GENETIC POLYMORPHISM of BOLA-DRB3.2 LOCUS in SAHIWAL CATTLE Dibyendu Chakraborty1, Avtar Singh2, M.S. Tantia3, Archana Verma4, A

Animal Science Reporter, Volume 9, Issue 1, January, 2015 GENETIC POLYMORPHISM OF BOLA-DRB3.2 LOCUS IN SAHIWAL CATTLE Dibyendu Chakraborty1, Avtar Singh2, M.S. Tantia3, Archana Verma4, A.K. Chakravarty5 ABSTRACT The DRB3.2 gene of bovine lymphocyte antigen (BoLA) locus has received wide attention because of its polymorphism, and association with immunity and productivity in dairy cattle. The present study was conducted on polymorphism of BoLA-DRB3.2 gene of Sahiwal cattle, a premier dairy breed of India, to identify marker genes that can boost milk production, besides providing relief from economic losses incurred due to mastitis, a major endemic disease of dairy cattle. It is a nascent subject of research, and no study has been conducted in Sahiwal cattle so far. The polymorphic analysis of BoLA-DRB3 gene, based on 112 Sahiwal (Bos indicus) cattle of the NDRI farm, was investigated by hemi-nested polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP). The amplification of BoLA-DRB3 gene, revealed a 284 bp of PCR product, composed of 17 bp of 5 intron, and 267 bp of exon. The PCR products digested with Bst YI, Hae III, and Rsa I restriction endonuclease enzymes revealed 3 (a, b, e), 3 (a, b, e), and 14 (a, b, d, n, m, f, g, h, o, l, s, t, i, u) RFLP prototypes, respectively. DNA sequencing revealed 36 BoLA-DRB3.2 alleles, out of which, 12 alleles (*baa, *iaa, *ibe, *laa, *dba, *sba, *saa, *gba, *mbb, *mab, *fbb, *naa) were detected for the first time in cattle. Seven alleles (*02/*02, *08/*08, *10/*10, *23/*23, *mab/*mab, *dba/*dba, *gba/*gba) were homozygote, and the rest were heterozygote. The alleles *1 and *8, alleles *15 and *51, and alleles *10 and *23 of Sahiwal cattle, detected in our study, assume special significance, as their association with susceptibility to mastitis, resistance to mastitis, and higher milk production, respectively, have been reported earlier in cattle, and needed validation in Sahiwal for use as markers, which could not be exercised, as it was beyond the ambit of our quest. It is concluded that BOLA-DRB 3.2 locus is highly polymorphic in Sahiwal cattle. KEY WORDS BoLA-DRB3 gene, PCR-RFLP, Polymorphism, Sahiwal cattle Author attribution: 1Assistant Professor, Division of Animal Genetics & Breeding, Faculty of Veterinary Science & Animal Husbandry, SKUAST-Jammu, R.S. Pura, Jammu, India-181102, 2,4,5Principal Scientist, Dairy Cattle Breeding Division, National Dairy Research Institute (NDRI), Karnal, Haryana, India- 132001, 3Principal Scientist, National Bureau of Animal Genetic Resources (NBAGR), Karnal, Haryana, India- 132001. 1Corresponding author (E-mail: [email protected]). Received: 24 May 2014, Accepted: 20 November 2014. pp. 33-40. 33 Animal Science Reporter, Volume 9, Issue 1, January, 2015 INTRODUCTION chloroform extraction method (Sambrook et al., 1989). The bovine lymphocyte antigen (BoLA) genes of major histocompatibility PCR amplification: The exon 2 of BoLA- complex (MHC), located in exon 2 of DRB3 gene (284 bp) was amplified by class IIa region of bovine chromosome hemi-nested polymerase chain reaction 23 (BTA 23), have received wide (PCR) with HL-030 (5'- attention because of their high degree of ATCCTCTCTCTGCAGCACATT TCC- expression and genetic polymorphism, 3') and HL-031 (5'-TTTAAT TCGCGC along with association with immunity TCACCTCGCCGCT-3') primers (van and productivity in dairy cattle (do Eijk et al., 1992), in the first round of Nascimento et al., 2006; Rupp et al., 2007; amplification. Duangjinda et al., 2009; Pasmi et al., 2009; Oprzadek et al., 2012). The first round of PCR amplification was performed with 50 ng of DNA in a 25 µl There is no information available on reaction mixture, containing 1xPCR BoLA locus of Sahiwal (Bos indicus) buffer (2.5 µl), Mg++ (2.5 mM), dNTPs (0.2 cattle, a prized milch breed of India, µl), HL-030 and HL-031 primers (1 µl although the propensity of high yielding each) containing 5pmol/ µl, and Taq cows carrying DRB3 *1 and *52 alleles, DNA polymerase (0.2 µl). to an economically important disease like mastitis has been well proven The thermal cycling profile for the first (Duangjinda et al., 2009). The present round of amplification was initial study was designed to explore the denaturation of 5 min at 94ºC, followed genetic variants of BoLA-DRB3.2 alleles by 10 cycles of 1 min at 94ºC, 2 min at of Sahiwal cattle. 60ºC, 1 min at 72ºC, and a final extension of 1 min at 72ºC. MATERIALS AND METHODS The second round of semi-nested PCR Animals: A total number of 112 Sahiwal amplification was performed with 1 µl cows in milk, maintained at the National of first-round PCR product as DNA Dairy Research Institute (NDRI) farm template in a separate tube, with the were randomly chosen for the same volume and concentration of experiment. contents as described above, using HL- 030 and HL-032 primers. HL-032 primer Blood collection: About 10 ml of blood (5'-TCGCCG CTGC ACAGT GAAA was collected from the jugular vein of CTCTC-3') is internal to the sequence of each of the animal aseptically in tubes the amplified product of the first-round containing 0.5% EDTA, and stored at - PCR, and has eight bases that overlap 20°C for analysis. with HL031 primer. DNA Extraction: Genomic DNA was The thermal cycling profile for the isolated from the whole blood by phenol- second round was 30 cycles of 1 min at 34 Animal Science Reporter, Volume 9, Issue 1, January, 2015 94ºC for denaturation and 30 s at 65.5ºC 200 V for 4 h. The ingredients of for annealing, extension at 72ºC for 1 digestion reactions were incubated min, followed by a final extension of 5 overnight and digestion products were min at 72ºC. The PCR products were resolved by 2.5% native acrylamide gel visualized by electrophoresis on 2.5% electrophoresis at 200 V for 5 h. A 50-bp agarose gel stained with ethidium DNA ladder (New England Biolabs) was bromide. used as a DNA size marker. BoLA-DRB3 typing: To examine the RESULTS AND DISCUSSION nucleotide sequence variability at the BoLA-DRB3.2 locus, three end Amplification: The amplification of nucleotide restriction enzymes, viz., Bst BoLA-DRB3 gene, a 284 bp of PCR YI, Hae III, and Rsa I were chosen (New product in Sahiwal cattle, revealed that England Biolabs, Ipswich, MA) based on it was composed of 17 bp of 5 intron, their cut site and ability to cut DNA in and 267 bp of exon. In contrast, this exon. Restriction fragments were Aravindakshan and Nainar (1999) have resolved by gel electrophoresis on 2.5% reported 304 bp of PCR product in acrylamide gel. Fifty (50) bp size markers Ongole cattle, while Oprzadek et al. were used as molecular weight markers. (2012) have reported that the size of the amplified BoLA-DRB3 gene was 284 bp BoLA-DRB3.2 typing was performed in Polish Holstein Friesian cattle. Wu et using a PCR-RFLP method adopted by al. (2010) has reported 284 bp of PCR van Eijk et al. (1992). The nomenclature product of exon 2, 3 bp of 3 intron and for alleles of BoLA-DRB3, defined by the 14 bp of 5 intron in Chinese Holstein PCR-RFLP method was indicated by the cattle. format locus.exon.allele, e.g., DRB3.2*1. RFLP prototypes: The RFLP patterns of Restriction Endonuclease Digestion: Six BoLA-DRB3 gene, explored by microlitre (6 µl) of the PCR products restriction endonuclease enzymes (Bst were digested at 37ºC with 5 units of Rsa YI, Hae III, and Rsa I) and their restriction I and Hae III , and at 60ºC with 5 units of patterns are presented in Box-1. The Bst YI in a total volume of 10 µl reaction study on the polymorphic pattern of mixture. Each reaction mixture DRB3 gene is important because it is contained 6 µl of PCR product, 2.5 µl of linked to the immune function of class autoclaved distilled water, 1.0 µl of II antigen of MHC (Wu et al., 2010). respective NEB buffers, and 0.5 µl of restriction enzyme. Bst YI: Digestion with Bst YI resulted in 3 RPLF restriction patterns, viz., a, b, The ingredients of digestion reactions and e with frequencies of 0.353, 0.629, were incubated overnight, and digestion and 0.018, respectively. Instead, products were resolved through 2.5% Aravindakshan and Nainar (1999) have native acrylamide gel electrophoresis reported two patterns, viz., a and b, using vertical electrophoretic system at in Ongole cattle, with frequencies of 0.73 35 Animal Science Reporter, Volume 9, Issue 1, January, 2015 and 0.27, respectively. Wu et al. (2010) respectively, in Chinese Holstein cattle have reported four RPLF patterns, viz., after digestion with Hae III enzyme. a, b, d, and e, with frequencies of 0.095, 0.823, 0.012, and 0.070, The high frequency of a pattern (0.714) respectively, in Chinese Holstein cattle. as obtained in our study in Sahiwal, The frequency of b was the highest in agreed with the reports of the workers Chinese Holstein cattle, and agreed with mentioned above. No fragment lengths our findings in Sahiwal cattle. which corresponded to the Hae III patterns c, d, f, g, h, and i of cattle Box-1. The restriction prototypes of were observed in our study. BoLA-DRB3 gene, detected by Bst YI, Rsa I: The restriction pattern of Rsa I Hae III, and Rsa I. enzyme was more complex than Bst YI Bst YI: a (0.353), b (0.629), e (0.018) and Hae III, and revealed 14patterns , viz., a, b, d, n, m, f, g, h, o, l, s, Hae III: a (0.714), b (0.272), e (0.014) t, i, and u in our study.

Load more