shutdown of endocytic activity, up-regulation of membrane-bound co-stimulatory molecules and major histocompatibility complexes (MHCs) as well as release of immunomodulatory factors [4, 24, 46, 47]. Upon maturation, DCs process and present captured antigens on class I or II MHCs required for antigen-specific immune responses. In the classical model, the origin of an antigen determines its presentation to antigen-specific T cells either on MHC class I or II. Intracellular derived antigens are presented on MHC class I whereas extracellular derived antigens on MHC class II. In particular, DCs have the capability to cross-present extracellular-derived antigens on MHC class I [48]. Along with antigen-presentation, DCs orchestrate the immune response by the controlled release of soluble attractants, referred to as chemokines, to recruit distinct sets of immune effectors upon maturation [45, 49, 50]. This mechanism allows the reciprocal interaction of DCs with immune effectors of the innate and adaptive immune system [5, 50]. However, the sole presentation of antigens on MHCs is not sufficient to induce an antigen specific immune response. Therefore, maturing DCs express high levels of co-stimulatory molecules, such as CD80 and CD86 required for efficient T cell activation, and switch their migratory responsiveness towards lymphoid tissue derived chemokines in order to activate lymphocytes in SLOs [8, 51, 52].

Dendritic cell migration

T cell activation by DCs is an event in which very rare numbers of specific T cells recognize their cognate antigen presented on MHCs of DCs. These events occur in SLOs in which antigen-bearing DCs and the repertoire of antigen-specific T cells are brought in close proximity to each other. Without a central “dating agency” in the shape of SLOs, adaptive immunity would be rather inefficient since T cells and DCs had to travel throughout the body to meet their matching counterpart [53]. Immune cell migration is tightly regulated and depends on the distinct expression of chemokine receptors on the cell surface [54]. Binding of chemokines to their cognate chemokine receptor on the cell surface triggers migration towards the chemokine source [55]. Chemokines are small chemotactic cytokines classified by their local sequence of cysteine residues in chemokines with no (CC), one (CXC) or three (CX3C) intervening amino acids between the first two cysteines [56]. Tissue distribution and trafficking of DCs depends on their distinct expression of chemokine receptors [57]. Immature DCs and some precursors express a variety of inflammatory chemokine receptors,

3 Chapter I - Introduction such as CCR1, CCR2, CCR5, CCR6 and CXCR1, to migrate into inflamed peripheral tissues in response to their cognate ligands [8, 44, 58]. Upon pathogen encounter, DCs mature, release inflammatory chemokines thus recruiting further immune effectors, such as immature DCs, monocytes, NK cells, neutrophils and various T cell subsets, and acquire the ability to migrate into SLOs where they mount specific immune responses [45, 50, 52]. While losing their ability to respond to inflammatory chemokines through desensitization and down- regulation of inflammatory chemokine receptors, DCs start to express the lymphoid tissue- homing receptor CCR7 [44, 45]. The two CCR7-ligands CCL19 and CCL21 guide mature DCs through afferent lymphatic vessels to and within SLOs [59]. DC migration towards and in SLOs essentially relies on the CCR7-CCL19/CCL21 axis as demonstrated in mice deficient in either CCR7 (CCR7-/-) or its cognate ligands (plt/plt) which displayed severe impaired T and B cell immune responses [60]. In order to reach SLOs, (i) DCs have to detach from extracellular substrates, (ii) pass interstitial tissue, (iii) enter and migrate along afferent lymphatics [8]. (i) After activation, DCs were reported to detach from extracellular substrates by dissolving their integrin-rich, adhesive structures [61, 62]. Integrins are molecular trans- membrane clutches, linked to the cellular cytoskeleton and mediate substrate-dependent cell adhesion and migration by transmitting extracellular signals to the intracellular compartment and vice versa [63, 64]. (ii) CCR7-dependent DC migration through interstitial tissues was suggested to depend on a theoretical phenomenon referred to as “autologous” chemotaxis. In this theoretical model, DCs follow their own released CCL19 which is transported with the interstitial flow towards lymphatic vessels [65, 66]. However, there is need for new theories and evidences because CCL19 but not CCL21 was shown to be dispensable for DC homing from the skin in vivo [67]. Recently, Lämmermann and colleagues demonstrated that murine DCs rapidly migrate through interstitial tissue in an amoeboid and integrin-independent manner towards soluble CCL19 gradients [68]. Leukocyte-associated amoeboid high-speed locomotion enables DCs to move through large pores by flowing and squeezing within three- dimensional tissues, such as the interstitial space, thus preventing structural tissue damage and enabling a rapid combat of infections [68, 69]. In contrast to the classical model of integrin-dependent mesenchymal cell migration, flowing and squeezing of the DC body does not require protrusive forces generated by integrin-mediated clutching to the surrounding environment [68, 69]. However, integrin-independent migration fails if DCs face close- meshed tissues or move along surfaces [68]. Upon encounter of close-meshed barriers, DC derived matrix metalloproteases (MMPs) might facilitate migration by clearing the track through proteolytic degradation of matrix components. This notion is supported by a study in which DC migration from human and murine skin was shown to be facilitated by MMP2 and MMP9 [70]. (iii) Once DCs approach the surface of CCL21 expressing afferent lymphatics [71], they enter the lumen by squeezing through preformed portals independent of proteolytic

4 Chapter I - Introduction activity [72] and are then passively transported with the lymphatic fluid stream into the lymph nodes [53]. As reviewed in Lämmermann et al., fibroblastic reticular cells (FRCs) express CCR7-ligands and shape a scaffold that is thought to organize T cell and DC migration within the T cell zone. Immobilized CCL21 on the FRC network is suggested to guide lymphocytes along predefined tracks, thus maximizing APC-T cell encounters. But whether and how DCs couple to these networks and how T cells are guided to their proximity remain open questions [53].

Dendritic cell mediated regulation of immune responses

Upon arrival in lymphatic T cell zones, mature antigen bearing DCs interact with antigen specific T cells by establishing cell-cell contacts, thus shaping a stable immunological synapse required for T cell priming [73-75]. The immunological synapse establishes a narrow junction between T cells and DCs in which clustered interactions between T cell receptors (TCRs) and antigenic peptide-presenting MHCs as well as co-stimulatory interactions such as CD28-CD80/86 take place [76]. T cell differentiation, expansion and cytokine expression is mainly promoted by CD28 [77] and depends on dose, strength and quality of antigen- loaded MHC-induced TCR stimulation [78-80], but can be further influenced by additional co- stimulatory signals [81]. These additional co-stimulatory signals are provided through receptors of the TNF superfamily, such as OX40, 4-1BB and CD27. By their distinct expression on T cells and their counterparts on APCs, these additional co-stimulatory signals influence T cell differentiation and survival resulting in an altered immune response [81]. Whether mature DCs induce T cell mediated immunity or tolerance is a matter of maturation and is determined by the maturation-regulated presence or absence of co-stimulatory molecules and the release of distinct T cell directed cytokines [81-84]. Apart from TCR engagement and co-stimulation, DCs release cytokines, such as Interleukin(IL)-12, IL-4, IL- 23 and IL-10, which modulate T cell responses by skewing CD4+ T helper (Th) cell polarization towards Th1, Th2, Th17 or regulatory T cells respectively [85]. Th1 cells are the primary source of Interferon (IFN) and are very effective in the clearance of intracellular pathogens by inducing cellular immunity, whereas Th2 cells release IL-4, IL-5 and IL-13 that effectively promote humoral immunity against parasites [86]. Recently, Th17 cells have been described to mediate immunity against fungi and extracellular bacteria [87] but were also found to promote tumour immunity [88]. Th17 cells are characterized by their unique ability to express the pro-inflammatory cytokine IL-17 and the expression of the transcription factor retinoic acid-related orphan receptor (ROR)γt [89, 90]. In contrast, regulatory T cells maintain tolerance and prevent inadequate immune responses by suppressing naive T cell activation

5 Chapter I - Introduction or immune effector functions, such as that of Th cells, CD8+ cytotoxic T cells (CTLs), B cells, macrophages and DCs [91]. On the one hand, these immune suppressive functions are often found to be exploited by pathogens or cancer cells in order to escape from the host immune response [86, 92]. On the other hand, disordered or lacking immune regulation by regulatory T cells leads to immunopathology such as Th1 and Th17 cell mediated autoimmunity or Th2 cell mediated allergy [86, 91].

6 Chapter I - Introduction

Prostaglandin E2 at new glance: novel insights in functional diversity offer therapeutic chances

Daniel F. Legler1,2, Markus Bruckner1, Edith Uetz-von Allmen1, Petra Krause1

1 Biotechnology Institute Thurgau (BITg) at the University of Konstanz, Kreuzlingen, Switzerland 2 Zukunftskolleg, University of Konstanz, Konstanz, Germany

Published in Int J Biochem Cell Biol 42(2):198-201

Abstract

Prostaglandin E2 (PGE2) is the most abundant eicosanoid and a very potent lipid mediator.

PGE2 is produced predominantly from arachidonic acid by its tightly regulated cyclooxygenases (COX) and prostaglandin E synthases (PGES). Secreted PGE2 acts in an autocrine or paracrine manner through its four cognate G protein coupled receptors EP1 to

EP4. Under physiological conditions, PGE2 is key in many biological functions, such as regulation of immune responses, blood pressure, gastrointestinal integrity, and fertility.

Deregulated PGE2 synthesis or degradation is associated with severe pathological conditions like chronic inflammation, Alzheimer’s disease, or tumorigenesis. Therefore, pharmacological inhibition of COX enzymes and PGE2 receptor antagonism is of great therapeutic interest.

7 Chapter I - Introduction

Introduction

Prostaglandins (PGs) are short-lived potent bioactive lipid messengers belonging to the family of eicosanoids [93-96]. The first prostaglandin was independently isolated by Maurice W. Goldblatt and Ulf S. von Euler from the prostate gland and seminal fluid back in 1935, and was shown to induce smooth muscle contraction and to reduce blood pressure. PGs derive from 20-carbon fatty acid precursors, mainly arachidonic acid (AA). Most cells synthesize almost undetectable or basal levels of PGs. PGs are de novo synthesized rapidly upon cell activation by most cells of the body and act in an autocrine and paracrine fashion. A variety of stimuli regulate the synthesis of PGs, which have an extraordinary broad spectrum of action [93, 94]. Prostaglandin E2 (PGE2; IUPAC: 7-[3-hydroxy-2-(3-hydroxyoct-1-enyl)-5-oxo- cyclopentyl] hept-5-enoic acid), also known as dinoprostone, is the most abundant prostanoid in humans and involved in regulating many different fundamental biological functions including normal physiology and pathophysiology [97-99].

Structure

PGE2 is an unsaturated carboxylic acid based on a 20-carbon skeleton containing a cyclopentane ring and its structure is depicted in the center of Figure 1A-B. Its molecular mass is 352.465 g/mol. The two double bonds in the carbon chains designate the numerical subscript in PG nomenclature also termed series-2 prostaglandins. PGE2 can be distinguished from other series-2 PGs i.e. by its degree of oxidation.

Expression, Activation and Turnover

The synthesis of PGs is initiated by the liberation of AA (Figure 1A and B) from plasma membrane phospholipids by members of the phoshpolipase A2 (PLA2) family, of which the 2+ Ca -dependent cytosolic PLA2 (cPLA2) plays a dominant role [95, 96, 98]. The amount of liberated AA designates the outcome of PG synthesis [98]. AA is immediately metabolized at the luminal side of nuclear and ER-membranes into the intermediate PGH2 by cyclooxygenases (COX) and converted into different PGs by cell- and tissue-specific prostaglandin synthases (PGS) [95, 98, 100]. COX exists in three isoforms [95-98]: The constitutively expressed COX-1 is responsible for basal, and upon stimulation, for immediate PG synthesis, which also occurs at high AA concentrations. COX-2 is induced by cytokines and growth factors and primarily involved in

8 Chapter I - Introduction the regulation of inflammatory responses. COX-3 is a splice variant of COX-1 predominantly expressed in brain and heart. PGE2 is synthesized from PGH2 by cytosolic cPGES or by membrane-associated/microsomal mPGES-1 and mPGES-2 [98, 100]. cPGES is constitutively and abundantly expressed and preferentially couples with COX-1. The expression of mPGES-1 is induced by cytokines and growth factors similar to COX-2, with which it couples. This suggests a coordinated regulation of COX-2 and mPGES-1 by common signaling pathways, such as NF-B. However, constitutive expression of mPGES-1 in certain tissues and cell types was also reported. The widely and constitutively expressed mPGES-2 was shown to be further induced under pathological conditions (i.e. cancer) and interacts with COX enzymes [98, 100].

Finally, de novo synthesized PGE2 is actively transported through the membrane by the ATP- dependent multidrug resistance protein-4 (MRP4) or diffuses across the plasma membrane

[98] to act at or nearby its site of secretion. PGE2 then acts locally through binding of one or more of its four cognate receptors, termed EP1-EP4 [101]. EP receptors belong to the large family of seven transmembrane domain receptors coupled to specific G proteins with different second messenger signaling pathways (Figure 1C). EP1 couples most probably to

Gq, and PGE2 binding leads to an elevation of cytosolic free calcium concentration. Gs- mediated EP2 and EP4 signaling increases intracellular cAMP. EP3 is regarded as an

“inhibitory” receptor that couples to Gi proteins and decreases cAMP formation.

As is the rule for locally acting lipid mediators, PGE2 is not stored but rapidly metabolized.

The major enzymes responsible for rapid (within minutes) inactivation of PGE2 are the cytosolic enzymes 15-ketoprostaglandin ∆13-reductase and 15-hydroxyprostaglandin dehydrogenase, of which the latter is deregulated in some forms of cancer [102].

9 Chapter I - Introduction

Figure 1. Biosynthesis of PGE2, interaction with its cognate receptors EP1–EP4 and main routes of pharmacological inhibition. PGE2 is synthesized by cyclooxygenases (COX) and prostaglandin E synthases (PGES) from arachidonic acid. After release from the producing cell via passive diffusion through the plasma membrane or active transport by the multidrug resistance protein 4 (MRP4), PGE2 binds to and signals through a family of specific E-prostanoid (EP) receptors. (A) COX-1 pathway of basal or stimulus-induced immediate PGE2 biosynthesis. After membrane interaction of cytosolic phospholipase A2 (cPLA2) in response to transient calcium increases, arachidonic acid is liberated from phospholipids of cellular membranes. At the luminal side of nuclear and ER-membranes, COX-1 converts arachidonic acid into its transient metabolite prostaglandin H2 (PGH2) which is then metabolized into PGE2 via the membrane-tethered cytosolic prostaglandin E synthase (cPGES) or, alternatively, via cytosolic residing, microsomal prostaglandin E synthase (mPGES)-2. (B) COX-2-mediated PGE2 biosynthetic pathway. At sites of inflammation, cytokine- and growth factor-inducible COX-2 oxidizes arachidonic acid to form PGH2 which is subsequently converted into PGE2 by mPGES-1 or mPGES-2. Black lines with arrow indicate conversion; dotted lines, translocation. The white right-angled arrows indicate transcription/translocation. Red letters indicate sites of inhibition of PG synthesis; non-steroidal anti-inflammatory drugs (NSAIDs). (C) PGE2 signaling through the EP receptor family of seven-transmembrane G-protein-coupled receptors; PGE2 acts through four different receptor subtypes, EP1 to EP4. EP1 couples to Gq protein and signals through the phospholipase C (PLC)/inositol-1,4,5-trisphosphate (IP3) pathway resulting in the formation of the second messengers diacylglycerol (DAG) and IP3, with the latter rapidly liberating Ca2+ ions from intracellular stores. EP3 couples to Gi for signaling and inhibits adenylyl cyclase (AC) activation resulting in decreased cAMP concentrations. In contrast, EP2 and EP4 receptor subtypes couple to Gs and its activation leads to increased cAMP production.

10 Chapter I - Introduction

Biological functions

Since PGE2 can be produced by virtually any cell of the human body, either constitutively or upon stimulation, and signals through different receptors, its biological effects are diverse and of an astounding complexity, depending on the amount of PGE2 available within the microenvironment of diverse tissues and on the subtype of EP receptors expressed on target cells [93, 94, 101].

Besides other prostanoids, PGE2 has been described as a regulator of numerous physiological functions ranging from reproduction to neuronal, metabolic and immune functions. In the central nervous system, PGE2 has been implied in the regulation of body temperature and sleep-wake activity, and is involved in hyperalgesic responses as part of sickness behavior. It has been described as a regulating factor for bone formation and bone healing. One of the most important features of PGE2, which makes it a key player in the control of multiple physiological processes, is its vasodilatory activity, through which PGE2 participates for example in embryo implantation and modulation of haemodynamics in the kidney [103]. Moreover, the effect of PGE2 on contraction and relaxation of smooth muscle cells are not only evident in childbirth and blood pressure control, but also in gastrointestinal motility, where it plays a major role in coordination of peristaltic movement. Distinct expression and distribution of EP receptors in the gastrointestinal tract determine additional functions of PGE2 in the gut [97]. Besides motility, PGE2 plays a role in gastrointestinal secretion and mucosal barrier functions. The first line of defense of the intestinal immune system is the secretion of mucins, glycoprotein polymers that protect the mucosa. Secretion of mucin from gastric epithelial cells can be induced by PGE2. Moreover, in a mouse injury model, PGE2 was demonstrated to protect small intestinal epithelial cells from radiation- induced apoptosis [97].

In inflammation, PGE2 is of particular interest because it is involved in all processes leading to the classic signs of inflammation: redness, swelling and pain [93, 94]. Redness and edema result from increased blood flow into the inflamed tissue through PGE2-mediated augmentation of arterial dilatation and increased microvascular permeability. Hyperalgesia is mediated by PGE2 through EP1 receptor signaling and acts on peripheral sensory neurons at the site of inflammation, as well as on central neuronal sites. Because of its role in these basic inflammatory processes, PGE2 has been referred to as a classical pro-inflammatory mediator. The relevance of prostaglandins during the promotion of inflammation is emphasized by the effectiveness of non-steroidal anti-inflammatory drugs (NSAIDs) acting as

COX-inhibitors [95]. However, the role of PGE2 in the regulation of immune responses is even more complex. Studies on knock-out mice deficient for individual EP receptors clearly revealed that PGE2 not only acts as a pro-inflammatory mediator, but also exerts anti-

11 Chapter I - Introduction inflammatory responses [101]. The environment, in which dendritic cells (DCs) take up antigens and undergo maturation, shapes the outcome of the induced adaptive immune response. As pro-inflammatory mediator, PGE2 contributes to the regulation of the cytokine expression profile of DCs and has been reported to bias T cell differentiation towards a T helper (Th) 1 or Th2 response. A recent study showed that PGE2-EP4 signaling in DCs and T cells facilitates Th1 and IL-23-dependent Th17 differentiation [104]. Additionally, PGE2 is fundamental to induce a migratory DC phenotype permitting their homing to draining lymph- nodes [105, 106]. Simultaneously, PGE2 stimulation early during maturation induced the expression of co-stimulatory molecules of the TNF superfamily on DCs resulting in an enhanced T cell activation [107]. In contrast, PGE2 has also been demonstrated to suppress

Th1 differentiation, B cell functions and allergic reactions [94, 108]. Moreover, PGE2 can exert anti-inflammatory actions on innate immune cells like neutrophils, monocytes and NK cells [94]. Deregulation of COX has been described in the pathogenesis of various diseases and a number of different tumor types [99, 109]. COX-2 over-expression leads to increased levels of PGE2 and has been associated particularly with colorectal, pancreatic, lung and breast cancer [99], albeit a recent study found reduced expression of COX-2 in primary breast cancer compared to surrounding healthy tissue [110]. Moreover, PGE2 has been implicated in various tumorigenic processes, and the involvement of specific EP receptors and signaling pathways has been elucidated [99, 109]. For example, PGE2 facilitates tumor progression through stimulation of angiogenesis via EP2, mediates cell invasion and metastasis formation via EP4 and promotes cell survival by inhibiting apoptosis via numerous signaling pathways. Moreover, tumor cell-produced PGE2 has been implicated in strategies of tumors for evasion of immune-surveillance [111]. The mechanisms by which PGE2 participates in suppression of anti-tumor immune responses could be multifaceted and are not yet fully understood. It has been demonstrated that PGE2-secreting lung cancer cells can induce human CD4+ T cells to express Foxp3 and develop a regulatory phenotype. Furthermore, the presence of PGE2 can enhance the inhibitory function of human regulatory T cells [112].

Additionally, PGE2 in the tumor environment can effect DCs by altering their cytokine expression profile, resulting in reduction of anti-tumor specific cytotoxic T cell activation [111,

113]. However, PGE2 has also been described as tumor-suppressive, which seems to be contradictive, but could be explained by different expression levels of PGE2 and co- occurrence of other factors leading to an opposing outcome [109, 113]. This fact emphasizes the complexity of the regulatory system of prostanoids, but also offers exciting and promising targets for therapeutic intervention. Targeting PGE2 levels during tumor therapies could be beneficial, as the administration of antibodies against PGE2 has been shown to delay tumor growth in mice [109].

12 Chapter I - Introduction

Pharmaceutical targeting of PGE2 synthesis and antagonizing specific EP receptors

Beside the clinical use of PGE2 to induce childbirth or abortion, and as vasodilator in severe ischemia or pulmonary hypertension, the main pharmaceutical focus lies in the inhibition of

PGE2 synthesis (Figure 1) or in the specific blockage of selected EP receptors. NSAIDs act as COX inhibitors although through different mechanisms and belong to the most utilized pharmaceutical drugs worldwide [95]. Its most prominent representative is acetylsalicylic acid (aspirin), which was first marketed in 1898. One unique feature of aspirin is that it covalently modifies COX-1 and, with lesser efficiency, COX-2 by acetylating a serine residue at the active site of the enzyme. Other NSAIDs predominantly compete for binding with arachidonic acid in the active site of COX. Well-known NSAIDs include the synthetic COX inhibitors indomethacin, NS398, celecoxib (Celebrex), rofecoxib (Vioxx), valdecoxib, flurbiprofen, or etoricoxib. Their modes of action and known side effects are precisely described [95]. PGE2 synthesis may also be blocked by glucocorticoids which inhibit PLA2. Recent studies with gene targeted mice, in which single EP receptors were deleted, gave new insights on the various actions of PGE2 [101]. This, in combination with the development of specific EP receptor agonists and antagonists, will boost novel therapeutic approaches both in physiology and pathology.

Acknowledgments

We are grateful to current and past members of the BITg. We received research funding from Swiss National Science Foundation, Vontobel Stiftung, Thurgauische Stiftung für Wissenschaft und Forschung, and Swiss State Secretariat for Education and Research. DFL is a recipient of a career development award from the Prof. Dr. Max Cloëtta Foundation.

13 Chapter I - Introduction

Lipids modulate DC behaviour

DCs inherit a central role in tolerance and immunity and were subjects of intense research since their first characterization in 1973 [6, 114]. Their behaviour and accordingly their abilities which are determined by their environment, ultimately decide whether infections and cancer are combated or tolerated, inflammatory disorders, such as chronic inflammation, autoimmunity and allergy are promoted or desired effects during vaccination occur.

Lipids modulate DC behaviour in tumour- and autoimmunity

Tumours are known to escape immune responses by modulating DC behaviour. In this scenario, DC functions are modulated during maturation in the vicinity of tumours by tumour- derived cytokines resulting in impaired or tolerogenic immune responses [115]. It is widely accepted that beside cytokines, lipids alter DC functions [116]. Moreover, several studies reported that lipid mediators, such as tumour derived prostaglandin E2 (PGE2), impair anti- tumour immune responses by either modulating DC functions [117] or inducing myeloid- derived suppressor cells [118]. Tumour-derived PGE2 is thought to dampen the capacity of

DCs to induce anti-tumour Th1 responses [109]. Whether PGE2 favours the induction of anti- tumour Th1 or humoral Th2 immune responses remains contradictive, but is suggested to depend on the state of maturation as well as on the environment in which DCs mature [119].

In contrast to the anti-inflammatory actions of PGE2 in anti-tumour responses, it is well established that the presence of PGE2 during maturation promotes the migratory ability of mature DCs towards SLOs independent of the magnitude of CCR7 expression in vitro [106, 120, 121] and in vivo [105], yet the precise underlying molecular mechanisms remain to be elucidated. In addition, PGE2 was found to elevate MMP9 expression critical for DC migration through ECM in vitro and in vivo [122]. Apart from PGE2, another tumour-derived lipid- derivate has been described to alter DC behaviour. Activation of the nuclear liver x receptor (LXR)  by tumour-derived cholesterol derivates was described to impair CCR7 expression of maturing DCs thus dampening anti-tumour immune responses [123]. So far, LXRs were reported to be key regulators in the transcriptional control of inflammatory responses and lipid homeostasis in macrophages [124], but were also found to influence the T cell stimulatory capabilities of DCs when present during DC differentiation or maturation [125, 126].

In autoimmunity, PGE2 promotes naive Th cell differentiation towards Th1 and Th17 cells depending on the strength of T cell activation [104, 127] and, very interesting, since DCs represent a major source of PGE2 [119]. Mice lacking the PGE2 receptor EP4 were less susceptible to disease in mouse models of autoimmune disorders which are known to be

14 Chapter I - Introduction mediated by Th1 and Th17 cell responses [104]. DCs of these mice did not release substantial amounts of the Th17-skewing cytokine IL-23 in presence of PGE2 during maturation [104] which is in line with other reports showing that PGE2 skews the cytokine pattern towards Th17 polarization [128, 129]. Of note, it was also shown that CCR7-ligands contribute to DC mediated Th17 cell expansion in a mouse model of experimental autoimmune encephalomyelitis (EAE) by a CCR7-dependent release of IL-23 [130].

PGE2 in DC-based tumour immunotherapy

One of the most promising and specific therapies to cure cancer are immunotherapeutic approaches that instruct the host immune system to specifically combat the disease compared to pharmaceutical approaches such as chemotherapy with undesired side effects. To date, efforts in cancer therapy have been made using monoclonal antibodies, adoptive T cell transfer, allogeneic bone marrow transfer and DC-based immunotherapy. In DC-based immunotherapy, DCs are utilized as cellular vaccines either loaded with tumour-antigen in vivo or generated, loaded and matured ex vivo. DCs that were generated ex vivo are then re- injected into the patient where they migrate into the draining lymph nodes to primarily elicit T cell mediated anti-tumour responses [115]. Ex vivo generated DCs are often matured with

PGE2 in combination with the pro-inflammatory cytokines IL-1, IL-6 and TNF under clinical approved serum-free conditions and were shown to exhibit a high migratory and T cell stimulatory ability after maturation [131]. The suitability of the maturation cocktail consisting of IL-1, IL-6, TNF and PGE2 was approved in clinical trials [132, 133], in particular in a trial with melanoma patients in which re-injected antigen-bearing DCs efficiently migrated into the draining lymph nodes [134]. Moreover, there are many evidences that under clinical relevant conditions, PGE2 is crucial for CCR7-dependent migration and furthermore elicits specific anti-tumour CTL responses in vitro and in vivo [120, 132]. But due to the course of improving

DC-based cancer immunotherapy, the use of PGE2 in clinical maturation protocols, regarding ability and effectiveness to attract immune effectors and to stimulate anti-tumour T cell responses in vitro, is still under debate [113, 135-138]. Still many aspects of PGE2-regulated DC functions, such as T cell activation, DC migration and cytokine expression, have not been fully investigated. A more detailed knowledge about the impact of PGE2 on DC functions could reveal beneficial insights for DC-based immunotherapy.

15 Chapter I - Introduction

Aim of the study

Dendritic cells (DCs) have the intriguing ability to orchestrate immune responses and to induce immunity or mediate tolerance. These features depend on their capability to recognize and react upon signals in their environment, which are subsequently determining their behaviour. The spectrum of distinct signals, which influence DC behaviour, such as migration and T cell stimulatory capacity, is likewise versatile as the resulting effects.

Prostaglandin E2 (PGE2) is a lipid mediator involved in many physiological processes. In inflammation, extracellular derived PGE2 modulates the migratory behaviour of DCs and thus promotes efficient CCR7-dependent migration. DCs migrate along the cues of the lymphoid tissue-derived chemokines CCL19 and CCL21 towards secondary lymphoid organs (SLOs) required for the induction of adaptive immune responses. The impact of PGE2 on DCs is not restricted to migration, since research in the past years provided growing evidence that PGE2 modulates various functions of DC behaviour in health and disease. Substantial progress has been made in understanding the sophisticated roles of PGE2 on DC functions with implications in medicine, such as DC-based immunotherapy, autoimmunity and carcinogenesis. However, many context-dependent effects of PGE2 on DC behaviour remain to be described more precisely and demand further investigations. This study addressed the impact of PGE2 on several aspects of DC behaviour such as migration, T cell stimulatory capacity and the ability to secrete chemokines to recruit immune effectors in order to orchestrate immune responses. Moreover, the present work aimed to examine CCR7- mediated DC migration more closely to gain new insights in the mechanism and modulation of DC migration.

16 Chapter II

Chapter II

Distinct modulation of chemokine expression patterns in human monocyte-derived dendritic cells by prostaglandin E2

Markus Bruckner1, Denise Dickel1, Eva Singer2 and Daniel F. Legler1

1 Biotechnology Institute Thurgau (BITg) at the University of Konstanz, Kreuzlingen, Switzerland 2 Klinikum Konstanz, Konstanz, Germany

Abstract

Dendritic cells (DCs) inherit a major role in the regulation of innate and adaptive immune responses. DCs reside predominantly in tissues facing the external environment and sample their surrounding for pathogens. Upon encounter of a pathogen, DCs produce chemokines, mature and migrate into secondary lymphoid organs. The type of signal(s) that triggers maturation dictates the ability of DCs to produce distinct patterns of chemokines that orchestrate a timely regulated recruitment of innate and adaptive immune effector cells and hence influence the quality and magnitude of an immune response. The lipid mediator prostaglandin E2 (PGE2) is abundantly found in inflammation and emerges to play key roles in modulating DC functions such as efficient DC migration, cytokine production and T cell activation. Here, we demonstrate that PGE2 significantly and distinctly modulates chemokine expression patterns of human monocyte-derived DCs (MoDCs) matured with either LPS, inflammatory cytokines, polyI:C or sCD40L. PGE2 dampened the early production of the inflammatory chemokines CCL2 and CCL4 by MoDCs. Interestingly, down-modulation of

CCL5 by PGE2 varied depending on the maturation stimulus. PGE2 also attenuated the expression of the primarily Th1- and effector memory T cell-attracting chemokines CXCL9,

CXCL10 and CXCL11. In contrast, PGE2 enhanced the production of CXCL8 early during maturation, whereas CXCL16 levels were continuously elevated. While PGE2 did not

17 Chapter II modulate the homeostatic chemokine CCL22, it rather induced CCL17 production at late DC maturation stages and modulated CCL20 expression depending on the maturation stimulus. Finally, mature MoDCs produced the homing chemokine CCL19 and its expression was down-regulated by PGE2. These results provide clear evidence that PGE2 regulates the expression pattern of various chemokines by MoDCs and hence modulate their capacity to differentially recruit distinct immune cells.

Introduction

Dendritic cells (DCs) are the most potent antigen-presenting cells (APCs) capable of inducing adaptive immunity or tolerance [3, 32]. In their immature state, DCs are strategically located at routes of pathogen entry and constantly scan the surrounding environment for antigens from invading pathogens [8]. Upon antigen uptake, DCs undergo a maturation process initiated by i.e. inflammatory cytokines, co-stimulatory molecules, bacterial or viral products, and migrate to the draining lymph node to present the processed antigens to T cells [4, 8]. Of note, DCs at different maturation stages produce distinct chemokine expression pattern which enables them to actively orchestrate the immune response by sequentially attracting innate and adaptive immune effector cells. Under inflammatory conditions for instance, DCs are described to rapidly and transiently secrete mainly pro- inflammatory chemokines early during maturation, attracting other immature DCs as well as monocytes/macrophages that can also differentiate into DCs, followed by constitutive and homing chemokines [45]. Upon challenging DCs with influenza viruses three coordinated successive waves of chemokine production were described [50]. In the first wave observed shortly after infection, chemokines are secreted that potently recruit effector cells including neutrophils, CTLs and NK cells. In the second wave, chemokines attracting effector memory cells are produced, while in the third wave occurring after full DC maturation homing chemokines are released that recruit naïve T and B cells [50]. Moreover, also the quality and magnitude of chemokine expression by DCs was shown to depend on the activation stimulus [49, 139]. In addition, DCs also change their responsiveness to chemokines upon maturation. Maturing DCs lose their migratory response to inflammatory chemokines permitting the emigration from the inflamed tissue. Simultaneously, antigen-loaded DCs up-regulate surface expression of the lymph node-homing chemokine receptor CCR7 [44, 140, 141]. It is well known that the environment in which DCs take up antigens and undergo maturation designates the quality of the immune response [4, 142], presupposing that DCs can recognize distinct sources of activation [49]. We and others discovered that efficient CCR7- dependent DC migration requires prostaglandin E2 (PGE2) early during maturation in vitro

18 Chapter II

[106, 120, 138] and in vivo [105]. The arachidonic acid metabolite PGE2 is rapidly produced by many cell types in inflammation and has major functions in regulating immune responses

[142]. Thereby, PGE2 participates in the outcome of adaptive T cell responses by regulating co-stimulatory molecules [107], cytokines [120, 128, 129, 131, 136, 143] and certain chemokines [113, 136, 138, 144-146]. Due to their natural function in orchestrating immune responses, human monocyte-derived DCs (MoDCs) are widely used as cellular vaccines in immunotherapy [133, 147-150] and the effectiveness depends on their maturation state [134]. Currently, different maturation protocols for DCs used in immunotherapies are controversially discussed [113, 137, 151] addressing the impact of DC migration [106, 120], the capacity to stimulate T cells [107, 137, 151, 152] and the ability to recruit effector cells [136, 138]. Nowadays, the majority of clinically approved MoDC maturation protocols contain either PGE2 [131] or interferon  (IFN) [151] with different chemokine expression patterns [113, 136-138, 146]. These studies either focused on distinct groups of chemokines regulated by PGE2 [113, 138] or compared maturation protocols in terms of their attracting capabilities [137]. However, there is no diversified study on the impact of PGE2 on chemokine expression in human MoDCs in combination with different maturation stimuli despite major implications in immune regulation and immunotherapy. Therefore, we decided to investigate the influence of PGE2 on the production of a number of key chemokines in MoDCs matured with different stimuli mimicking various conditions of DC activation.

Results

DCs are known to be a rich source of chemokines and, importantly, differentially change the chemokine production pattern depending on the stimuli and the maturation stage. To determine the influence of PGE2 on MoDC chemokine expression patterns we generated human MoDCs under serum-free, clinically relevant conditions and matured them with either the TLR3-ligand polyI:C, the TLR4-ligand LPS, the cytokine cocktail consisting of IL-6, IL-1 and TNF or with soluble trimeric CD40 ligand (sCD40L), in the presence or absence of

PGE2. Flow cytometric characterization revealed that MoDCs at the immature stage were negative for CD14 and CD83 and positive for HLA-DR, CD80 and CD86, but up-regulated CCR7 and CD83 upon maturation (data not shown) as described previously [106, 107]. Chemokine mRNA expression of MoDCs was determined after differentiation and after 6h or 1d of maturation by real-time PCR. Secretion of chemokine proteins into the culture supernatant was measured after MoDC differentiation and after maturation at 48h by ELISA.

19 Chapter II

We first investigated the role of PGE2 in modulating the expression pattern of chemokines primarily involved in the recruitment of immediate immune effectors. The inflammatory chemokine CCL4 (MIP-1β) was shown to be expressed by DCs upon maturation and attracts monocytes, immature DCs, NK cells, as well as various T cell subsets via the chemokine receptor CCR5 [44, 145, 153, 154]. As depicted in Figure 1A, CCL4 mRNA was strongly expressed in human MoDCs within the first hours of maturation and its expression rapidly declined independent of the maturation stimulus used. The presence of PGE2 led to a profound down-regulation of CCL4 mRNA and protein expression (Figure 1A) confirming previous results in murine LPS-matured BMDCs [145]. Marginal or undetectable amounts of CCL4 protein were measured in supernatants of terminally differentiated, immature human MoDCs, whereas high amounts of CCL4 accumulated upon MoDC maturation for 2 days with all four maturation stimuli (Figure 1A). Similar to mRNA levels, PGE2 attenuated CCL4 protein expression (Figure 1A). A sustained mRNA expression of CCL5 (RANTES) was measured in MoDCs matured with either sCD40L, polyI:C or LPS, but CCL5 mRNA levels strongly decreased within 1d of maturation with inflammatory cytokines (Figure 1A). CCL5 protein levels in sCD40L-matured MoDCs were below the detection limit. The presence of

PGE2 during maturation decreased CCL5 mRNA expression and secretion after TLR3 and TLR4 activation (Figure 1A). Interestingly, polyI:C-matured MoDCs produced the highest concentration of CCL5 which was reduced in presence of PGE2 (Figure 1A). Expression of CCL2 (MCP-1) was detected early after MoDC stimulation (Figure 1A) and was dampened or fully inhibited by PGE2 on both mRNA and protein levels (Figure 1A). As a consequence,

PGE2 impairs the attraction of cells expressing CCR2, such as neutrophils, monocytes, immature DCs, NK cells and T cell subsets that are involved in early immune responses [57, 155] as well as immune effectors expressing CCR5. Upon viral infection, DCs were reported to express and rapidly secrete CXCL8 (IL-8) [50] thereby attracting PMNCs via CXCR1 and CXCR2 [156]. We observed an early and robust induction of CXCL8 transcription and protein secretion under all maturation conditions (Figure 1B). Interestingly, PGE2 up-regulated

CXCL8 production in stimulated MoDCs, except for TLR4 activation where PGE2 down- regulated CXCL8 production after one day of maturation (Figure 1B). Upon activation, DCs were also reported to attract immune effectors harboring the chemokine receptor CXCR6 [50], such as NK T cells, Th1 cells and CTLs [157] by the production of the soluble form of CXCL16 [158]. As shown in Figure 1B, activated MoDCs constitutively expressed and secreted CXCL16, which was slightly increased by PGE2. Matured MoDCs also expressed the membrane anchored form of CXCL16, however, we did not observe obvious surface expression changes of CXCL16 by PGE2 (data not shown). After establishing a first line of defense, maturing DCs were shown to release the CXCR3 ligands CXCR9 (MIG), CXCR10 (IP-10) and CXCR11 (I-TAC) to attract Th1 and effector

20 Chapter II memory T cells [50, 113]. Upon TLR3 or TLR4 ligation on human MoDCs, we detected a dramatic increase of CXCL10 (Figure 1B), CXCL9 and CXCL11 (data not shown) transcripts in the first hours of maturation. The impeded secretion of CXCR3-ligands by PGE2 in MoDCs was representatively corroborated on protein level for CXCL10 (Figure 1B). Stimulation of MoDCs with inflammatory cytokines or sCD40L marginally induced CXCL10 and its expression was dampened by PGE2 (Figure 1B). Next, we investigated the expression of the inflammatory and homeostatic CCL20 (MIP- 3LARC) in MoDCs, a chemokine induced early upon maturation and known to attract various T cell and DC subsets expressing CCR6 [141, 159-161]. PGE2 slightly increased CCL20 expression if MoDCs were matured with sCD40L or inflammatory cytokines, and marginally decreased its expression upon LPS stimulation (Figure 1C). No modulation of

CCL20 expression by PGE2 was measured in MoDCs matured with polyI:C (Figure 1C). We also investigated the family of lymph node-associated homeostatic chemokines. CCL17 (TARC) and CCL22 (MDC) were shown to be constitutively expressed by DCs and to bind to CCR4 on T helper cell subsets, including Th17 cells, and regulatory T cells [113, 155, 162- 164]. As expected, MoDCs constitutively expressed high amounts of CCL22 in response to sCD40L, polyI:C, LPS or inflammatory cytokine stimulation (Figure 1C). If at all, PGE2 slightly induced CCL22 transcription early during maturation. Of note, in MoDCs matured solely by

TNF, PGE2 was shown to either decreased [136] or increased [113] CCL22 expression, whereas in MoDCs matured with IFNand TNF, PGE2 did not regulate CCL22 transcription [113]. In line with other reports using only TNF-matured DCs [136], our results demonstrate that PGE2 increased CCL17 mRNA expression in the first 24h of maturation and independent of stimulus (Figure 1C). However, we could detect a PGE2-dependent and elevated CCL17 secretion in polyI:C, sCD40L and in inflammatory cytokine matured MoDCs (Figure 1C). Noteworthy, MoDCs matured by polyI:C produced low amounts of the B and follicular T helper cell attracting chemokine CXCL13 (BCA-1) [165] exclusively in the presence of PGE2, whereas no CXCL13 secretion was observed with other DC maturation stimuli (data not shown). Similarly, MoDCs did not secret detectable amounts of CXCL12 (SDF-1) or CCL21 (SLC/6Ckine) (data not shown). Finally, DC-derived CCL19 (ELC/MIP-3) was suggested to recruit naïve T cells at the early T cell priming phase to increase the frequency of DC-T cell interactions, whereat PGE2 was reported to down-regulate CCL19 [138]. In our experiments, we observed that MoDCs transcribed CCL19 exclusively at late TLR- or cytokine-induced maturation stages and that PGE2 dampened the expression of CCL19 (Figure 1D). TLR3- activated MoDCs produced the highest amount of CCL19 with detectable amounts in supernatants of MoDCs matured in presence of PGE2, whereas chemokine secretion in supernatants of sCD40L matured MoDCs was undetectable (Figure 1D).

21 Chapter II

22 Chapter II

Figure 1. Modulation of chemokine expression pattern of human MoDCs by PGE2. Human peripheral blood monocytes were differentiated to immature MoDCs for 5-6 days in the presence of GM-CSF and IL-4. Immature MoDCs were stimulated with different maturation stimuli for indicated time points in the absence () or presence () of PGE2. (right panel) Chemokine mRNA levels after 6h and 1d of maturation were determined by quantitative real-time RT-PCR and are depicted as relative expression to immature DCs. Mean values and SEM from at least 3 individual donors is depicted. (left panel) Supernatants of terminally differentiated, immature MoDCs and of MoDCs matured for 48h derived from 2 individual donors were collected and chemokine protein secretion was assessed by specific ELISA. Chemokine concentration below the detection limit is marked as not detectable (n.d.), chemokine concentrations above the limit are described with the upper detection limit (i.e., > 40ng/ml). Representative chemokines include CCL2, CCL4, CCL5 (A), CXCL8, CXCL10, CXCL16 (B), CCL17, CCL20, CCL22 (C), and CCL19 (D).

Taken together, we provide a diversified overview of activation-induced chemokine expression patterns in human MoDCs. Of note, human immature MoDCs prepared under clinically relevant conditions per se do not produce any chemokines. However, we demonstrate that PGE2 significantly and distinctly alters the maturation-induced expression pattern of pro-inflammatory and homeostatic chemokines at various stages of human MoDC maturation.

23 Chapter II

Discussion

Understanding mechanisms that regulate DC behavior and the outcome of an adaptive immune response is still a central question in immunology. Divergent maturation signals and mediators, like PGE2, from the environment shape DC functions resulting in distinct adaptive immune response. PGE2 is an important lipid mediator involved in many biological processes and represents a key player in the regulation of the immune system [142]. Depending on context and environment, PGE2 can promote or dampen immune responses [101, 142].

PGE2 production is highly induced upon infection or inflammation and accounts for the classical symptoms of swelling, redness, vasodilatation and pain [142]. As exemplified for viral infection, DCs are among the first cells to arrive at the virus entry sites [166]. DCs take up antigens and subsequently orchestrate the immune response by their ability to attract further immune effectors [50]. In the present study, we show an increased expression of the neutrophil and NK cell attracting chemokine CXCL8 within the first hours of MoDC maturation, which is in line with other observations [50]. We report for the first time that PGE2 increases CXCL8 expression in MoDCs matured with inflammatory cytokines, TLR ligands or sCD40L, but not if MoDCs are challenged with LPS. For the latter, it is tempting to speculate that this phenomenon displays a negative feedback regulation as bacterial pathogens themselves are a rich source of fMLP that attracts neutrophils [167]. Moreover, we are first to show a continuous increase of CXCL16 expression by MoDCs in presence of PGE2 which augments immigration of CXCR6 expressing NK T cells, naïve CTLs and a subset of T helper cells into inflamed tissue or secondary lymphoid organs. In contrast, we found that the presence of PGE2 led to a strong down-regulation of the pro-inflammatory chemokines CCL2, CCL4, CCL5 and all CXCR3 ligands to basal or almost undetectable levels independent of maturation stimulus. Hence, the impaired ability to attract important immune effectors, such as monocytes, immature DCs or effector T cell subsets, supports the notion that PGE2 might induce an anti-inflammatory behavior of DCs [113, 145, 168]. Moreover, our data suggest that PGE2 alters the recruitment ability of DCs to attract specific immune effectors, probably to prevent excessive adaptive immune responses, but favors the attraction of primarily innate immune effectors such as neutrophils and NK cells through elevating the expression of CXCL8 and CXCL16. Furthermore, we detected a DC maturation stimulus-dependent regulation of the homeostatic chemokines CCL17, CCL20 and CCL22 by

PGE2.

In an earlier study, PGE2 was shown to up-regulate CCL22 mRNA expression in DCs matured with TNF alone [113]. The authors therefore suggested that addition of PGE2 to the maturation stimulus increased the ability of DCs to interact with regulatory T cells [113]. In

24 Chapter II

contrast, another study showed that using the same condition, PGE2 down-regulated CCL22 expression [136], whereas DCs matured by TNF in combination with IFN expressed similar amounts of CCL22 independently on the presence of PGE2 [113]. Latter is in line with our data indicating that CCL22 was constitutively expressed in MoDCs matured by all four stimuli tested, and that PGE2 did not substantially change the expression profile. Intriguingly, the homeostatic chemokines CCL17, CCL20 and CCL22 can attract FOXP3+ regulatory T cells as well as Th17 cells which share a similar receptor expression pattern [164]. This is of interest because Th17 cells play key roles in several PGE2-mediated autoimmune diseases [104] and were shown to promote CTL activation in tumor immunity [88]. For the latter, the use of PGE2 in clinical maturation protocols might offer beneficial perspectives. Furthermore, we corroborate recent findings [138] and provide further evidence that PGE2 down-regulates CCL19 expression independent of the maturation stimulus. Interestingly, we were able to detect a slight up-regulation of the B cell attracting chemokine CXCL13 by PGE2, enabling DCs to mediate T cell-dependent B cell activation. Taken together and more generally speaking, our results reveal that TLR ligation often leads to a higher chemokine expression and secretion compared to DCs matured with sCD40L or inflammatory cytokines supporting the notion that DCs recognize the inflammatory condition and react in a fine-tuned and highly adapted manner. Considering the altered chemokine expression pattern and the fact that PGE2 facilitates DC homing to lymph nodes [105, 106,

120, 138], we hypothesize that PGE2 renders DCs from orchestrators of innate and adaptive immune responses to rapid antigen deliverers favoring T and B cell activation in secondary lymphoid organs. In summary, our results show that the type and magnitude of chemokine regulation depends on the environment, in particular on the availability of PGE2, in which DCs mature. Moreover, we also provide a diversified overview of the kinetics and magnitude of chemokine expression pattern in human MoDCs.

25 Chapter II

Materials and methods

Generation of human MoDCs

Peripheral blood mononuclear cells (PBMCs) from healthy donors were enriched by density gradient centrifugation on Ficoll Paque Plus (Amersham Biosciences, Uppsala Sweden) and monocytes were isolated using anti-CD14 conjugated microbeads (Miltenyi Biotec, Bergisch- Gladbach, Germany). Monocytes were cultured at 1x106 cells/ml in serum-free AIM-V medium (Gibco, Paisley, UK) supplemented with GM-CSF (Leukomax, Novartis, Basel, Switzerland) and IL-4 as described [106, 107]. After 5-6 days, terminally differentiated, immature DCs were harvested and matured for indicated time points by adding 0.5g/ml soluble trimeric CD40L (sCD40L; PromoCell, Heidelberg, Germany), 20µg/ml poly I:C (Sigma, Saint Louis, MO), 10g/ml LPS (Salmonella abortus equi; Sigma) or a cocktail of cytokines including 20ng/ml TNF, 20ng/ml IL-6 and 10ng/ml IL-1 (PeproTech, London, UK

 and PromoCell) in the presence or absence of 1g/ml PGE2 (Minprostin E2, Pharmacia, Uppsala, Sweden). Blood donation for research purposes was approved by the cantonal ethics committee and individual donors gave written consent.

Quantitative real-time PCR

Total RNA of MoDCs was isolated using the RNeasy Mini Kit (Qiagen, Hilden, Germany) and transcribed into cDNA using random hexamer primers and the Hi Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Rotkreuz, Switzerland) according to the manufacturer`s instructions. Amplification of human CCL2, CCL4, CCL5, CCL17, CCL22, CXCL8, CXCL10, CXCL13 and CXCL16 transcripts was performed using the Fast SYBR Green PCR Master Mix on a 7900HT Fast Real-Time PCR System (Applied Biosystems) with an initial denaturation step at 95°C for 20s followed by 40 cycles of 1s at 95°C and 20s at 60°C. Forward and reverse primers were used at a concentration of 200nM with the following sequences: CCL2: 5`-ACTCTCGCCTCCAGCATGAA, 5`-TTGATTGCATCTGGCTGAGC; CCL4: 5`-CGCCTGCTGCTTTTCTTACAC, 5`-GGTTTGGAATACCACAGCTGG; CCL5: 5`- GAGTATTTCTACACCAGTGGCAAGTG, 5`-CCCGAACCCATTTCTTCTCTG or 5- GCCCACATCAAGGAGTATTTCTACA, 5`-CGGTTCTTTCGGGTGACAA; CCL-17: 5`- GTCACCGCCTGCTGATGG, 5`-CCAGGGCCAGCATCTTCA; CCL20: 5`- AAAAGTTGTCTGTGTGCGCAAA, 5`-TTGGGCTATGTCCAATTCCATT; CCL22: 5`- CTGCCGTGATTACGTCCGTTA, 5`-TCCTTATCCCTGAAGGTTAGCAAC; CXCL8: 5`-

26 Chapter II

CCTTCCTGATTTCTGCAGCTCT, 5`-GGTGGAAAGGTTTGGAGTATGTCT; CXCL10: 5`- CCAGAATCGAAGGCCATCA, 5`-CTCTGTGTGGTCCATCCTTGG; CXCL16: 5`- CAACGAGGGCAGCGTCA, 5`-AAAGGAGCTGGAACCTCGTGT. For amplification of human CCL19 mRNA and for verification of CCL5 mRNA expression the following Taqman® Gene Expression Arrays (Applied Biosystems) with identical thermal conditions were used: CCL19: Hs00171149_m1; CCL5 Hs99999048_m1. The mRNA expression was normalized to the house keeping genes ß-2 microglobulin (ß2M; primers: 5’- GCTATCCAGCGTACTCCAAAGATTC and 5’-CAACTTCAATGTCGGATGGATGA) and ubiquitin C (UBC, primers 5’-ATTTGGGTCGCGGTTCTTG and 5’- TGCCTTGACATTCTCGATGGT) using Fast SYBR Green PCR Master Mix (Applied Biosystems). The relative mRNA expression was calculated by the Ct-method.

Cytokine production

Supernatants of terminally differentiated, immature MoDCs and cells matured for 48h from the same donor were centrifuged and stored at -80°C. The amount of soluble chemokines was quantified using Human Quantikine ELISA Kits (R&D Systems, Minneapolis MN) specific for CCL2, CCL4, CCL5, CCL17, CCL20, CCL 22, CXCL8, CXCL10, CXCL13 and CXCL16. Concentrations of human CCL19 in supernatants were detected by sandwich ELISA. Briefly, MaxiSorp ELISA plates (Nunc, Roskilde, Denmark) were coated overnight with 100µl anti- human CCL19/MIP-3β (5µg/ml) capture-antibody (#AF361; R&D Systems) in PBS at 4°C followed by washing (0.02% Tween-20 in PBS) and blocking with 3% bovine serum albumin (BSA) in PBS for 1h at room temperature. DC supernatants (100µl) were added to the wells, incubated for 1h, washed and incubated with 100µl biotinylated anti-CCL19/MIP-3β antibody (2.5µg/ml) (#BAF361; R&D Systems) diluted in PBS/3% BSA for 1h. Subsequently, plates were washed and incubated with a 1:200 dilution of streptavidin-horseradish peroxidase (R&D Systems) in PBS/3% BSA. After washing, plates were incubated with 100µl 3,3`,5,5`- tetramethylbenzidine (Sigma), the reaction was stopped with 50µl of 1M H2SO4 and absorbance was measured at 450nm. Graded amounts of recombinant human CCL19 (Peprotech) were used as standards. Evaluation of ELISA data was assessed using MagellanTM Data Analysis Software (Tecan Group Ltd., Switzerland).

27 Chapter II

Acknowledgements

We thank Marcus Groettrup and Michael Basler for helpful discussions, and Eva-Maria Boneberg for technical advice. This study was supported in parts by research funding from the Swiss National Science Foundation (SNF 31003A-127474/1), the Thurgauische Stiftung für Wissenschaft und Forschung, the Swiss State Secretariat for Education and Research, and the Thurgauische Krebsliga to DFL. DFL is a recipient of a career development award from the Prof. Dr. Max Cloëtta Foundation.

28 Chapter III

Chapter III

Opposing forces – Prostaglandin E2 counteracts liver X receptor  activation in human dendritic cells

Markus Bruckner1, Denise Dickel1, Eva Singer2 and Daniel F. Legler1

1 Biotechnology Institute Thurgau (BITg) at the University of Konstanz, Kreuzlingen, Switzerland 2 Klinikum Konstanz, Konstanz, Germany

Abstract

Migration and homing of dendritic cells (DCs) to lymphoid organs is pivotal for inducing adaptive immunity and tolerance. DC homing depends on the chemokine receptor CCR7. However, expression of CCR7 alone is not sufficient for effective DC migration. A second signal, mediated by prostaglandin (PG)E2, is critical for the development of a migratory DC phenotype. PGE2 on the one hand is important for inducing efficient immune responses, but on the other hand, e.g. if deregulated, contributes to chronic inflammation, development of autoimmune diseases through Th17 cell differentiation and tumorigenesis. In contrast, tumor- mediated activation of liver X receptor (LXR) has recently been shown to interfere with CCR7 expression and migration of DCs resulting in a reduced anti-tumor immune response.

Here, we demonstrate that PGE2 down-regulates LXR expression in human monocyte- derived as well as ex vivo DCs. In addition, PGE2 stimulation dampens LXR activation and

LXR auto-regulation. PGE2 stimulation rescues CCR7 expression and migration of LXR- activated DCs. Furthermore, we provide clear evidence that PGE2 signaling and LXR activation specifically act in a counteracting fashion on CCR7 expression and DC migration, whereas other PGE2-regulated functions of DCs, such as MMP9 expression and IL-23 production, are not affected, offering new perspectives for therapeutic interventions.

29 Chapter III

Introduction

Dendritic Cells (DCs) are professional antigen-presenting cells and critical for inducing adaptive immunity and tolerance [8, 32, 115]. DCs are found in healthy tissues as immature cells and ready to sample the environment for foreign antigens. Upon infection or inflammation, DCs mature and migrate to the draining lymph node, where the peripherally acquired antigens are presented to T cells in the context of MHC molecules. Mature DCs acquire an enhanced capacity to stimulate T cells which is on the one hand achieved by the up-regulation of co-stimulatory molecules to allow efficient DC-T cell interactions, and on the other hand by the production of cytokines that T cells need to differentiate and proliferate [4]. DC migration to secondary lymphoid organs fully depends on the two chemokines CCL19 and CCL21, which are constitutively expressed by peripheral lymphatic endothelial cells and lymph node stroma cells [71, 169] and its cognate receptor CCR7, which is up-regulated upon DC maturation [8, 60]. The fact that CCR7 and its ligands are mandatory for homing was demonstrated in CCR7-deficient and in plt/plt mice lacking lymphoid CCL21 and CCL19 [60]. The lack of a coordinated CCR7-dependent homing to lymph nodes results in a severely impaired T and B cell immunity [60]. However, CCR7 expression on DCs alone does not necessarily mean that DCs readily migrate towards CCL19 and CCL21. We and others have discovered that CCR7-expressing DCs migrate poorly unless DCs were exposed to prostaglandin E2 (PGE2) during maturation [106, 120, 131, 138, 170]. PGE2, a metabolite of arachidonic acid, plays key roles in initiating and terminating inflammatory responses

[142]. Of note, PGE2–EP4 signaling early during DC maturation not only permits efficient CCR7 signaling and migration in vitro [106, 170] and in vivo [105], but is also critical for the expression of co-stimulatory molecules and augmented T cell activation [105, 107, 152].

Moreover, PGE2-mediated activation of EP4 in T cells and DCs promotes Th1 and Th17 differentiation and expansion, thereby promoting severe autoimmune diseases [104, 127]. Of note, mice lacking the inflammatory microsomal PGE2 synthase 1 (mPGES1) show reduced symptoms of experimental autoimmune encephalomyelitis, whereas mPGES1 is highly expressed at auto-inflammatory sites in multiple sclerosis patients [171]. The nuclear liver X receptors LXR and LXR are oxysterol-activated transcription factors known to play key roles in innate and adaptive immunity [172, 173]. Human monocyte- derived (Mo)DCs and ex vivo peripheral blood myeloid DCs (PBDCs) have been shown to express high amounts of LXR and low, but constant levels of LXR [125]. LXR activation in these cells interfered with cytokine production, LPS-mediated DC maturation and immunological synapse formation by preventing fascin expression [125]. Very recently, activation of LXRs has been shown to prevent TLR-induced CCR7 up-regulation in MoDCs

30 Chapter III as well as HIV-1 capture and trans infection [174] and to interfere with CCR7 expression on mature DCs resulting in a dampened anti-tumour immune response [123].

As PGE2 and LXR ligands play key roles in inflammation, tumour biology and autoimmune diseases and as both lipid derivates seem to have opposing effects on CCR7 expression and

DC migration, we aimed to elucidate the interplay of PGE2 signaling and LXR activation on CCR7 expression and migration of human DCs.

Results

PGE2 down-regulates LXR expression, activation and self-induction in human DCs

CCR7-driven migration of antigen-bearing DCs to draining lymph nodes is pivotal for launching an efficient adaptive immune response. However, CCR7-expressing DCs migrate poorly towards the CCR7 ligands CCL19 and CCL21, except DCs are triggered by PGE2 early during DC maturation [105, 106, 120, 131, 170]. Recently, LXR activation was shown to reduce maturation-induced CCR7 expression and migration of DCs [123, 174] resulting in a poor anti-tumour immune response [123]. As LXR activation emerges to be a major regulator of inflammation [173] and as PGE2 is highly expressed during inflammation and plays a key role in tumours [142], we thought to investigate whether PGE2 regulates LXR expression in maturing DCs. To this end, we matured human MoDCs by different stimuli in the presence or absence of PGE2 and measured LXR and LXR transcripts by quantitative real-time PCR (Figure 1A). PGE2 provoked a fast, profound and sustained down-regulation of LXR, but not LXR, independent whether MoDCs were matured by TLR3 or TLR4 ligation, by CD40L triggering or by cytokines (IL-1, IL-6, TNF). In addition, LXR down-regulation by PGE2 was confirmed on protein levels (Figure 1B).

31 Chapter III

Figure 1. PGE2 rapidly down-regulates LXR, but not LXR, expression in human MoDCs during maturation. (A) Quantitative real-time RT-PCR analysis of human LXR and LXR mRNA expression during maturation of human MoDCs. MoDCs from healthy donors were matured by cytokine cocktail, LPS, polyI:C or trimeric soluble CD40L in presence () or absence () of PGE2. Regulation of specific mRNA expression is depicted as relative expression to immature DCs (0h). Mean values and SEM from at least 4 (LXR) or 3 (LXR) individual donors are shown. (B) Western blot analysis of LXR protein expression in MoDCs matured by cytokine cocktail in presence or absence of PGE2. Levels of -actin of the same blot were determined and served as loading control. One representative experiment of 3 with different donors is shown.

In macrophages, LXR activation results in the synthesis of the cholesterol efflux transporter ABCG1, and of LXR itself through an auto-regulatory mechanism [173, 175]. In order to investigate the influence of PGE2 on LXR activation, we first treated MoDCs with natural active (22R-hydroxycholesterol, 22R-HC), natural inactive (22S-hydroxycholesterol, 22S- HC), as well as with synthetic (T0901317) LXR agonists. As depicted in Figure 2, LXR activation by both natural and synthetic ligands strongly induced its own as well as ABCG1 expression confirming previous observations [123]. In contrast, in MoDCs matured in the presence of PGE2, LXR activation was significantly dampened (Figure 2). It seems unlikely that PGE2 interfered with LXR triggering by inactivating LXR ligands by specific

32 Chapter III sulfotransferases as we did not detect transcripts for the two major sulfotransferases (SULT2B1A and SULT2B1A) in MoDCs (not shown). Of note, MoDCs differentiated in the presence of IL-4 and GM-CSF do not endogenously produce PGE2 [106]. Interestingly, expression of LXR was not diminished in MoDCs that endogenously produce PGE2 (achieved by replacing IL-4 with IL-13 for MoDCs differentiation and maturation [106], indicating that endogenously synthesized PGE2 by MoDCs was not sufficient to confer with

LXR activation (not shown). Our data provide evidence that PGE2 on the one hand down- regulates LXR expression and on the other hand impedes LXR activation, including its auto-regulation.

Figure 2. PGE2 stimulation of MoDCs impairs LXR activation. Human MoDCs were matured with cytokine cocktail in the absence () or presence () of PGE2 with or without specific synthetic (T0901317), natural active (22R-HC) or inactive (22S- HC) LXR agonists for 6h. Relative mRNA expression of the LXR reporter ABCG1 and of LXR itself was determined by quantitative real-time RT-PCR. Mean values and SEM from 5 individual donors are depicted.

PGE2 counteracts LXR-mediated inhibition of CCR7 expression and DC migration

LXR activation by T0901317 strongly reduced CCR7 expression (Figure 3A, B) in cytokine cocktail-matured MoDCs and hampered CCL21-driven MoDC migration (Figure 3C), confirming recent observations in LPS- and CD40L-matured DCs [123, 174]. Of note, residual CCR7 surface expression and marginal specific migration remained upon LXR activation. By contrast, MoDCs matured in the presence of both T0901317 and PGE2 expressed similar levels of CCR7 compared to MoDC matured with cytokine cocktail alone

(Figure 3A, B), indicating that PGE2 counteracts LXR-mediated down-regulation of CCR7. Similar results were obtained when MoDCs were pre-activated with LXR for 2 hours prior maturation (not shown), strengthening the rescuing ability of PGE2 on DC migration. To address whether PGE2 and LXR ligands act as opponents on CCR7 expression, we challenged MoDCs with different concentrations of both agonists against each other. Both

33 Chapter III

PGE2 signaling and LXR activation regulated CCR7 expression in a dose-dependent manner and counteracted on the expression of the chemokine receptor (supplementary Figure S1).

Although PGE2 is known to augment surface expression of CCR7 or to keep CCR7 expression constant depending on the DC maturation stimulus [106, 120, 138], PGE2 significantly enhances DC migration independently of the expression level of CCR7. In

MoDCs matured by cytokine cocktail, PGE2 significantly enhances CCR7 expression by 2 to 3-fold (Figure 4A), whereas specific migration was about 5-times more efficient (Figure 4B).

Interestingly, MoDCs matured in the presence of both PGE2 and T0901317 expressed similar levels of CCR7 compared to untreated cells (Figure 4A, C). In contrast, specific migration in response to CCL21 was higher than in untreated MoDCs albeit significantly reduced compared to DCs matured in the presence of PGE2 alone (Figure 4B). CCR7 expression in

MoDCs matured in the presence of PGE2 and 22S-HC was slightly higher than in DCs matured in the presence of PGE2 and the active stereoisomer 22S-HC or in DCs matured by cytokine cocktail alone. Differences in CCL21-mediated DC migration for the same stimulatory conditions were comparable, albeit more pronounced and significant. Similar results were observed when T0901317 was replaced with the synthetic LXR agonist GW3965 (not shown). Ex vivo peripheral blood (PB)DCs expressed substantial amounts of CCR7 and its expression level was significantly reduced by T0901317 (Figure 5A, B). Again,

PGE2 reverted LXR-mediated down-regulation of CCR7 expression and, more efficiently, DC migration (Figure 5C). As controversial observations on the influence of LXR activation on MoDCs maturation was described [123, 125, 174], we determined the expression of various surface markers by flow cytometry. We did not detect major alterations in CD80, CD86 and HLA-DR expression on MoDCs matured in the presence of active LXR agonists (supplementary Figure S2). However, we found a reduced CD83 expression in T0901317-treated MoDCs in the majority but not all donors tested. As noted previously [131], MoDCs matured in the presence of

PGE2 were non-adherent and formed clusters, whereas many MoDCs matured in the absence of PGE2 showed a needle-like adherent morphology (supplementary Figure S3). Of note, both adherent and non-adherent MoDCs matured in the absence of PGE2 migrated poorly in response to CCL21 (not shown) whereas PGE2 rendered almost the entire MoDC population into a migratory phenotype, lacking an adherent morphology (supplementary Figure S3 and ref [62]. In contrast, LXR-activated MoDCs showed a less migratory phenotype (supplementary Figure S3). Thus, LXR activation of MoDCs leads to down- regulation of CCR7 expression and reduced DC migration, which can be rescued by PGE2.

Highest CCR7 expression and most efficient DC migration, however, are achieved if PGE2 alone is added to the maturation stimulus.

34 Chapter III

Figure 3. PGE2 rescues CCR7 expression and migration of LXR-activated MoDCs. Influence of PGE2 and T0901317 on CCR7 surface expression (A, B) and migration (C) of human MoDCs. T0901317 in the absence () or presence () of PGE2 was added during MoDC maturation induced by cytokine cocktail for two days. CCR7 surface expression was determined by flow cytometry. Results from one representative experiment showing CCR7 expression (black lines) and isotype controls (gray dotted lines) is depicted in (A). Relative specific cell migration towards CCL21 was determined in Transwell chemotaxis assays (C). Mean values and SEM of relative CCR7 expression (B) and specific migration (C) of at least 6 different donors are presented.

Figure 4. Impact of PGE2 and LXR activation on CCR7 expression and migration in MoDCs. Relative CCR7 expression (A), relative CCL21-mediated migration (B) and (C) CCR7/CD83 expression with indicated percentages of human cytokine cocktail-matured MoDCs. MoDCs were stimulated or not with synthetic (T0901317), natural active (22R-HC) and inactive (22S-HC) LXR agonists in the absence () or presence () of PGE2 during maturation. Mean values and SEM of at least 6 different donors are shown. (C) One representative experiment of at least 6 individual donors is depicted.

35 Chapter III

Figure 5. Impact of PGE2 and LXR activation on CCR7 expression and migration in human ex vivo PBDCs. CCR7 expression (A, B), CCL21-mediated migration (C) and CCR7/CD83 expression (D) with indicated percentages of human cytokine cocktail-matured PBDCs. Results from one representative experiment showing CCR7 expression in presence (gray filled areas) or in absence (black lines) of synthetic LXR agonists (T0901317) and controls (gray dotted lines) is depicted in (A). (B, C) PBDCs were stimulated with T0901317 in the absence () or presence () of PGE2 during maturation. Mean values (B, C) and SEM of at least 5 different donors are shown. (D) One representative experiment of at least 5 individual donors is presented.

LXR activation does not interfere with PGE2-regulated production of CCL4, COX-2, MMP9 and IL-23

PGE2 was recently described to induce metalloproteinase (MMP)9 expression in mouse bone-marrow derived (BM)DCs which is essential for BMDC homing to lymphoid organs [122]. As LXR activation in macrophages was shown to inhibit the expression of MMP9 and enzymes for PGE2 synthesis [173, 176], we investigated on MMP9 and COX-2 expression in cytokine cocktail-matured MoDCs exposed to PGE2 and T0901317. As depicted in Figure 6,

PGE2 induced MMP9 and COX-2 expression in human MoDCs. However, LXR activation had no influence on MMP9 and COX-2 expression in MoDCs, neither in the presence nor in the absence of PGE2 (Figure 6A, B). In addition, PGE2 stimulation inhibited the expression of the pro-inflammatory chemokine CCL4 [145] independently of LXR activation (Figure 6C).

Furthermore, PGE2 stimulation of DCs is required for IL-23 production and Th17 differentiation [104, 127] and hence for promoting autoimmune diseases in mice. We confirmed that PGE2 is essential for IL-23 production by human MoDCs. However, we found

36 Chapter III

that LXR activation did not interfere with PGE2-induced IL-23p19 expression (not shown) and IL-23 secretion (Figure 6D). These data provide evidence that the counteracting forces of LXR and PGE2 are restricted to DC migration and CCR7 expression, whereas tissue remodeling and changes in cytokine production by PGE2 are not altered by LXR activation.

Figure 6. LXR activation neither counteracts PGE2-regulated MMP9, COX-2 and CCL4 production nor IL-23 expression in MoDCs. Human MoDCs were matured for two days with cytokine cocktail. Where indicated, PGE2 and T0901317 were added during DC maturation. Relative MMP9, COX-2 and CCL4 mRNA expression (A, B, C) and IL-23 secretion (D) was determined by quantitative real-time RT-PCR and ELISA, respectively. Mean values and SEM of 3-5 different donors are shown. n.d.: not detectable.

37 Chapter III

Discussion

It is well known that deregulated PGE2 production can contribute to severe immune inflammation resulting in tissue damage, autoimmune diseases through Th1 and Th17 cell differentiation, or tumorigenesis [104, 127, 142, 171]. However, under physiological conditions, PGE2 is also known to be necessary for initiating immune responses, e.g. by promoting CCR7-driven DC migration and homing to lymph nodes [105, 106], for efficient T cell priming [105, 107], for keeping the gut mucosal barrier intact preventing colitis [177], and for homeostasis [93]. Recently, other lipid derivatives, namely LXR ligands and its synthetic agonists, were found to dampen CCR7 expression and migration of DCs, hence interfering with inducing proper immune responses [123, 174]. Here, we demonstrate that PGE2 counteracts LXR-mediated dampening of CCR7 expression and DC migration suggesting that PGE2 and LXR ligands execute in opposite ways on CCR7 expression and DC migration. Furthermore, we determined whether LXR-ligands were able to counteract other known PGE2-regulated genes involved in migration and inflammation. For instance, the metalloproteinase MMP9 was shown to be up-regulated by PGE2 and essential for DC migration [70, 122, 178]. Whether oxysterols influence MMP9 expression has not been addressed before. Here, we demonstrate that LXR activation did not down-regulate MMP9 expression and confirmed that PGE2 is essential for MMP9 expression also in human DCs (Figure 6). Our results imply that the described hampered DC migration mediated by LXR agonists solely relies on the negative regulation of CCR7 expression [123], and not by MMP9. Moreover, we found that LXR activation did not perturb down-regulation of CCL4 and induction of IL-23 (Figure 6), which are known to be regulated by PGE2 [129, 144]. In macrophages, LXR activation has been shown to alter the regulation of the PGE2 synthesizing enzyme COX-2 [176]. In DCs, however, we found no indication that LXR activation influenced COX-2 expression (Figure 6). Depending on the maturation stimulus,

PGE2 and LXR agonists have both been shown to regulate CCR7 at the mRNA level [120, 123], suggesting that transcriptional activators/repressors are involved in the counteracting regulation of CCR7 expression. This notion is supported by the finding that PKA activation impaired the binding activity of LXR to DNA, thus abrogating its activity as transactivator/- repressor [179], and that PGE2 signaling is known to elevate cAMP levels in DCs, which is accompanied with increased PKA activity [142]. Of note, on the one hand, Geyeregger and coworkers showed recently, that LXR activation in TLR-activated DCs led to a reduced ability to activate T cells in vitro through down-regulation of the immunological synapse forming protein fascin which was accompanied with reduced secretion of the Th1 polarizing cytokine IL-12p70 [125]. On the other hand, PGE2 was shown to affect the balance of IL-

38 Chapter III

12p70 and IL-23 production of DC skewing T helper cell differentiation from Th1 to Th17 [104, 129]. Interestingly, LXR activation in DCs decreased IL-12p70 production [125] similar to PGE2 which in turn increased the production of IL-23 [129]. In the present study, we observed a small increase in IL-23 secretion upon treatment of DCs with LXR agonists

(Figure 6) pointing to a synergistic effect between LXR activation and PGE2 signaling supporting the common notion that IL-12p70 and IL-23 secretion are reciprocally regulated. Administration of LXR-ligands in mice suppressed the development of experimental EAE in part by reduced IL-23 receptor expression in T cells resulting in impeded IL-23 signaling

[180]. PGE2 stimulation of T cells induced elevated expression of IL-23 and IL-1 receptor which favored Th17 differentiation [127]. Along this line, a recent study showed that LXR activation hampered Th17 differentiation in mice and humans by reducing the expression of the transcription factor RORt [181], which itself is inducible by IL-23, IL-1 and PGE2 [127].

The ability of PGE2 to counteract the influence of LXR agonists on both, DCs and T cells, highlights the importance of understanding the interplay between these lipid mediators in immunity.

Taken together, we provide evidence that PGE2 interferes with LXR activation, down- regulates LXR expression and rescues the migratory ability of DCs to migrate towards CCR7 ligands. Our findings add to the complexity of how the immune system can be regulated by lipid derivates and provide a new perspective how to modulate immune responses in health and diseases by pharmacologically targeting either the PGE2 or the LXR signaling pathway.

39 Chapter III

Materials and methods

Generation of human MoDCs

The study using human blood was approved by the cantonal ethics committee and all participants gave written informed consent. Peripheral blood mononuclear cells (PBMCs) from healthy donors were enriched by density gradient centrifugation on Ficoll Paque Plus (Amersham Biosciences, Uppsala Sweden) and monocytes were isolated using anti-CD14 conjugated microbeads (Miltenyi Biotec, Bergisch-Gladbach, Germany). Monocytes were cultured at 1x106 cells/ml in serum-free AIM-V medium (Gibco, Paisley, UK) supplemented with 50 ng/ml GM-CSF (Leukomax, Novartis, Basel, Switzerland) and 50 ng/ml IL-4 (PeproTech, London, UK) or 10 ng/ml IL-13 (PromoCell, Heidelberg, Germany) to assess COX-2 expression. After 5-6 days, immature DCs were harvested and matured for 2 days by adding 0.5 g/ml soluble trimeric CD40L (sCD40L; PromoCell), 20 µg/ml polyI:C (Sigma, Saint Louis, MO), 10 g/ml LPS (Salmonella abortus equi; Sigma) or a cocktail of cytokines including 20 ng/ml TNF-, 20 ng/ml IL-6 and 10 ng/ml IL-1 (PeproTech and PromoCell).

 Moreover, MoDCs were matured in the presence or absence of 1 g/ml PGE2 (Minprostin E2, Pharmacia, Uppsala, Sweden), 1M T0901317, 1 M 22R-HC or 1 M 22S-HC (Sigma).

Peripheral blood (PB)DCs

Ex vivo myeloid CD1c+ DCs were isolated from PBMCs using the CD1c (BDCA-1) DC Isolation Kit (Miltenyi Biotec). PBDCs were directly matured with the cytokine cocktail for 18- 24h as described above for MoDCs.

Flow cytometry

MoDCs were stained for 60 min at 4°C in PBS containing 1% FCS and 0.02% sodium azide with phycoerythrin or allophycocyanin conjugated anti-CD80, anti-CD83, anti-CD86, (BD Biosciences, Erembodegen, Belgium), anti-CCR7 (R&D Systems, Minneapolis, MN) and isotype-matched control antibodies. Cells were washed and immediately analyzed on a LSRII flow cytometer (BD Biosciences) or fixed using Cell FIXTM according to the manufacturer’s instructions (BD Biosciences) and analyzed within 20h. Relative CCR7 expression was calculated by subtraction of isotype mean fluorescence intensity (MFI) from

40 Chapter III specific CCR7 MFI and related to DCs matured in presence (Figure 4A, 5B) or absence of

PGE2 (Figure 3B). Data were assessed using the FlowJo Software (version 7.2.5; TreeStar, Inc., OR).

Chemotaxis Assay

DCs (1x105 cells in AIM-V medium) were placed on a polycarbonate filter with a pore size of 5 m in a 24-well Transwell plate (Corning Costar) and allowed to migrate towards the lower chamber containing 250 ng/ml CCL21 (PeproTech). Alive (ToPro3- or SytoxBlue-negative; Molecular Probes) input and migrated MoDCs were counted by flow cytometry for 60 sec. The number of spontaneously migrated cells toward AIM-V medium without chemokine was subtracted.

Quantitative real-time PCR

Total RNA of harvested MoDCs at indicated time points was isolated using the RNeasy Mini Kit (Qiagen, Hilden, Germany) and transcribed into cDNA using random hexamer primers and the Hi Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Rotkreuz, Switzerland) according to the manufacturer`s instructions. Amplification of human NR1H3 (LXR) and MMP9 transcripts was performed using the Fast SYBR Green PCR Master Mix on a 7900HT Fast Real-Time PCR System (Applied Biosystems) with an initial denaturation step at 95°C for 20 s followed by 40 cycles of 1 s at 95°C and 20 s at 60°C. Forward and reverse primers were used at a concentration of 200 nM with the following sequences: CCL4: 5`-CGCCTGCTGCTTTTCTTACAC, 5`-GGTTTGGAATACCACAGCTGG; COX-2: 5`- GCCTTCTCTAACCTCTCC, 5`-CTGATGCGTGAAGTGC; MMP9: 5`- CCAGTCCACCCTTGTGCTC, 5`-TTTCGACTCTCCACGCATCTC; NR1H3: 5`- GCTGCAAGTGGAATTCATCAACC, 5`-ATATGTGTGCTGCAGCCTCTCCA. For the amplification of human ABCG1 and NR1H2 (LXR) mRNA the following Taqman® Gene Expression Arrays (Applied Biosystems) with same thermal conditions were used: ABCG1: Hs00245154_m1, Hs01555190_g1; NR1H2: Hs00190268_m1. mRNA expression was normalized to ß-2 microglobulin (ß2M; primers: 5’-GCTATCCAGCGTACTCCAAAGATTC and 5’-CAACTTCAATGTCGGATGGATGA) and ubiquitin C (UBC, primers 5’- ATTTGGGTCGCGGTTCTTG and 5’-TGCCTTGACATTCTCGATGGT) using Fast SYBR Green PCR Master Mix (Applied Biosystems). Relative mRNA expression was calculated by the Ct-method.

41 Chapter III

Cytokine production

Immature MoDCs were stimulated with the pro-inflammatory cytokine cocktail in the presence or absence of 1 g/ml PGE2 and 1 M T0901317. After 2 days, culture supernatants were collected and analyzed using the human IL-23 Ready-Set-Go! ELISA Set (eBioscience, San Diego, CA) according to the manufacturer`s instructions.

Cell lysis and immunodetection

Mature MoDCs were harvested and solubilized in lysis buffer containing 1% Nonidet P-40 and protease inhibitor cocktail (Roche). Samples were separated under reducing conditions on SDS-PAGE and analyzed by Western blot using an anti-human LXR-specific mAb (Abcam, Cambridge, UK). To ensure equal protein loading, blots were stripped and re- probed using a mAb against human -actin (Cell Signaling, Danvers, MA)

Statistical evaluation

Differences between groups were assessed by the student’s two-tailed paired t test using GraphPad InStat (version 3.06; GraphPad Software, Inc.). *p<0.05; **p<0.01; ***<0.001.

Acknowledgements

We are grateful to Marc Müller for assistance in blood collections, and Marcus Groettrup and Michael Basler for helpful discussions. This study was supported in parts by research funding from the Swiss National Science Foundation (SNF 31003A-27474/1), the Pablo Frolich Stiftung, the Thurgauische Stiftung für Wissenschaft und Forschung, the Swiss State Secretariat for Education and Research, and the Thurgauische Krebsliga to DFL. DFL is a recipient of a career development award from the Prof. Dr. Max Cloëtta Foundation.

42 Chapter III

Supplements

Supplemental Figures

Figure S1. Dose dependent counterbalance of PGE2 and LXR activation in human MoDCs. Influence of different doses of PGE2 or LXR on CCR7 expression of MoDCs. (A) matured with cytokine cocktail with PGE2 in indicated gradient amounts of synthetic LXR agonist (T0901317) or solvent or (B) with synthetic LXR agonist (T0901317) in indicated amounts of PGE2. (A,B) One representative experiment of at least 2 independent donors is depicted.

43 Chapter III

Figure S2. Impact of synthetic or natural LXR agonists on MoDC maturation . MoDC surface maturation markers CD80, CD83, CD86 and HLA-DR stimulated or not with synthetic (T0901317), natural active (22R-HC) and inactive (22S-HC) LXR agonists in the absence or presence of PGE2 during maturation. Similar results were obtained with another synthetic LXR agonist (GW3965). One representative experiment of at least 3 independent donors is shown.

Figure S3. LXR activation induces changes on migratory MoDC phenotype. Migratory behavior of DCs is dependent on PGE2-mediated dissolution of adherent podosomes [62]. Phenotypical changes were observed in MoDCs stimulated with synthetic LXR agonist in presence or absence of PGE2 matured with cytokine cocktail for 48h on a culture slide. Pictures were assessed with a Zeiss Axiovert M200 microscope using 10x objective and subsequently analyzed with Zeiss AxioVision imaging software.

44 Chapter IV

Chapter IV

Prostaglandin E2 enhances T cell proliferation by inducing the costimulatory molecules OX40L, CD70 and 4-1BBL on dendritic cells

Petra Krause1,*, Markus Bruckner1,*, Christina Uermösi1, Eva Singer2, Marcus Groettrup1,3 and Daniel F. Legler1,4

1 Biotechnology Institute Thurgau (BITg) at the University of Konstanz, Kreuzlingen, Switzerland 2 Klinikum Konstanz, Konstanz, Germany 3 Department of Biology, Division of Immunology, University of Konstanz, Konstanz, Germany 4 Zukunftskolleg, University of Konstanz, Konstanz, Germany

* contributed equally to this work

Published in Blood 113(11):2451-60

Abstract

Dendritic cell (DC)-based immunotherapy of malignant diseases relies on 2 critical parameters: antigen transport from the periphery to draining lymph nodes and efficient priming of primary and stimulation of secondary immune responses. Prostaglandin E2 (PGE2) signaling has been shown to be pivotal for DC migration toward lymph node-derived chemokines in vitro and in vivo. Here, we demonstrate that PGE2 induced the expression of the costimulatory molecules OX40L, CD70, and 4-1BBL on human DCs. Short triggering by

PGE2 early during DC maturation was sufficient to induce the costimulatory molecules. The expression of the costimulatory molecules was independent of the maturation stimulus but

45 Chapter IV

strictly dependent on PGE2 on both monocyte-derived (Mo)DCs and peripheral blood myeloid

(PB)DCs. PGE2-matured MoDCs showed enhanced costimulatory capacities resulting in augmented antigen-specific CD4+ and CD8+ T-cell proliferation in primary and recall T-cell responses. Blocking OX40/OX40L signaling impaired the enhanced T-cell proliferation induced by PGE2-matured MoDCs. Moreover, MoDCs matured in the presence of PGE2 induced the expression of OX40, OX40L, and CD70 on T cells facilitating T-cell/T-cell interaction that warrant long-lasting costimulation. This newly identified parameter will help to further optimize DC-based immunotherapy.

Introduction

Dendritic cells (DCs) are key players in the defense against pathogens because of their unique capacity to induce primary and secondary T -cell responses. By presenting specific antigens on major histocompatibility complex and by expressing costimulatory molecules, DCs provide essential signals for optimal T cell activation, prevention of tolerance, and development of T cell immunity. The most important costimulatory receptor for early proliferation of naive T cells is CD28, which interacts with CD80 or CD86 on DCs [77]. However, CD28-CD80/86 costimulatory interactions cannot fully account for an efficient long- lasting T-cell response or the generation of memory T cells [182]. T cell proliferation and survival at later phases and the development of memory T cells depend on additional costimulatory molecules belonging to the tumor necrosis factor (TNF)/TNF receptor (TNFR) superfamily and include OX40L/OX40, 4-1BBL/4-1BB, and CD70/CD27 [81]. OX40 is induced on activated T cells and provides an essential signal for optimal CD4+ T-cell function [183-186] as well as for the generation of memory T cells [187-189] by prolonging the survival of effector T cells [188]. Signaling through OX40 is controlled in vivo by the availability of its ligand OX40L. The expression of OX40L is tightly regulated and can be induced on antigen-presenting cells (APCs), such as DCs [190, 191] and B cells [192] and microglia [193]. The lack of OX40L on APCs results in a marked reduction of cytokine production and proliferation of T-helper cells [184, 186]. Murine DCs transfected with mRNA encoding OX40L induce enhanced antitumor activity in vivo, whereas transfection of OX40L mRNA in human monocyte-derived (Mo) DCs improves the induction of antigen-specific cytotoxic T lymphocytes (CTLs) in vitro [194]. CD27 is expressed on naive CD4+ and CD8+ T cells [195] and on primed B cells [196] and triggering of CD27 by CD70 supports T-cell survival. Consequently, constant activation of CD27 by persistent transgenic expression of CD70 on mouse B cells leads to excessive T-cell proliferation [197, 198]. CD70 expression is

46 Chapter IV transiently induced on T-cells, B cells, and DCs after antigen receptor engagement or Toll- like receptor (TLR) stimulation [199-201]. CD70 expression on activated DCs is important for expansion and survival of primed CD8+ T cells in mice [202-204]. In addition to its expression on DCs, OX40L and CD70 can be induced on T cells, providing a mechanism by which costimulatory survival signals are delivered by T-cell/T-cell contacts responsible for keeping T cells alive after APCs and antigens are no longer available to generate memory cells [205]. Because of their natural features, DCs are currently used as cellular vaccines against tumors and infectious diseases [150]. Because DCs in peripheral blood are very rare, the development of a protocol to differentiate blood monocytes into immature DCs in vitro [206], a process that also occurs in vivo [207, 208], boosted the feasibility of DC-based immunotherapies. DC maturation can be induced by addition of sCD40L, poly I:C, lipopolysaccharide (LPS), or a cocktail of proinflammatory cytokines comprising TNF-, interleukin-1ß (IL-1ß), IL-6, and prostaglandin E2 (PGE2) [120, 131, 206]. The presence of the arachidonic acid metabolite PGE2 during DC maturation is fundamental for the acquisition of a migratory DC phenotype both in vitro and in vivo [105, 106, 120], and hence essential for the transport of antigen from the periphery to draining lymph nodes and the induction of an antigen-specific immune response. Langerhans cells deficient in the PGE2 receptor EP4 display a significantly reduced T cell-stimulatory capacity [105]. Moreover, stimulation of human MoDCs with PGE2 enhances their ability to induce allogeneic as well as antigen- specific T-cell proliferation [120, 136, 152]. The mechanism by which PGE2 induces enhanced T cell-stimulatory capacities in mature DCs has not been identified yet. In the present study, we demonstrate that the expression of the costimulatory molecules

OX40L and CD70 on mature MoDCs depends on PGE2 stimulation resulting in a significantly enhanced capacity to induce antigen-specific CD4+ and CD8+ T-cell proliferation.

47 Chapter IV

Results

PGE2 potentiates the capacity of human MoDCs to induce T-cell proliferation

It is well established that PGE2 is the crucial factor during MoDC maturation to generate DCs with a migratory phenotype under serum-free conditions [106, 120]. Moreover, MoDCs matured in the presence of PGE2 show an enhanced capacity to stimulate allogenic T-cell proliferation [120, 152]. To determine whether this effect also applies to antigen-specific T- cell stimulation, we generated MoDCs matured with soluble trimeric CD40L (sCD40L) in the absence or presence of PGE2 under serum-free conditions and cocultured them with autologous CFSE-labeled PBMCs. MoDCs from TT-vaccinated donors were pulsed either with TT to induce secondary (memory) T-cell responses or keyhole limpet hemocyanin (KLH) to promote primary (naive) T-cell responses. Immature antigen-pulsed MoDCs elicited only weak T-cell proliferation after 6 days of coculture (Figure 1A, B), as expected because of the lack of CD83 expression and weaker expression of CD80 and CD86 compared with mature MoDCs (Figure 1C). MoDC maturation by CD40 ligation did not strongly improve T-cell proliferative responses (Figure 1A, B), despite high surface expression of CD83, CD80, and

CD86 (Figure 1C). By contrast, MoDCs matured in the presence of PGE2 promoted strong antigen-specific primary and secondary T-cell proliferation (Figure 1A, B), although expression levels of CD83, CD80, and CD86 were not further increased by the addition of

PGE2 (Figure 1C). Moreover, the augmented stimulatory capacity of PGE2-matured MoDCs affected both CD4+ and CD8+ T cells (Figure 1A, B). The latter must occur by cross- presentation as both antigens, if delivered exogenously to DCs, are known to be presented to CTLs by this pathway [136, 209].

48 Chapter IV

Figure 1. PGE2 enhances T-cell-stimulatory capacities of human MoDCs. Human CSFE-labeled PBMCs were stimulated with tetanus toxoid (TT; A) or keyhole limpet hemocyanin (KLH; B) pulsed autologous immature (iDC) and MoDCs matured with trimeric soluble CD40L (mDC) in the absence or presence of PGE2. On day 6 of the coculture, cells were harvested, stained for CD3, CD4, CD8, and Sytox Blue to identify live T cells, and analyzed by flow cytometry. CSFE fluorescence of live CD3+CD4+ and CD3+CD8+ T cells from a representative experiment of at least 5 is shown. Percentages of proliferating, CSFE low, T cells are indicated. (C) Immature (iDC) or matured MoDCs (mDC) were analyzed for the expression of costimulatory molecules by flow cytometry. MoDCs were matured with sCD40L in the absence or presence of PGE2. Gray thin lines represent isotype controls; black bold lines, specific staining for CD83, CD80, or CD86 as indicated.

PGE2 induces the expression of costimulatory molecules of the TNF superfamily on mature MoDCs and PBDCs

To investigate the mechanism responsible for the enhanced T cell-activating properties of

PGE2-matured MoDCs, we analyzed the gene expression profiles of MoDCs matured with sCD40L in the absence or presence of PGE2 derived from 5 individual donors by Affymetrix GeneChip arrays (Santa Clara, CA). We found nonclassic costimulatory molecules of the TNF superfamily, namely, TNFSF4 (OX40L, CD134), TNFSF7 (CD70, CD27L), and TNFSF9

(4-1BBL, CD137L) to be up-regulated in MoDCs matured in the presence of PGE2, whereas the expression levels of CD80 and CD86 remained unchanged (data not shown). We corroborated these findings by quantitative real-time polymerase chain reaction (PCR) revealing a 10- to 30-fold higher mRNA expression of OX40L, CD70 and 4-1BBL in PGE2- matured MoDCs (Figure 2A). Next, we assessed cell-surface expression of the costimulatory molecules on MoDCs by flow cytometry. Immature MoDCs did not express OX40L and

CD70, and stimulation with PGE2 alone had no effect (Figure 2B, C). Both costimulatory molecules were also absent in DCs after 24 hours or 48 hours of maturation with sCD40L.

However, MoDCs matured by CD40 ligation in the presence of PGE2 markedly expressed OX40L and CD70 (Figure 2B, C) on the cell surface on day 2. Because we cultivated MoDCs under serum-free conditions, a prerequisite for immunotherapy, we investigated whether the observed necessity for PGE2 to induce OX40L and CD70 expression on mature MoDCs was the result of serum deprivation in our culture system. Therefore, we generated MoDCs in

49 Chapter IV medium containing human AB serum and induced maturation using sCD40L with or without addition of PGE2. Even in the presence of serum, PGE2 was crucial for OX40L and CD70 expression on mature MoDCs as MoDCs matured in the absence of PGE2 did not express those costimulatory molecules (Figure 2D). We could not detect surface expression of 4- 1BBL on MoDCs, which may be because of the poor quality of antibodies specific for human 4-1BBL. Next, we investigated the expression of costimulatory molecules on human peripheral blood myeloid (PB)DCs. Ex vivo PBDCs are CD83-, CD80-, CD86low (data not shown[106]) and do not express OX40L and CD70 (Figure 3A). Stimulation of ex vivo PBDCs with sCD40L for 2 days induced surface expression of CD83, CD80, and CD86, but not OX40L and CD70. As for MoDCs, PBDCs expressed OX40L and CD70 exclusively if

PGE2 was added to the maturation stimulus (Figure 3A).

Figure 2. PGE2-dependent expression of costimulatory molecules of the TNF superfamily on MoDCs. (A) Quantitative real-time RT-PCR analysis of TNFSF4 (OX40L), TNFSF7 (CD70), and TNFSF9 (4- 1BBL) mRNA expression in MoDCs matured in the absence or presence of PGE2. Up- regulation of specific mRNA expression levels is depicted as fold increase by PGE2. Mean values and SEM derived from 7 individual donors are shown. Cell-surface expression of OX40L (B, black bold lines) and CD70 (C, black bold lines) on immature MoDCs (iDC) or sCD40L-matured DCs in the absence or presence of PGE2 after 24 hours or 48 hours of culture was analyzed by flow cytometry. MoDCs were generated either in serum-free AIM-V medium (A-C) or AIM-V medium containing 5% human AB serum (D). Gray thin lines represent isotype control stainings. A representative of 3 (D) or at least 5 (B,C) independent experiments with different donors is shown.

50 Chapter IV

Figure 3. Expression of OX40L and CD70 on ex vivo PBDCs and MoDCs strictly depends on PGE2 stimulation. (A) Myeloid DCs were isolated from peripheral blood of healthy donors, and cell-surface expression of OX40L and CD70 (black bold lines) was measured by flow cytometry on ex vivo DCs, or PBDCs cultured for 48 hours in medium alone (no stimulus), or matured with sCD40L in presence or absence of PGE2. (B,C) MoDCs were matured for 48 hours with sCD40L, LPS, poly I:C, or a cytokine cocktail consisting of TNF-α, IL-1β, and IL-6, in the absence or presence of PGE2 and analyzed for surface expression of OX40L (B, black bold lines) and CD70 (C, black bold lines) by flow cytometry. (D) MoDCs were matured with sCD40L, whereas PGE2 was present for the first 3 hours or 15 hours, or for the full period of maturation. Cell-surface expression of OX40L and CD70 (black bold lines) was assessed by flow cytometry after 48 hours of maturation. Isotype control stainings are presented as gray thin lines. A representative of 4 independent experiments with different donors is shown.

Expression of OX40L and CD70 on mature MoDCs is PGE2-dependent

To test whether up-regulation of OX40L and CD70 on DCs generally depends on PGE2, we matured MoDCs by TLR4 or TLR3 stimulation or by adding a cytokine cocktail consisting of TNF-, IL-1ß, and IL-6. Interestingly, MoDC maturation by sCD40L, LPS, poly I:C, or a cocktail of cytokines in the absence of PGE2 was never accompanied by the expression of

OX40L (Figure 3B), whereas MoDCs matured in the presence of PGE2 always expressed OX40L, independently of the maturation stimulus used (Figure 3B). Similarly, CD70 expression on MoDCs was only detectable if PGE2 was added during maturation (Figure 3C). In some donors, maturation via TLR3 signaling alone led to low expression of CD70, which was strongly enhanced in the presence of PGE2 (Figure 3C). In vivo, peripheral DCs are exposed to PGE2 that is produced very early during inflammation by monocytes, macrophages, fibroblast, and keratinocytes [210, 211] only for a short period of time as they rapidly leave the inflammatory milieu. Therefore, we determined whether a short stimulation with PGE2 during the first hours of maturation was sufficient to up-regulate OX40L and CD70 expression on mature MoDCs. As depicted in Figure 3D, both OX40L and CD70 were expressed on MoDCs after a maturation time of 48 hours if PGE2 was added exclusively for the initial 3 hours of maturation. A prolonged presence of PGE2 further increased surface expression of both costimulatory molecules in some donors but was dispensable in others.

51 Chapter IV

PGE2-induced augmentation of T cell-stimulatory capacities of MoDCs is inhibited by OX40L blockage

To determine the impact of PGE2-induced OX40L expression on human MoDCs, we cocultured antigen-pulsed MoDCs matured in the absence or presence of PGE2 with autologous PBMCs while blocking the OX40L/OX40 interaction using a neutralizing goat anti- human OX40L antibody. First, we used TT-pulsed MoDCs from TT-vaccinated donors to investigate the role of OX40/OX40L signaling on a recall, secondary immune response. After

6 days of coculture, neutralizing OX40L antibody inhibited the PGE2-dependent enhanced proliferation of both CD4+ and CD8+ T-cell populations in a concentration-dependent manner, whereas an irrelevant control goat IgG had no effect (Figure 4A, B). The effect of OX40L blockage was even more pronounced on day 12 of coculture (Figure 4C, D), which can be explained by the antiapoptotic signal provided by OX40 leading to survival of proliferating T cells [188]. Noteworthy, the inhibition by OX40L neutralization was not complete, suggesting that CD70 and maybe 4-1BBL contribute to the enhanced T-cell proliferation induced by

PGE2-matured MoDCs. Because there are currently no neutralizing antibodies for human CD70 and 4-1BBL commercially available, we were not able to address their contribution. Next, we tested whether the enhanced primary T-cell response induced by KLH-pulsed,

PGE2-matured MoDCs was also mediated by OX40/OX40L. Indeed, neutralizing OX40L antibody significantly impaired the enhanced expansion of CD4+ and CD8+ T cells induced by

PGE2-matured MoDCs at days 6 and 12 (Figure 5). To rule out a possible role of non-T cells in our coculture system, we purified CD3+ T cells and cocultured them separately with autologous TT- and KLH-pulsed MoDCs matured in the presence or absence of PGE2. Similar to T cells in total PBMCs, cultivation of purified CD3+ T cells with MoDCs resulted in enhanced proliferation of CD4+ and CD8+ T cells when antigen-bearing MoDCs were matured in the presence of PGE2 (Figure 6). Moreover, the PGE2-induced augmentation of T cell-stimulatory capacities of MoDCs was reduced by blocking the OX40L/OX40 interaction (Figure 6).

52 Chapter IV

Figure 4. Blocking OX40L partially reversed the PGE2-induced enhanced capacity of MoDCs to stimulate memory T-cell proliferation. MoDCs were matured with sCD40L in the absence (□) or presence (■) of PGE2, pulsed with tetanus toxoid (TT), and cocultured with autologous CFSE-labeled PBMCs for 6 (A,B) or 12 days (C,D). Graded concentrations of a goat anti– human OX40L-neutralizing antibody (■) or control goat IgG (●) were added to cocultures with PGE2-matured MoDCs, and T-cell proliferation was analyzed by CFSE dilution of live (Sytox Blue negative) cells. Percentages of proliferating, CSFElowCD3+CD4+ (A,C) or CSFElowCD3+CD8+ (B,D) T cells are presented. Mean values and SEM of at least 4 independent experiments with different donors are shown. *P < .05; **P < .01; ***P < .001.

Figure 5. The enhanced primary T-cell response induced by PGE2-matured MoDCs can be inhibited by OX40L blockage. MoDCs were pulsed with KLH and matured with sCD40L in the absence (□) or presence of PGE2 (■) for 48 hours. Freshly isolated autologous PBMCs were labeled with CFSE and cocultured with MoDCs at a PBMC/MoDC ratio of 10:1. Where indicated, 5 μg/mL of a neutralizing goat anti– human OX40L antibody or a control goat IgG was added. CD4+ (A,C) and CD8+ (B,D) T-cell proliferation on day 6 (A,B) or 12 (C,D) of the coculture was analyzed by flow cytometry by CFSE dilution of live (Sytox Blue negative) cells. Mean values and SEM of 7 (A,B) or 4 (C,D) independent experiments with different donors are shown. *P < .05; **P < .01.

53 Chapter IV

Figure 6. Enhanced T-cell response induced by PGE2- matured MoDCs in cocultures with purified CD3+ T cells is inhibited by OX40L blockage. MoDCs were matured with sCD40L in the presence (■) or absence (□) of PGE2 and pulsed with either TT (A,B) or KLH (C,D) for 48 hours. Freshly isolated purified CD3+ T cells were labeled with CFSE and cocultured with autologous MoDCs at a T- cell/MoDC ratio of 10:1. Where indicated, 5 μg/mL of a neutralizing goat anti–human OX40L antibody or a control goat IgG was added. CD4+ (A,C) and CD8+ (B,D) T-cell proliferation was determined by flow cytometry on day 6 of the coculture by CFSE dilution of live (Sytox Blue negative) cells. Mean values and SEM of 3 independent experiments with different donors are shown.

PGE2-matured MoDCs induce expression of OX40L, OX40 and CD70 in T cells

Costimulatory molecules are also involved in contacts between T cells. Expression of OX40L on activated CD4+ T cells has been reported to contribute to an enhanced T-cell survival by triggering OX40 on adjacent T cells [205]. To test whether T cells interacting with (PGE2-) matured MoDCs up-regulate costimulatory molecules and thus deliver an amplification signal, we measured the expression of OX40L and OX40 on CD4+ T cells after 2 and 6 days of coculture of PBMCs with autologous antigen-pulsed MoDCs matured with sCD40L in the absence or presence of PGE2. The percentage of OX40L-expressing T helper cells increased in cocultures with PGE2-matured MoDCs (Figure 7A, B). This holds true for both primary KLH-mediated and secondary TT-mediated immune responses and was observed at day 2 and even more profoundly at day 6 of coculture. Moreover, OX40 is induced in CD4+ T cells after activation rendering them susceptible to OX40L-mediated survival signals [182], + and CD4 T cells from cocultures with TT-pulsed MoDCs matured in the presence of PGE2 expressed significantly more OX40 than those cocultured with MoDCs matured in the absence of PGE2 (Figure 7C). In addition, significantly more T cells expressed OX40 when responding to the primary antigen KLH presented by PGE2-matured MoDCs (Figure 7D). Because the expression of CD70 can be induced on T cells after T-cell receptor engagement [199, 200], we determined the surface expression level of CD70 on CD4+ and CD8+ T cells

54 Chapter IV after 6 days of stimulation by TT-pulsed (Figure 7E) or KLH-pulsed (Figure 7F) MoDCs + + matured in the absence or presence of PGE2. Significantly more CD4 and CD8 T cells expressed CD70 on the surface in cocultures with PGE2-matured MoDCs compared with MoDCs matured in the absence of the arachidonic acid metabolite. The expression of OX40L and CD70 on CD4+ T cells was not restricted to proliferating T cells but was also observed on a population of nonproliferating T cells; and a population of proliferating cells lacked expression of the 2 costimulatory molecules (data not shown).

Figure 7. Enhanced expression of OX40L, OX40, and CD70 on T cells stimulated with PGE2-matured MoDCs. MoDCs were matured with sCD40L in the absence or presence of PGE2, pulsed with TT (A,C,E) or KLH (B,D,F), and cocultured with autologous PBMCs. On days 2 and 6 of the coculture, surface expression of OX40L (A,B), OX40 (C,D), and CD70 (E,F) was analyzed on CD3+CD4+ or CD3+CD8+ T cells by flow cytometry. (A-D) One representative experiment on day 6 is shown as dot plots; diagrams represent mean values and SEM for at least 5 independent experiments with different donors. (E,F) Mean values and SEM of at least 4 independent experiments at day 6 are presented. *P < .05; **P < .01.

55 Chapter IV

In summary, we provide clear evidence that the inflammatory mediator PGE2 is critical during DC maturation, permitting efficient proliferation of antigen-specific CD4+ and CD8+ T cells.

We demonstrate, for the first time, that PGE2 induces the up-regulation of the costimulatory molecules OX40L, CD70, and 4-1BBL on human DCs, correlating with an enhanced capacity to elicit primary and secondary T-cell responses. Blocking OX40/OX40L signaling impaired the enhanced T-cell proliferation induced by PGE2-matured MoDCs. Moreover, MoDCs matured in the presence of PGE2 induce the expression of OX40, OX40L, and CD70 on T cells, which provide prolonged survival signals. Together with the fact that PGE2 facilitates

DC migration permitting the transport of antigens to draining lymph nodes, PGE2 also enables DCs to deliver an efficient costimulatory signal for naive and memory CD4+ and CD8+ T-cell responses.

Discussion

The exceptional ability of DCs to induce antigen-specific immune responses has brought them into the focus of cell-based immunotherapy of malignant diseases. As the quantity of sufficient numbers of primary human DCs is a limiting factor, MoDCs are used as source of DCs in most clinical studies. Large numbers of monocytes can be isolated from peripheral blood of patients and differentiated in vitro under serum-free conditions into immature MoDCs, which are fully competent to take up and process antigens. The pulsing with tumor antigens and induction of maturation results in antigen-presenting DCs, which can potently activate tumor antigen-specific immune responses. We and others have shown previously that supplementation of the maturation stimulus with PGE2 at concentrations found at inflammatory sites is critical to generate MoDCs with a migratory phenotype [62, 106, 120].

Particularly, the presence of PGE2 in the initial phase of maturation is essential to promote

DC migration toward lymph node-derived chemokines [106]. Interestingly, PGE2 also affects T cell-stimulatory properties of MoDCs. Allogenic T-cell proliferation was enhanced in mixed lymphocyte reactions if MoDCs were matured in the presence of PGE2 [120, 152]. In the present study, we provide evidence that PGE2-matured MoDCs have an enhanced potential to induce antigen-specific T-cell proliferation by up-regulating the expression of the costimulatory molecules OX40L, CD70, and 4-1BBL. The expression of OX40L on mature DCs was shown to prolong survival of OX40-bearing CD4+ T cells at the late phase of a primary immune response contributing to the development of a larger pool of memory T cells [183, 188]. Consequently, mice lacking OX40L expression on mature DCs are unable to mount a specific cellular antitumor response [212]. Conversely, transfection of murine DCs with mRNA encoding OX40L augmented the induction of an antitumor response [194]. On

56 Chapter IV human MoDCs, a rather weak induction of OX40L expression has been described after TNF-

 and CD40L stimulation [190]. In the present study, we identify PGE2 as a key factor for the expression of OX40L and CD70 on the surface of mature MoDCs (Figure 2) and PBDCs (Figure 3A). For 4 different maturation stimuli, we observed OX40L and CD70 expression exclusively if DCs were matured in the presence of PGE2 (Figure 3B, C). Notably, addition of the TLR7/8 ligand resiquimod (R-848) to poly I:C and PGE2 for MoDC maturation resulted in migratory DCs that produced high amounts of IL-12p70 [213] (data not shown). However, addition of resiquimod does not induce full maturation of MoDCs [214] (M.B., personal observation, August 2008). Consequently, we did not detect expression of OX40L and CD70 on MoDCs matured by poly I:C and resiquimod, even in the presence of PGE2 (data not shown). For all other maturation stimuli tested, PGE2 induced OX40L and CD70 on DCs. The enhanced proliferation of antigen-specific T cells induced by MoDCs matured in the presence of PGE2 was partially reversed by antibody-mediated blockage of OX40/OX40L interactions (Figures 4-6). Blocking OX40L/OX40 signaling not only inhibited CD4+ T-cell proliferation but also strongly hampered the expansion of CD8+ T cells (Figures 4-6), even though OX40 is described to primarily affect CD4+ T-cell proliferation. However, we detected OX40 + expression on 2% to 15% of CD8 T cells after 6 days of coculture with PGE2-matured MoDCs, whereas OX40 expression was mostly absent if MoDCs were matured in the + absence of PGE2 (data not shown). The inhibitory effect of OX40L-blockage on CD8 T-cell proliferation may be indirect because of impaired CD4+ T-cell help occurring through multiple mechanisms, including cytokine production and supply of costimulatory signals. A role of OX40 on costimulation of CD8+ T cells is described, although the signal is weaker than that delivered by 4-1BB [215] Indeed, we also found a profound up-regulation of 4-1BBL mRNA on MoDCs matured in the presence of PGE2 (Figure 2A), which may contribute to the enhanced CTL response. Unfortunately, we could not investigate the role of human 4- 1BBL/4-1BB signaling in our coculture system because of the lack of specific antibodies. Expression of CD70 on activated DCs contributes to the expansion of CD8+ T cells leading to the generation of memory CD8+ T cells, even in the absence of T cell help [216]. Indeed, binding of CD70 to CD27 promoted survival of activated T cells, rather than augmenting cell- cycle progression [217], and blocking CD70 completely abrogated mouse CD8+ T-cell proliferation [202]. Recently, it has been reported that CD70 must be expressed by DCs for efficient priming of CD8+ T cells to eliminate pathogens in vivo [203]. The observation that antigen-induced expansion of CD8+ T cells is dependent on CD70 expression by DCs highlights the importance of our finding that CD70 expression in human MoDCs fully depended on the presence of PGE2 during maturation (Figure 3C). In addition, we found that + PGE2-matured MoDCs induced CD70 expression on proliferating and nonproliferating CD4 and CD8+ T cells (Figure 7E, F). T-cell/T-cell interaction mediated by CD70 and CD27 is a

57 Chapter IV relatively early event after priming [218] and plays a critical role not only in T-cell activation but also in T cell-dependent modulation of B-cell functions[195]. Similar to CD70, OX40L expression was induced on CD4+ T cells on stimulation by MoDCs matured in the presence of PGE2 (Figure 7A, B). OX40L expressed on T cells provides a potent costimulatory signal, leading to augmented CD4+ T-cell proliferation and sustained CD4+ T-cell longevity [205, 219]. OX40/OX40L interaction between T cells was suggested to occur in T-cell zones of lymph nodes or spleen and to sustain T-cell survival after OX40L expression on APCs had diminished [219]. Therefore, the induction of OX40L and CD70 on T cells by PGE2-matured MoDCs ensures the maintenance of survival signals through T-cell/T-cell contacts resulting in sustained and enhanced antigen-specific immune responses. Triggering costimulatory molecules on APCs and T cells also modulates the profile of cytokine production [195] and hence strongly influences the outcome of a T cell-mediated immune response. CD4+ T cells producing high amounts of IFN- are referred to as Th1 cells and play a major role in the defense against intracellular pathogens and tumors, whereas CD4+ T cells producing IL-4, IL- 5 , and IL-13 are termed Th2 cells and mediate immunity against helminth infection [220]. Interestingly, a recent report points to CD70 as a decision marker for an IL-12 –independent IFN- production/Th1 differentiation by a DEC205+ DC subset in vivo [221]. The role of OX40 in T cell differentiation is more complex. On the one hand, OX40 engagement was shown to enhance IL-4 production of T cells resulting in Th2 effector cell differentiation [219, 222, 223]. On the other hand, in experimental allergic encephalomyelitis and an inflammatory bowel disease model, OX40/OX40L interactions promoted the generation of Th1 responses [193, 224]. Moreover, OX40L triggering on DCs enhanced its production of IL-12 [190], favoring Th1 differentiation, and CD4+ T cells cocultured with MoDCs matured in the presence of

PGE2 produced the Th1 cytokines IFN- and TNF-, but only little IL-4 [136]. Because of these controversial observations, it may be that OX40L/OX40 interactions rather support the survival of activated T cells, which then differentiate dependent on the balance of existing cytokines, than serving as decision maker for Th1/Th2 differentiation. An antitumor immune response is usually weaker than a response to pathogens because of the lack of danger signals. Moreover, the tumor environment can be immunosuppressive, resulting in antigen- specific tolerization of T cells. Stimulation of OX40 can restore antigen-specific proliferation and cytokine production by anergic CD4+ T cells, suggesting that OX40 signals can reverse established tolerance. Along this line, OX40 signaling has been shown to enhance antitumor immune responses, resulting in tumor rejection in a variety of tumor models [225-227]. Breaking tumor-specific tolerance is of pivotal importance for the success of immunotherapy.

The induction of OX40L on MoDCs by PGE2 could hence be a crucial parameter for DC- based immunotherapy. However, overcoming tolerance is not the only challenge immunotherapy is facing. The presence and induction of regulatory T cells (Treg) in tumors

58 Chapter IV pose another problem. Interestingly, OX40 stimulation on T cells not only increases the frequencies of antigen-specific effector and memory T cells, but renders CD25-CD4+ T cells insusceptible to Treg-mediated suppression [228]. Moreover, costimulation by OX40 inhibited TGF-driven Foxp3 expression in CD25-CD4+ T cells and prevented the induction of new Tregs from effector T cells and suppressed the functions of natural Foxp3+ Tregs [229, 230].

Thus, up-regulation of OX40L on MoDCs by PGE2 may fulfill major functions relevant for DC- based immunotherapies: enhancing survival of effector T cells, promoting the generation of memory T cells, breaking established tolerance, and suppressing natural Tregs. Besides their role in the initiation of an adaptive immune response, DCs also play a role in the innate immune system. A recent study demonstrated that the antitumor activity of NKT cells depended on the expression of OX40L on DCs [212], thus further emphasizing the importance of PGE2-mediated OX40L up-regulation on MoDCs.

In conclusion, we demonstrate that human MoDCs greatly enhance their capacity to activate + + naive and memory, as well as CD4 and CD8 T cells if matured in the presence of PGE2 by up-regulating costimulatory molecules of the TNF superfamily. Surface expression of OX40L and CD70 on PBDCs and MoDCs strictly depended on PGE2 stimulation. Expression of OX40L and CD70 on migratory DCs has the potential to improve the efficacy of immunotherapy by promoting protective effector and memory T-cell responses, by hampering antigen-specific tolerance, and by attenuating the suppressor activity of Tregs.

Besides its established role in facilitating DC migration, PGE2-dependent expression of OX40L and CD70 on mature human MoDCs as described herein represents a new parameter that will help to further optimize DC-based immunotherapy.

59 Chapter IV

Materials and Methods

Generation of MoDCs

Human monocytes were positively selected from whole blood of healthy donors as previously described [106, 120]. Briefly, peripheral blood mononuclear cells (PBMCs) were enriched by density gradient centrifugation on Ficoll Paque Plus (GE Healthcare, Little Chalfont, United Kingdom), and CD14+ monocytes were isolated using anti-CD14-conjugated microbeads (Miltenyi Biotec, Bergisch Gladbach, Germany). Monocytes were cultured at 106 cells/mL in serum-free AIM-V medium (Invitrogen, Carlsbad, CA) supplemented with 50 ng/mL granulocyte-macrophage colony-stimulating factor (GM-CSF; Leukomax; Novartis, Basel, Switzerland) and IL-4 (recombinant protein from PromoCell, Heidelberg, Germany, or supernatant of an IL-4-producing J558 cell line; both revealed identical results). Where indicated, MoDCs were generated in AIM-V containing 5% human AB serum (Lonza, Basel, Switzerland). After 5 to 6 days, immature DCs were harvested and matured for 2 days by addition of 0.5 g/mL soluble trimeric CD40L (sCD40L; PromoCell), 20 µg/mL poly I:C (Sigma-Aldrich, St Louis, MO), 10 g/mL LPS (Salmonella abortus equi; Sigma-Aldrich), or a combination of 20 ng/mL TNF-, 10 ng/mL IL-1 and 20 ng/mL IL-6 (all PromoCell).

Maturation occurred in the absence or presence of 1 g/mL PGE2 (Minprostin E 2; GE Healthcare), a concentration found in inflammation and used for clinical applications. For antigen loading, 10 g/mL KLH (Sigma-Aldrich) or tetanus toxoid (TT; Berna Biotech AG, Berne, Switzerland) was added during DC maturation.

Peripheral blood DCs

Myeloid CD1c+ DCs were isolated from PBMCs using the CD1c (BDCA-1) DC Isolation Kit (Miltenyi Biotec) according to the manufacturer’s instructions. Peripheral blood DCs (PBDCs) were analyzed by flow cytometry directly after isolation (ex vivo) or cultured at 106 cells/mL in AIM-V medium supplemented with 50 ng/mL GM-CSF and 50 ng/mL IL-4 (PromoCell). After 2 days of maturation with 0.5 g/mL soluble trimeric CD40L in the absence or presence of 1

g/mL PGE2, cells were analyzed by flow cytometry.

60 Chapter IV

Cocultures and T-cell proliferation assay

Purified CD3+ T cells (Pan T-Cell Isolation Kit; Miltenyi Biotec) or PBMCs were labeled with CFSE (Invitrogen) according to the manufacturer’s protocol. Subsequently, 105 autologous MoDCs were cultured together with 106 PBMCs or purified T cells in 1 mL AIM-V medium. Where indicated, graded amounts of a goat anti-human OX40L-neutralizing antibody (R&D Systems, Minneapolis MN) or control goat IgG (R&D Systems) were added. After 6 or 12 days of coculture, T-cell proliferation was assessed by carboxyfluorescein succinimidyl ester (CSFE) dilution assays using flow cytometry.

Flow cytometry

For cell-surface staining of costimulatory molecules, MoDCs were incubated for 45 minutes at 4°C in phosphate-buffered saline (PBS) containing 1% fetal calf serum (FCS) and 0.02% sodium azide with anti-CD83-phycoerythrin (PE), anti-CD80-PE, anti-CD86-PE, anti-OX40L- PE (clone Ik-1), anti-CD70-PE (clone Ki-24), or IgG-PE isotype control antibodies (all from BD Biosciences, San Jose, CA) and analyzed by flow cytometry (LSRII; BD Biosciences). T- cell proliferation was assessed by measuring CFSE dilution of cells stained with anti-CD3- allophycocyanin/Cy7, anti-CD4-PE/Cy7, anti-CD8-allophycocyanin (BD Biosciences). Dead cells were excluded by Sytox Blue (Invitrogen) staining. Surface expression of costimulatory molecules of nonlabeled T cells was measured using anti-CD3-allophycocyanin/Cy7, CD4- PE/Cy7, CD8-Pacific Blue in combination with either anti-OX40L-PE and anti-OX40-FITC or anti-CD70-PE (BD Biosciences).

Quantitative real-time RT-PCR

Total RNA from MoDCs matured with sCD40L in the absence or presence of PGE2 was isolated using the RNeasy mini kit (QIAGEN, Hilden, Germany) and transcribed into cDNA using random hexamer primers and the TaqMan reverse transcription kit (Applied Biosystems, Foster City, CA) according to the manufacturer’s instructions. Amplification of TNFSF4, TNFSF7, and TNFSF9 mRNA was performed using the QuantiTect SYBR Green PCR Master Mix (QIAGEN) on a TaqMan 7700 (Applied Biosystems) with an initial denaturation step at 95°C for 15 minutes followed by 40 cycles of 15 seconds at 94°C, 30 seconds at 60°C, and 30 seconds at 72°C. Forward and reverse primers were used at a concentration of 200 nM with the following sequences: TNFSF4: 5’-

61 Chapter IV

CACCTACATCTGCCTGCACTTCT, 5’-GTTGTTCTGCACCTTCATGATTTC; TNFSF7: 5’- CCTCGTGGTGTGCATCCA, 5’-ATGCCATCACGATGGATACGTA; TNFSF9: 5’- GAGCTTTCGCCCGACGAT, 5’-GCAGCTCTAGTTGAAAGAAGACATAGTAGA. Expression of mRNA was normalized to ß-2 microglobulin (ß2M) and ubiquitin C (UBC) using SYBR Green PCR Master Mix (Applied Biosystems) containing 200 nM forward and reverse primer (ß2M: 5’-GCTATCCAGCGTACTCCAAAGATTC and 5’-CAACTTCAATGTCGGATGGATGA; ubiquitin C: 5’-ATTTGGGTCGCGGTTCTTG and 5’-TGCCTTGACATTCTCGATGGT). Relative mRNA expression was calculated by the  cycle-threshold (Ct) method.

Statistical evaluation

Differences between groups were assessed by the Student paired t test.

Acknowledgments

We thank Dr Eva-Maria Boneberg for helpful discussions and Stefanie Buerger for excellent technical assistance. This study was supported in part by research funding from the Vontobel Stiftung, the Swiss National Science Foundation (SNF 310000-112421/1), the Thurgauische Stiftung für Wissenschaft und Forschung, the Swiss State Secretariat for Education and Research, and the Thurgauische Krebsliga (D.F.L.). D.F.L. is a recipient of a Career Development Award from the Prof Dr Max Cloetta Foundation.

62 Chapter V

Chapter V

Immobilized Chemokine Fields and Soluble Chemokine Gradients Cooperatively Shape Migration Patterns of Dendritic Cells

Kathrin Schumann1, 8, Tim Lämmermann1, 8, Markus Bruckner2, Daniel F. Legler2, Julien Polleux3, Joachim P. Spatz3, Gerold Schuler4, Reinhold Förster5, Manfred B. Lutz6, Lydia Sorokin7 and Michael Sixt1

1 Hofschneider Group Leukocyte Migration, Max Planck Institute of Biochemistry, 82152 Martinsried, Germany 2 Biotechnology Institute Thurgau at the University of Konstanz, CH-8280 Kreuzlingen, Switzerland 3 Department of New Materials and Biosystems, Max Planck Institute of Metal Reserach, 70569 Stuttgart, Germany 4 Department of Dermatology, University Hospital Erlangen, 91052 Erlangen, Germany 5 Institute of Immunology, Hannover Medical School, 30625 Hannover, Germany 6 Institute for Virology and Immunobiology, University of Würzburg, 97078 Würzburg, Germany 7 Institute for Physiological Chemistry and Pathobiochemistry, University of Münster, 48149 Münster, Germany

8 contributed equally to this work

Published in Immunity 32(5):703-13

63 Chapter V

Abstract

Chemokines orchestrate immune cell trafficking by eliciting either directed or random migration and by activating integrins in order to induce cell adhesion. Analyzing dendritic cell (DC) migration, we showed that these distinct cellular responses depended on the mode of chemokine presentation within tissues. The surface-immobilized form of the chemokine CCL21, the heparan sulfate-anchoring ligand of the CC-chemokine receptor 7 (CCR7), caused random movement of DCs that was confined to the chemokine-presenting surface because it triggered integrin-mediated adhesion. Upon direct contact with CCL21, DCs truncated the anchoring residues of CCL21, thereby releasing it from the solid phase. Soluble CCL21 functionally resembles the second CCR7 ligand, CCL19, which lacks anchoring residues and forms soluble gradients. Both soluble CCR7 ligands triggered chemotactic movement, but not surface adhesion. Adhesive random migration and directional steering cooperate to produce dynamic but spatially restricted locomotion patterns closely resembling the cellular dynamics observed in secondary lymphoid organs.

Introduction

Chemokines are central orchestrators of the hematopoietic system. They control leukocyte migration and positioning within tissues and direct recirculation patterns by inducing extra- or intravasation at vascular sites. On the cellular level, two main responses are triggered upon chemokine receptor signaling: (1) integrin activation that causes adhesion to endothelial surfaces and (2) polarization of the actomyosin cytoskeleton that causes migration along chemokine gradients [231]. Surface adhesion and migration are traditionally viewed as interdependent phenomena, and in mesenchymal and epithelial cells, the integrin repertoire of a cell restricts its migratory ability to defined tissue environments [64]. Adhesive migration is termed haptokinesis when migration is random or haptotaxis when cells move along concentration gradients of immobilized ligands [232]. Haptic movement is strictly confined to an adhesive surface or track as the immobilized integrin ligands play dual roles as mechanical anchors and instructive signals. Leukocytes employ fundamentally different modes of migration, and recent studies have demonstrated that within three-dimensional (3D) environments such as the interstitium, they can directly convert actomyosin forces into locomotion without utilizing integrin-mediated force coupling. Hence, in leukocytes, adhesion and migration can occur independently [68, 233, 234]. We have previously shown that adhesion-independent

64 Chapter V movement can be triggered by soluble chemokines, resulting in chemokinesis (random migration) in response to homogenous chemokine signals or chemotaxis (directed migration) when cells migrate along soluble chemokine gradients [68, 235]. As chemokines can induce both integrin activation and polarization of the cytoskeleton, the question arises: what determines whether only one or both responses are triggered, i.e., when does a chemokine induce leukocytes to adhere, migrate, or adhere and migrate? The best-investigated chemokine effect is the triggering of integrin inside-out signaling, which mediates tight adhesion of leukocytes to the endothelium during extravasation from the bloodstream [236]. It is well established that at sites of inflammation, chemokines are immobilized to the vascular lumen via cell-anchored sugar residues or scavenger receptors [231, 237, 238]. This immobilization appears to be a prerequisite for inducing leukocyte surface adhesion, and there is evidence that soluble chemokines do not efficiently trigger adhesion [239]. This suggests that the mode of chemokine presentation might determine the cellular response. If and how the presentation form of a chemokine affects leukocyte migration has not been systematically investigated. It is also not known how chemokines are presented within tissues. In principle, they could form homogenous fields or spatial gradients and could either be freely diffusible or immobilize to cellular or extracellular surfaces [240]. In this study, we investigate how chemokine presentation within tissues can shape the leukocytes' chemokinetic, haptokinetic, chemotactic, and haptotactic responses. As a model system, we use dendritic cells (DCs), antigen-presenting cells that sample the periphery and, upon exposure to infection or inflammatory stimuli, migrate into the draining lymph node where they present peripherally acquired antigens to naive T cells [8, 241]. DC migration to the lymph node is entirely dependent on the CC-chemokine receptor 7 (CCR7), which is upregulated after pathogen contact [44, 242, 243] and recognizes two ligands, CCL19 and CCL21. CCL21 is expressed on afferent lymphatic vessels and guides DCs into the vessel lumen, while within the lymph node, CCL21 is produced by fibroblastic reticular cells (FRCs), the stromal cells of the T cell area [244]. FRCs also express CCL19, albeit in much smaller amounts [245]. Apart from mature DCs, naive T cells and activated B cells express CCR7, and CCL19 as well as CCL21 are the decisive homeostatic chemokines that direct these cell types into a common compartment of the lymph node where they interact [246, 247]. Why are there two chemokines for the same receptor? While equal receptor binding potency suggests redundancy [248], both chemokines differ in their ability to bind to heparan sulfate residues. This difference is because of a highly charged 40 amino acid extension at the C terminus of CCL21 that is lacking in CCL19. It has been shown that this region immobilizes CCL21 while CCL19 is largely soluble [249-251]. In vivo, C-terminal truncation of CCL21 prevents its immobilization to the lumen of high endothelial venules and consequently abolishes its ability to trigger lymphocyte extravasation [252]. Here, we show that CCL21

65 Chapter V immobilized on FRCs creates a haptokinetic surface for DCs because it triggers both integrin-dependent adhesion and motility. We show that haptokinesis on immobilized CCL21 can be directionally biased by gradients of soluble CCL21 or CCL19, which alone trigger directed migration, but not adhesion. This principle combines the robustness of a haptokinetic surface with the flexibility of a chemotactic gradient. The result is locally adjustable leukocyte swarming within confined areas as it is found in lymphatic organs.

Results

A Reductionist In Vitro System to Study Chemokine-Driven DC Migration

The abundant chemokine in the T cell area of lymph nodes is CCL21 as detected by immunohistology on cryosections [71, 234]. As mature DCs migrate vigorously in response to CCR7 ligands, we tested whether DCs could be employed as environmental sensors of chemokine distribution on cryosections. We layered mature bone marrow-derived DCs on unfixed cryosections of inguinal mouse lymph nodes and followed their behavior by time- lapse video microscopy. In this setup, the cells showed a highly synchronized wave of directed migration from the periphery toward the inner part of the lymph node section (Figures 1A–1C; Movie S1 available online). Twelve to eighteen hours after the onset of migration, DCs accumulated in the center of the lymph node. Migration was observed only when mature DCs were employed and not immature DCs (Figure 1B) or other cell types, including macrophages, mast cells, B cells, and T cells (data not shown). As migratory activity was restricted to defined areas, we tested whether these areas represented the physiological entry routes and combined in vivo and in vitro migration assays to address this issue. Mice were injected subcutaneously with fluorescently labeled mature DCs, and draining lymph nodes were excised after 10 hr. Costaining of the stromal backbone showed that the transferred DCs located to the interfollicular areas (Figure 1D, left panel). Consecutive sections were then used as substrates for in vitro assays. Single-cell tracking of DCs revealed migrating cells in areas that also contained the DCs that had migrated in vivo (Figure 1D, right panel).

66 Chapter V

Figure 1. Organized Dendritic Cell Migration on Lymph Node Cryosections. (A) Contrast enhanced serial images of mature dendritic cells (DCs) on a section. Margins of the section are highlighted by the dotted line. Areas of high DC density are outlined (black line). Red arrows indicate entry sites of DCs. Small insert: brightfield image of the lymph node (LN) cryosection. Black boxes mark T cell area (T), sinus area (S), and control area (C) used for quantification in (B). Scale bar represents 200 μm. (B) DCs were quantified in the areas C, S, and T by automated density measurement. The upper diagram represents mature; the lower represents immature DCs. Data represent one out of > 30 independent experiments. (C) Composite picture of serial images of (A). Different time points were colorized in graded wavelengths from yellow (1 hr) to red (18 hr) to show migratory fractions of DCs on the section. Dotted line: outline of the section. (D) Left panel: section of a lymph node showing fluorescently labeled DCs (green) entering the lymph node via interfollicular areas 10 hr after subcutaneous injection. Laminin staining (red) highlights the reticular fibers surrounding the B cell follicle. Right panel: single-cell tracking of DCs migrating on a consecutive section of the one shown left. Each track represents the pathway of a single cell. Dotted line: outline of the section. Scale bar represents 50 μm.

Response Patterns to CCL21

To define the extracellular signals directing the cells, we employed mature Ccr7−/− DCs in the cryosection assays and found no accumulation in the center of the section (Figure 2A). Similarly, mature wild-type (WT) DCs did not accumulate on lymph node sections obtained from plt/plt mice, which lack expression of both CCR7 ligands [253], while plt/plt DCs accumulated on WT sections (Figure 2A). These findings suggest that CCR7 present on the DCs and CCR7 ligands present on the sections are essential for DC migration on lymph node sections. We conclude that DC migration on cryosections recapitulates the physiological process, while complex intercellular crosstalks are largely excluded as the section is not alive. A simple explanation for the directional movement of the DCs was migration along a graded distribution of CCR7 ligand that is immobilized on the section. In order to visualize immobilized gradients, we immunostained for CCL21 and CCL19. In

67 Chapter V accordance with previous studies [244], CCL19 was not detectable with our histological techniques, while CCL21 signal decorated the reticular network of the T cell parenchyma and left B cell follicles unstained (Figure 2B). Consistent with a previous report [254], the gross staining pattern suggested concentration of CCL21 in the center of the lymph node. To investigate the possibility of DC migration along an immobilized CCL21 gradient, a peripheral portion of a lymph node cryosection was removed and repositioned at 180° to the remaining tissue section (Figure 2C, left panel). Here, DCs showed a wave of directed migration, with migration on the inverted tissue segment still being directed toward the center of the larger segment (Figure 2C, right panel; Movie S2). Migration ceased at the margin of the section as DCs migrate poorly on glass surfaces. Hence, on the inverted segment, the migration direction had changed relative to the tissue substrate. These results disprove migration along an immobilized gradient and suggest the involvement of a soluble gradient, originating from the T cell area.

Figure 2. Dendritic Cells Are Directed by Soluble Gradients. (A) Accumulation of wild-type (WT), Ccr7−/−, and plt/plt dendritic cells (DCs) on either WT or plt/plt lymph node sections. Bars represent mean ± SEM, n = 3. (B) Fluorescent staining of a lymph node section for CCL21 (green) and ICAM-1 (red). Scale bar represents 250 μm. (C) A peripheral part of a lymph node section was dissected, inverted by 180°, and repositioned in close proximity to the remaining part of the section. Left panel: bright-field image of the manipulated section. Right panel: Migratory course of mature DCs on this section. Different time points were colorized in graded wavelengths from yellow (1 hr) to red (4 hr) to show migrating fractions of DCs. Dotted line: outline of the section. Data represent one out of four independent experiments. Scale bar represents 200 μm. ***p < 0.001; ns, not significant.

68 Chapter V

To reduce the complexity of our assays, we next investigated migration in response to immobilized CCL21. DCs were followed by video microscopy while being exposed to a cell culture polystyrene surface decorated with a spot of immobilized CCL21. DCs directly settling onto the coated area showed rapid spreading, followed by random migration. Five to ten minutes after the onset of migration, DCs outside the coated area started to move directionally toward the chemokine spot, while Ccr7−/− DCs were unresponsive (Figures 3A– 3C; Movie S3). These observations suggest that immobilized CCL21 has three effects on mature DCs: (1) it triggers rapid spreading, (2) it triggers random migration, and (3) it triggers the release of a soluble factor that attracts more DCs. We continued to dissect these individual responses in a reductionist manner.

Figure 3. Migration of Dendritic Cells toward Immobilized CCL21. CCL21 was plated on cell culture plastic (coated area marked by dotted circle). (A) Distribution of dendritic cells (DCs) on CCL21 coated area after 2 min (left panel) and 15 hr (right panel). Data show one representative out of > 30 independent experiments. (B) Ccr7−/− DC distribution after 15 hr.(C) Single-cell tracking of migrating WT DCs. Each track represents the pathway of a single cell over 30 min. Migration is directed toward the CCL21 coated area (arrow) and is observed in uncoated areas up to 1 mm from the coated area.

69 Chapter V

DCs Turn Immobilized CCL21 into Soluble CCL21 that Resembles CCL19

We first addressed the nature of the soluble attractant that is produced once DCs contact CCL21. In order to physically separate the site where soluble attractant is produced from the responding cells, we performed underagarose chemotaxis assays. Here, cells and attractant are placed in distant holes of an agarose layer, which allows diffusion of solutes while the cells can migrate between agarose and substrate along soluble gradients [255]. In this setup, CCL21 triggered a minimal chemotactic response in mature DCs, while they migrated vigorously (and directionally) toward a mixture of CCL21 and DCs. DCs alone did not attract other DCs. This demonstrated the induction of a soluble chemotactic gradient once DCs contacted CCL21. This chemotactic response was comparable to DCs migrating toward CCL19 (Figure 4A). Migration toward the mixture of CCL21 and DCs was blocked when the responder DCs were preincubated with pertussis toxin. Moreover, Ccr7−/− DCs were unresponsive (Figure 4A), suggesting that either an unknown CCR7 ligand, CCL19 or an altered form of CCL21 was released upon contact of CCL21 with DCs. As plt/plt DCs plus CCL21 and WT DCs plus CCL21 (in the absence or presence of BrefeldinA to inhibit golgi export, data not shown) triggered comparable chemotaxis (Figure 4A), the induced release of CCL19 or other proteins was excluded. We conclude that the chemotactic cue was most likely a modified variant of CCL21 itself that is produced upon direct contact between DCs and CCL21.To test for possible modifications of CCL21, we performed immunoblot analysis of CCL21 before and after incubation with DCs. A CCL21 fragment of approximately 8 kDa size appeared with increasing incubation times (Figure 4B), but no comparable response was seen upon incubation with naive T cells, B cells, or fibroblasts (Figure 4C). We found a comparable CCL21 fragment when we immunoprecipitated CCL21 from lymph node lysates (Figure 4D), demonstrating the potential in vivo relevance of our findings. Processing was completely blocked by the serine protease inhibitor Aprotinin (Figure 4E), but not by a wide range of other protease inhibitors (data not shown). Accordingly, the supernatant of WT DCs plus CCL21 lost its chemotactic activity in under agarose assays when Aprotinin was present (Figure 4A). To map the site of cleavage, we incubated recombinant CCL21 carrying an N- terminal Flag-tag and a C-terminal His-tag with DCs. Loss of His-tag, but not Flag-tag, immunoreactivity demonstrated cleavage of the C terminus (Figure 4F). Together, these findings demonstrate that upon direct contact with mature DCs, CCL21 is processed into a variant that lacks the heparan sulfate binding residues and is able to diffuse and act chemotactically. Cleaved CCL21 resembles native CCL19, which is neither proteolytically processed nor gains chemotactic activity upon exposure to DCs (data not shown). Accordingly, recombinant truncated CCL21 that lacked the C terminus induced strong chemotaxis (Figure 4A).

70 Chapter V

Figure 4. Dendritic Cells Turn Immobilized CCL21 into Soluble CCL21. (A) Number of migrated cells after 15 hr. Ptx, pertussis-toxin; Apr, aprotinin; Sup, cell supernatant; CCL21 trunc., CCL21 with truncated C terminus. If not otherwise indicated, WT DCs were applied. Error bars represent mean ± SEM, n = 4–8. (B) CCL21 was incubated with DCs for up to 12 hr. Processing of CCL21 was determined by immunoblot analysis. Control (−), CCL21 incubated in medium without DCs. (C) DCs, B cells, T cells, and fibroblasts were coincubated with CCL21 for 12 hr before immunoblot analysis of the supernatant. (D) In vitro: CCL21 cleavage after 12 hr coincubation with DCs. In vivo: pull-down of in vivo cleaved CCL21 out of LN-lysate. (E) CCL21 was incubated with DCs or with DCs and Aprotinin for 15 hr. Control (−): CCL21 incubated in medium without DCs. (F) Immunoblot analysis of tagged CCL21 (detection of CCL21, His- and Flag-tag) after 15 hr incubation with DCs (+). Control (−): CCL21- incubation in medium without DCs. ***p < 0.001; ns, not significant.

Immobilized, but Not Soluble, Chemokine Triggers Integrins on DCs

Morphology of migratory DCs on lymph node sections and on immobilized CCL21 suggested that adhesion is a critical factor for DC migration on the sections: migratory DCs were flattened and polarized, while nonmigrating DCs were rounded and dendritic (Figure 5A; Movie S4). This prompted us to test whether integrins are involved in the migration process. In contrast to negative results with all other integrin family members (data not shown), DCs generated from Itgb2−/− mice neither spread on the interfollicular areas nor accumulated in the center of sections (Figure 5B; Movie S5). We conclude that DC migration on lymph node cryosections is mediated by β2 integrin dependent adhesion. Similarly, Ccr7−/− DCs were not only unable to perform directed migration but also remained rounded on cryosections

71 Chapter V

(data not shown). This suggested that adhesiveness and chemokine sensing were functionally linked and led us to investigate the crosstalk between CCR7 and integrins on DCs. One potential β2 integrin ligand on the sections is ICAM-1, which is abundantly expressed in the T cell area (Figure 2B). WT DCs were monitored upon settling on surfaces coated with a mixture of CCL21 and ICAM-1. The cells showed rapid spreading within minutes after contact with CCL21 plus ICAM-1 (Figure 5C), while ICAM-1 alone did not trigger spreading, indicating a quiescent state of the ICAM-1 binding β2 integrins on mature DCs. When DCs were plated onto surfaces coated with both CCL19 and ICAM-1, only weak spreading was observed (Figure 5C). The same pattern emerged when both chemokines were bound to surfaces that were precoated with polysialic acid, a physiological substrate for CCL21 binding [256] (Figure S1A). Importantly, soluble CCL21 and CCL19 applied in concentrations that exceeded the amounts needed to trigger chemotactic migration did not induce any spreading response (Figure 5D). The lack of spreading on CCL19 could either be due to differential signaling properties or inefficient immobilization of CCL19 because it lacks a charged C terminus. We therefore plated the chemokines on surfaces pretreated to enhance protein-loading capacity. In this setup, where comparable amounts of CCL21 and CCL19 were immobilized (Figure S1B), CCL19 induced substantial spreading (Figure 5E). When Itgb2−/− and Ccr7−/− DCs were plated on the same cocoated surfaces, no spreading was observed (Figure 5E). These findings indicate that the interaction between CCR7 and immobilized, but not soluble, CCR7 ligand induces integrin-dependent spreading, polarization, and migration of DCs (Figure 5F).

72 Chapter V

Figure 5. Immobilized chemokine causes haptokinetic migration. (A) Morphology of a dendritic cell (DC) applied to a lymph node section after 0, 2, and 4 hr. Upper panels: elongated, nondendritic “amoeboid” shape of a DC migrating on a sinus area. Lower panels: rounded, dendritic-like morphology of a nonmigrating DC on a B cell follicle. The cell surfaces are highlighted in green. Scale bar represents 10 μm. (B) Accumulation of WT and Itgb2−/− DCs on a lymph node sections. Error bars represent mean ± SEM, n = 3. (C) Quantification of the 2D projected cell surface after contact with either CCL21 plus ICAM-1, CCL19 plus ICAM-1, or BSA plus ICAM-1 coated glass surfaces after 1, 5, 10, and 15 min. Error bars show mean ± SEM, n = 25. (D) 2D projected surface of DCs on ICAM-1 coated glass surfaces after 1, 5, 10, and 15 min incubation with CCL21, CCL19, or BSA applied to the medium. Error bars represent mean ± SEM, n = 25. (E) 2D projected surface of WT, Ccr7−/−, and Itgb2−/− DCs after contact with a plasma-treated and subsequently CCL21 plus ICAM-1, CCL19 plus ICAM-1, or BSA plus ICAM-1 coated glass surface after 1, 5, 10, and 15 min. Error bars represent mean ± SEM, n = 25. (F) Outline of a DC polarizing on a CCL21 plus ICAM-1-spot over 13 min. The surface of the DC is highlighted in green. Scale bar represents 25 μm. ***p < 0.001.

73 Chapter V

Directional Steering of Haptokinetic Movement

The cryosection assays suggested that haptic migration on a track functionalized with CCL21 can be steered by a soluble gradient of CCR7 ligand. To directly test this in a controlled experimental setup, we established a variant of 3D collagen gel chemotaxis assays. Consistent with our above observation that soluble chemokine does not activate integrins, DCs migrate in a nonadhesive and integrin-independent manner when they are exposed to soluble gradients of CCL19 within the gels [68]. To mimic chemokinetic interfaces, we incorporated carbon microfibers (5 μm diameter) that were previously cocoated with ICAM-1 and CCL21 into the gels. Once in contact with the fibers, DCs adhered to the surface and moved up and down frequently switching directionality, while uncoated fibers were ignored (Figures 6A and 6B; Movies S6 and S7). Itgb2−/− DCs did not associate with the coated fibers (Figure 6C). To test if the haptokinetic cells on the fibers were still responsive to directional stimuli, we introduced soluble gradients of either CCL19 or truncated CCL21 into the gel. As shown previously, this caused directionally persistent chemotactic migration of the non-fiber-associated DCs. Importantly, the soluble gradient directionally biased the DCs on the fibers: once cells contacted a fiber, they preferred to follow its surface even if they were distracted from the direct path (Figures 6E and 6F and Movies S8 and S9). With increasing concentrations of soluble CCL19, less DCs remained on the fibers, suggesting that chemotactic and adhesive signals compete (Figure 6D). Fibers coated with ICAM-1 alone were ignored by the DCs, confirming our previous results that soluble CCR7 ligand does not trigger adhesion. Accordingly, when Itgb2−/− DCs were employed in the assays, they showed no interaction with CCL21 plus ICAM-1 cofunctionalized fibers but moved with normal speed and directionality within the gels (Figure 6G; Movie S10), as expected from our previous studies [68].

These results demonstrate that DCs respond to immobilized CCL21 fields haptokinetically while simultaneously sensing a soluble gradient of CCR7 ligand that introduces a directional bias.

74 Chapter V

Figure 6. Soluble Chemokine Steers Haptokinetic Migration. Three-dimensional collagen gel assays with incorporated protein-coated carbon microfibers. (A, E, F, and G) Left panels: bright-field image of the collagen gel with coated fibers. Right panels: single-cell tracking of dendritic cells (DCs). Here, each colored track represents the pathway of a single cell. (A) DCs in the presence of CCL21/ICAM-1-coated carbon fibers. (B) Differential interference contrast image of DCs spreading on a CCL21 plus ICAM-1-coated fiber. Scale bar represents 50 μm. (C) Quantification of WT and Itgb2−/− DCs associated with CCL21 plus ICAM-1-coated fibers after 5 hr incubation. Bars represent mean ± SEM, n = 5. (D) Quantification of WT DCs associated with with CCL21 plus ICAM-1 coated fibers after 5 hr incubation in a collagen gel with different CCL19 gradients applied. Bars represent mean ± SEM, n = 4. (E) Directionally biased DCs migration on CCL21 plus ICAM-1 coated fibers within a CCL19 gradient. DCs remote from coated fibers migrate through the collagen gel toward the CCL19 gradient. (F) WT DCs migrating with a directional bias in a collagen gel with CCL21 plus ICAM-1-coated fibers toward a gradient of truncated CCL21. (G) Itgb2−/− DCs migrating in a collagen gel with CCL21 plus ICAM-1-coated fibers and applied CCL19-gradient. ***p < 0.001.

75 Chapter V

Discussion

We have shown that in mature DCs, surface-immobilized CCL21 induces both inside-out activation of β2 integrins and cytoskeletal polarization, which results in haptokinetic movement. CCL19, which does not immobilize to surfaces because it lacks a heparan sulfate binding C terminus, does not induce adhesion but does polarize the cytoskeleton and therefore causes chemotactic movement. When both immobilized and soluble chemokines were offered, DCs showed a combined response and performed directionally biased haptokinetic migration. By proteolytically truncating the heparan sulfate binding residue and thereby generating a soluble form of CCL21, DCs generated a self-perpetuating wave of collective migration where immobilized CCL21 dictated the pathway and either solubilized CCL21 or CCL19 the direction of migration. We demonstrated this principle using reductionist in vitro setups. However, the combination of haptokinesis and chemotaxis potentially explains many phenomena that have been observed in vivo, and the principle might apply to lymphocytes as well as DCs. Using intravital or tissue-slice microscopy, it was shown that both blocking of Gi protein-coupled chemokine receptors or the deletion of CCR7 impaired the movement of naive T cells and mature DCs in the lymph node [254, 257, 258]. Hence, chemokine signals are essential for both triggering and maintaining an optimal motile state. Recent intravital microscopy studies provided an extension to this view and demonstrated that the three-dimensional scaffolds of T cell area FRCs and the B cell area follicular dendritic cells represent the tracks along which T and B cells migrate, respectively [259-262]. Interestingly, migration on the tracks lacked any directional bias, resulting in “guided randomness” [263], a swarming locomotion pattern within strictly segregated compartments. Mechanistically, it was suggested that CCL21 that is produced by and immobilized on the FRC surface might form a field that keeps the cells motile [259]. The same was suggested for CXCL13 on B cell follicle stroma cells [262]. However, a kinetic stroma-scaffold alone does not sufficiently explain such behavior. The scaffold additionally has to be adhesive, otherwise the cells would lose surface contact and would “fall off the tracks.” The haptokinetic migration mode we describe here perfectly explains the above in vivo findings. The haptokinetic scaffold is conceptually appealing as an immobilized and therefore static chemokine field and is potentially robust against the convective forces, turbulences, and mechanical perturbations in vivo. While this principle explains homeostatic swarming, it also has limitations: it lacks any directional information and does not allow for local regulation. Most importantly, it does not explain the following phenomena that have been described in vivo: (1) After penetrating the floor of the subcapsular sinus, DCs migrate directionally around the B cell follicles into the deeper T cell regions [68, 264]. (2) Upon activation, B cells

76 Chapter V upregulate CCR7 and move directionally toward the interface between T and B area, and the experimental introduction of CCR7 into naive B cells has the same effect [247, 265]. (3) Upon lymph node entry, epidermis-derived DCs that only express CCR7 settle in the deep T cell area [266-268], while dermis-derived DCs that express both CCR7 and CXCR5 [267] move to areas closer to the B cell follicles. These and other in vivo reports of directional migration within lymphatic organs [153, 265, 269], together with in vitro findings that T cells, B cells, and DCs are all capable to migrate toward spatial chemokine gradients [68, 235, 258], strongly argue for the presence of graded distributions of chemokines within lymphatic organs that serve not only as motility triggers but also as long-range directional cues. The directionally biased haptokinesis that we describe here resolves the dilemma between the kinetic and the tactic model as it combines the robustness of haptokinesis with the flexibility of chemotaxis. It also harbors many regulatory possibilities that we did not directly address in our reductionist approach. Physiological phenomena such as blurred borders between T and B cell area during inflammatory responses [265] might well be caused by shifting the balance between soluble and bound CCR7 ligand as in the example caused by the proteolytic shedding of CCL21 that we describe. In this context it is interesting that the chemotactic “pull” of a soluble gradient counteracts adhesion to the immobilized chemokine and vice-versa. This means that either steep soluble gradients or sparse CCL21 and integrin- ligand coating of the FRCs might, depending on the chemokine receptor expression level of the responding cell, individually influence intranodal positioning and also dwell times of cell populations within the lymph node. It was shown that stroma cells of reactive lymph nodes downregulate the transcription of homeostatic chemokines, leading to reduced T cell priming during secondary immunizations [270]. Shedding of CCL21 might act similarly, even before such transcriptional responses occur, and possibly causes local micromilieus within the reactive lymph node. Solubilization of chemokines might further support collective movement patterns as they have been described for DCs: here, migrating cells locally recruit more cells into the lymph node, a phenomenon that has been described as lymph node conditioning [271]. From a cell biological perspective, kinesis is the product of either spontaneous or externally triggered self-polarization. Self-polarization does not rely on asymmetrical external cues and thereby causes cytoskeletal rearrangements and migration in a random direction [272, 273]. Recently, it has been proposed that self-polarization and directed migration might be more closely connected than previously considered. Arrieumerlou et al proposed a model that describes directed movement as a phenomenon that is superimposed on self-polarization. Here, every chemokine-triggered signaling event that occurs within one of many leading edge protrusions of a self-polarized cell leads to local re-enforcement of the protrusion. Consequently, an initially random migrating cell gradually turns toward the source of the

77 Chapter V chemotactic cue and thereby performs a “directionally biased random walk” that shows increasing directional persistence with increasing steepness of the gradient [274]. The directionally steered haptokinesis we observed in the present study can be viewed as an extension of this model, where immobilized CCL21 triggers adhesion as well as random polarization and migration, while soluble chemokine gradients introduce a directional bias (see schematic in Figure S2). Apart from offering a cell biological explanation for observed phenomena of intranodal leukocyte migration, our findings might be of more general relevance. We have recently shown that leukocytes are able to migrate with identical velocities in the adhesive and nonadhesive mode because they efficiently adapt their cytoskeletal dynamics [275]. Although this means that integrins are not essential for actual movement, they can shape the migratory pathway and also mediate close contact with surfaces while the cell moves. This makes physiological sense because diffusive distribution of soluble cues is largely unaffected by extracellular matrix components. Cells that are nonadherent can directly follow these cues without being “distracted” by the local cellular or extracellular infrastructure. Only once it is decorated with an immobilized chemokine that activates integrin-mediated anchoring, the infrastructure becomes adhesive and therefore affects the behavior of the cell.

Materials and Methods

Reagents

Chemokines: recombinant murine CCL19 and CCL21 and murine ICAM-1 humanFc fusion protein were purchased from R&D Systems. For immunofluorescence polyclonal rabbit anti- mouse laminin 111 [22], rabbit anti-mouse Exodus-2 (PeproTech) monoclonal hamster anti ICAM-1 (PharMingen) were used. Primary antibodies were detected using FITC- or Cy3- conjugated goat anti-rat or goat anti-rabbit IgG (Dianova). Primary antibodies employed for immunoblot analysis were as follows: rabbit anti-mouse Exodus-2 (PeproTech), mouse anti- His-Tag (Novagen), and anti-Flag M2-Peroxidase (Sigma-Aldrich). Anti-rabbit horseradish peroxidase (HRP) and anti-mouse-HRP (both Biorad) were used as secondaries.

Mice

Itgb2−/− [276], Ccr7−/− [242], and plt/plt mice [253] were kept on a C57BL/6 background and bred in a conventional animal facility according to the local regulations.

78 Chapter V

Generation of Bone Marrow-Derived DC

DCs were generated from flushed bone marrow as described previously [277]. Maturation was induced overnight with 200 ng/ml LPS (Sigma-Aldrich; E. coli; 0127:B8) on days 9–11 of culture. All experiments with DCs were performed in R10 medium (RPMI supplemented with 10% fetal calf serum [FCS] [both Invitrogen; FCS heat-inactivated for 20 min at 57°C], penicillin-streptomycin, and glutamine [PAA]).

Immunofluorescence Microscopy

Cryostat sections (8 μm) were fixed in methanol at −20° for 10 min, blocked with 1% BSA, and subjected to standard immunofluorescence staining procedures. Stained sections were examined using either a Zeiss Axiophot fluorescence microscope and documented with the Openlab software version 3.1.2 (Improvision) or an inverted confocal microscope (Leica, SP2).

In Vivo Migration of DCs

Mature DCs were labeled with 5 μM 5-, 6-carboxyfluorescein diacetate succiniminidyl ester (CFSE) according to the manufacturer's recommendations (Molecular Probes). After labeling and extensive washing in phosphate buffered saline (PBS), 5 × 105 DCs in a volume of 20 μl PBS were injected into the hind footpads. Draining lymph nodes were harvested and snap- frozen in liquid nitrogen.

Production of Recombinant Chemokines

Tagged recombinant CCL21 was produced using the Pichia pastoris yeast expression system (Invitrogen). The coding sequence of mature CCL21 (amino acids 24–133) was PCR- amplified from pET52-CCL21 (forward: 5′-ACG TAG AAT TCC GAC TAC AAG GAC GAC GAT GAC AAG AGT GAT GGA GGG GGT CAG GAC-3′; reverse: 5′-TAC GTA TCT AGA GG TCC TCT TGA GGG CTG TGT CTG-3′). The product was cloned into pPICZαC (Invitrogen), and the plasmid linearized with ScaI (NEB) and transfected into P. pastoris SMD1168H (Invitrogen). CCL21 was purified from the yeast culture supernatant using NTA agarose (RAQ007.2, QIAGEN).

79 Chapter V

Full-length and C-terminally truncated CCL21 (amino acids 24–98) were PCR-amplified introducing a stop codon (forward: full-length and truncated mCCL21: 5′- CAAGGTCTCAGGTGGTAGTGATGGAGGGGGTCAG; reverse: full-length, 5′- CAGCTCGAGTCATCCTCTTGAGGGCTGTGTCTG; truncated, 5′- AATCTCGAGTCATTTCCCTGGGGCTGGAGG). PCR fragments were cloned into pET-6his- SUMO-1. Transformed E. coli B834(DE3)pLysS (Novagen) were disrupted (Constant Systems Ltd.), supernatants were loaded on a HisTrap HP column (GE Healthcare), and bound proteins were eluted with PBS containing 500 mM imidazole using an AKTA Explorer chromatography system (Amersham Biosciences). Eluted fractions were digested with a C- terminal his-tagged Ubl-specific protease 1 (ULP1) at 4°C followed by purification of cleaved chemokines in a Zn2+ charged HiTrap IMAC FF column (GE Healthcare) and optional gel filtration (HiPrep Sephacryl S-200, GE Healthcare).

Analysis of Chemokine Cleavage

150 ng of untagged CCL21 (R&D Systems) or 75 ng tagged CCL21 (expressed in P. pastoris) were incubated with 6 × 105 DCs in 100 μl R10-medium for 4–12 hr at 37°C, 5%

CO2. The proteins in the cell supernatants were separated by SDS-PAGE on 15% Tris- lysine-gels and blotted on PVDF membrane (Immobilon, 0.2 μm, Millipore). Membranes were blocked with PBS containing 5% BSA (PAA), and consecutively incubated with first antibody and HRP-conjugated secondary antibody. Signal was detected using Western Lightning Chemiluminescence Reagent Plus (PerkinElmer). For CCL21 pull-down from lymph node- lysate popliteal, inguinal and axillary LNs were harvested and sonicated in lysis buffer (50 mM Tris [pH 8], 150 mM NaCl, 10 mM EDTA, 0.05% Desoxycholate, 1% Triton, and protease inhibitor cocktail [Roche]). For antibody binding, ProteinG Dynabeads were incubated in washing buffer (PBS [pH 7.4] with 1% Triton) containing rabbit anti-mouse Exodus-2 (PeproTech). After extensive washing, beads were incubated with the lysate and subsequently washed and resuspended in 6× SDS-PAGE sample buffer, heated at 95°C for 10 min, and analyzed by SDS-PAGE.

In Vitro Migration Assays

For migration on cryosections mouse inguinal lymph nodes were snap-frozen in liquid nitrogen. Eight to ten μm thick sections were collected on glass slides. The slides with the section were then immobilized on the bottom of a custom-built migration chamber, covered

80 Chapter V with DCs in R10 medium, and observed by time-lapse video microscopy. For migration on chemokine spots, custom-made glass bottom cell culture dishes were either left untreated or incubated for 1 min in a plasma cleaner. A drop containing 22.5 μg/ml CCL21 or CCL19 and 10 μg/ml ICAM-1 was incubated on a coverslip (optionally precoated with 10 μg/ml polySia [Sigma-Aldrich]) in PBS for 30 min at 37°C. After washing with PBS, the surface was covered with 1 × 106 DCs/ml in a custom built incubation chamber. The surface area of the cells was documented after 1, 5, 10, and 15 min. Underagarose assays were performed as described previously [255]. Wells (volume approx. 7 μl) were filled with 6 × 104 DCs and/or 625 ng/ml CCL19, CCL21, or truncated CCL21. Pertussis-Toxin (List Biochemicals) was applied at 20

μg/ml, and Aprotinin (Calbiochem) was applied at 150 μM. After 15 hr at 37°C, 5% CO2, cells that migrated out of the “responder” hole were photographed using a Zeiss Axiovert 40 CFL microscope and manually counted. Collagen assays were performed as described previously [68] with a collagen concentration of 1.6 mg/ml and 106 DCs/ml. The gels were cast in a custom-made chamber (thickness of 2 mm) with protein-coated carbon fibers (BP 2308, BALTIC). For coating, fibers were incubated with 5 μg/ml ICAM-1 and either 0.1% BSA (PAA),5 μg/ml CCL21 or CCL19. Polymerized gels were covered with R10-medium or R10- medium containing 0.17 μg/ml CCL19 or 0.54 μg/ml truncated CCL21 and observed by time- lapse video microscopy.

Image Processing

Color-coded composites were generated by superimposing background-subtracted binary layers using Openlab software version 3.1.2 (Improvision). Automated cell counting was done by creating background-subtracted binary layers and subsequent automated pixel density measurements in the marked areas using Openlab software. Single-cell tracking and surface measurements of cells were either done with the classification module of Volocity software version 2.5 (Improvision) or ImageJ software employing the “Manual Tracking Plugin” (http://rsbweb.nih.gov/ij/). Surface measurements were done with Metamorph software (Molecular Devices).

Statistical Analysis

Student's t tests and analysis of variance (ANOVA) were performed after data were confirmed to fulfill the criteria of normal distribution and equal variance. Analyses were performed with Sigma Stat 2.03.

81 Chapter V

Acknowledgments

This work was funded by the Peter Hans Hofschneider Foundation for Experimental Biomedicine, the German Research Foundation, the Max Planck Society, the Swiss National Science Foundation, the Max Cloëtta Foundation, the ELAN Fond of the University of Erlangen, and European Union Marie Curie Fellowships to M.S. and J.P. We thank the members of the Sixt laboratory for discussions and critical reading of the manuscript, N. Catone for technical assistance, and R. Fässler for continuous support.

Supplements

Supplemental Figures

Figure S1: DC spreading on with polysialic acid (polySia)-coated surfaces / Quantification of immobilized CCL21 and CCL19. (A) Cell culture dishes were coated over night at 4 °C with 10 µg/ml polySia (Sigma-Aldrich) in PBS. After two washing steps with PBS the dishes were blocked for 30 min at 37°C with TSM (20 mM Tris-HCl, 150 mM NaCl, 1 mM CaCl2 , 1 mM MgCl2 ) containing 1% BSA (PAA). After washing with PBS a drop of either 22.5 µg/ml CCL21 (R&D Systems) or 22.5 µg/ml CCL19 (R&D Systems) in PBS containing 0.1% BSA mixed with 10 µg/ ml ICAM-1 (R&D Systems) was applied. For controls, spots of 0.1 % BSA in PBS mixed with 10 µg/ml ICAM-1 (R&D Systems) were applied. All spots were incubated for 30 min at 37 °C. After washing, the chemokine plus ICAM-1 coated area was covered with 1x106 cells/ml. The surface area of the cells was determined microscopically after 1, 5, 10 and 15 min. Bars represent mean ± SEM, n = 25 cells. (B) Microscope slides were incubated for 1 min in a plasmacleaner. Compartments were demarkated with a PapPen (Kisker) border stripes and within the compartments 3 drops of either 22.5 µg/ml CCL21 (R&D Systems) or 22.5 µg/ml CCL19 (R&D Systems) mixed with 10 µg/ ml ICAM-1 (R&D Systems) were incubated for 30 min at room temperature. Spots were washed with PBS and subsequently incubated with either 1 µg/ml anti-CCL21 (Exodus2; rabbit; Peprotech) or 1 µg/ml anti-CCL19 (goat; R&D Systems) in PBS with 1% BSA (PAA) for 30 min. After washing the coated areas were incubated with 7.5 µg/ml anti-rabbit Cy3 (donkey; Jackson ImmunoResearch) or anti-goat Cy3 (donkey; Jackson ImmunoResearch) in PBS with 1% BSA. After washing with PBS the slides were embedded and fluorescence intensities quantified using Metamorph software. Bars represent mean ± SEM, n = 10.

82 Chapter V

Figure S2: Schematic representation of chemotactically biased haptokinesis. The scaffold in the big panel represents the fibroblastic reticular cell network of secondary lymphoid organs. The scaffold is decorated with the integrin ligand ICAM-1 and immobilized CCL21. The soluble chemokine gradient (grey; either CCL19 or solubilized CCL21) establishes three principle motility patterns that are depicted in panels A-C. (A) Steep gradients of soluble CCR7 ligand lead to detachment of the DCs from the haptokinetic scaffold and integrin- independent migration along the gradient. (B) Shallow gradients induce directionally biased haptokinesis. Here, immobilized CCL21 induces inside-out activation of β2 integrins that confine the cells to the scaffold while soluble CCR7 ligand induces the directional bias. (C) In the absence of soluble CCR7 ligands, cells perform haptokinetic random migration that is strictly confined to the fiber scaffold.

83 Chapter V

Legends of supplemental movies

(movies online available at the publisher`s website [278])

Movie S1. Migration of mature DCs on a lymph node cryosection. An unfixed cryosection of a murine inguinal lymph node was fixed on the bottom of a cell culture dish and covered with mature DCs. The DCs show a highly synchronized wave of migration from the peripheral parts of the section and even from the surrounding of the section towards the center of the lymph node (LN) cryosection. The cells enter the LN section along defined segments, suggesting migration along preformed tracks. 12-18 h after the start of migration the cells accumulate in the inner part of the LN section. Cell behavior was followed by time-lapse video microscopy over 18 h (103 frames, 15 frames/s).

Movie S2. Migration of mature DCs on a lymph node cryosection with a removed and inverted peripheral part of the section. A peripheral part of a lymph node cryosection was cut off and repositioned inverted by 180° in close proximity to the remaining section to challenge the possibility of DC migration on immobilized gradients. Applied mature DCs again showed a wave of directed migration, but the migration on the small segment was still directed towards the center of the big segment. This result implicates the induction of a soluble chemotactic gradient. The DCs were imaged over 4 h (41 frames, 15 frames/s).

Movie S3. DC migration on immobilized CCL21. In this reductionistic in vitro approach CCL21 was dropped on cell culture plastic and after 30 min at 37 °C non-immobilized chemokine was washed away with PBS. The coated area was then covered with mature DCs. The cells settling directly on the immobilized area showed random migration. 5 – 10 min after the onset of migration, DCs near to the coated area start directed migration to the center of the spot and accumulate there. DC migration was monitored over 15 h (104 frames, 15 frames/s).

Movie S4. DC spreading on different structural parts of a lymph node cryosection. In this time-lapse movie a representative DC migrating on an interfollicular area (left) and a DC sitting on a B cell follicle (right) is shown. DC migration was monitored over 1 min (29 frames, 15 frames/s).

Movie S5. Migration of wt and Itgb2-/- DCs on a lymph node cryosection. The time-lapse movie over 20 min shows wt (left) and Itgb2-/- (right) DCs crawling on a lymph node cryosection (41 frames, 15 frames/s).

Movie S6. Wt DCs migrating in a 3D collagen gel with incorporated BSA plus ICAM-1 coated carbon fibers. DCs migrate in a 3D collagen matrix where BSA plus ICAM-1 coated fibers were embedded. DCs show unbiased random migration in the collagen matrix. The DCs were recorded over 4 h (241 frames, 30 frames/s, without and with cell tracking).

Movie S7. Wt DCs migrating in a 3D collagen gel with incorporated CCL21 plus ICAM-1 coated carbon fibers. Time-lapse movie of DCs migrating in a 3D collagen gel with incorporated CCL21 plus ICAM-1 coated carbon fibers. When the cells get into contact with the coated fibers, they adhere and move along the fiber with frequent directional changes. Cell behavior was monitored over 4 h (241 frames, 30 frames/s, without and with cell tracking).

Movie S8. Wt DCs migrating in a 3D collagen gel with incorporated CCL21 plus ICAM-1 coated carbon fibers towards a CCL19 gradient. DCs migrate in a 3D matrix with embedded CCL21 plus ICAM-1 coated fibers. An additional external CCL19 gradient is applied (highest concentration on top). Once the cells get into contact with the fibers, they adhere and move along the fibers with a bias towards the CCL19 source. Occasionally, cells detach from the fibers and migrate freely through the gel. This movie shows directional steering of haptokinetic movement. The cells were monitored over 4 h (241 frames, 30 frames/s, without and with cell tracking).

Movie S9. Wt DCs migrating in a 3D collagen gel with incorporated CCL21 plus ICAM-1 coated carbon fibers towards a gradient of truncated CCL21. The time-laps movie shows wt DCs crawling in a 3D collagen matrix towards a gradient of truncated CCL21 (highest concentration on top) over 4 h (241 frames, 30 frames/s, without and with cell tracking). The DCs show directed migration with a directional bias towards the full-length CCL21 on the fibers. The truncated CCL21 resembles the CCL19 gradient in Movie S8.

Movie S10. Itgb2-/- DCs migrating in a 3D collagen gel with incorporated CCL21 plus ICAM-1 coated carbon fibers towards a CCL19 gradient. The time-laps movie shows Itgb2-/- DCs crawling in a 3D collagen matrix towards CCL19 (highest concentration on top) over 4 h (241 frames, 30 frames/s, without and with cell tracking). The DCs show directed migration, but do not interact with the included CCL21 plus ICAM-1 coated fibers.

84 Chapter VI –Discussion

Chapter VI

General discussion

Host defense mechanisms arose with the beginning of life and have evolutionary developed as complex as the life-form they are protecting. During the past billion years, host defense in primitive, invertebrate life-forms has evolved to a highly complex immune system as present in mammals. Development of immunity or tolerance requires the general ability of the army of immunological sentinels to distinguish between “self”, “non-self” and “altered-self” [279]. The innate immune system has evolved coincident with the existence of life and is characterized throughout all living organisms by the ability to rapidly detect and respond to threats. During the evolution, very complex host defense mechanisms have developed that allow the protection of equally sophisticated organisms. In vertebrates, the complex system of adaptive or acquired immunity is highly effective endowed with an immunological memory [279]. It is without a doubt that the interplay between the innate and adaptive immune system plays a crucial role in the outcome of immune responses. Dendritic cells (DCs) represent linkers between the non-specific innate and the antigen-specific adaptive immune system by virtue of their ability to recognize and acquire antigenic information which is subsequently used to educate cells of the adaptive immune system in secondary lymphoid organs (SLOs) [280]. A growing body of evidence suggests that DCs orchestrate immune responses by recruiting innate and adaptive immune effectors into inflamed or lymphoid tissues via the controlled release of distinct chemokines [45, 50]. It is assumed that DCs conduct immune responses in a fine tuned and highly adapted manner as they are the first ones to arrive upon microbial encounter [166]. Findings demonstrating that DCs adapt their inflammatory gene-expression pattern to the type of encountered pathogen [139] support this notion and prompted us to investigate the chemokine expression pattern in monocyte-derived DCs (MoDCs) in response to distinct signals derived from various sources. Interestingly, in most cases we observed a pronounced increase of pro-inflammatory chemokine expression upon TLR activation in human MoDCs compared to activation with sCD40L or pro-inflammatory cytokines (Chapter 2). It is tempting to speculate that TLR-mediated activation of DCs, resembling a direct pathogen encounter, leads to an elevated recruitment of immune effectors into the inflamed tissue to curtail infection. Prostaglandin E2 (PGE2), a very important inflammatory mediator produced in acute and chronic inflammation [94, 98, 281], impaired the ability of human MoDCs to recruit distinct immune effector subsets via the pro- inflammatory chemokines CCL2, CCL4, CCL5 and CXCL10, but concurrently favored the

85 Chapter VI –Discussion attraction of cells expressing CXCR1-2 and/or CXCR6 (Chapter 2). These results give rise to a model in which rapidly released PGE2 under acute inflammatory conditions [116] may instruct DCs to preferentially recruit neutrophils and distinct subsets of NK cells, NK T cells, monocytes as well as T cells most likely via the CXCR1/CXCR2-CXCL8 and CXCR6- CXCL16 axis [156, 157, 282] to build up a first line of defense, while DCs rapidly transport the antigenic cargo into SLOs to educate the arm of adaptive immunity. Meanwhile, infiltrating neutrophils and NK cells, known to release a variety of pro-inflammatory chemokines upon activation [283, 284], could orchestrate the immune response at inflamed sites in the absence of DCs. Since interferon (IFN) counteracts the PGE2-mediated CCR7- dependent migration [285] as well as the chemokine expression pattern [163], the ensued recruitment to the site of inflammation of IFN-releasing innate and adaptive immune effectors may oppose the effects of PGE2 on DC maturation, thus generating DCs competent in orchestrating the immune response coincident with minor migratory abilities. Under acute inflammation, PGE2 might program DCs to rapidly educate the arm of adaptive immunity, which is in turn curtailing the influence of PGE2 on DCs to avoid excessive immune responses. This notion is further supported by our and previous findings, which clearly demonstrate that PGE2 augments the T cell stimulatory capacity of DCs (Chapter 4) [152], induces a high-speed migratory DC phenotype [62] and ensures efficient DC migration (Chapter 3) [105, 106, 121].

Under pathophysiological conditions, such as chronic inflammation and cancer, PGE2 is considered to promote carcinogenesis [98, 109, 286]. Malignancies are the product of multiple and diverse cell and tissue-specific alterations that have accumulated and developed during the hosts life [287]. Aberrant cells are recognized as “altered-self” by the innate and adaptive immune system. The efficiency of the subsequent immune response, which is either leading to cancer elimination or dormancy and/or progression, decides about the fate of carcinogenesis [286]. Based on our findings (Chapter 3 & 4) and previous studies highlighting the role of PGE2 as a pro-inflammatory mediator [105, 106, 116, 152], it can be assumed that inflammation-induced PGE2 promotes the elimination of aberrant cells, in particular by facilitating DC migration and augmenting T cell stimulatory capacity of DCs. In addition, PGE2 promotes elimination of aberrant cells by increasing the ability of DCs to recruit innate NK and NK T cells (Chapter 2) which are capable of detecting aberrant cells and promote anti-tumour immunity [288, 289]. Cancer dormancy a result of ineffective host immune responses and intrinsic alterations that favor growth and immunoescape, is characterized by an equilibrium state resembling chronic inflammation in which immune responses curtail tumour growth but fail clearance [286]. Our finding that PGE2 increases CXCL8 and CXCL16 production in DCs (Chapter 2) may provide interesting insights in the understanding whether and how PGE2 misemploys DCs in carcinogenesis. The fact that

86 Chapter VI –Discussion

CXCL8 promotes chronic inflammation [290], angiogenesis, tumour growth and metastasis

[291] suggests that PGE2, synthesized in chronically inflamed tissues and cancer, could elevate the release of DC-derived CXCL8 which in turn contributes to the maintenance of chronic inflammation, cancer development and progression. Moreover, the elevated PGE2- mediated release of DC-derived CXCL16 (Chapter 2) could further promote cancer progression since soluble CXCL16 was also reported to promote tumour growth and metastasis [292]. Intriguingly, tumour resident DCs were found to be critical for tumour growth and vascularization which is believed to depend on the release of DC-derived angiogenic factors, such as CXCL8 [293, 294]. Malignant cancer progression occurs and becomes clinical apparent when tumours acquire the ability to escape from the host immune response, in particular by the generation of an immunosuppressive milieu [286, 295, 296]. Recently, a study demonstrated that tumour-released sterol metabolites activate nuclear liver X  receptors (LXR) and suppress maturation-induced CCR7 expression in DCs, thus disrupt DC migration and tumour-specific T cell responses [123]. While studying the impact of PGE2 on DC behaviour, we observed that PGE2 hampered LXR expression and counteracted its activation by a yet-unknown mechanism (Chapter 3). Hence, CCR7 expression and migration towards CCL21 of LXR-activated DCs could be counterbalanced by PGE2 (Chapter 3), known to elevate CCR7 surface expression on DCs [120]. LXRs are important regulators of the cellular lipid metabolism and emerging players in the regulation of immunity. Depending on the context, LXR activation was reported to exhibit anti- or inflammatory properties, but nonetheless the biological role of LXR activation in immunity, despite substantial progress, remains obscure [173]. However, in macrophages it was recently shown that uptake of cholesterol-bearing apoptotic cell debris suppresses the inflammatory response in a LXR-dependent manner to maintain self-tolerance and avoid autoimmunity [297]. Therefore, it seems most likely that LXR activation is a regulatory mechanism in DCs to maintain self-tolerance in response to apoptotic cell death thereby avoiding autoimmunity. The possibility that LXR activation positively regulates the phagocytic activity in DCs has not been addressed so far. In our study, we exclusively observed a counterbalance between PGE2 and LXR activation on the expression of metabolic regulators, CCR7 surface expression and migration in human DCs (Chapter 3). Although expression of PGE2-induced matrix metalloproteinase (MMP)9, CCL4, Interleukin(IL)-23 or COX-2 in LXR-activated human DCs was not affected (Chapter 3), it cannot be excluded that PGE2 and LXR activation counterbalance further DC functions. The protein kinase B (PKB), commonly known as AKT, is a central signaling node in all cells of higher eukaryotes and regulates a variety of cellular functions such as cell survival, growth and proliferation

[325]. Interestingly, PGE2 producing prostate carcinoma cells undergo apoptosis upon LXR activation or COX-2 inhibition by impairing AKT activation [298, 299], whereas PGE2 is

87 Chapter VI –Discussion known to activate AKT to promote cancer cell survival [300]. Analogous to prostate cancer cells, exogenous PGE2 was reported to induce AKT activation in DCs [170] leading to a pronounced resistance to apoptotic stimuli [301, 302]. But, whether LXR activation impairs

PGE2-mediated DC survival by means of AKT has to be investigated in future studies. Since

PGE2 counteracted tumour-associated LXR activation in human DCs (Chapter 3), one might expect that PGE2 promotes anti-tumour immunity by preserving CCR7-dependent DC migration. Sustained PGE2 synthesis in chronic inflammation and cancer has become evident to facilitate carcinogenesis and immune evasion, whereat, among further and diverse mechanisms, tumour-derived PGE2 compromises DC-mediated anti-tumour Th1 responses [109] or generates, in concert with further tumour-derived factors, DCs with tolerogenic features leading to suppression of anti-tumour immunity [295]. But the beneficial influence of

PGE2 on DC behaviour, such as an increase in migratory efficiency [106] (Chapter 3) and T cell stimulatory capacity [152] (Chapter 4), challenge the classical paradigm of PGE2 as a general immunosuppressive and tumour-promoting agent during carcinogenesis [109, 303]. It is well accepted that along with the generation of genotoxic stress, tumour-associated inflammation leads to the selection of highly immunogenic tumour cells. Thus, malignant cells that may have acquired an intrinsic ability to escape from the host immune response remain and promote carcinogenesis [286]. Whereas PGE2 may support DC-mediated anti-tumour immunity leading to cancer elimination, it most likely participates, in particular by facilitating DC-mediated promotion of tumour-growth, angiogenesis and immunoselection, in the interdependent process of inflammation and carcinogenesis. Besides great implications in acute inflammation and carcinogenesis, it has become increasingly evident that PGE2 plays a key role in chronic inflammation in the context of various autoimmune diseases. In several murine models of autoimmune disorders, such as experimental autoimmune encephalomyelitis (EAE) resembling human multiple sclerosis

(MS), PGE2 was recently identified to promote T helper (Th)17 cell development in a DC- dependent and -independent manner [104, 127, 128]. Th17 cells represent a special subset of Th cells involved in anti-fungal and autoimmunity [87, 104]. In detail, PGE2 skews DC- mediated Th17 cell polarization in particular by a reciprocal down-regulation of IL-12 (Th1) and up-regulation of IL-23 (Th17) [129]. Intriguingly, administration of synthetic LXR agonists into EAE diseased mice suppressed IL-23 signaling and reduced clinical severity, but how DCs are involved in this process remains unclear [180]. Reduction of clinical symptoms in diseased mice upon LXR activation may result, at least in part, from an impaired DC migration into SLOs, as we have demonstrated that LXR activation did not hamper PGE2 induced IL-23 secretion but counterbalanced CCR7-dependent migration of human DCs

(Chapter 3). But, the inflammatory mediator PGE2 was also reported to directly act on naive Th cells and accordingly promotes murine and human Th17 cell differentiation [104, 127]. Cui

88 Chapter VI –Discussion and colleges further demonstrated that LXR deficient mice displayed severe signs of EAE, whereas LXR activation ameliorated the disease which was accompanied by an altered expression of the Th17-specific transcription factor RORt [181]. Because PGE2-EP2/4 signaling promotes [127] and LXR activation impedes RORt-dependent Th17 cell development [181], it seems conceivable that PGE2 and LXR not only counteract in the regulation of specific DC functions (Chapter 3) but also in the development of Th17 cells. Co-stimulatory molecules of the TNF superfamily, such as OX40L, not only mediate inflammation but also promote autoimmunity as OX40L neutralization or deficiency ameliorates disease in many in vivo models [304]. In Th17 cells, activation of OX40 during the priming phase leads to an elevated pro-inflammatory cytokine secretion [305, 306]. In our studies, the expression of the co-stimulatory molecule OX40L induced by PGE2 on human DCs augmented the induction of primary and secondary T cell responses (Chapter 4). These findings suggest that PGE2, at least in part, promotes chronic inflammation in various autoimmune diseases by inducing OX40L on DCs leading to long lasting and inappropriate T cell responses. The question whether LXR activation impedes PGE2 induced OX40L expression in DCs has not been answered so far. Notably, chronic inflammation in autoimmunity may contribute to carcinogenesis by promoting malignant cellular aberration and/or immunoevasion [307]. These findings suggest that modulation of DC behaviour by

PGE2 not only supports immunity, but can context-dependently contribute to the formation of severe diseases. Hence, PGE2 blurs the borders between immunity, autoimmunity and carcinogenesis in particular by modulating DC behaviour. Though, specific pharmacological in vivo targeting of PGE2 signalling or LXR activation in DCs could be beneficial in the treatment of autoimmune diseases, as we (Chapter 3 & 4) and others [104, 129] have demonstrated that both pathways modulate important aspects of DC behaviour. In cancer immunotherapy, the unexampled ability of DCs to induce specific effector and memory T cell responses as well as to recruit and activate potent innate effectors designates them as promising cellular vaccines [115]. In clinically applied DC-based cancer immunotherapy, DCs are either targeted in vivo or generated and loaded with tumour-antigen ex vivo prior to re-injection into the patient [2]. For the latter, monocytes are isolated out of the blood of patients and differentiated with IL-4 or IL-13 and GM-CSF into immature monocyte-derived DCs (MoDCs) [308]. In clinical trials, DCs are matured with an approved standard combination of pro-inflammatory cytokines and PGE2 (sDC), yielding highly migratory DCs with an efficient T cell stimulatory capacity [131, 133, 134]. In the past years, it has become evident that maturation dictates the immunomodulatory capacities of DCs and consequently determines the outcome of immune responses in DC-based immunotherapy

[309, 310]. However, the applicability of PGE2 in clinical DC maturation protocols regarding their migratory and recruiting abilities as well as T cell stimulatory capacities is still under

89 Chapter VI –Discussion

debate. PGE2 rapidly induces highly migratory DCs in combination with various maturation stimuli [311, 312] but concomitantly reduces the release of the Th1-skewing cytokine IL-12 [313] and induces secretion of the Th17-skewing cytokine IL-23 [129]. Induction of Th17 cell development is somehow a double-edged sword in tumour immunity as Th17 cells are reported to induce immunity or to promote carcinogenesis [314]. As Th1 cells are the ones that primarily drive tumour immunity, an alternative maturation cocktail (DC1) comprising IFN, IFN, polyI:C, TNF and IL-1 leading to a robust IL-12 production, has been suggested for clinical use [151]. Alternatively matured DCs induce strong cytotoxic T cell (CTL) responses in vitro [151, 315] and display superior recruiting abilities compared to DC matured with the PGE2-containing standard maturation cocktail [113, 312, 316]. In contradiction to previous reports demonstrating that PGE2 increases CCL17 and CCL22 production that are considered to recruit immunosuppressive regulatory T cells or IL-4 producing Th2 cells [113, 163], we hardly observed an altered production of CCL17 and

CCL22 in PGE2-matured DCs (Chapter 2). In line with our results, vaccination of melanoma patients in a clinical trial with tumour-antigen bearing sDCs did not induce vaccine-specific regulatory T cells, but IFN-producing Th1 cells [133]. Accordingly, CCL17 and CCL22 either play a minor role in the recruitment of regulatory T cells and/or their expansion is overcome by the expression of co-stimulatory TNF superfamily members on DCs matured in the presence of PGE2 (Chapter 4). But, PGE2 was also reported to impair inflammatory chemokine expression [113, 136, 144, 163, 312] which might be unfavorable in DC-based immunotherapy. Indeed, our study (Chapter 2) corroborates previous findings that PGE2 impedes CCL4, CXCL9/10/11 and CCL19 expression in DCs [144, 163, 312]. CCL4 not only recruits inflammatory immune effectors to the site of pathogen encounter, it promotes immunity through guidance of naïve CTLs to the site of DC-Th cell interactions in lymph nodes [153]. Interestingly, upon DC-Th cell interaction, both cell types were reported to release CCL3 and CCL4 [317]. Thus, a break-down in supply of DC-derived CCL4 could be partially compensated by interacting with Th cells. Although CXCR3-ligand deficiency in sDCs seems disadvantageous for the induction of CTL responses [113], it was reported that CXCR3 deficiency in CTLs favors the induction of central memory CTLs exhibiting stronger responses upon stimulation [318]. The latter is highly desired in the induction of long-lasting anti-tumour T cell responses in DC-based immunotherapy. Moreover, mature antigen-bearing DCs are believed to guide naïve T cells to their vicinity via CCL19 and hence maximize the stochastic probability of an encounter with matching antigen-specific T cells. But, whether DC-derived CCL19 is required for an optimal induction of T cell responses has to be discussed. CCL19 and CCL21 equally bind to CCR7 with similar affinities [248], whereas CCL19 is highly soluble and CCL21 is predominantly found immobilized on surfaces. The major difference between both CCR7-ligands is the carboxy-

90 Chapter VI –Discussion terminal extension of CCL21 [319] which facilitates the immobilization on various molecules distributed in the extracellular matrix (ECM) and cell surfaces [250, 320]. DCs migrate along pre-formed tracks of immobilized CCL21 in an adhesive and integrin-dependent manner, whereat directionality is induced by co-existing gradients of soluble CCL19 or C-terminal truncated CCL21 (Chapter 5). Intriguingly, we found that mouse (Chapter 5) and human (Bruckner, unpublished) DCs release a soluble, C-terminal truncated form of CCL21 by proteolytic processing and thereby generate soluble chemotactic cues for CCR7-expressing leukocytes. We further investigated the influence of PGE2 on DC-mediated processing of

CCL21 but found no evidence that PGE2 alters the proteolytic activity (Bruckner, unpublished). These results suggest that antigen-bearing DCs in lymphatic T-cell zones may solubilize CCL21 to recruit CCR7 expressing naïve T cells and further mature DCs to form clusters of DC-T cell interactions. Because this proteolytic mechanism negatively regulates the short-term availability of immobilized CCL21 due to a delayed replenishment as a result of de-novo synthesis, DC-derived CCL19 could prolong CCR7 expressing leukocytes guidance upon depletion of immobilized CCL21. The importance of CCL21 processing was recently highlighted by a study demonstrating that CCL21 is crucial for DC-homing and T cell priming in vivo whereas CCL19 was found to play a redundant role [67]. In conclusion, the

PGE2 mediated down-regulation of CCL19 in DCs seems to have a minor impact on the outcome of T cell responses since CCL19 can be replaced by solubilized CCL21. Both mentioned maturation protocols facilitate CCR7-dependent DC migration in vitro, whereat

DCs matured in the presence of PGE2 migrate in higher amounts in response to CCL21 and thus display a superior migratory capability compared to alternatively matured DCs [151]. Nevertheless, DC migration in vivo is more complex due the three-dimensionality as well as natural occurring obstacles and demand mechanism to cope with it. Proteolytic degradation of ECM molecules by specific proteases represents one strategy to overcome migratory barriers in vivo. In DCs, MMP9 activity promotes 3D DC migration in response to CCR7- ligands as demonstrated by independent studies and distinct experimental setups in vitro and in vivo [70, 122, 321]. In contrast, DC migration was observed to occur independently of proteolytic activity through a three dimensional (3D)-network of collagen fibers in vitro in the absence of chemotactic cues [322]. These contradictive observations could be explained by the fact that CCR7-ligands trigger DCs to release MMP9 [321] and therefore might facilitate migration in response to chemokines through narrow matrices that cannot be passed through amoeboid squeezing. In line with our observations on MMP9 expression in human DCs

(Bruckner, unpublished), Yen and colleagues recently reported that PGE2 induces MMP9 expression in murine DCs and thus promotes DC migration through ECM in vitro and in vivo [122]. Whether alternatively matured DCs release effective amounts of MMP9 has not been investigated but both maturation protocols induced DCs capable of migrating into lymph

91 Chapter VI –Discussion nodes of patients [134, 138]. Although much has been speculated, reported and discussed concerning the ins and outs of both maturation protocols in DC-based immunotherapy, a study comparing the clinical outcomes has not been performed yet. Until now, the vast majority of clinical trials with late stage cancer patients has been carried out using sDCs, whereas alternatively matured DCs are currently evaluated in clinical trials [323]. To improve the immunogenicity of DCs for cancer immunotherapy, combinations of PGE2, TLR-ligands and pro-inflammatory cytokines, such as IFN, should be evaluated in future studies to obtain DCs featuring co-stimulatory molecules of the TNF superfamily, migratory phenotype, robust IL-12 production and a favorable chemokine production. Besides cancer immunotherapy, DCs become the focus in treating autoimmune disorders by virtue of their ability to induce and maintain peripheral tolerance [324]. For these reasons, modulating DC behaviour also represents a promising approach to treat autoimmune disorders. The use of DCs as cellular vaccines is a feasible approach to overcome tumour-induced tolerance and to induce anti-tumour immunity, however, clinical outcomes were below expectations and demand massive improvements as well as new strategies such as combinations of DC- based immunotherapy with radiotherapy, chemotherapy and/or antibody-treatment [133]. As DCs are central conductors in the symphony of immunity, the understanding of the causalities and modalities modulating their behaviour opens up new opportunities in health and disease.

92 Summary

Summary

Dendritic cells (DCs) are professional antigen-presenting cells (APCs) capable of inducing immunity or mediating tolerance. Given their role as sentinels of the immune system, DCs are predominantly located in peripheral tissues and acquire antigenic information from their surrounding which are required for the education of the adaptive immune system. After acquiring antigenic information, DCs mature and up-regulate the chemokine receptor CCR7 required for their guidance into lymphatic tissues along cues of the CCR7-ligands CCL19 and CCL21 to induce antigen-specific T cell responses. The environment in which DCs undergo maturation determines in particular their migratory as well as their T cell stimulatory capacity and hence designates the outcome of the immune response. The lipid mediator

Prostaglandin E2 (PGE2), which is increasingly produced under inflammatory conditions, was described to modulate important DC functions such as efficient DC migration, T cell activation and cytokine production in health and disease. Since DCs become evident to play key roles in many diseases and can be exploited for clinical immunotherapy, the understanding of their functions and its modulation is of great interest. Therefore, the present thesis addressed the potential of PGE2 in modulating distinct aspects of DC behaviour.

In inflammation, DCs orchestrate immune responses by recruiting immune cells to sites of inflammation or in lymphoid tissues through the release of specific attractants, so-called chemokines. A comprehensive study in this thesis addressed the impact of PGE2 on the expression of a wide range of chemokines in DCs revealing that PGE2 decisively alters the chemokine expression pattern of DCs and thus their role in orchestrating immune responses in health and disease.

Moreover, PGE2 is known to augment the T cell stimulatory capacity of DCs, however, there is paucity of knowledge about the precise mechanisms. Investigations on the T cell stimulatory capacity of DCs revealed that PGE2 induced surface expression of the co- stimulatory molecules OX40L, CD70 and 4-1BBL on DCs and thereby augmented DC- mediated specific T cell responses. The observed PGE2-mediated expression of OX40L on DCs not only offers new opportunities in the design of DC-based cancer immunotherapy, it also provides novel insights in the regulation of PGE2-mediated autoimmune diseases in which DCs participate in disease development.

Besides PGE2, distinct lipids derived from the sterol metabolism have recently become evident to modulate DC migration. Tumour-derived sterol metabolites were described to impair the ability of DCs to migrate into secondary lymphatic organs (SLOs) in a nuclear liver

X receptor (LXR)-dependent manner. This thesis provides evidence that PGE2 counteracts

93 Summary nuclear LXR activation and suppression of DC migration. These results support the feasibility of treating PGE2-mediated autoimmunity with synthetic LXR agonists. Furthermore, this thesis unravels a mechanism explaining how DCs may swarm into T cell zones of SLOs. The herein performed studies on the migratory behaviour of DCs towards SLO-derived chemokines demonstrate that adhesive random DC migration along surfaces is triggered via surface-immobilized CCL21, whereas directionality is guided by CCL19 or solubilized CCL21. Intriguingly, DCs were found to solubilize surface-bound CCL21 to induce their own directional guidance cues allowing their directed migration along pre-defined tracks of immobilized CCL21. Taken together, the present thesis provides new insights in modulating DC functions such as DC migration, T cell activation and cytokine secretion with valuable implications in health and disease.

94 Zusammenfassung

Zusammenfassung

Dendritische Zellen (DC) sind professionelle, antigenpräsentierende Zellen mit der Fähigkeit Immunität zu induzieren oder Toleranz zu vermitteln. Aufgrund ihrer Rolle als Wächter des Immunsystems, befinden sich DCs vorwiegend in peripheren Geweben und nehmen Antigene, welche für die Bildung einer adaptiven Immunantwort benötigt werden, aus ihrer Umgebung auf. Um eine adaptive Immunantwort auslösen zu können, reifen DCs nach Antigenaufnahme und exprimieren den Chemokinrezeptor CCR7, welcher für ihre Orientierung in lymphatische Gewebe entlang der wegweisenden CCR7-Liganden CCL19 und CCL21 benötigt wird. Die Umgebung in welcher DCs heranreifen, bestimmt sowohl ihre Wanderungsfähigkeit als auch ihre T-Zell-Stimulationsfähigkeit und ist damit entscheidend für den Ausgang einer Immunantwort. Der Lipidmediator Prostaglandin E2 (PGE2) wird vermehrt bei Entzündungen gebildet und ist dafür bekannt wichtige dendritische Zellfunktionen, wie DC-Wanderung, T-Zellaktivierung und Zytokinproduktion in physiologischen sowie pathophysiologischen Prozessen zu modulieren. Seitdem erwiesen ist, dass DCs entscheidende Rollen bei vielen Krankheiten spielen und für klinische Immuntherapien instrumentalisiert werden können, ist das Verstehen ihrer Fähigkeiten und ihrer Modulation von großem Interesse. Die vorliegende Arbeit befasste sich daher mit dem

Potenzial von PGE2 verschiedene Aspekte dendritischen Zellverhaltens zu modulieren.

Durch das Ausschütten spezifischer Lockstoffe, welche als Chemokine bezeichnet werden, rekrutieren DCs Immunzellen an den Entzündungsherd oder in lymphatisches Gewebe und koordinieren somit Immunantworten. Eine umfassende Studie in dieser Arbeit befasste sich mit dem Einfluss von PGE2 auf die Expression einer umfangreichen Reihe von Chemokinen in DCs mit dem Ergebnis, dass PGE2 das Chemokin-Expressionsprofil von DCs und demnach ihre Rolle bei der Koordinierung einer Immunantwort in physiologischen sowie pathophysiologischen Prozessen verändert.

PGE2 ist darüber hinaus bekannt, die T-Zell-Stimulationsfähigkeit von DCs zu verbessern, dennoch mangelt es an Informationen über den genauen Mechanismus. Untersuchungen bezüglich der T-Zell-Stimulationsfähigkeit ergaben, dass PGE2 durch die Expression der kostimulatorischen Moleküle OX40L, CD70 und 4-1BBL auf DCs die spezifische DC- vermittelte T-Zellantwort steigert. Die beobachtete PGE2-vermittelte Expression kostimulatorischer Moleküle auf DCs eröffnet nicht nur neue Möglichkeiten bei der Gestaltung DC-basierender Immuntherapien, sondern liefert auch neue Erkenntnisse zum

Verständnis PGE2-vermittelter Autoimmunkrankheiten in welchen DCs an der Pathogenese beteiligt sind.

95 Zusammenfassung

Neben PGE2 wurde kürzlich bekannt, dass auch verschiedenartige Lipide aus dem Sterin- Stoffwechsel DC-Wanderung modulieren können. Es wurde beobachtet, dass vom Tumor- abstammende Sterin-Metabolite, welche nukleäre liver X Rezeptoren (LXR) in DCs aktivieren, die Wanderungsfähigkeit von DCs in sekundär lymphatische Organe (SLO) beeinträchtigen. Diese Arbeit zeigt, dass PGE2 der Aktivierung von nukleären LXR sowie der Beeinträchtigung der DC Wanderung entgegenwirkt und unterstützt damit die Anwendbarkeit von synthetischen LXR-Agonisten bei der Behandlung PGE2-vermittelter Autoimmunerkrankungen. Außerdem deckten Untersuchungen zum DC-Wanderungsverhalten zu SLO-assoziierten Chemokinen einen Mechanismus auf, welcher neue Einblicke, wie DCs in T-Zellzonen sekundär lymphatischer Organe einwandern könnten, liefert. Die hier durchgeführten Untersuchungen zeigen, dass die zufällige, adhäsive DC-Wanderung durch immobilisiertes CCL21 auf Oberflächen gesteuert wird, während lösliches CCL19 oder in Lösung gebrachtes CCL21 die Wanderungsrichtung bestimmt. Zudem konnte interessanterweise herausgefunden werden, dass DCs immobilisiertes CCL21 in Lösung bringen, was DCs wiederum erlaubt, entlang vordefinierter Pfade mit immobilisiertem CCL21 zu wandern und dabei ihre eigenen Richtungssignale zu induzieren. Zusammenfassend liefert die vorliegende Arbeit neue Erkenntnisse über die Modulation dendritischer Zellfunktionen, wie DC-Wanderung, T-Zellaktivierung und Zytokinsekretion, mit wertvollen Implikationen in physiologischen sowie pathophysiologischen Prozessen.

96 References

References

1 Shortman, K. and Naik, S. H., Steady-state and inflammatory dendritic-cell development. Nat Rev Immunol 2007. 7: 19-30. 2 Ueno, H., Klechevsky, E., Morita, R., Aspord, C., Cao, T., Matsui, T., Di Pucchio, T., Connolly, J., Fay, J. W., Pascual, V., Palucka, A. K. and Banchereau, J., Dendritic cell subsets in health and disease. Immunol Rev 2007. 219: 118-142. 3 Banchereau, J. and Steinman, R. M., Dendritic cells and the control of immunity. Nature 1998. 392: 245-252. 4 Guermonprez, P., Valladeau, J., Zitvogel, L., Thery, C. and Amigorena, S., Antigen presentation and T cell stimulation by dendritic cells. Annu Rev Immunol 2002. 20: 621-667. 5 Reschner, A., Hubert, P., Delvenne, P., Boniver, J. and Jacobs, N., Innate lymphocyte and dendritic cell cross-talk: a key factor in the regulation of the immune response. Clin Exp Immunol 2008. 152: 219-226. 6 Banchereau, J., Briere, F., Caux, C., Davoust, J., Lebecque, S., Liu, Y. J., Pulendran, B. and Palucka, K., Immunobiology of dendritic cells. Annu Rev Immunol 2000. 18: 767-811. 7 Shortman, K. and Liu, Y. J., Mouse and human dendritic cell subtypes. Nat Rev Immunol 2002. 2: 151-161. 8 Alvarez, D., Vollmann, E. H. and von Andrian, U. H., Mechanisms and consequences of dendritic cell migration. Immunity 2008. 29: 325-342. 9 D'Amico, A. and Wu, L., The early progenitors of mouse dendritic cells and plasmacytoid predendritic cells are within the bone marrow hemopoietic precursors expressing Flt3. J Exp Med 2003. 198: 293-303. 10 Karsunky, H., Merad, M., Cozzio, A., Weissman, I. L. and Manz, M. G., Flt3 ligand regulates dendritic cell development from Flt3+ lymphoid and myeloid-committed progenitors to Flt3+ dendritic cells in vivo. J Exp Med 2003. 198: 305-313. 11 Pulendran, B., Smith, J. L., Caspary, G., Brasel, K., Pettit, D., Maraskovsky, E. and Maliszewski, C. R., Distinct dendritic cell subsets differentially regulate the class of immune response in vivo. Proc Natl Acad Sci U S A 1999. 96: 1036-1041. 12 Geissmann, F., Manz, M. G., Jung, S., Sieweke, M. H., Merad, M. and Ley, K., Development of monocytes, macrophages, and dendritic cells. Science 2010. 327: 656-661. 13 Robinson, S. P., Patterson, S., English, N., Davies, D., Knight, S. C. and Reid, C. D., Human peripheral blood contains two distinct lineages of dendritic cells. Eur J Immunol 1999. 29: 2769-2778. 14 Bonasio, R. and von Andrian, U. H., Generation, migration and function of circulating dendritic cells. Curr Opin Immunol 2006. 18: 503-511. 15 Colonna, M., Trinchieri, G. and Liu, Y. J., Plasmacytoid dendritic cells in immunity. Nat Immunol 2004. 5: 1219-1226. 16 Young, L. J., Wilson, N. S., Schnorrer, P., Proietto, A., ten Broeke, T., Matsuki, Y., Mount, A. M., Belz, G. T., O'Keeffe, M., Ohmura-Hoshino, M., Ishido, S., Stoorvogel, W., Heath, W. R., Shortman, K. and Villadangos, J. A., Differential MHC class II synthesis and ubiquitination confers distinct antigen-presenting properties on conventional and plasmacytoid dendritic cells. Nat Immunol 2008. 9: 1244-1252. 17 Valladeau, J. and Saeland, S., Cutaneous dendritic cells. Semin Immunol 2005. 17: 273-283. 18 Merad, M. and Manz, M. G., Dendritic cell homeostasis. Blood 2009. 113: 3418- 3427. 19 Villadangos, J. A. and Schnorrer, P., Intrinsic and cooperative antigen-presenting functions of dendritic-cell subsets in vivo. Nat Rev Immunol 2007. 7: 543-555.

97 References

20 Villadangos, J. A. and Young, L., Antigen-presentation properties of plasmacytoid dendritic cells. Immunity 2008. 29: 352-361. 21 Steinman, R. M., Hawiger, D. and Nussenzweig, M. C., Tolerogenic dendritic cells. Annu Rev Immunol 2003. 21: 685-711. 22 Sixt, M., Kanazawa, N., Selg, M., Samson, T., Roos, G., Reinhardt, D. P., Pabst, R., Lutz, M. B. and Sorokin, L., The conduit system transports soluble antigens from the afferent lymph to resident dendritic cells in the T cell area of the lymph node. Immunity 2005. 22: 19-29. 23 Carbone, F. R., Belz, G. T. and Heath, W. R., Transfer of antigen between migrating and lymph node-resident DCs in peripheral T-cell tolerance and immunity. Trends Immunol 2004. 25: 655-658. 24 Trombetta, E. S. and Mellman, I., Cell biology of antigen processing in vitro and in vivo. Annu Rev Immunol 2005. 23: 975-1028. 25 Medzhitov, R., Preston-Hurlburt, P. and Janeway, C. A., Jr., A human homologue of the Drosophila Toll protein signals activation of adaptive immunity. Nature 1997. 388: 394-397. 26 Akira, S., Uematsu, S. and Takeuchi, O., Pathogen recognition and innate immunity. Cell 2006. 124: 783-801. 27 van Vliet, S. J., den Dunnen, J., Gringhuis, S. I., Geijtenbeek, T. B. and van Kooyk, Y., Innate signaling and regulation of Dendritic cell immunity. Curr Opin Immunol 2007. 19: 435-440. 28 Fritz, J. H., Girardin, S. E., Fitting, C., Werts, C., Mengin-Lecreulx, D., Caroff, M., Cavaillon, J. M., Philpott, D. J. and Adib-Conquy, M., Synergistic stimulation of human monocytes and dendritic cells by Toll-like receptor 4 and NOD1- and NOD2- activating agonists. Eur J Immunol 2005. 35: 2459-2470. 29 Takeuchi, O. and Akira, S., Pattern recognition receptors and inflammation. Cell 2010. 140: 805-820. 30 Srivastava, P. K. and Heike, M., Tumor-specific immunogenicity of stress-induced proteins: convergence of two evolutionary pathways of antigen presentation? Semin Immunol 1991. 3: 57-64. 31 Kuppner, M. C., Gastpar, R., Gelwer, S., Nossner, E., Ochmann, O., Scharner, A. and Issels, R. D., The role of heat shock protein (hsp70) in dendritic cell maturation: hsp70 induces the maturation of immature dendritic cells but reduces DC differentiation from monocyte precursors. Eur J Immunol 2001. 31: 1602-1609. 32 Reis e Sousa, C., Dendritic cells in a mature age. Nat Rev Immunol 2006. 6: 476- 483. 33 Lotze, M. T. and Tracey, K. J., High-mobility group box 1 protein (HMGB1): nuclear weapon in the immune arsenal. Nat Rev Immunol 2005. 5: 331-342. 34 Yang, D., Chen, Q., Yang, H., Tracey, K. J., Bustin, M. and Oppenheim, J. J., High mobility group box-1 protein induces the migration and activation of human dendritic cells and acts as an alarmin. J Leukoc Biol 2007. 81: 59-66. 35 Regnault, A., Lankar, D., Lacabanne, V., Rodriguez, A., Thery, C., Rescigno, M., Saito, T., Verbeek, S., Bonnerot, C., Ricciardi-Castagnoli, P. and Amigorena, S., Fcgamma receptor-mediated induction of dendritic cell maturation and major histocompatibility complex class I-restricted antigen presentation after immune complex internalization. J Exp Med 1999. 189: 371-380. 36 Rossi, M. and Young, J. W., Human dendritic cells: potent antigen-presenting cells at the crossroads of innate and adaptive immunity. J Immunol 2005. 175: 1373-1381. 37 Reis e Sousa, C., Activation of dendritic cells: translating innate into adaptive immunity. Curr Opin Immunol 2004. 16: 21-25. 38 Roy, M., Waldschmidt, T., Aruffo, A., Ledbetter, J. A. and Noelle, R. J., The regulation of the expression of gp39, the CD40 ligand, on normal and cloned CD4+ T cells. J Immunol 1993. 151: 2497-2510. 39 Caux, C., Massacrier, C., Vanbervliet, B., Dubois, B., Van Kooten, C., Durand, I. and Banchereau, J., Activation of human dendritic cells through CD40 cross-linking. J Exp Med 1994. 180: 1263-1272.

98 References

40 Cella, M., Scheidegger, D., Palmer-Lehmann, K., Lane, P., Lanzavecchia, A. and Alber, G., Ligation of CD40 on dendritic cells triggers production of high levels of interleukin-12 and enhances T cell stimulatory capacity: T-T help via APC activation. J Exp Med 1996. 184: 747-752. 41 Koch, F., Stanzl, U., Jennewein, P., Janke, K., Heufler, C., Kampgen, E., Romani, N. and Schuler, G., High level IL-12 production by murine dendritic cells: upregulation via MHC class II and CD40 molecules and downregulation by IL-4 and IL-10. J Exp Med 1996. 184: 741-746. 42 van Kooten, C. and Banchereau, J., CD40-CD40 ligand. J Leukoc Biol 2000. 67: 2- 17. 43 Sozzani, S., Luini, W., Borsatti, A., Polentarutti, N., Zhou, D., Piemonti, L., D'Amico, G., Power, C. A., Wells, T. N., Gobbi, M., Allavena, P. and Mantovani, A., Receptor expression and responsiveness of human dendritic cells to a defined set of CC and CXC chemokines. J Immunol 1997. 159: 1993-2000. 44 Sallusto, F., Schaerli, P., Loetscher, P., Schaniel, C., Lenig, D., Mackay, C. R., Qin, S. and Lanzavecchia, A., Rapid and coordinated switch in chemokine receptor expression during dendritic cell maturation. Eur J Immunol 1998. 28: 2760-2769. 45 Sallusto, F., Palermo, B., Lenig, D., Miettinen, M., Matikainen, S., Julkunen, I., Forster, R., Burgstahler, R., Lipp, M. and Lanzavecchia, A., Distinct patterns and kinetics of chemokine production regulate dendritic cell function. Eur J Immunol 1999. 29: 1617-1625. 46 Cella, M., Engering, A., Pinet, V., Pieters, J. and Lanzavecchia, A., Inflammatory stimuli induce accumulation of MHC class II complexes on dendritic cells. Nature 1997. 388: 782-787. 47 Rescigno, M., Citterio, S., Thery, C., Rittig, M., Medaglini, D., Pozzi, G., Amigorena, S. and Ricciardi-Castagnoli, P., Bacteria-induced neo-biosynthesis, stabilization, and surface expression of functional class I molecules in mouse dendritic cells. Proc Natl Acad Sci U S A 1998. 95: 5229-5234. 48 Guermonprez, P. and Amigorena, S., Pathways for antigen cross presentation. Springer Semin Immunopathol 2005. 26: 257-271. 49 Jarrossay, D., Napolitani, G., Colonna, M., Sallusto, F. and Lanzavecchia, A., Specialization and complementarity in microbial molecule recognition by human myeloid and plasmacytoid dendritic cells. Eur J Immunol 2001. 31: 3388-3393. 50 Piqueras, B., Connolly, J., Freitas, H., Palucka, A. K. and Banchereau, J., Upon viral exposure, myeloid and plasmacytoid dendritic cells produce 3 waves of distinct chemokines to recruit immune effectors. Blood 2006. 107: 2613-2618. 51 Inaba, K., Witmer-Pack, M., Inaba, M., Hathcock, K. S., Sakuta, H., Azuma, M., Yagita, H., Okumura, K., Linsley, P. S., Ikehara, S., Muramatsu, S., Hodes, R. J. and Steinman, R. M., The tissue distribution of the B7-2 costimulator in mice: abundant expression on dendritic cells in situ and during maturation in vitro. J Exp Med 1994. 180: 1849-1860. 52 Lanzavecchia, A. and Sallusto, F., Regulation of T cell immunity by dendritic cells. Cell 2001. 106: 263-266. 53 Lammermann, T. and Sixt, M., The microanatomy of T-cell responses. Immunol Rev 2008. 221: 26-43. 54 Bromley, S. K., Mempel, T. R. and Luster, A. D., Orchestrating the orchestrators: chemokines in control of T cell traffic. Nat Immunol 2008. 9: 970-980. 55 Thelen, M. and Stein, J. V., How chemokines invite leukocytes to dance. Nat Immunol 2008. 9: 953-959. 56 Fernandez, E. J. and Lolis, E., Structure, function, and inhibition of chemokines. Annu Rev Pharmacol Toxicol 2002. 42: 469-499. 57 Sozzani, S., Allavena, P., Vecchi, A. and Mantovani, A., The role of chemokines in the regulation of dendritic cell trafficking. J Leukoc Biol 1999. 66: 1-9. 58 Sozzani, S., Luini, W., Borsatti, A., Polentarutti, N., Zhou, D., Piemonti, L., D'Amico, G., Power, C. A., Wells, T. N., Gobbi, M., Allavena, P. and Mantovani,

99 References

A., Receptor expression and responsiveness of human dendritic cells to a defined set of CC and CXC chemokines. J Immunol 1997. 159: 1993-2000. 59 Cavanagh, L. L. and Von Andrian, U. H., Travellers in many guises: the origins and destinations of dendritic cells. Immunol Cell Biol 2002. 80: 448-462. 60 Forster, R., Davalos-Misslitz, A. C. and Rot, A., CCR7 and its ligands: balancing immunity and tolerance. Nat Rev Immunol 2008. 8: 362-371. 61 West, M. A., Wallin, R. P., Matthews, S. P., Svensson, H. G., Zaru, R., Ljunggren, H. G., Prescott, A. R. and Watts, C., Enhanced dendritic cell antigen capture via toll- like receptor-induced actin remodeling. Science 2004. 305: 1153-1157. 62 van Helden, S. F., Krooshoop, D. J., Broers, K. C., Raymakers, R. A., Figdor, C. G. and van Leeuwen, F. N., A Critical Role for Prostaglandin E2 in Podosome Dissolution and Induction of High-Speed Migration during Dendritic Cell Maturation. J Immunol 2006. 177: 1567-1574. 63 Hynes, R. O., Integrins: bidirectional, allosteric signaling machines. Cell 2002. 110: 673-687. 64 Vicente-Manzanares, M., Choi, C. K. and Horwitz, A. R., Integrins in cell migration - the actin connection. J Cell Sci 2009. 122: 199-206. 65 Fleury, M. E., Boardman, K. C. and Swartz, M. A., Autologous morphogen gradients by subtle interstitial flow and matrix interactions. Biophys J 2006. 91: 113- 121. 66 Shields, J. D., Fleury, M. E., Yong, C., Tomei, A. A., Randolph, G. J. and Swartz, M. A., Autologous chemotaxis as a mechanism of tumor cell homing to lymphatics via interstitial flow and autocrine CCR7 signaling. Cancer Cell 2007. 11: 526-538. 67 Britschgi, M. R., Favre, S. and Luther, S. A., CCL21 is sufficient to mediate DC migration, maturation and function in the absence of CCL19. Eur J Immunol 2010. 68 Lammermann, T., Bader, B. L., Monkley, S. J., Worbs, T., Wedlich-Soldner, R., Hirsch, K., Keller, M., Forster, R., Critchley, D. R., Fassler, R. and Sixt, M., Rapid leukocyte migration by integrin-independent flowing and squeezing. Nature 2008. 453: 51-55. 69 Friedl, P. and Weigelin, B., Interstitial leukocyte migration and immune function. Nat Immunol 2008. 9: 960-969. 70 Ratzinger, G., Stoitzner, P., Ebner, S., Lutz, M. B., Layton, G. T., Rainer, C., Senior, R. M., Shipley, J. M., Fritsch, P., Schuler, G. and Romani, N., Matrix metalloproteinases 9 and 2 are necessary for the migration of Langerhans cells and dermal dendritic cells from human and murine skin. J Immunol 2002. 168: 4361-4371. 71 Luther, S. A., Tang, H. L., Hyman, P. L., Farr, A. G. and Cyster, J. G., Coexpression of the chemokines ELC and SLC by T zone stromal cells and deletion of the ELC gene in the plt/plt mouse. Proc Natl Acad Sci U S A 2000. 97: 12694- 12699. 72 Pflicke, H. and Sixt, M., Preformed portals facilitate dendritic cell entry into afferent lymphatic vessels. J Exp Med 2009. 206: 2925-2935. 73 Grakoui, A., Bromley, S. K., Sumen, C., Davis, M. M., Shaw, A. S., Allen, P. M. and Dustin, M. L., The immunological synapse: a molecular machine controlling T cell activation. Science 1999. 285: 221-227. 74 Mempel, T. R., Henrickson, S. E. and Von Andrian, U. H., T-cell priming by dendritic cells in lymph nodes occurs in three distinct phases. Nature 2004. 427: 154- 159. 75 Shakhar, G., Lindquist, R. L., Skokos, D., Dudziak, D., Huang, J. H., Nussenzweig, M. C. and Dustin, M. L., Stable T cell-dendritic cell interactions precede the development of both tolerance and immunity in vivo. Nat Immunol 2005. 6: 707-714. 76 Bromley, S. K., Iaboni, A., Davis, S. J., Whitty, A., Green, J. M., Shaw, A. S., Weiss, A. and Dustin, M. L., The immunological synapse and CD28-CD80 interactions. Nat Immunol 2001. 2: 1159-1166. 77 Lenschow, D. J., Walunas, T. L. and Bluestone, J. A., CD28/B7 system of T cell costimulation. Annu Rev Immunol 1996. 14: 233-258.

100 References

78 Langenkamp, A., Casorati, G., Garavaglia, C., Dellabona, P., Lanzavecchia, A. and Sallusto, F., T cell priming by dendritic cells: thresholds for proliferation, differentiation and death and intraclonal functional diversification. Eur J Immunol 2002. 32: 2046-2054. 79 Gett, A. V., Sallusto, F., Lanzavecchia, A. and Geginat, J., T cell fitness determined by signal strength. Nat Immunol 2003. 4: 355-360. 80 Henrickson, S. E., Mempel, T. R., Mazo, I. B., Liu, B., Artyomov, M. N., Zheng, H., Peixoto, A., Flynn, M. P., Senman, B., Junt, T., Wong, H. C., Chakraborty, A. K. and von Andrian, U. H., T cell sensing of antigen dose governs interactive behavior with dendritic cells and sets a threshold for T cell activation. Nat Immunol 2008. 9: 282-291. 81 Watts, T. H., TNF/TNFR family members in costimulation of T cell responses. Annu Rev Immunol 2005. 23: 23-68. 82 Rutella, S., Danese, S. and Leone, G., Tolerogenic dendritic cells: cytokine modulation comes of age. Blood 2006. 108: 1435-1440. 83 Lutz, M. B. and Kurts, C., Induction of peripheral CD4+ T-cell tolerance and CD8+ T- cell cross-tolerance by dendritic cells. Eur J Immunol 2009. 39: 2325-2330. 84 Tisch, R., Immunogenic versus tolerogenic dendritic cells: a matter of maturation. Int Rev Immunol 2010. 29: 111-118. 85 Palucka, K., Banchereau, J. and Mellman, I., Designing vaccines based on biology of human dendritic cell subsets. Immunity 2010. 33: 464-478. 86 Pulendran, B., Tang, H. and Manicassamy, S., Programming dendritic cells to induce T(H)2 and tolerogenic responses. Nat Immunol 2010. 11: 647-655. 87 Geijtenbeek, T. B. and Gringhuis, S. I., Signalling through C-type lectin receptors: shaping immune responses. Nat Rev Immunol 2009. 9: 465-479. 88 Martin-Orozco, N., Muranski, P., Chung, Y., Yang, X. O., Yamazaki, T., Lu, S., Hwu, P., Restifo, N. P., Overwijk, W. W. and Dong, C., T helper 17 cells promote cytotoxic T cell activation in tumor immunity. Immunity 2009. 31: 787-798. 89 Ouyang, W., Kolls, J. K. and Zheng, Y., The biological functions of T helper 17 cell effector cytokines in inflammation. Immunity 2008. 28: 454-467. 90 Manel, N., Unutmaz, D. and Littman, D. R., The differentiation of human T(H)-17 cells requires transforming growth factor-beta and induction of the nuclear receptor RORgammat. Nat Immunol 2008. 9: 641-649. 91 Sakaguchi, S., Yamaguchi, T., Nomura, T. and Ono, M., Regulatory T cells and immune tolerance. Cell 2008. 133: 775-787. 92 Curiel, T. J., Tregs and rethinking cancer immunotherapy. J Clin Invest 2007. 117: 1167-1174. 93 Funk, C. D., Prostaglandins and leukotrienes: advances in eicosanoid biology. Science 2001. 294: 1871-1875. 94 Harris, S. G., Padilla, J., Koumas, L., Ray, D. and Phipps, R. P., Prostaglandins as modulators of immunity. Trends Immunol 2002. 23: 144-150. 95 Simmons, D. L., Botting, R. M. and Hla, T., Cyclooxygenase isozymes: the biology of prostaglandin synthesis and inhibition. Pharmacol Rev 2004. 56: 387-437. 96 Smith, W. L., DeWitt, D. L. and Garavito, R. M., Cyclooxygenases: structural, cellular, and molecular biology. Annu Rev Biochem 2000. 69: 145-182. 97 Dey, I., Lejeune, M. and Chadee, K., Prostaglandin E2 receptor distribution and function in the gastrointestinal tract. Br J Pharmacol 2006. 149: 611-623. 98 Park, J. Y., Pillinger, M. H. and Abramson, S. B., Prostaglandin E2 synthesis and secretion: the role of PGE2 synthases. Clin Immunol 2006. 119: 229-240. 99 Wang, M. T., Honn, K. V. and Nie, D., Cyclooxygenases, prostanoids, and tumor progression. Cancer Metastasis Rev 2007. 26: 525-534. 100 Samuelsson, B., Morgenstern, R. and Jakobsson, P. J., Membrane prostaglandin E synthase-1: a novel therapeutic target. Pharmacol Rev 2007. 59: 207-224. 101 Sugimoto, Y. and Narumiya, S., Prostaglandin E receptors. J Biol Chem 2007. 282: 11613-11617.

101 References

102 Tai, H. H., Cho, H., Tong, M. and Ding, Y., NAD+-linked 15-hydroxyprostaglandin dehydrogenase: structure and biological functions. Curr Pharm Des 2006. 12: 955- 962. 103 Fortier, M. A., Krishnaswamy, K., Danyod, G., Boucher-Kovalik, S. and Chapdalaine, P., A postgenomic integrated view of prostaglandins in reproduction: implications for other body systems. J Physiol Pharmacol 2008. 59 Suppl 1: 65-89. 104 Yao, C., Sakata, D., Esaki, Y., Li, Y., Matsuoka, T., Kuroiwa, K., Sugimoto, Y. and Narumiya, S., Prostaglandin E(2)-EP4 signaling promotes immune inflammation through T(H)1 cell differentiation and T(H)17 cell expansion. Nat Med 2009. 15: 633- 640. 105 Kabashima, K., Sakata, D., Nagamachi, M., Miyachi, Y., Inaba, K. and Narumiya, S., Prostaglandin E2-EP4 signaling initiates skin immune responses by promoting migration and maturation of Langerhans cells. Nat Med 2003. 9: 744-749. 106 Legler, D. F., Krause, P., Scandella, E., Singer, E. and Groettrup, M., Prostaglandin E2 Is Generally Required for Human Dendritic Cell Migration and Exerts Its Effect via EP2 and EP4 Receptors. J Immunol 2006. 176: 966-973. 107 Krause, P., Bruckner, M., Uermosi, C., Singer, E., Groettrup, M. and Legler, D. F., Prostaglandin E2 enhances T cell proliferation by inducing the co-stimulatory molecules OX40L, CD70 and 4-1BBL on dendritic cells. Blood 2009. 113: 2451-2460. 108 Kunikata, T., Yamane, H., Segi, E., Matsuoka, T., Sugimoto, Y., Tanaka, S., Tanaka, H., Nagai, H., Ichikawa, A. and Narumiya, S., Suppression of allergic inflammation by the prostaglandin E receptor subtype EP3. Nat Immunol 2005. 6: 524-531. 109 Greenhough, A., Smartt, H. J., Moore, A. E., Roberts, H. R., Williams, A. C., Paraskeva, C. and Kaidi, A., The COX-2/PGE2 pathway: key roles in the hallmarks of cancer and adaptation to the tumour microenvironment. Carcinogenesis 2009. 30: 377-386. 110 Boneberg, E. M., Legler, D. F., Senn, H. J. and Furstenberger, G., Reduced expression of cyclooxygenase-2 in primary breast cancer. J Natl Cancer Inst 2008. 100: 1042-1043. 111 Ahmadi, M., Emery, D. C. and Morgan, D. J., Prevention of both direct and cross- priming of antitumor CD8+ T-cell responses following overproduction of prostaglandin E2 by tumor cells in vivo. Cancer Res 2008. 68: 7520-7529. 112 Baratelli, F., Lin, Y., Zhu, L., Yang, S. C., Heuze-Vourc'h, N., Zeng, G., Reckamp, K., Dohadwala, M., Sharma, S. and Dubinett, S. M., Prostaglandin E2 Induces FOXP3 Gene Expression and T Regulatory Cell Function in Human CD4+ T Cells. J Immunol 2005. 175: 1483-1490. 113 Muthuswamy, R., Urban, J., Lee, J. J., Reinhart, T. A., Bartlett, D. and Kalinski, P., Ability of mature dendritic cells to interact with regulatory T cells is imprinted during maturation. Cancer Res 2008. 68: 5972-5978. 114 Steinman, R. M. and Cohn, Z. A., Identification of a novel cell type in peripheral lymphoid organs of mice. I. Morphology, quantitation, tissue distribution. J Exp Med 1973. 137: 1142-1162. 115 Steinman, R. M. and Banchereau, J., Taking dendritic cells into medicine. Nature 2007. 449: 419-426. 116 Thurnher, M., Lipids in dendritic cell biology: messengers, effectors, and antigens. J Leukoc Biol 2007. 81: 154-160. 117 Yang, A. S. and Lattime, E. C., Tumor-induced interleukin 10 suppresses the ability of splenic dendritic cells to stimulate CD4 and CD8 T-cell responses. Cancer Res 2003. 63: 2150-2157. 118 Sinha, P., Clements, V. K., Fulton, A. M. and Ostrand-Rosenberg, S., Prostaglandin E2 promotes tumor progression by inducing myeloid-derived suppressor cells. Cancer Res 2007. 67: 4507-4513. 119 Gualde, N. and Harizi, H., Prostanoids and their receptors that modulate dendritic cell-mediated immunity. Immunol Cell Biol 2004. 82: 353-360.

102 References

120 Scandella, E., Men, Y., Gillessen, S., Forster, R. and Groettrup, M., Prostaglandin E2 is a key factor for CCR7 surface expression and migration of monocyte-derived dendritic cells. Blood 2002. 100: 1354-1361. 121 Luft, T., Jefford, M., Luetjens, P., Toy, T., Hochrein, H., Masterman, K. A., Maliszewski, C., Shortman, K., Cebon, J. and Maraskovsky, E., Functionally distinct dendritic cell (DC) populations induced by physiologic stimuli: prostaglandin E(2) regulates the migratory capacity of specific DC subsets. Blood 2002. 100: 1362- 1372. 122 Yen, J. H., Khayrullina, T. and Ganea, D., PGE2-induced metalloproteinase-9 is essential for dendritic cell migration. Blood 2008. 111: 260-270. 123 Villablanca, E. J., Raccosta, L., Zhou, D., Fontana, R., Maggioni, D., Negro, A., Sanvito, F., Ponzoni, M., Valentinis, B., Bregni, M., Prinetti, A., Steffensen, K. R., Sonnino, S., Gustafsson, J. A., Doglioni, C., Bordignon, C., Traversari, C. and Russo, V., Tumor-mediated liver X receptor-alpha activation inhibits CC chemokine receptor-7 expression on dendritic cells and dampens antitumor responses. Nat Med 2010. 16: 98-105. 124 Zelcer, N. and Tontonoz, P., Liver X receptors as integrators of metabolic and inflammatory signaling. J Clin Invest 2006. 116: 607-614. 125 Geyeregger, R., Zeyda, M., Bauer, W., Kriehuber, E., Saemann, M. D., Zlabinger, G. J., Maurer, D. and Stulnig, T. M., Liver X receptors regulate dendritic cell phenotype and function through blocked induction of the actin-bundling protein fascin. Blood 2007. 109: 4288-4295. 126 Torocsik, D., Barath, M., Benko, S., Szeles, L., Dezso, B., Poliska, S., Hegyi, Z., Homolya, L., Szatmari, I., Lanyi, A. and Nagy, L., Activation of liver X receptor sensitizes human dendritic cells to inflammatory stimuli. J Immunol 2010. 184: 5456- 5465. 127 Boniface, K., Bak-Jensen, K. S., Li, Y., Blumenschein, W. M., McGeachy, M. J., McClanahan, T. K., McKenzie, B. S., Kastelein, R. A., Cua, D. J. and de Waal Malefyt, R., Prostaglandin E2 regulates Th17 cell differentiation and function through cyclic AMP and EP2/EP4 receptor signaling. J Exp Med 2009. 206: 535-548. 128 Sheibanie, A. F., Tadmori, I., Jing, H., Vassiliou, E. and Ganea, D., Prostaglandin E2 induces IL-23 production in bone marrow-derived dendritic cells. FASEB J 2004. 18: 1318-1320. 129 Khayrullina, T., Yen, J. H., Jing, H. and Ganea, D., In vitro differentiation of dendritic cells in the presence of prostaglandin E2 alters the IL-12/IL-23 balance and promotes differentiation of Th17 cells. J Immunol 2008. 181: 721-735. 130 Kuwabara, T., Ishikawa, F., Yasuda, T., Aritomi, K., Nakano, H., Tanaka, Y., Okada, Y., Lipp, M. and Kakiuchi, T., CCR 7 ligands are required for development of experimental autoimmune encephalomyelitis through generating IL-23-dependent Th17 cells. J Immunol 2009. 183: 2513-2521. 131 Jonuleit, H., Kuhn, U., Muller, G., Steinbrink, K., Paragnik, L., Schmitt, E., Knop, J. and Enk, A. H., Pro-inflammatory cytokines and prostaglandins induce maturation of potent immunostimulatory dendritic cells under fetal calf serum-free conditions. Eur J Immunol 1997. 27: 3135-3142. 132 Schuler, G., Schuler-Thurner, B. and Steinman, R. M., The use of dendritic cells in cancer immunotherapy. Curr Opin Immunol 2003. 15: 138-147. 133 Schuler, G., Dendritic cells in cancer immunotherapy. Eur J Immunol 2010. 40: 2123- 2130. 134 de Vries, I. J., Krooshoop, D. J., Scharenborg, N. M., Lesterhuis, W. J., Diepstra, J. H., Van Muijen, G. N., Strijk, S. P., Ruers, T. J., Boerman, O. C., Oyen, W. J., Adema, G. J., Punt, C. J. and Figdor, C. G., Effective migration of antigen-pulsed dendritic cells to lymph nodes in melanoma patients is determined by their maturation state. Cancer Res 2003. 63: 12-17. 135 Kalinski, P., Vieira, P. L., Schuitemaker, J. H., de Jong, E. C. and Kapsenberg, M. L., Prostaglandin E(2) is a selective inducer of interleukin-12 p40 (IL-12p40)

103 References

production and an inhibitor of bioactive IL-12p70 heterodimer. Blood 2001. 97: 3466- 3469. 136 Rubio, M. T., Means, T. K., Chakraverty, R., Shaffer, J., Fudaba, Y., Chittenden, M., Luster, A. D. and Sykes, M., Maturation of human monocyte-derived dendritic cells (MoDCs) in the presence of prostaglandin E2 optimizes CD4 and CD8 T cell- mediated responses to protein antigens: role of PGE2 in chemokine and cytokine expression by MoDCs. Int Immunol 2005. 17: 1561-1572. 137 Moller, I., Michel, K., Frech, N., Burger, M., Pfeifer, D., Frommolt, P., Veelken, H. and Thomas-Kaskel, A. K., Dendritic cell maturation with poly(I:C)-based versus PGE2-based cytokine combinations results in differential functional characteristics relevant to clinical application. J Immunother 2008. 31: 506-519. 138 Muthuswamy, R., Mueller-Berghaus, J., Haberkorn, U., Reinhart, T. A., Schadendorf, D. and Kalinski, P., PGE2 transiently enhances DC expression of CCR7 but inhibits the ability of DCs to produce CCL19 and attract naive T cells. Blood 2010. 116: 1454-1459. 139 Huang, Q., Liu, D., Majewski, P., Schulte, L. C., Korn, J. M., Young, R. A., Lander, E. S. and Hacohen, N., The plasticity of dendritic cell responses to pathogens and their components. Science 2001. 294: 870-875. 140 Sozzani, S., Allavena, P., D'Amico, G., Luini, W., Bianchi, G., Kataura, M., Imai, T., Yoshie, O., Bonecchi, R. and Mantovani, A., Differential regulation of chemokine receptors during dendritic cell maturation: a model for their trafficking properties. J Immunol 1998. 161: 1083-1086. 141 Dieu, M. C., Vanbervliet, B., Vicari, A., Bridon, J. M., Oldham, E., Ait-Yahia, S., Briere, F., Zlotnik, A., Lebecque, S. and Caux, C., Selective recruitment of immature and mature dendritic cells by distinct chemokines expressed in different anatomic sites. J Exp Med 1998. 188: 373-386. 142 Legler, D. F., Bruckner, M., Uetz-von Allmen, E. and Krause, P., Prostaglandin E(2) at new glance: Novel insights in functional diversity offer therapeutic chances. Int J Biochem Cell Biol 2010. 42: 198-201. 143 Kalinski, P., Schuitemaker, J. H., Hilkens, C. M. and Kapsenberg, M. L., Prostaglandin E2 induces the final maturation of IL-12-deficient CD1a+CD83+ dendritic cells: the levels of IL-12 are determined during the final dendritic cell maturation and are resistant to further modulation. J Immunol 1998. 161: 2804-2809. 144 Jing, H., Yen, J. H. and Ganea, D., A novel signaling pathway mediates the inhibition of CCL3/4 expression by prostaglandin E2. J Biol Chem 2004. 279: 55176-55186. 145 Jing, H., Vassiliou, E. and Ganea, D., Prostaglandin E2 inhibits production of the inflammatory chemokines CCL3 and CCL4 in dendritic cells. J Leukoc Biol 2003. 74: 868-879. 146 Vissers, J. L., Hartgers, F. C., Lindhout, E., Teunissen, M. B., Figdor, C. G. and Adema, G. J., Quantitative analysis of chemokine expression by dendritic cell subsets in vitro and in vivo. J Leukoc Biol 2001. 69: 785-793. 147 Palucka, A. K., Ueno, H., Fay, J. W. and Banchereau, J., Taming cancer by inducing immunity via dendritic cells. Immunol Rev 2007. 220: 129-150. 148 Gilboa, E., DC-based cancer vaccines. J Clin Invest 2007. 117: 1195-1203. 149 Tacken, P. J., de Vries, I. J., Torensma, R. and Figdor, C. G., Dendritic-cell immunotherapy: from ex vivo loading to in vivo targeting. Nat Rev Immunol 2007. 7: 790-802. 150 Banchereau, J. and Palucka, A. K., Dendritic cells as therapeutic vaccines against cancer. Nat Rev Immunol 2005. 5: 296-306. 151 Mailliard, R. B., Wankowicz-Kalinska, A., Cai, Q., Wesa, A., Hilkens, C. M., Kapsenberg, M. L., Kirkwood, J. M., Storkus, W. J. and Kalinski, P., alpha-type-1 polarized dendritic cells: a novel immunization tool with optimized CTL-inducing activity. Cancer Res 2004. 64: 5934-5937. 152 Krause, P., Singer, E., Darley, P. I., Klebensberger, J., Groettrup, M. and Legler, D. F., Prostaglandin E2 is a key factor for monocyte-derived dendritic cell maturation:

104 References

enhanced T cell-stimulatory capacity despite IDO. J Leukoc Biol 2007. 82: 1106- 1114. 153 Castellino, F., Huang, A. Y., Altan-Bonnet, G., Stoll, S., Scheinecker, C. and Germain, R. N., Chemokines enhance immunity by guiding naive CD8+ T cells to sites of CD4+ T cell-dendritic cell interaction. Nature 2006. 440: 890-895. 154 Sallusto, F., Kremmer, E., Palermo, B., Hoy, A., Ponath, P., Qin, S., Forster, R., Lipp, M. and Lanzavecchia, A., Switch in chemokine receptor expression upon TCR stimulation reveals novel homing potential for recently activated T cells. Eur J Immunol 1999. 29: 2037-2045. 155 Lebre, M. C., Burwell, T., Vieira, P. L., Lora, J., Coyle, A. J., Kapsenberg, M. L., Clausen, B. E. and De Jong, E. C., Differential expression of inflammatory chemokines by Th1- and Th2-cell promoting dendritic cells: a role for different mature dendritic cell populations in attracting appropriate effector cells to peripheral sites of inflammation. Immunol Cell Biol 2005. 83: 525-535. 156 Scimone, M. L., Lutzky, V. P., Zittermann, S. I., Maffia, P., Jancic, C., Buzzola, F., Issekutz, A. C. and Chuluyan, H. E., Migration of polymorphonuclear leucocytes is influenced by dendritic cells. Immunology 2005. 114: 375-385. 157 Shimaoka, T., Nakayama, T., Kume, N., Takahashi, S., Yamaguchi, J., Minami, M., Hayashida, K., Kita, T., Ohsumi, J., Yoshie, O. and Yonehara, S., Cutting edge: SR-PSOX/CXC chemokine ligand 16 mediates bacterial phagocytosis by APCs through its chemokine domain. J Immunol 2003. 171: 1647-1651. 158 van der Voort, R., Verweij, V., de Witte, T. M., Lasonder, E., Adema, G. J. and Dolstra, H., An alternatively spliced CXCL16 isoform expressed by dendritic cells is a secreted chemoattractant for CXCR6+ cells. J Leukoc Biol 2010. 159 Cook, D. N., Prosser, D. M., Forster, R., Zhang, J., Kuklin, N. A., Abbondanzo, S. J., Niu, X. D., Chen, S. C., Manfra, D. J., Wiekowski, M. T., Sullivan, L. M., Smith, S. R., Greenberg, H. B., Narula, S. K., Lipp, M. and Lira, S. A., CCR6 mediates dendritic cell localization, lymphocyte homeostasis, and immune responses in mucosal tissue. Immunity 2000. 12: 495-503. 160 Greaves, D. R., Wang, W., Dairaghi, D. J., Dieu, M. C., Saint-Vis, B., Franz- Bacon, K., Rossi, D., Caux, C., McClanahan, T., Gordon, S., Zlotnik, A. and Schall, T. J., CCR6, a CC chemokine receptor that interacts with macrophage inflammatory protein 3alpha and is highly expressed in human dendritic cells. J Exp Med 1997. 186: 837-844. 161 Hirota, K., Yoshitomi, H., Hashimoto, M., Maeda, S., Teradaira, S., Sugimoto, N., Yamaguchi, T., Nomura, T., Ito, H., Nakamura, T., Sakaguchi, N. and Sakaguchi, S., Preferential recruitment of CCR6-expressing Th17 cells to inflamed joints via CCL20 in rheumatoid arthritis and its animal model. J Exp Med 2007. 204: 2803- 2812. 162 Iellem, A., Mariani, M., Lang, R., Recalde, H., Panina-Bordignon, P., Sinigaglia, F. and D'Ambrosio, D., Unique chemotactic response profile and specific expression of chemokine receptors CCR4 and CCR8 by CD4(+)CD25(+) regulatory T cells. J Exp Med 2001. 194: 847-853. 163 McIlroy, A., Caron, G., Blanchard, S., Fremaux, I., Duluc, D., Delneste, Y., Chevailler, A. and Jeannin, P., Histamine and prostaglandin E up-regulate the production of Th2-attracting chemokines (CCL17 and CCL22) and down-regulate IFN-gamma-induced CXCL10 production by immature human dendritic cells. Immunology 2006. 117: 507-516. 164 Lim, H. W., Lee, J., Hillsamer, P. and Kim, C. H., Human Th17 cells share major trafficking receptors with both polarized effector T cells and FOXP3+ regulatory T cells. J Immunol 2008. 180: 122-129. 165 Legler, D. F., Loetscher, M., Roos, R. S., Clark-Lewis, I., Baggiolini, M. and Moser, B., B cell-attracting chemokine 1, a human CXC chemokine expressed in lymphoid tissues, selectively attracts B lymphocytes via BLR1/CXCR5. J Exp Med 1998. 187: 655-660.

105 References

166 McWilliam, A. S., Marsh, A. M. and Holt, P. G., Inflammatory infiltration of the upper airway epithelium during Sendai virus infection: involvement of epithelial dendritic cells. J Virol 1997. 71: 226-236. 167 Bagorda, A. and Parent, C. A., Eukaryotic chemotaxis at a glance. J Cell Sci 2008. 121: 2621-2624. 168 Vassiliou, E., Jing, H. and Ganea, D., Prostaglandin E2 inhibits TNF production in murine bone marrow-derived dendritic cells. Cell Immunol 2003. 223: 120-132. 169 Willimann, K., Legler, D. F., Loetscher, M., Roos, R. S., Delgado, M. B., Clark- Lewis, I., Baggiolini, M. and Moser, B., The chemokine SLC is expressed in T cell areas of lymph nodes and mucosal lymphoid tissues and attracts activated T cells via CCR7. Eur J Immunol 1998. 28: 2025-2034. 170 Scandella, E., Men, Y., Legler, D. F., Gillessen, S., Prikler, L., Ludewig, B. and Groettrup, M., CCL19/CCL21-triggered signal transduction and migration of dendritic cells requires prostaglandin E2. Blood 2004. 103: 1595-1601. 171 Kihara, Y., Matsushita, T., Kita, Y., Uematsu, S., Akira, S., Kira, J., Ishii, S. and Shimizu, T., Targeted lipidomics reveals mPGES-1-PGE2 as a therapeutic target for multiple sclerosis. Proc Natl Acad Sci U S A 2009. 106: 21807-21812. 172 Bensinger, S. J., Bradley, M. N., Joseph, S. B., Zelcer, N., Janssen, E. M., Hausner, M. A., Shih, R., Parks, J. S., Edwards, P. A., Jamieson, B. D. and Tontonoz, P., LXR signaling couples sterol metabolism to proliferation in the acquired immune response. Cell 2008. 134: 97-111. 173 Bensinger, S. J. and Tontonoz, P., Integration of metabolism and inflammation by lipid-activated nuclear receptors. Nature 2008. 454: 470-477. 174 Hanley, T. M., Blay Puryear, W., Gummuluru, S. and Viglianti, G. A., PPARgamma and LXR signaling inhibit dendritic cell-mediated HIV-1 capture and trans-infection. PLoS Pathog 2010. 6: e1000981. 175 Whitney, K. D., Watson, M. A., Goodwin, B., Galardi, C. M., Maglich, J. M., Wilson, J. G., Willson, T. M., Collins, J. L. and Kliewer, S. A., Liver X receptor (LXR) regulation of the LXRalpha gene in human macrophages. J Biol Chem 2001. 276: 43509-43515. 176 Joseph, S. B., Castrillo, A., Laffitte, B. A., Mangelsdorf, D. J. and Tontonoz, P., Reciprocal regulation of inflammation and lipid metabolism by liver X receptors. Nat Med 2003. 9: 213-219. 177 Kabashima, K., Saji, T., Murata, T., Nagamachi, M., Matsuoka, T., Segi, E., Tsuboi, K., Sugimoto, Y., Kobayashi, T., Miyachi, Y., Ichikawa, A. and Narumiya, S., The prostaglandin receptor EP4 suppresses colitis, mucosal damage and CD4 cell activation in the gut. J Clin Invest 2002. 109: 883-893. 178 Yen, J. H., Kong, W. and Ganea, D., IFN-beta inhibits dendritic cell migration through STAT-1-mediated transcriptional suppression of CCR7 and matrix metalloproteinase 9. J Immunol 2010. 184: 3478-3486. 179 Yamamoto, T., Shimano, H., Inoue, N., Nakagawa, Y., Matsuzaka, T., Takahashi, A., Yahagi, N., Sone, H., Suzuki, H., Toyoshima, H. and Yamada, N., Protein kinase A suppresses sterol regulatory element-binding protein-1C expression via phosphorylation of liver X receptor in the liver. J Biol Chem 2007. 282: 11687-11695. 180 Xu, J., Wagoner, G., Douglas, J. C. and Drew, P. D., Liver X receptor agonist regulation of Th17 lymphocyte function in autoimmunity. J Leukoc Biol 2009. 86: 401- 409. 181 Cui, G., Qin, X., Wu, L., Zhang, Y., Sheng, X., Yu, Q., Sheng, H., Xi, B., Zhang, J. Z. and Zang, Y. Q., Liver X receptor (LXR) mediates negative regulation of mouse and human Th17 differentiation. J Clin Invest 2011. 121: 658-670. 182 Croft, M., Co-stimulatory members of the TNFR family: keys to effective T-cell immunity? Nat Rev Immunol 2003. 3: 609-620. 183 Gramaglia, I., Weinberg, A. D., Lemon, M. and Croft, M., Ox-40 ligand: a potent costimulatory molecule for sustaining primary CD4 T cell responses. J Immunol 1998. 161: 6510-6517.

106 References

184 Chen, A. I., McAdam, A. J., Buhlmann, J. E., Scott, S., Lupher, M. L., Jr., Greenfield, E. A., Baum, P. R., Fanslow, W. C., Calderhead, D. M., Freeman, G. J. and Sharpe, A. H., Ox40-ligand has a critical costimulatory role in dendritic cell:T cell interactions. Immunity 1999. 11: 689-698. 185 Kopf, M., Ruedl, C., Schmitz, N., Gallimore, A., Lefrang, K., Ecabert, B., Odermatt, B. and Bachmann, M. F., OX40-deficient mice are defective in Th cell proliferation but are competent in generating B cell and CTL Responses after virus infection. Immunity 1999. 11: 699-708. 186 Murata, K., Ishii, N., Takano, H., Miura, S., Ndhlovu, L. C., Nose, M., Noda, T. and Sugamura, K., Impairment of antigen-presenting cell function in mice lacking expression of OX40 ligand. J Exp Med 2000. 191: 365-374. 187 Gramaglia, I., Jember, A., Pippig, S. D., Weinberg, A. D., Killeen, N. and Croft, M., The OX40 costimulatory receptor determines the development of CD4 memory by regulating primary clonal expansion. J Immunol 2000. 165: 3043-3050. 188 Rogers, P. R., Song, J., Gramaglia, I., Killeen, N. and Croft, M., OX40 promotes Bcl-xL and Bcl-2 expression and is essential for long-term survival of CD4 T cells. Immunity 2001. 15: 445-455. 189 Hendriks, J., Xiao, Y., Rossen, J. W., van der Sluijs, K. F., Sugamura, K., Ishii, N. and Borst, J., During viral infection of the respiratory tract, CD27, 4-1BB, and OX40 collectively determine formation of CD8+ memory T cells and their capacity for secondary expansion. J Immunol 2005. 175: 1665-1676. 190 Ohshima, Y., Tanaka, Y., Tozawa, H., Takahashi, Y., Maliszewski, C. and Delespesse, G., Expression and function of OX40 ligand on human dendritic cells. J Immunol 1997. 159: 3838-3848. 191 Brocker, T., Gulbranson-Judge, A., Flynn, S., Riedinger, M., Raykundalia, C. and Lane, P., CD4 T cell traffic control: in vivo evidence that ligation of OX40 on CD4 T cells by OX40-ligand expressed on dendritic cells leads to the accumulation of CD4 T cells in B follicles. Eur J Immunol 1999. 29: 1610-1616. 192 Stuber, E., Neurath, M., Calderhead, D., Fell, H. P. and Strober, W., Cross-linking of OX40 ligand, a member of the TNF/NGF cytokine family, induces proliferation and differentiation in murine splenic B cells. Immunity 1995. 2: 507-521. 193 Weinberg, A. D., Wegmann, K. W., Funatake, C. and Whitham, R. H., Blocking OX-40/OX-40 ligand interaction in vitro and in vivo leads to decreased T cell function and amelioration of experimental allergic encephalomyelitis. J Immunol 1999. 162: 1818-1826. 194 Dannull, J., Nair, S., Su, Z., Boczkowski, D., DeBeck, C., Yang, B., Gilboa, E. and Vieweg, J., Enhancing the immunostimulatory function of dendritic cells by transfection with mRNA encoding OX40 ligand. Blood 2005. 105: 3206-3213. 195 Borst, J., Hendriks, J. and Xiao, Y., CD27 and CD70 in T cell and B cell activation. Curr Opin Immunol 2005. 17: 275-281. 196 Xiao, Y., Hendriks, J., Langerak, P., Jacobs, H. and Borst, J., CD27 is acquired by primed B cells at the centroblast stage and promotes germinal center formation. J Immunol 2004. 172: 7432-7441. 197 Arens, R., Tesselaar, K., Baars, P. A., van Schijndel, G. M., Hendriks, J., Pals, S. T., Krimpenfort, P., Borst, J., van Oers, M. H. and van Lier, R. A., Constitutive CD27/CD70 interaction induces expansion of effector-type T cells and results in IFNgamma-mediated B cell depletion. Immunity 2001. 15: 801-812. 198 Tesselaar, K., Arens, R., van Schijndel, G. M., Baars, P. A., van der Valk, M. A., Borst, J., van Oers, M. H. and van Lier, R. A., Lethal T cell immunodeficiency induced by chronic costimulation via CD27-CD70 interactions. Nat Immunol 2003. 4: 49-54. 199 Bowman, M. R., Crimmins, M. A., Yetz-Aldape, J., Kriz, R., Kelleher, K. and Herrmann, S., The cloning of CD70 and its identification as the ligand for CD27. J Immunol 1994. 152: 1756-1761.

107 References

200 Tesselaar, K., Gravestein, L. A., van Schijndel, G. M., Borst, J. and van Lier, R. A., Characterization of murine CD70, the ligand of the TNF receptor family member CD27. J Immunol 1997. 159: 4959-4965. 201 Tesselaar, K., Xiao, Y., Arens, R., van Schijndel, G. M., Schuurhuis, D. H., Mebius, R. E., Borst, J. and van Lier, R. A., Expression of the murine CD27 ligand CD70 in vitro and in vivo. J Immunol 2003. 170: 33-40. 202 Taraban, V. Y., Rowley, T. F. and Al-Shamkhani, A., Cutting edge: a critical role for CD70 in CD8 T cell priming by CD40-licensed APCs. J Immunol 2004. 173: 6542- 6546. 203 Schildknecht, A., Miescher, I., Yagita, H. and van den Broek, M., Priming of CD8+ T cell responses by pathogens typically depends on CD70-mediated interactions with dendritic cells. Eur J Immunol 2007. 37: 716-728. 204 Laouar, A., Haridas, V., Vargas, D., Zhinan, X., Chaplin, D., van Lier, R. A. and Manjunath, N., CD70+ antigen-presenting cells control the proliferation and differentiation of T cells in the intestinal mucosa. Nat Immunol 2005. 6: 698-706. 205 Soroosh, P., Ine, S., Sugamura, K. and Ishii, N., OX40-OX40 ligand interaction through T cell-T cell contact contributes to CD4 T cell longevity. J Immunol 2006. 176: 5975-5987. 206 Sallusto, F. and Lanzavecchia, A., Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony- stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor alpha. J Exp Med 1994. 179: 1109-1118. 207 Ginhoux, F., Tacke, F., Angeli, V., Bogunovic, M., Loubeau, M., Dai, X. M., Stanley, E. R., Randolph, G. J. and Merad, M., Langerhans cells arise from monocytes in vivo. Nat Immunol 2006. 7: 265-273. 208 Zhang, A. L., Colmenero, P., Purath, U., Teixeira de Matos, C., Hueber, W., Klareskog, L., Tarner, I. H., Engleman, E. G. and Soderstrom, K., Natural killer cells trigger differentiation of monocytes into dendritic cells. Blood 2007. 110: 2484- 2493. 209 Tacken, P. J., de Vries, I. J., Gijzen, K., Joosten, B., Wu, D., Rother, R. P., Faas, S. J., Punt, C. J., Torensma, R., Adema, G. J. and Figdor, C. G., Effective induction of naive and recall T-cell responses by targeting antigen to human dendritic cells via a humanized anti-DC-SIGN antibody. Blood 2005. 106: 1278-1285. 210 Sato, T., Kirimura, Y. and Mori, Y., The co-culture of dermal fibroblasts with human epidermal keratinocytes induces increased prostaglandin E2 production and cyclooxygenase 2 activity in fibroblasts. J Invest Dermatol 1997. 109: 334-339. 211 Endo, T., Ogushi, F., Kawano, T. and Sone, S., Comparison of the regulations by Th2-type cytokines of the arachidonic-acid metabolic pathway in human alveolar macrophages and monocytes. Am J Respir Cell Mol Biol 1998. 19: 300-307. 212 Zaini, J., Andarini, S., Tahara, M., Saijo, Y., Ishii, N., Kawakami, K., Taniguchi, M., Sugamura, K., Nukiwa, T. and Kikuchi, T., OX40 ligand expressed by DCs costimulates NKT and CD4+ Th cell antitumor immunity in mice. J Clin Invest 2007. 117: 3330-3338. 213 Boullart, A. C., Aarntzen, E. H., Verdijk, P., Jacobs, J. F., Schuurhuis, D. H., Benitez-Ribas, D., Schreibelt, G., van de Rakt, M. W., Scharenborg, N. M., de Boer, A., Kramer, M., Figdor, C. G., Punt, C. J., Adema, G. J. and de Vries, I. J., Maturation of monocyte-derived dendritic cells with Toll-like receptor 3 and 7/8 ligands combined with prostaglandin E(2) results in high interleukin-12 production and cell migration. Cancer Immunol Immunother 2008. 57: 1589-1597. 214 Assier, E., Marin-Esteban, V., Haziot, A., Maggi, E., Charron, D. and Mooney, N., TLR7/8 agonists impair monocyte-derived dendritic cell differentiation and maturation. J Leukoc Biol 2007. 81: 221-228. 215 Taraban, V. Y., Rowley, T. F., O'Brien, L., Chan, H. T., Haswell, L. E., Green, M. H., Tutt, A. L., Glennie, M. J. and Al-Shamkhani, A., Expression and costimulatory effects of the TNF receptor superfamily members CD134 (OX40) and CD137 (4-1BB),

108 References

and their role in the generation of anti-tumor immune responses. Eur J Immunol 2002. 32: 3617-3627. 216 Bullock, T. N. and Yagita, H., Induction of CD70 on dendritic cells through CD40 or TLR stimulation contributes to the development of CD8+ T cell responses in the absence of CD4+ T cells. J Immunol 2005. 174: 710-717. 217 Hendriks, J., Xiao, Y. and Borst, J., CD27 promotes survival of activated T cells and complements CD28 in generation and establishment of the effector T cell pool. J Exp Med 2003. 198: 1369-1380. 218 Lens, S. M., Baars, P. A., Hooibrink, B., van Oers, M. H. and van Lier, R. A., Antigen-presenting cell-derived signals determine expression levels of CD70 on primed T cells. Immunology 1997. 90: 38-45. 219 Mendel, I. and Shevach, E. M., Activated T cells express the OX40 ligand: requirements for induction and costimulatory function. Immunology 2006. 117: 196- 204. 220 Murphy, K. M. and Reiner, S. L., The lineage decisions of helper T cells. Nat Rev Immunol 2002. 2: 933-944. 221 Soares, H., Waechter, H., Glaichenhaus, N., Mougneau, E., Yagita, H., Mizenina, O., Dudziak, D., Nussenzweig, M. C. and Steinman, R. M., A subset of dendritic cells induces CD4+ T cells to produce IFN-gamma by an IL-12-independent but CD70-dependent mechanism in vivo. J Exp Med 2007. 204: 1095-1106. 222 Flynn, S., Toellner, K. M., Raykundalia, C., Goodall, M. and Lane, P., CD4 T cell cytokine differentiation: the B cell activation molecule, OX40 ligand, instructs CD4 T cells to express interleukin 4 and upregulates expression of the chemokine receptor, Blr-1. J Exp Med 1998. 188: 297-304. 223 Ohshima, Y., Yang, L. P., Uchiyama, T., Tanaka, Y., Baum, P., Sergerie, M., Hermann, P. and Delespesse, G., OX40 costimulation enhances interleukin-4 (IL-4) expression at priming and promotes the differentiation of naive human CD4(+) T cells into high IL-4-producing effectors. Blood 1998. 92: 3338-3345. 224 Higgins, L. M., McDonald, S. A., Whittle, N., Crockett, N., Shields, J. G. and MacDonald, T. T., Regulation of T cell activation in vitro and in vivo by targeting the OX40-OX40 ligand interaction: amelioration of ongoing inflammatory bowel disease with an OX40-IgG fusion protein, but not with an OX40 ligand-IgG fusion protein. J Immunol 1999. 162: 486-493. 225 Weinberg, A. D., Rivera, M. M., Prell, R., Morris, A., Ramstad, T., Vetto, J. T., Urba, W. J., Alvord, G., Bunce, C. and Shields, J., Engagement of the OX-40 receptor in vivo enhances antitumor immunity. J Immunol 2000. 164: 2160-2169. 226 Morris, A., Vetto, J. T., Ramstad, T., Funatake, C. J., Choolun, E., Entwisle, C. and Weinberg, A. D., Induction of anti-mammary cancer immunity by engaging the OX-40 receptor in vivo. Breast Cancer Res Treat 2001. 67: 71-80. 227 Pan, P. Y., Zang, Y., Weber, K., Meseck, M. L. and Chen, S. H., OX40 ligation enhances primary and memory cytotoxic T lymphocyte responses in an immunotherapy for hepatic colon metastases. Mol Ther 2002. 6: 528-536. 228 Takeda, I., Ine, S., Killeen, N., Ndhlovu, L. C., Murata, K., Satomi, S., Sugamura, K. and Ishii, N., Distinct roles for the OX40-OX40 ligand interaction in regulatory and nonregulatory T cells. J Immunol 2004. 172: 3580-3589. 229 Vu, M. D., Xiao, X., Gao, W., Degauque, N., Chen, M., Kroemer, A., Killeen, N., Ishii, N. and Chang Li, X., OX40 costimulation turns off Foxp3+ Tregs. Blood 2007. 110: 2501-2510. 230 So, T. and Croft, M., Cutting edge: OX40 inhibits TGF-beta- and antigen-driven conversion of naive CD4 T cells into CD25+Foxp3+ T cells. J Immunol 2007. 179: 1427-1430. 231 Rot, A. and von Andrian, U. H., Chemokines in innate and adaptive host defense: basic chemokinese grammar for immune cells. Annu Rev Immunol 2004. 22: 891- 928.

109 References

232 Friedl, P., Borgmann, S. and Brocker, E. B., Amoeboid leukocyte crawling through extracellular matrix: lessons from the Dictyostelium paradigm of cell movement. J Leukoc Biol 2001. 70: 491-509. 233 Friedl, P., Entschladen, F., Conrad, C., Niggemann, B. and Zanker, K. S., CD4+ T lymphocytes migrating in three-dimensional collagen lattices lack focal adhesions and utilize beta1 integrin-independent strategies for polarization, interaction with collagen fibers and locomotion. Eur J Immunol 1998. 28: 2331-2343. 234 Woolf, E., Grigorova, I., Sagiv, A., Grabovsky, V., Feigelson, S. W., Shulman, Z., Hartmann, T., Sixt, M., Cyster, J. G. and Alon, R., Lymph node chemokines promote sustained T lymphocyte motility without triggering stable integrin adhesiveness in the absence of shear forces. Nat Immunol 2007. 8: 1076-1085. 235 Lammermann, T., Renkawitz, J., Wu, X., Hirsch, K., Brakebusch, C. and Sixt, M., Cdc42-dependent leading edge coordination is essential for interstitial dendritic cell migration. Blood 2009. 113: 5703-5710. 236 Ley, K., Laudanna, C., Cybulsky, M. I. and Nourshargh, S., Getting to the site of inflammation: the leukocyte adhesion cascade updated. Nat Rev Immunol 2007. 7: 678-689. 237 Middleton, J., Neil, S., Wintle, J., Clark-Lewis, I., Moore, H., Lam, C., Auer, M., Hub, E. and Rot, A., Transcytosis and surface presentation of IL-8 by venular endothelial cells. Cell 1997. 91: 385-395. 238 Pruenster, M., Mudde, L., Bombosi, P., Dimitrova, S., Zsak, M., Middleton, J., Richmond, A., Graham, G. J., Segerer, S., Nibbs, R. J. and Rot, A., The Duffy antigen receptor for chemokines transports chemokines and supports their promigratory activity. Nat Immunol 2009. 10: 101-108. 239 Shamri, R., Grabovsky, V., Gauguet, J. M., Feigelson, S., Manevich, E., Kolanus, W., Robinson, M. K., Staunton, D. E., von Andrian, U. H. and Alon, R., Lymphocyte arrest requires instantaneous induction of an extended LFA-1 conformation mediated by endothelium-bound chemokines. Nat Immunol 2005. 6: 497-506. 240 Miyasaka, M. and Tanaka, T., Lymphocyte trafficking across high endothelial venules: dogmas and enigmas. Nat Rev Immunol 2004. 4: 360-370. 241 Mellman, I. and Steinman, R. M., Dendritic cells: specialized and regulated antigen processing machines. Cell 2001. 106: 255-258. 242 Forster, R., Schubel, A., Breitfeld, D., Kremmer, E., Renner-Muller, I., Wolf, E. and Lipp, M., CCR7 coordinates the primary immune response by establishing functional microenvironments in secondary lymphoid organs. Cell 1999. 99: 23-33. 243 Ohl, L., Mohaupt, M., Czeloth, N., Hintzen, G., Kiafard, Z., Zwirner, J., Blankenstein, T., Henning, G. and Forster, R., CCR7 governs skin dendritic cell migration under inflammatory and steady-state conditions. Immunity 2004. 21: 279- 288. 244 Luther, S. A., Tang, H. L., Hyman, P. L., Farr, A. G. and Cyster, J. G., Coexpression of the chemokines ELC and SLC by T zone stromal cells and deletion of the ELC gene in the plt/plt mouse. Proc Natl Acad Sci U S A 2000. 97: 12694- 12699. 245 Luther, S. A., Bidgol, A., Hargreaves, D. C., Schmidt, A., Xu, Y., Paniyadi, J., Matloubian, M. and Cyster, J. G., Differing activities of homeostatic chemokines CCL19, CCL21, and CXCL12 in lymphocyte and dendritic cell recruitment and lymphoid neogenesis. J Immunol 2002. 169: 424-433. 246 Junt, T., Scandella, E., Forster, R., Krebs, P., Krautwald, S., Lipp, M., Hengartner, H. and Ludewig, B., Impact of CCR7 on Priming and Distribution of Antiviral Effector and Memory CTL. J Immunol 2004. 173: 6684-6693. 247 Reif, K., Ekland, E. H., Ohl, L., Nakano, H., Lipp, M., Forster, R. and Cyster, J. G., Balanced responsiveness to chemoattractants from adjacent zones determines B-cell position. Nature 2002. 416: 94-99. 248 Kohout, T. A., Nicholas, S. L., Perry, S. J., Reinhart, G., Junger, S. and Struthers, R. S., Differential Desensitization, Receptor Phosphorylation, beta-Arrestin

110 References

Recruitment, and ERK1/2 Activation by the Two Endogenous Ligands for the CC Chemokine Receptor 7. J Biol Chem 2004. 279: 23214-23222. 249 de Paz, J. L., Moseman, E. A., Noti, C., Polito, L., von Andrian, U. H. and Seeberger, P. H., Profiling heparin-chemokine interactions using synthetic tools. ACS Chem Biol 2007. 2: 735-744. 250 Hirose, J., Kawashima, H., Swope Willis, M., Springer, T. A., Hasegawa, H., Yoshie, O. and Miyasaka, M., Chondroitin sulfate B exerts its inhibitory effect on secondary lymphoid tissue chemokine (SLC) by binding to the C-terminus of SLC. Biochim Biophys Acta 2002. 1571: 219-224. 251 Patel, D. D., Koopmann, W., Imai, T., Whichard, L. P., Yoshie, O. and Krangel, M. S., Chemokines have diverse abilities to form solid phase gradients. Clin Immunol 2001. 99: 43-52. 252 Stein, J. V., Rot, A., Luo, Y., Narasimhaswamy, M., Nakano, H., Gunn, M. D., Matsuzawa, A., Quackenbush, E. J., Dorf, M. E. and von Andrian, U. H., The CC chemokine thymus-derived chemotactic agent 4 (TCA-4, secondary lymphoid tissue chemokine, 6Ckine, exodus-2) triggers lymphocyte function-associated antigen 1- mediated arrest of rolling T lymphocytes in peripheral lymph node high endothelial venules. J Exp Med 2000. 191: 61-76. 253 Nakano, H., Mori, S., Yonekawa, H., Nariuchi, H., Matsuzawa, A. and Kakiuchi, T., A novel mutant gene involved in T-lymphocyte-specific homing into peripheral lymphoid organs on mouse chromosome 4. Blood 1998. 91: 2886-2895. 254 Okada, T. and Cyster, J. G., CC chemokine receptor 7 contributes to Gi-dependent T cell motility in the lymph node. J Immunol 2007. 178: 2973-2978. 255 Heit, B. and Kubes, P., Measuring chemotaxis and chemokinesis: the under-agarose cell migration assay. Sci STKE 2003. 2003: PL5. 256 Bax, M., van Vliet, S. J., Litjens, M., Garcia-Vallejo, J. J. and van Kooyk, Y., Interaction of polysialic acid with CCL21 regulates the migratory capacity of human dendritic cells. PLoS One 2009. 4: e6987. 257 Asperti-Boursin, F., Real, E., Bismuth, G., Trautmann, A. and Donnadieu, E., CCR7 ligands control basal T cell motility within lymph node slices in a phosphoinositide 3-kinase-independent manner. J Exp Med 2007. 204: 1167-1179. 258 Worbs, T., Mempel, T. R., Bolter, J., von Andrian, U. H. and Forster, R., CCR7 ligands stimulate the intranodal motility of T lymphocytes in vivo. J Exp Med 2007. 204: 489-495. 259 Bajenoff, M., Egen, J. G., Koo, L. Y., Laugier, J. P., Brau, F., Glaichenhaus, N. and Germain, R. N., Stromal cell networks regulate lymphocyte entry, migration, and territoriality in lymph nodes. Immunity 2006. 25: 989-1001. 260 Bajenoff, M., Egen, J. G., Qi, H., Huang, A. Y., Castellino, F. and Germain, R. N., Highways, byways and breadcrumbs: directing lymphocyte traffic in the lymph node. Trends Immunol 2007. 28: 346-352. 261 Bajenoff, M., Glaichenhaus, N. and Germain, R. N., Fibroblastic reticular cells guide T lymphocyte entry into and migration within the splenic T cell zone. J Immunol 2008. 181: 3947-3954. 262 Roozendaal, R., Mempel, T. R., Pitcher, L. A., Gonzalez, S. F., Verschoor, A., Mebius, R. E., von Andrian, U. H. and Carroll, M. C., Conduits mediate transport of low-molecular-weight antigen to lymph node follicles. Immunity 2009. 30: 264-276. 263 Mempel, T. R., Junt, T. and von Andrian, U. H., Rulers over Randomness: Stroma Cells Guide Lymphocyte Migration in Lymph Nodes. Immunity 2006. 25: 867-869. 264 Sumen, C., Mempel, T. R., Mazo, I. B. and von Andrian, U. H., Intravital microscopy: visualizing immunity in context. Immunity 2004. 21: 315-329. 265 Okada, T., Miller, M. J., Parker, I., Krummel, M. F., Neighbors, M., Hartley, S. B., O'Garra, A., Cahalan, M. D. and Cyster, J. G., Antigen-engaged B cells undergo chemotaxis toward the T zone and form motile conjugates with helper T cells. PLoS Biol 2005. 3: e150. 266 Kissenpfennig, A., Henri, S., Dubois, B., Laplace-Builhe, C., Perrin, P., Romani, N., Tripp, C. H., Douillard, P., Leserman, L., Kaiserlian, D., Saeland, S., Davoust,

111 References

J. and Malissen, B., Dynamics and function of Langerhans cells in vivo: dermal dendritic cells colonize lymph node areas distinct from slower migrating Langerhans cells. Immunity 2005. 22: 643-654. 267 Saeki, H., Wu, M. T., Olasz, E. and Hwang, S. T., A migratory population of skin- derived dendritic cells expresses CXCR5, responds to B lymphocyte chemoattractant in vitro, and co-localizes to B cell zones in lymph nodes in vivo. Eur J Immunol 2000. 30: 2808-2814. 268 Wu, M. T. and Hwang, S. T., CXCR5-transduced bone marrow-derived dendritic cells traffic to B cell zones of lymph nodes and modify antigen-specific immune responses. J Immunol 2002. 168: 5096-5102. 269 Chtanova, T., Schaeffer, M., Han, S. J., van Dooren, G. G., Nollmann, M., Herzmark, P., Chan, S. W., Satija, H., Camfield, K., Aaron, H., Striepen, B. and Robey, E. A., Dynamics of neutrophil migration in lymph nodes during infection. Immunity 2008. 29: 487-496. 270 Mueller, S. N., Hosiawa-Meagher, K. A., Konieczny, B. T., Sullivan, B. M., Bachmann, M. F., Locksley, R. M., Ahmed, R. and Matloubian, M., Regulation of homeostatic chemokine expression and cell trafficking during immune responses. Science 2007. 317: 670-674. 271 Martin-Fontecha, A., Sebastiani, S., Hopken, U. E., Uguccioni, M., Lipp, M., Lanzavecchia, A. and Sallusto, F., Regulation of dendritic cell migration to the draining lymph node: impact on T lymphocyte traffic and priming. J Exp Med 2003. 198: 615-621. 272 Andrew, N. and Insall, R. H., Chemotaxis in shallow gradients is mediated independently of PtdIns 3-kinase by biased choices between random protrusions. Nat Cell Biol 2007. 9: 193-200. 273 Wedlich-Soldner, R. and Li, R., Spontaneous cell polarization: undermining determinism. Nat Cell Biol 2003. 5: 267-270. 274 Arrieumerlou, C. and Meyer, T., A local coupling model and compass parameter for eukaryotic chemotaxis. Dev Cell 2005. 8: 215-227. 275 Renkawitz, J., Schumann, K., Weber, M., Lammermann, T., Pflicke, H., Piel, M., Polleux, J., Spatz, J. P. and Sixt, M., Adaptive force transmission in amoeboid cell migration. Nat Cell Biol 2009. 11: 1438-1443. 276 Wilson, R. W., Ballantyne, C. M., Smith, C. W., Montgomery, C., Bradley, A., O'Brien, W. E. and Beaudet, A. L., Gene targeting yields a CD18-mutant mouse for study of inflammation. J Immunol 1993. 151: 1571-1578. 277 Lutz, M. B., Kukutsch, N., Ogilvie, A. L., Rossner, S., Koch, F., Romani, N. and Schuler, G., An advanced culture method for generating large quantities of highly pure dendritic cells from mouse bone marrow. J Immunol Methods 1999. 223: 77-92. 278 Schumann, K., Lammermann, T., Bruckner, M., Legler, D. F., Polleux, J., Spatz, J. P., Schuler, G., Forster, R., Lutz, M. B., Sorokin, L. and Sixt, M., Immobilized chemokine fields and soluble chemokine gradients cooperatively shape migration patterns of dendritic cells. Immunity 2010. 32: 703-713. (http://www.sciencedirect.com/science/article/pii/S1074761310001664) 279 Beck, G. and Habicht, G. S., Immunity and the invertebrates. Sci Am 1996. 275: 60- 63, 66. 280 Steinman, R. M., Linking innate to adaptive immunity through dendritic cells. Novartis Found Symp 2006. 279: 101-109; discussion 109-113, 216-109. 281 Portanova, J. P., Zhang, Y., Anderson, G. D., Hauser, S. D., Masferrer, J. L., Seibert, K., Gregory, S. A. and Isakson, P. C., Selective neutralization of prostaglandin E2 blocks inflammation, hyperalgesia, and interleukin 6 production in vivo. J Exp Med 1996. 184: 883-891. 282 Geissmann, F., Jung, S. and Littman, D. R., Blood monocytes consist of two principal subsets with distinct migratory properties. Immunity 2003. 19: 71-82. 283 Scapini, P., Lapinet-Vera, J. A., Gasperini, S., Calzetti, F., Bazzoni, F. and Cassatella, M. A., The neutrophil as a cellular source of chemokines. Immunol Rev 2000. 177: 195-203.

112 References

284 Fehniger, T. A., Shah, M. H., Turner, M. J., VanDeusen, J. B., Whitman, S. P., Cooper, M. A., Suzuki, K., Wechser, M., Goodsaid, F. and Caligiuri, M. A., Differential cytokine and chemokine gene expression by human NK cells following activation with IL-18 or IL-15 in combination with IL-12: implications for the innate immune response. J Immunol 1999. 162: 4511-4520. 285 Alder, J., Hahn-Zoric, M., Andersson, B. A. and Karlsson-Parra, A., Interferon- gamma dose-dependently inhibits prostaglandin E(2)-mediated dendritic-cell- migration towards secondary lymphoid organ chemokines. Vaccine 2006. 24: 7087- 7094. 286 Vesely, M. D., Kershaw, M. H., Schreiber, R. D. and Smyth, M. J., Natural innate and adaptive immunity to cancer. Annu Rev Immunol 2011. 29: 235-271. 287 Hanahan, D. and Weinberg, R. A., The hallmarks of cancer. Cell 2000. 100: 57-70. 288 Fernandez, N. C., Lozier, A., Flament, C., Ricciardi-Castagnoli, P., Bellet, D., Suter, M., Perricaudet, M., Tursz, T., Maraskovsky, E. and Zitvogel, L., Dendritic cells directly trigger NK cell functions: cross-talk relevant in innate anti-tumor immune responses in vivo. Nat Med 1999. 5: 405-411. 289 Terabe, M. and Berzofsky, J. A., The role of NKT cells in tumor immunity. Adv Cancer Res 2008. 101: 277-348. 290 Mukaida, N., Pathophysiological roles of interleukin-8/CXCL8 in pulmonary diseases. Am J Physiol Lung Cell Mol Physiol 2003. 284: L566-577. 291 Waugh, D. J., Wilson, C., Seaton, A. and Maxwell, P. J., Multi-faceted roles for CXC-chemokines in prostate cancer progression. Front Biosci 2008. 13: 4595-4604. 292 Deng, L., Chen, N., Li, Y., Zheng, H. and Lei, Q., CXCR6/CXCL16 functions as a regulator in metastasis and progression of cancer. Biochim Biophys Acta 2010. 1806: 42-49. 293 Fainaru, O., Adini, A., Benny, O., Adini, I., Short, S., Bazinet, L., Nakai, K., Pravda, E., Hornstein, M. D., D'Amato, R. J. and Folkman, J., Dendritic cells support angiogenesis and promote lesion growth in a murine model of endometriosis. FASEB J 2008. 22: 522-529. 294 Fainaru, O., Almog, N., Yung, C. W., Nakai, K., Montoya-Zavala, M., Abdollahi, A., D'Amato, R. and Ingber, D. E., Tumor growth and angiogenesis are dependent on the presence of immature dendritic cells. FASEB J 2010. 24: 1411-1418. 295 Chaput, N., Conforti, R., Viaud, S., Spatz, A. and Zitvogel, L., The Janus face of dendritic cells in cancer. Oncogene 2008. 27: 5920-5931. 296 Ma, Y., Aymeric, L., Locher, C., Kroemer, G. and Zitvogel, L., The dendritic cell- tumor cross-talk in cancer. Curr Opin Immunol 2011. 23: 146-152. 297 N, A. G., Bensinger, S. J., Hong, C., Beceiro, S., Bradley, M. N., Zelcer, N., Deniz, J., Ramirez, C., Diaz, M., Gallardo, G., de Galarreta, C. R., Salazar, J., Lopez, F., Edwards, P., Parks, J., Andujar, M., Tontonoz, P. and Castrillo, A., Apoptotic cells promote their own clearance and immune tolerance through activation of the nuclear receptor LXR. Immunity 2009. 31: 245-258. 298 Pommier, A. J., Alves, G., Viennois, E., Bernard, S., Communal, Y., Sion, B., Marceau, G., Damon, C., Mouzat, K., Caira, F., Baron, S. and Lobaccaro, J. M., Liver X Receptor activation downregulates AKT survival signaling in lipid rafts and induces apoptosis of prostate cancer cells. Oncogene 2010. 29: 2712-2723. 299 Hsu, A. L., Ching, T. T., Wang, D. S., Song, X., Rangnekar, V. M. and Chen, C. S., The cyclooxygenase-2 inhibitor celecoxib induces apoptosis by blocking Akt activation in human prostate cancer cells independently of Bcl-2. J Biol Chem 2000. 275: 11397-11403. 300 Gately, S., The contributions of cyclooxygenase-2 to tumor angiogenesis. Cancer Metastasis Rev 2000. 19: 19-27. 301 Vassiliou, E., Sharma, V., Jing, H., Sheibanie, F. and Ganea, D., Prostaglandin E2 promotes the survival of bone marrow-derived dendritic cells. J Immunol 2004. 173: 6955-6964. 302 Baratelli, F., Krysan, K., Heuze-Vourc'h, N., Zhu, L., Escuadro, B., Sharma, S., Reckamp, K., Dohadwala, M. and Dubinett, S. M., PGE2 confers survivin-

113 References

dependent apoptosis resistance in human monocyte-derived dendritic cells. J Leukoc Biol 2005. 78: 555-564. 303 Wang, D. and Dubois, R. N., Prostaglandins and cancer. Gut 2006. 55: 115-122. 304 Salek-Ardakani, S. and Croft, M., Regulation of CD4 T cell memory by OX40 (CD134). Vaccine 2006. 24: 872-883. 305 Nakae, S., Saijo, S., Horai, R., Sudo, K., Mori, S. and Iwakura, Y., IL-17 production from activated T cells is required for the spontaneous development of destructive arthritis in mice deficient in IL-1 receptor antagonist. Proc Natl Acad Sci U S A 2003. 100: 5986-5990. 306 Zhang, Z., Zhong, W., Hinrichs, D., Wu, X., Weinberg, A., Hall, M., Spencer, D., Wegmann, K. and Rosenbaum, J. T., Activation of OX40 augments Th17 cytokine expression and antigen-specific uveitis. Am J Pathol 2010. 177: 2912-2920. 307 Grivennikov, S. I., Greten, F. R. and Karin, M., Immunity, inflammation, and cancer. Cell 2010. 140: 883-899. 308 Alters, S. E., Gadea, J. R., Holm, B., Lebkowski, J. and Philip, R., IL-13 can substitute for IL-4 in the generation of dendritic cells for the induction of cytotoxic T lymphocytes and gene therapy. J Immunother 1999. 22: 229-236. 309 Simon, T., Fonteneau, J. F. and Gregoire, M., Dendritic cell preparation for immunotherapeutic interventions. Immunotherapy 2009. 1: 289-302. 310 Castiello, L., Sabatino, M., Jin, P., Clayberger, C., Marincola, F. M., Krensky, A. M. and Stroncek, D. F., Monocyte-derived DC maturation strategies and related pathways: a transcriptional view. Cancer Immunol Immunother 2011. 60: 457-466. 311 Legler, D. F., Krause, P., Scandella, E., Singer, E. and Groettrup, M., Prostaglandin E2 is generally required for human dendritic cell migration and exerts its effect via EP2 and EP4 receptors. J Immunol 2006. 176: 966-973. 312 Muthuswamy, R., Mueller-Berghaus, J., Haberkorn, U., Reinhart, T. A., Schadendorf, D. and Kalinski, P., PGE(2) transiently enhances DC expression of CCR7 but inhibits the ability of DCs to produce CCL19 and attract naive T cells. Blood 2010. 116: 1454-1459. 313 Scandella, E., Men, Y., Gillessen, S., Forster, R. and Groettrup, M., Prostaglandin E2 is a key factor for CCR7 surface expression and migration of monocyte-derived dendritic cells. Blood 2002. 100: 1354-1361. 314 Zou, W. and Restifo, N. P., T(H)17 cells in tumour immunity and immunotherapy. Nat Rev Immunol 2010. 10: 248-256. 315 Watchmaker, P. B., Berk, E., Muthuswamy, R., Mailliard, R. B., Urban, J. A., Kirkwood, J. M. and Kalinski, P., Independent regulation of chemokine responsiveness and cytolytic function versus CD8+ T cell expansion by dendritic cells. J Immunol 2010. 184: 591-597. 316 Gustafsson, K., Ingelsten, M., Bergqvist, L., Nystrom, J., Andersson, B. and Karlsson-Parra, A., Recruitment and activation of natural killer cells in vitro by a human dendritic cell vaccine. Cancer Res 2008. 68: 5965-5971. 317 Nobile, C., Lind, M., Miro, F., Chemin, K., Tourret, M., Occhipinti, G., Dogniaux, S., Amigorena, S. and Hivroz, C., Cognate CD4+ T-cell-dendritic cell interactions induce migration of immature dendritic cells through dissolution of their podosomes. Blood 2008. 111: 3579-3590. 318 Hu, J. K., Kagari, T., Clingan, J. M. and Matloubian, M., PNAS Plus: Expression of chemokine receptor CXCR3 on T cells affects the balance between effector and memory CD8 T-cell generation. Proc Natl Acad Sci U S A 2011. 108: E118-127. 319 Hromas, R., Kim, C. H., Klemsz, M., Krathwohl, M., Fife, K., Cooper, S., Schnizlein-Bick, C. and Broxmeyer, H. E., Isolation and characterization of Exodus- 2, a novel C-C chemokine with a unique 37-amino acid carboxyl-terminal extension. J Immunol 1997. 159: 2554-2558. 320 Yang, B. G., Tanaka, T., Jang, M. H., Bai, Z., Hayasaka, H. and Miyasaka, M., Binding of Lymphoid Chemokines to Collagen IV That Accumulates in the Basal Lamina of High Endothelial Venules: Its Implications in Lymphocyte Trafficking. J Immunol 2007. 179: 4376-4382.

114 References

321 Hollender, P., Ittelett, D., Villard, F., Eymard, J. C., Jeannesson, P. and Bernard, J., Active matrix metalloprotease-9 in and migration pattern of dendritic cells matured in clinical grade culture conditions. Immunobiology 2002. 206: 441-458. 322 Wolf, K., Muller, R., Borgmann, S., Brocker, E. B. and Friedl, P., Amoeboid shape change and contact guidance: T-lymphocyte crawling through fibrillar collagen is independent of matrix remodeling by MMPs and other proteases. Blood 2003. 102: 3262-3269. 323 Kalinski, P. and Okada, H., Polarized dendritic cells as cancer vaccines: directing effector-type T cells to tumors. Semin Immunol 2010. 22: 173-182. 324 Rescigno, M., Dendritic cells in tolerance induction for the treatment of autoimmune diseases. Eur J Immunol 2010. 40: 2119-2123. 325 Manning, B. D. and Cantley, L. C., AKT/PKB signaling: navigating downstream. Cell 2007. 129: 1261-1274.

115

116

Record of contributions

Chapter I The general introduction includes a manuscript of a review article where I designed the figure and drafted parts of the manuscript. The review was published in Int J Biochem Cell Biol (2010) 42(2):198-201.

Chapter II I conceived, designed and analyzed all experiments that were performed by Denise Dickel primarily during her master thesis under my supervision. This chapter is submitted for publication.

Chapter III I conceived, designed, analyzed and performed all experiments. The manuscript was written in collaboration with Daniel Legler. Denise Dickel provided technical assistance in some experiments. This chapter is submitted for publication and currently under revision at J Immunol.

Chapter IV I conceived, designed, analyzed and performed the experiments shown in figures 2D and 6, as well as all unpublished experimental work requested for final publication. This chapter is published in Blood (2009) 113(11):2451-60.

Chapter V I obtained similar data on DC mediated CCL21-shedding in the human system, which is not published. To investigate the impact of truncated CCL21 on DC migration in the mouse system, I provided the full-length and truncated form of the chemokine CCL21 for the respective experiments published. This included cloning, production and characterization of both chemokine species. Nicola Catone provided technical assistance during the protein purification step. This chapter is published in Immunity (2010) 32(5):703-13.

117