GENETIC POLYMORPHISM of BOLA-DRB3.2 LOCUS in SAHIWAL CATTLE Dibyendu Chakraborty1, Avtar Singh2, M.S. Tantia3, Archana Verma4, A

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Animal Science Reporter, Volume 9, Issue 1, January, 2015 GENETIC POLYMORPHISM OF BOLA-DRB3.2 LOCUS IN SAHIWAL CATTLE Dibyendu Chakraborty1, Avtar Singh2, M.S. Tantia3, Archana Verma4, A.K. Chakravarty5 ABSTRACT The DRB3.2 gene of bovine lymphocyte antigen (BoLA) locus has received wide attention because of its polymorphism, and association with immunity and productivity in dairy cattle. The present study was conducted on polymorphism of BoLA-DRB3.2 gene of Sahiwal cattle, a premier dairy breed of India, to identify marker genes that can boost milk production, besides providing relief from economic losses incurred due to mastitis, a major endemic disease of dairy cattle. It is a nascent subject of research, and no study has been conducted in Sahiwal cattle so far. The polymorphic analysis of BoLA-DRB3 gene, based on 112 Sahiwal (Bos indicus) cattle of the NDRI farm, was investigated by hemi-nested polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP). The amplification of BoLA-DRB3 gene, revealed a 284 bp of PCR product, composed of 17 bp of 5 intron, and 267 bp of exon. The PCR products digested with Bst YI, Hae III, and Rsa I restriction endonuclease enzymes revealed 3 (a, b, e), 3 (a, b, e), and 14 (a, b, d, n, m, f, g, h, o, l, s, t, i, u) RFLP prototypes, respectively. DNA sequencing revealed 36 BoLA-DRB3.2 alleles, out of which, 12 alleles (*baa, *iaa, *ibe, *laa, *dba, *sba, *saa, *gba, *mbb, *mab, *fbb, *naa) were detected for the first time in cattle. Seven alleles (*02/*02, *08/*08, *10/*10, *23/*23, *mab/*mab, *dba/*dba, *gba/*gba) were homozygote, and the rest were heterozygote. The alleles *1 and *8, alleles *15 and *51, and alleles *10 and *23 of Sahiwal cattle, detected in our study, assume special significance, as their association with susceptibility to mastitis, resistance to mastitis, and higher milk production, respectively, have been reported earlier in cattle, and needed validation in Sahiwal for use as markers, which could not be exercised, as it was beyond the ambit of our quest. It is concluded that BOLA-DRB 3.2 locus is highly polymorphic in Sahiwal cattle. KEY WORDS BoLA-DRB3 gene, PCR-RFLP, Polymorphism, Sahiwal cattle Author attribution: 1Assistant Professor, Division of Animal Genetics & Breeding, Faculty of Veterinary Science & Animal Husbandry, SKUAST-Jammu, R.S. Pura, Jammu, India-181102, 2,4,5Principal Scientist, Dairy Cattle Breeding Division, National Dairy Research Institute (NDRI), Karnal, Haryana, India- 132001, 3Principal Scientist, National Bureau of Animal Genetic Resources (NBAGR), Karnal, Haryana, India- 132001. 1Corresponding author (E-mail: [email protected]). Received: 24 May 2014, Accepted: 20 November 2014. pp. 33-40. 33 Animal Science Reporter, Volume 9, Issue 1, January, 2015 INTRODUCTION chloroform extraction method (Sambrook et al., 1989). The bovine lymphocyte antigen (BoLA) genes of major histocompatibility PCR amplification: The exon 2 of BoLA- complex (MHC), located in exon 2 of DRB3 gene (284 bp) was amplified by class IIa region of bovine chromosome hemi-nested polymerase chain reaction 23 (BTA 23), have received wide (PCR) with HL-030 (5'- attention because of their high degree of ATCCTCTCTCTGCAGCACATT TCC- expression and genetic polymorphism, 3') and HL-031 (5'-TTTAAT TCGCGC along with association with immunity TCACCTCGCCGCT-3') primers (van and productivity in dairy cattle (do Eijk et al., 1992), in the first round of Nascimento et al., 2006; Rupp et al., 2007; amplification. Duangjinda et al., 2009; Pasmi et al., 2009; Oprzadek et al., 2012). The first round of PCR amplification was performed with 50 ng of DNA in a 25 µl There is no information available on reaction mixture, containing 1xPCR BoLA locus of Sahiwal (Bos indicus) buffer (2.5 µl), Mg++ (2.5 mM), dNTPs (0.2 cattle, a prized milch breed of India, µl), HL-030 and HL-031 primers (1 µl although the propensity of high yielding each) containing 5pmol/ µl, and Taq cows carrying DRB3 *1 and *52 alleles, DNA polymerase (0.2 µl). to an economically important disease like mastitis has been well proven The thermal cycling profile for the first (Duangjinda et al., 2009). The present round of amplification was initial study was designed to explore the denaturation of 5 min at 94ºC, followed genetic variants of BoLA-DRB3.2 alleles by 10 cycles of 1 min at 94ºC, 2 min at of Sahiwal cattle. 60ºC, 1 min at 72ºC, and a final extension of 1 min at 72ºC. MATERIALS AND METHODS The second round of semi-nested PCR Animals: A total number of 112 Sahiwal amplification was performed with 1 µl cows in milk, maintained at the National of first-round PCR product as DNA Dairy Research Institute (NDRI) farm template in a separate tube, with the were randomly chosen for the same volume and concentration of experiment. contents as described above, using HL- 030 and HL-032 primers. HL-032 primer Blood collection: About 10 ml of blood (5'-TCGCCG CTGC ACAGT GAAA was collected from the jugular vein of CTCTC-3') is internal to the sequence of each of the animal aseptically in tubes the amplified product of the first-round containing 0.5% EDTA, and stored at - PCR, and has eight bases that overlap 20°C for analysis. with HL031 primer. DNA Extraction: Genomic DNA was The thermal cycling profile for the isolated from the whole blood by phenol- second round was 30 cycles of 1 min at 34 Animal Science Reporter, Volume 9, Issue 1, January, 2015 94ºC for denaturation and 30 s at 65.5ºC 200 V for 4 h. The ingredients of for annealing, extension at 72ºC for 1 digestion reactions were incubated min, followed by a final extension of 5 overnight and digestion products were min at 72ºC. The PCR products were resolved by 2.5% native acrylamide gel visualized by electrophoresis on 2.5% electrophoresis at 200 V for 5 h. A 50-bp agarose gel stained with ethidium DNA ladder (New England Biolabs) was bromide. used as a DNA size marker. BoLA-DRB3 typing: To examine the RESULTS AND DISCUSSION nucleotide sequence variability at the BoLA-DRB3.2 locus, three end Amplification: The amplification of nucleotide restriction enzymes, viz., Bst BoLA-DRB3 gene, a 284 bp of PCR YI, Hae III, and Rsa I were chosen (New product in Sahiwal cattle, revealed that England Biolabs, Ipswich, MA) based on it was composed of 17 bp of 5 intron, their cut site and ability to cut DNA in and 267 bp of exon. In contrast, this exon. Restriction fragments were Aravindakshan and Nainar (1999) have resolved by gel electrophoresis on 2.5% reported 304 bp of PCR product in acrylamide gel. Fifty (50) bp size markers Ongole cattle, while Oprzadek et al. were used as molecular weight markers. (2012) have reported that the size of the amplified BoLA-DRB3 gene was 284 bp BoLA-DRB3.2 typing was performed in Polish Holstein Friesian cattle. Wu et using a PCR-RFLP method adopted by al. (2010) has reported 284 bp of PCR van Eijk et al. (1992). The nomenclature product of exon 2, 3 bp of 3 intron and for alleles of BoLA-DRB3, defined by the 14 bp of 5 intron in Chinese Holstein PCR-RFLP method was indicated by the cattle. format locus.exon.allele, e.g., DRB3.2*1. RFLP prototypes: The RFLP patterns of Restriction Endonuclease Digestion: Six BoLA-DRB3 gene, explored by microlitre (6 µl) of the PCR products restriction endonuclease enzymes (Bst were digested at 37ºC with 5 units of Rsa YI, Hae III, and Rsa I) and their restriction I and Hae III , and at 60ºC with 5 units of patterns are presented in Box-1. The Bst YI in a total volume of 10 µl reaction study on the polymorphic pattern of mixture. Each reaction mixture DRB3 gene is important because it is contained 6 µl of PCR product, 2.5 µl of linked to the immune function of class autoclaved distilled water, 1.0 µl of II antigen of MHC (Wu et al., 2010). respective NEB buffers, and 0.5 µl of restriction enzyme. Bst YI: Digestion with Bst YI resulted in 3 RPLF restriction patterns, viz., a, b, The ingredients of digestion reactions and e with frequencies of 0.353, 0.629, were incubated overnight, and digestion and 0.018, respectively. Instead, products were resolved through 2.5% Aravindakshan and Nainar (1999) have native acrylamide gel electrophoresis reported two patterns, viz., a and b, using vertical electrophoretic system at in Ongole cattle, with frequencies of 0.73 35 Animal Science Reporter, Volume 9, Issue 1, January, 2015 and 0.27, respectively. Wu et al. (2010) respectively, in Chinese Holstein cattle have reported four RPLF patterns, viz., after digestion with Hae III enzyme. a, b, d, and e, with frequencies of 0.095, 0.823, 0.012, and 0.070, The high frequency of a pattern (0.714) respectively, in Chinese Holstein cattle. as obtained in our study in Sahiwal, The frequency of b was the highest in agreed with the reports of the workers Chinese Holstein cattle, and agreed with mentioned above. No fragment lengths our findings in Sahiwal cattle. which corresponded to the Hae III patterns c, d, f, g, h, and i of cattle Box-1. The restriction prototypes of were observed in our study. BoLA-DRB3 gene, detected by Bst YI, Rsa I: The restriction pattern of Rsa I Hae III, and Rsa I. enzyme was more complex than Bst YI Bst YI: a (0.353), b (0.629), e (0.018) and Hae III, and revealed 14patterns , viz., a, b, d, n, m, f, g, h, o, l, s, Hae III: a (0.714), b (0.272), e (0.014) t, i, and u in our study.
Recommended publications
  • Factors Affecting the Reproductive Performance of Sahiwal Cattle

    Factors Affecting the Reproductive Performance of Sahiwal Cattle

    Int.J.Curr.Microbiol.App.Sci (2020) 9(9): 1236-1240 International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 9 Number 9 (2020) Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2020.909.151 Factors Affecting the Reproductive Performance of Sahiwal Cattle Devesh Singh, C. B. Singh, B. S. Khadda* and S. B. Bhardwaj Department of Livestock Production Management, College of Veterinary and Animal Sciences, G. B. Pant University of Agriculture and Technology, Pantnagar-263145, Uttarakhand, India *Corresponding author ABSTRACT The present study was conducted on 308 Sahiwal cows sired by 38 bulls spared over a K e yw or ds period of 32 years (1981- 2012), maintained at instructional dairy farm and AICRP on Age at first calving, cattle -Sahiwal (field unit) at G.B.P.U.A. & T., Pantnagar Uttarakhand and Chak Ganjaria Calving interval, Government Cattle Farm Lucknow, Uttar Pradesh. The overall least- square means for age Service period, at first calving (AFC), first calving interval (FC1) and first service period (FSP) were Sahiwal cattle, 1281.89 ± 15.57, 426.70 ± 8.53 and 140.85 ± 8.90 days, respectively. Significant effect of Reproductive traits sire and farm was observed in all the reproductive traits, while season was found to non- significantly influencing the age at first calving, first calving interval and first service Article Info period. Period of calving had highly significant (P<0.01) effect on AFC whereas, effect period of calving was found to be non-significant on first calving interval and first service Accepted: period.
  • View Full Text-PDF

    View Full Text-PDF

    Int.J.Curr.Microbiol.App.Sci (2021) 10(01): 1773-1779 International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 10 Number 01 (2021) Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2021.1001.207 Assessment of Haematological and Biochemical Changes in Postpartum Anoestrous Ongole Cattle of Andhra Pradesh M. Rama Goury1, B.V.S. Saikiran2, S.K.I. Vasantha2*, Nikhil Kumar Tej2 and C.H. Srinivasa Prasad2 1NTR College of Veterinary Science, Gannavaram, A.P, India 2Dept of Veterinary Physiology, NTR College of Veterinary Science, Gannavaram, A.P, India *Corresponding author ABSTRACT The present study was aimed to assess the hemato-biochemical changes in postpartum anoestrous Ongole cattle. A total of 12 animals of same age and K e yw or ds body weight were randomly selected and divided in to two groups, G I: Hematology , postpartum anoestrous (PPA, n=6) and G II: cyclic animals (n=6). Blood Biochemical , samples were collected by jugular vein puncture and analyzed for Postpartum anoestrous (PPA); hematological parameters. Further, the serum was separated from another Ongole cattle aliquot of blood sample and utilized for biochemical parameters. The mean RBC, Hb, PCV, glucose, total protein and cholesterol values were Article Info significantly (p<0.05) lower in PPA compared to cyclic animals. In Accepted: 12 December 2020 contrast, no significant (p>0.05) difference was observed in MCV, MCH, Available Online: MCHC, WBC, lymphocyte and monocytes between groups. From the 10 January 2021 present study, it was concluded that hematological and biochemical parameters are reliable indicators of postpartum anestrus.
  • Annual Report 2001-2002, in Which Multiple Activities of Agricultural Research, Education and Extension Are Highlighted

    Annual Report 2001-2002, in Which Multiple Activities of Agricultural Research, Education and Extension Are Highlighted

    DARE/ICARDARE/ICAR AnnualAnnual ReportReport 2001-20022001-2002 Department of Agricultural Research Indian Council of and Education Agricultural Research Ministry of Agriculture New Delhi Government of India Indian Council of Agricultural Research President Shri Nitish Kumar (Up to 22.7.2001) Minister of Agriculture Shri Ajit Singh (Since 23.7.2001) Minister of Agriculture Vice-President Dr Debendra Pradhan (Up to 1.9.2001) Minister of State (AH&D & DARE) Director-General Dr R S Paroda (Up to 14.8.2001) Secretary Department of Agricultural Research and Education Shri J N L Srivastava (15.8.2001 to 3.10.2001) Secretary, Ministry of Agriculture Dr Panjab Singh (Since 4.10.2001) Secretary Department of Agricultural Research and Education Secretary Smt Shashi Misra (Since 22.2.2001) Additional Secretary Department of Agricultural Research and Education Financial Adviser Shri R S Prasad (Up to 7.6.2001) Joint Secretary and FA Department of Agricultural Research and Education Shri P Sinha (Since 7.6.2001) Additional Secretary and FA Department of Agricultural Research and Education iii OVERVIEW Foreword The National Agricultural Research System (NARS) with the Indian Council of Agricultural Research (ICAR) as an apex body is striving for the holistic development of agriculture at the national level through planning, promoting, conducting and coordinating research, education and extension and training on all aspects of agriculture for ensuring optimal utilization of land, water and plant and animal genetic resources. India has achieved worldwide acclaim in the field of agricultural research, education and extension by achieving more than four-fold increase in foodgrains production besides significant increases in the milk, oilseeds, fruits, vegetables and fish production since independence.
  • Class 4 :Definition of Breed-Classification of Indigenous, Exotic Cattle and Buffaloes -Breed Characteristics of Sindhi, Kangaya

    Class 4 :Definition of Breed-Classification of Indigenous, Exotic Cattle and Buffaloes -Breed Characteristics of Sindhi, Kangaya

    Class 4 :Definition of breed-classification of indigenous, exotic cattle and buffaloes -Breed characteristics of Sindhi, Kangayam and Umblacherry, Jersey, Holstein Friesian, Murrah and Surti. Breed: Definition : Denotes and established group of animals / birds having the similar general body shape, colour, structure and characters which produced offspring with same characters I . Cattle - 1. Indigenous 2. Exotic Indigenous Breeds are classified under three groups based on utility / purpose. a. Milch - Example- Sindhi, Sahiwal, Gir and Deoni b. Dual - Example- Hariyana, Ongole, Tharparkar, Kankrej c. Draught – Example- Kangayam, Umblacherry, Amritmahal, Hallikar 2. Exotic – Milch – Jersey, Holstein Friesian Red Sindhi Also Known By: Malir (Baluchistan), Red Karachi, Sindhi The Red Sindhi originated in the Pakistani state of Sind but due to its hardiness, heat resistance and high milk yields they have spread into many parts of India and at least 33 countries in Asia, Africa, Oceania and the Americas. Under good management conditions the Red Sindhi averages over 1700 kg of milk after suckling their calves but under optimum conditions there have been milk yields of over 3400 kg per lactation. The average height of a Red Sindhi cow is 116 cm with a body weight of 340 kg. Bulls average 134 cm in height and a body weight of 420 kg. They are normally a deep, rich red color but this can vary from a yellowish brown to dark brown. Males are darker than females and when mature may be almost black on the extremities, such as the head, feet and tail. Red Sindhi in Australia Red Sindhi cattle arrived in Australia in 1954 from Pakistan, as a gift to the Australian Government.
  • Unit 4 Milch Breeds

    Unit 4 Milch Breeds

    UNIT 4 MILCH BREEDS Structure 4.0 Objectives 4.1 Introduction 4.2 Milch Breeds of Cattle Indigenous Milch and Dual-purpose Breed Exotic Dairy Cattle Breeds Synthetic Crossbred Cattle Strains Breed Improvement in Cattle 4.3 Milch Breeds of Buffaloes Breed Improvement in Buffaloes 4.4 Milch Breeds of Goats Indigenous Goat breeds Exotic Dairy Goat Breeds Breed Improvement in Goats 4.5 Let Us Sum Up 4.6 Key Words 4.7 Some Useful Books 4.8 Answers to check your Progress 4.0 OBJECTIVES After reading this unit, we shall be able to: enumerate the names of different milch breeds of cattle, buffalo and goat; state the distribution of these breeds in their respective home tracts; describe the physical characteristics of these breeds; performance of these breeds; specify the reproduction and production; and indicate the concept of breed improvement. 4.1 INTRODUCTION Cattle, buffalo and goats constituting 404.1 million population are three major domestic animal species, which contribute over 91.0 million tonnes milk in the country. The buffaloes contribute maximum (52%) to total milk production followed by cattle (45%) and goats (3%). There are large number of well descript breeds of cattle, buffalo and goats which are widely distributed under different agro-climatic regions. Besides these, there is large population of non-descript animals. A breed is a group of inter-breeding domestic animals of a species. It shows similarity among its individuals in certain distinguishable characteristics (colour, shape, size of body parts). The breeds have been developed as a result of selection and breeding based on the needs of mankind as well as adaptation to agro-climatic conditions of their native home tracts.
  • Study of Certain Reproductive and Productive Performance Parameters

    Study of Certain Reproductive and Productive Performance Parameters

    The Pharma Innovation Journal 2020; 9(9): 270-274 ISSN (E): 2277- 7695 ISSN (P): 2349-8242 NAAS Rating: 5.03 Study of certain reproductive and productive TPI 2020; 9(9): 270-274 © 2020 TPI performance parameters of malnad gidda cattle in its www.thepharmajournal.com Received: 21-06-2020 native tract Accepted: 07-08-2020 Murugeppa A Murugeppa A, Tandle MK, Shridhar NB, Prakash N, Sahadev A, Vijaya Associate Professor and Head, Department of Veterinary Kumar Shettar, Nagaraja BN and Renukaradhya GJ Gynaecology and Obstetrics, Veterinary College, Shivamogga, Abstract Karnataka, India The study was conducted to establish baseline information pertaining to productive and reproductive performance of Malnad Gidda and its crossbred in Shivamogga District of Karnataka. The data from 286 Tandle MK animals reared by 98 farmers from Thirtahalli, Hosanagara and Sagara taluks of Shivamogga district Director of Instruction (PGS), Karnataka Veterinary Animal were collected through a structured questionnaire. The parameters such as age at puberty (25.15±0.29 and Fisheries University, Bidar, months); age at first calving (39.32±2.99 months); dry period (6.22±1.26 months); calving interval Karnataka, India (13.68±2.55 months); gestation period (282.14±9.03 days); service period (136.73±10.03 days); lactation length (258.22 ± 10.95 days); milk yield per day (3.69±0.32 kg); total milk yield (227.19±8.31 kg); days Shridhar NB to reach peak milk yield (46.19±0.51 day); birth weight of the new born calf (8.71±0.45 kg); time taken Professor and Head, Department for placental expulsion of placenta (4.63±0.39 hours); onset of postpartum estrous (77.64±1.98 days); of Veterinary Pharmacology and Duration of estrous period (15.25±1.67 hours); time of ovulation (15.15 ± 1.7 hours) and length of estrus Toxicology, Veterinary College cycle (22.63±2.96.
  • Animal Genetic Resources Information Bulletin

    Animal Genetic Resources Information Bulletin

    The designations employed and the presentation of material in this publication do not imply the expression of any opinion whatsoever on the part of the Food and Agriculture Organization of the United Nations concerning the legal status of any country, territory, city or area or of its authorities, or concerning the delimitation of its frontiers or boundaries. Les appellations employées dans cette publication et la présentation des données qui y figurent n’impliquent de la part de l’Organisation des Nations Unies pour l’alimentation et l’agriculture aucune prise de position quant au statut juridique des pays, territoires, villes ou zones, ou de leurs autorités, ni quant au tracé de leurs frontières ou limites. Las denominaciones empleadas en esta publicación y la forma en que aparecen presentados los datos que contiene no implican de parte de la Organización de las Naciones Unidas para la Agricultura y la Alimentación juicio alguno sobre la condición jurídica de países, territorios, ciudades o zonas, o de sus autoridades, ni respecto de la delimitación de sus fronteras o límites. All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted in any form or by any means, electronic, mechanical, photocopying or otherwise, without the prior permission of the copyright owner. Applications for such permission, with a statement of the purpose and the extent of the reproduction, should be addressed to the Director, Information Division, Food and Agriculture Organization of the United Nations, Viale delle Terme di Caracalla, 00100 Rome, Italy. Tous droits réservés. Aucune partie de cette publication ne peut être reproduite, mise en mémoire dans un système de recherche documentaire ni transmise sous quelque forme ou par quelque procédé que ce soit: électronique, mécanique, par photocopie ou autre, sans autorisation préalable du détenteur des droits d’auteur.
  • Bos Indicus) Breeds

    Bos Indicus) Breeds

    Animal Biotechnology ISSN: 1049-5398 (Print) 1532-2378 (Online) Journal homepage: http://www.tandfonline.com/loi/labt20 Complete mitogenome reveals genetic divergence and phylogenetic relationships among Indian cattle (Bos indicus) breeds R. Kumar Pramod, Dinesh Velayutham, Sajesh P. K., Beena P. S., Anil Zachariah, Arun Zachariah, Chandramohan B., Sujith S. S., Ganapathi P., Bangarusamy Dhinoth Kumar, Sosamma Iype, Ravi Gupta, Sam Santhosh & George Thomas To cite this article: R. Kumar Pramod, Dinesh Velayutham, Sajesh P. K., Beena P. S., Anil Zachariah, Arun Zachariah, Chandramohan B., Sujith S. S., Ganapathi P., Bangarusamy Dhinoth Kumar, Sosamma Iype, Ravi Gupta, Sam Santhosh & George Thomas (2018): Complete mitogenome reveals genetic divergence and phylogenetic relationships among Indian cattle (Bos indicus) breeds, Animal Biotechnology, DOI: 10.1080/10495398.2018.1476376 To link to this article: https://doi.org/10.1080/10495398.2018.1476376 View supplementary material Published online: 23 Jun 2018. Submit your article to this journal View related articles View Crossmark data Full Terms & Conditions of access and use can be found at http://www.tandfonline.com/action/journalInformation?journalCode=labt20 ANIMAL BIOTECHNOLOGY https://doi.org/10.1080/10495398.2018.1476376 ORIGINAL ARTICLE Complete mitogenome reveals genetic divergence and phylogenetic relationships among Indian cattle (Bos indicus) breeds R. Kumar Pramoda, Dinesh Velayuthama, Sajesh P. K.a, Beena P. S.a, Anil Zachariahb, Arun Zachariahc, Chandramohan B.d, Sujith S. S.a, Ganapathi P.e, Bangarusamy Dhinoth Kumara, Sosamma Iypeb, Ravi Guptaf, Sam Santhoshg and George Thomasg aAgriGenome Labs Pvt. Ltd., Smart City Kochi, India; bVechur Conservation Trust, Thrissur, India; cDepartment of Forest and Wildlife, Wayanad, Kerala, India; dNational Institute of Science Education and Research, Jatni, India; eBargur Cattle Research Station, Tamil Nadu Veterinary Animal Sciences University, Chennai, India; fMedgenome Labs Pvt.
  • ACE Appendix

    ACE Appendix

    CBP and Trade Automated Interface Requirements Appendix: PGA August 13, 2021 Pub # 0875-0419 Contents Table of Changes .................................................................................................................................................... 4 PG01 – Agency Program Codes ........................................................................................................................... 18 PG01 – Government Agency Processing Codes ................................................................................................... 22 PG01 – Electronic Image Submitted Codes .......................................................................................................... 26 PG01 – Globally Unique Product Identification Code Qualifiers ........................................................................ 26 PG01 – Correction Indicators* ............................................................................................................................. 26 PG02 – Product Code Qualifiers ........................................................................................................................... 28 PG04 – Units of Measure ...................................................................................................................................... 30 PG05 – Scientific Species Code ........................................................................................................................... 31 PG05 – FWS Wildlife Description Codes ...........................................................................................................
  • REPRODUCTIVE PERFORMANCE of RED CHITTAGONG CATTLE in a NUCLEUS HERD Abstract Introduction

    REPRODUCTIVE PERFORMANCE of RED CHITTAGONG CATTLE in a NUCLEUS HERD Abstract Introduction

    Bang. J. Anim. Sci. 2010, 39(1&2) : 9 – 19 ISSN 0003-3588 REPRODUCTIVE PERFORMANCE OF RED CHITTAGONG CATTLE IN A NUCLEUS HERD M. A. Habib, A. K. F. H. Bhuiyan*and M. R. Amin1 Abstract The present study was undertaken to estimate the performance of some reproductive traits of Red Chittagong Cattle (RCC) is an important indigenous Farm Animal Genetic Resource of Bangladesh having some efficient reproductive capabilities. The effect of parity on these traits was also studied. The study was conducted in the nucleus herd of RCC Project at Bangladesh Agricultural University (BAU) dairy farm taking data from 2005 to 2008. The traits considered for this study were age at sexual maturity, age at first calving, number of service per conception, conception rate, calving interval, post partum heat period, gestation length and service period of RCC cows. The mean (±SE) values of the said traits are 28.75 ± 1.26 months, 40.93 ± 1.74 months, 1.55 ± 0.08, 78.91 ± 2.82 %, 14.42 ± 0.33 months, 127.71 ± 7.02 days, 282.11 ± 0.58 days and 151.72 ± 6.83 days, respectively. All the traits studied did not differ significantly (P>0.05) between different parities. Key words: RCC, Nucleus herd, Reproductive traits Introduction In dairy industry, reproductive efficiency of cow is inseparably associated with the profitability. Although data on reproductive performances of exotic and crossbred cows are abundantly available but they are very limited in case of indigenous cattle, because indigenous cattle has not yet been reared under close monitoring system. Indigenous cattle are reared scatteredly in the rural farmers’ house as because very difficult to get information due to poor awareness of the farmers.
  • Herd Movements the Exchange of Livestock Breeds and Genes Between North and South

    Herd Movements the Exchange of Livestock Breeds and Genes Between North and South

    Herd movements The exchange of livestock breeds and genes between North and South Evelyn Mathias and Paul Mundy League for Pastoral Peoples and Endogenous Livestock Development LEAGUE FOR PASTORAL PEOPLES AND ENDOGENOUS LIVESTOCK DEVELOPMENT Herd movements The exchange of livestock breeds and genes between North and South Evelyn Mathias and Paul Mundy League for Pastoral Peoples and Endogenous Livestock Development 2005 Herd Movements Published 2005 by the League for Pastoral Peoples and Endogenous Live- stock Development The League for Pastoral Peoples and Endogenous Livestock Develop- ment (LPP) is a non-profit organization devoted to advocacy and techni- cal support to marginal livestock keepers, in particular pastoralists. It was founded in 1992 in Germany. Activities focus on research, training, capac- LEAGUE FOR ity building and networking in co-operation with partner organizations. PASTORAL PEOPLES AND ENDOGENOUS LPP promotes the concept of endogenous livestock development utilizing LIVESTOCK DEVELOPMENT indigenous animal genetic resources and building on local institutions. For further information, contact: League for Pastoral Peoples, Pragelatostrasse 20, 64372 Ober-Ramstadt, Germany. www.pastoralpeoples.org, email [email protected] This study was compiled and printed with the support of: Misereor, Mozartstraße 9, 52064 Aachen, Germany, www.misereor.org Misereor is a Catholic development organization that helps people in Germany contribute to justice and solidarity with the poor and oppressed in Africa, Asia and Latin America. The projects support and promote local initiatives, irrespective of nationality, religion or gender. The opinions expressed in this book do not necessarily reflect those of Misereor. We encourage organizations and individuals to photocopy and distribute this publication. Please credit the League for Pastoral Peoples if you do so.
  • Ongole Cattle Status in India

    Ongole Cattle Status in India

    27 Ongole cattle status in India G.K. Gaur1 , S.N. Kaushik & R.C. Garg Project Directorate on Cattle, PH-7, Pallavpuram Phase 2, Modipuram, Meerut- 250 110, Uttar Pradesh, India Summary machos castrados son poderosos y apropiados para el arado y la tracción. Estos The Ongole cattle breed, also known as animales son resistentes a varias Nellore, is the native of the coastal districts enfermedades transmitidas por insectos. El Guntur, Prakasham and Nellore of Andhra manto de la raza Ongole es mayormente Pradesh. This is a dual-purpose breed. blanco pero en algunos machos se observan Bullocks are very powerful and suitable for manchas grises en la parte superior y en ploughing and cart pulling. These animals are ocasiones se han observados también dichas resistant to various insect-born diseases. The manchas en el cuarto trasero. Son animales de coat colour of Ongoles is glossy white but peso elevado con largas y anchas orejas, some males have grey markings on their papada, joroba, y extremidades. El rabo, el hump and grey markings on the back cuello y los cuernos son en general cortos. Las quarters have also been noticed. The animals orejas se presentan erectas con las puntas of this breed are heavy having long/large ligeramente negras. La papada se presenta ears, dewlap, hump, limbs and barrel. The amplia, flaccida y ligeramente colgante. Las size of a tail, neck and horns is in general ubres están bien formadas y colocadas. Una short. Ears are alert with a moderately short encuesta fue llevada a cabo en 60 poblados en black tip.