GENETIC POLYMORPHISM of BOLA-DRB3.2 LOCUS in SAHIWAL CATTLE Dibyendu Chakraborty1, Avtar Singh2, M.S. Tantia3, Archana Verma4, A

Animal Science Reporter, Volume 9, Issue 1, January, 2015

GENETIC POLYMORPHISM OF BOLA-DRB3.2 LOCUS IN SAHIWAL CATTLE

Dibyendu Chakraborty1, Avtar Singh2, M.S. Tantia3, Archana Verma4, A.K. Chakravarty5

ABSTRACT

The DRB3.2 gene of bovine lymphocyte antigen (BoLA) locus has received wide attention because of its polymorphism, and association with immunity and productivity in dairy cattle. The present study was conducted on polymorphism of BoLA-DRB3.2 gene of Sahiwal cattle, a premier dairy breed of India, to identify marker genes that can boost milk production, besides providing relief from economic losses incurred due to mastitis, a major endemic disease of dairy cattle. It is a nascent subject of research, and no study has been conducted in Sahiwal cattle so far. The polymorphic analysis of BoLA-DRB3 gene, based on 112 Sahiwal (Bos indicus) cattle of the NDRI farm, was investigated by hemi-nested polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP). The amplification of BoLA-DRB3 gene, revealed a 284 bp of PCR product, composed of 17 bp of 5 intron, and 267 bp of exon. The PCR products digested with Bst YI, Hae III, and Rsa I restriction endonuclease enzymes revealed 3 (a, b, e), 3 (a, b, e), and 14 (a, b, d, n, m, f, g, h, o, l, s, t, i, u) RFLP prototypes, respectively. DNA sequencing revealed 36 BoLA-DRB3.2 alleles, out of which, 12 alleles (*baa, *iaa, *ibe, *laa, *dba, *sba, *saa, *gba, *mbb, *mab, *fbb, *naa) were detected for the first time in cattle. Seven alleles (*02/*02, *08/*08, *10/*10, *23/*23, *mab/*mab, *dba/*dba, *gba/*gba) were homozygote, and the rest were heterozygote. The alleles *1 and *8, alleles *15 and *51, and alleles *10 and *23 of Sahiwal cattle, detected in our study, assume special significance, as their association with susceptibility to mastitis, resistance to mastitis, and higher milk production, respectively, have been reported earlier in cattle, and needed validation in Sahiwal for use as markers, which could not be exercised, as it was beyond the ambit of our quest. It is concluded that BOLA-DRB 3.2 locus is highly polymorphic in Sahiwal cattle.

KEY WORDS

BoLA-DRB3 gene, PCR-RFLP, Polymorphism, Sahiwal cattle

Author attribution: 1Assistant Professor, Division of Animal Genetics & Breeding, Faculty of Veterinary Science & Animal Husbandry, SKUAST-Jammu, R.S. Pura, Jammu, India-181102, 2,4,5Principal Scientist, Dairy Cattle Breeding Division, National Dairy Research Institute (NDRI), Karnal, Haryana, India- 132001, 3Principal Scientist, National Bureau of Animal Genetic Resources (NBAGR), Karnal, Haryana, India- 132001. 1Corresponding author (E-mail: [email protected]). Received: 24 May 2014, Accepted: 20 November 2014. pp. 33-40.

33 Animal Science Reporter, Volume 9, Issue 1, January, 2015

INTRODUCTION chloroform extraction method (Sambrook et al., 1989). The bovine lymphocyte antigen (BoLA) genes of major histocompatibility PCR amplification: The exon 2 of BoLA- complex (MHC), located in exon 2 of DRB3 gene (284 bp) was amplified by class IIa region of bovine chromosome hemi-nested polymerase chain reaction 23 (BTA 23), have received wide (PCR) with HL-030 (5'- attention because of their high degree of ATCCTCTCTCTGCAGCACATT TCC- expression and genetic polymorphism, 3') and HL-031 (5'-TTTAAT TCGCGC along with association with immunity TCACCTCGCCGCT-3') primers (van and productivity in dairy cattle (do Eijk et al., 1992), in the first round of Nascimento et al., 2006; Rupp et al., 2007; amplification. Duangjinda et al., 2009; Pasmi et al., 2009; Oprzadek et al., 2012). The first round of PCR amplification was performed with 50 ng of DNA in a 25 µl There is no information available on reaction mixture, containing 1xPCR BoLA locus of Sahiwal (Bos indicus) buffer (2.5 µl), Mg++ (2.5 mM), dNTPs (0.2 cattle, a prized milch breed of India, µl), HL-030 and HL-031 primers (1 µl although the propensity of high yielding each) containing 5pmol/ µl, and Taq cows carrying DRB3 *1 and *52 alleles, DNA polymerase (0.2 µl). to an economically important disease like mastitis has been well proven The thermal cycling profile for the first (Duangjinda et al., 2009). The present round of amplification was initial study was designed to explore the denaturation of 5 min at 94ºC, followed genetic variants of BoLA-DRB3.2 alleles by 10 cycles of 1 min at 94ºC, 2 min at of Sahiwal cattle. 60ºC, 1 min at 72ºC, and a final extension of 1 min at 72ºC. MATERIALS AND METHODS The second round of semi-nested PCR Animals: A total number of 112 Sahiwal amplification was performed with 1 µl cows in milk, maintained at the National of first-round PCR product as DNA Dairy Research Institute (NDRI) farm template in a separate tube, with the were randomly chosen for the same volume and concentration of experiment. contents as described above, using HL- 030 and HL-032 primers. HL-032 primer Blood collection: About 10 ml of blood (5'-TCGCCG CTGC ACAGT GAAA was collected from the jugular vein of CTCTC-3') is internal to the sequence of each of the animal aseptically in tubes the amplified product of the first-round containing 0.5% EDTA, and stored at - PCR, and has eight bases that overlap 20°C for analysis. with HL031 primer.

DNA Extraction: Genomic DNA was The thermal cycling profile for the isolated from the whole blood by phenol- second round was 30 cycles of 1 min at

34 Animal Science Reporter, Volume 9, Issue 1, January, 2015

94ºC for denaturation and 30 s at 65.5ºC 200 V for 4 h. The ingredients of for annealing, extension at 72ºC for 1 digestion reactions were incubated min, followed by a final extension of 5 overnight and digestion products were min at 72ºC. The PCR products were resolved by 2.5% native acrylamide gel visualized by electrophoresis on 2.5% electrophoresis at 200 V for 5 h. A 50-bp agarose gel stained with ethidium DNA ladder (New England Biolabs) was bromide. used as a DNA size marker. BoLA-DRB3 typing: To examine the RESULTS AND DISCUSSION nucleotide sequence variability at the BoLA-DRB3.2 locus, three end Amplification: The amplification of nucleotide restriction enzymes, viz., Bst BoLA-DRB3 gene, a 284 bp of PCR YI, Hae III, and Rsa I were chosen (New product in Sahiwal cattle, revealed that England Biolabs, Ipswich, MA) based on it was composed of 17 bp of 5 intron, their cut site and ability to cut DNA in and 267 bp of exon. In contrast, this exon. Restriction fragments were Aravindakshan and Nainar (1999) have resolved by gel electrophoresis on 2.5% reported 304 bp of PCR product in acrylamide gel. Fifty (50) bp size markers Ongole cattle, while Oprzadek et al. were used as molecular weight markers. (2012) have reported that the size of the amplified BoLA-DRB3 gene was 284 bp BoLA-DRB3.2 typing was performed in Polish Holstein Friesian cattle. Wu et using a PCR-RFLP method adopted by al. (2010) has reported 284 bp of PCR van Eijk et al. (1992). The nomenclature product of exon 2, 3 bp of 3 intron and for alleles of BoLA-DRB3, defined by the 14 bp of 5 intron in Chinese Holstein PCR-RFLP method was indicated by the cattle. format locus.exon.allele, e.g., DRB3.2*1. RFLP prototypes: The RFLP patterns of Restriction Endonuclease Digestion: Six BoLA-DRB3 gene, explored by microlitre (6 µl) of the PCR products restriction endonuclease enzymes (Bst were digested at 37ºC with 5 units of Rsa YI, Hae III, and Rsa I) and their restriction I and Hae III , and at 60ºC with 5 units of patterns are presented in Box-1. The Bst YI in a total volume of 10 µl reaction study on the polymorphic pattern of mixture. Each reaction mixture DRB3 gene is important because it is contained 6 µl of PCR product, 2.5 µl of linked to the immune function of class autoclaved distilled water, 1.0 µl of II antigen of MHC (Wu et al., 2010). respective NEB buffers, and 0.5 µl of restriction enzyme. Bst YI: Digestion with Bst YI resulted in 3 RPLF restriction patterns, viz., a, b, The ingredients of digestion reactions and e with frequencies of 0.353, 0.629, were incubated overnight, and digestion and 0.018, respectively. Instead, products were resolved through 2.5% Aravindakshan and Nainar (1999) have native acrylamide gel electrophoresis reported two patterns, viz., a and b, using vertical electrophoretic system at in Ongole cattle, with frequencies of 0.73

35 Animal Science Reporter, Volume 9, Issue 1, January, 2015 and 0.27, respectively. Wu et al. (2010) respectively, in Chinese Holstein cattle have reported four RPLF patterns, viz., after digestion with Hae III enzyme. a, b, d, and e, with frequencies of 0.095, 0.823, 0.012, and 0.070, The high frequency of a pattern (0.714) respectively, in Chinese Holstein cattle. as obtained in our study in Sahiwal, The frequency of b was the highest in agreed with the reports of the workers Chinese Holstein cattle, and agreed with mentioned above. No fragment lengths our findings in Sahiwal cattle. which corresponded to the Hae III patterns c, d, f, g, h, and i of cattle Box-1. The restriction prototypes of were observed in our study. BoLA-DRB3 gene, detected by Bst YI, Rsa I: The restriction pattern of Rsa I Hae III, and Rsa I. enzyme was more complex than Bst YI Bst YI: a (0.353), b (0.629), e (0.018) and Hae III, and revealed 14patterns , viz., a, b, d, n, m, f, g, h, o, l, s, Hae III: a (0.714), b (0.272), e (0.014) t, i, and u in our study. The Rsa I: a (0.013), b (0.165), s (0.027) frequency for a single pattern was the highest for d with a frequency of 0.179. i (0.085), l (0.089), o (0.147), f (0.129) u (0.013) d (0.179), n (0.054), t (0.004) Aravindakshan and Nainar (1999) have reported elevem Rsa I patterns (c, d, f, d, m (0.045), g (0.027), h (0.009) g, i, k, l, n, o, t) in Ongole cattle (Bos indicus). The frequency of d was 0.03. Note: Figures in parentheses indicate Gilliespie et al. (1999) have reported eight frequency. Rsa I patterns (b, f, i, k, l, m, n, and o) in Hae III: Digestion with Hae III resulted Jersey cattle. Wu et al. (2010) have also in 3 RPLF restriction patterns, viz., a, reported eleven RPLF patterns (b, d, f, b, and e with frequencies of 0.714, g, h, i, j, l, m, n, o) in Chinese Holstein 0.272, and 0.014, respectively. cattle after digestion with Rsa I enzyme. Aravindakshan and Nainar (1999) have The frequency of d was 0.024. reported 4 restriction patterns, viz., a, There has been considerable variability b, i, and h, in Ongole cattle. The in the number of polymorphic patterns frequency of a was higher (0.63) than of BoLA-DRB3 locus in Sahiwal cattle, other patterns. Acharya et al. (2002) have so also their frequencies. This is reported a, b, and d patterns with attributed to the level of adaptation of high frequencies for a and b (0.458 the breeds to the geographical and each) in Gir cattle (Bos indicus), and a, climatic conditions, which influences the b, and e patterns in Kankrej cattle (Bos immune function of the animal (Wu et indicus), with the highest frequency of al., 2010). a (0.739). Wu et al. (2010) have reported 6 RPLF patterns, viz., a, b, d, e, f, Allelic composition: A total of 36 alleles and h with frequencies of 0.598, 0.238, were detected at BoLA-DRB3 locus 0.049, 0.037, 0.061, and 0.017 (Table-1). The highest frequencies was

36 Animal Science Reporter, Volume 9, Issue 1, January, 2015

Table-1. The allelic composition of BoLA-DRB3.2 locus in Sahiwal cattle.

S.No. Allele PCR-RFLP pattern Freq. S.No. Allele PCR-RFLP pattern Freq. Bst YI HaeIII Rsa I (%) Bst YI HaeIII Rsa I (%) 1 *01 a a a 0.90 19 *36 b a l 4.00 2 *02 b a b 13.80 20 *37 b a o 9.40 3 *03 b b b 0.45 21 *39 b a t 0.45 4 *06 a a d 8.90 22 *40 b a u 1.34 5 *08 a a f 7.60 23 *41 b a a 0.45 6 *10 b a f 5.90 24 *51 a a g 1.79 7 *14 b b h 0.90 25 *baa a a b 2.23 8 *15 b a i 5.90 26 *gba b a g 0.90 9 *19 b b s 0.90 27 *dba b a d 9.80 10 *20 b b l 3.13 28 *sba b a s 0.45 11 *21 b e l 0.90 29 *naa a a n 0.90 12 *22 b a m 0.45 30 *mbb b b m 0.90 13 *23 b a n 4.50 31 *iaa a a i 2.23 14 *25 a a o 0.45 32 *ibe b e i 0.90 15 *26 a b o 0.45 33 *laa a a l 0.45 16 *28 b b o 4.5 34 *fbb b b f 0.45 17 *32 a a m 0.45 35 *saa a a s 0.45 18 *34 a b l 0.45 36 *mab a b m 2.69 observed for *02 which was 13.8% of the indicus) cattle (Behl et al., 2007), 29 alleles population. The most common alleles in Deoni and Ongole cattle (Saravanan were *02, *06, *08, *28, and *dba ranging et al., 2010), 25 alleles in Chinese Holstein from 7 to 14%, and these 5 alleles cattle (Wu et al., 2010), and 28 alleles in constituted almost 50% of the total Polish Holstein-Friesian cattle number of observed alleles in Sahiwal (Oprzadek et al., 2012). cattle. The alleles of BoLA-DRB3.2 locus in Out of these alleles, 12 new alleles (*baa, Sahiwal cattle, associated with *iaa, *ibe, *laa, *dba, *sba, *saa, *gba, productivity and immunity were, allele *mbb, *mab, *fbb, *naa) obtained in our *1 with clinical mastitis in Holstein x study, were not reported in earlier Zebu cows of Thailand (Duangjinda et studies in cattle (van Ejik et al., 1992; al., 2009). Allele *3 with increase (P ≤0.01) Gelhaus et al., 1995; Maillard et al., 1999). in somatic cell score in Brazilian Gyr The new alleles comprised cattle (do Nascimento et al., 2006), and approximately 22% of the total number lower somatic cell count and reduced of observed alleles in Sahiwal cattle. Of mastitis in Canadian Holsteins (Rupp et the new alleles detected, the frequency al., 2007). of *dba was the highest (9.8%) in Sahiwal. Allele *6 is associated with decrease (P ≤0.05) in milk protein in Brazilian Gyr The number of alleles detected in other cattle (do Nascimento et al., 2006). Allele breeds of cattle were 37 alleles in *8 is associated with increase in Brazilian Gyr (Gir) cattle (do Nascimento subclinical mastitis in Iranian Holsteins et al., 2006), 21 alleles in Kankrej (Bos

37 Animal Science Reporter, Volume 9, Issue 1, January, 2015

(Pasmi et al., 2009). Allele *15 is Thailand (Duangjinda et al., 2009). These associated with resistance to clinical observations need to be validated in mastitis in Holstein x Zebu cows of Sahiwal cattle. Thailand (Duangjinda et al., 2009). Out of 36 alleles observed in the present study only 7 genotypes were present as Allele *22 is associated with higher homozygote. These were, *02/*02 somatic cell count in Canadian Holsteins (4.46%), *08/*08 (1.79%), *10/*10 (Rupp et al., 2007), and positive and (1.79%), *23/*23 (1.79%), *mab/*mab significant (P ≤0.05) association with milk (1.79%), *dba/*dba (1.79%), and *gba/ fat (%) and milk protein (%) in Iranian *gba (0.89%). The remaining alleles were Holsteins, resistance to clinical mastitis in heterozygote, which formed the majority Holstein x Zebu cows of Thailand in Sahiwal cattle. (Duangjinda et al., 2009), and resistance CONCLUSION to mastitis and bovine leukemia virus It is concluded that PCR-RLFP is a highly infection in Polish Holstein-Friesian cattle potent molecular marker to explore (Oprzadek et al., 2012). genetic variants of BoLA-DRB 3.2 locus, and Sahiwal cattle is highly polymorphic Allele *23 is associated with higher for BoLA-DRB 3.2 locus. somatic cell count in Canadian Holsteins (Rupp et al., 2007). Allele *51 is ACKNOWLEDGEMENT associated with resistance to clinical The authors are grateful to the Director, mastitis in Holstein x Zebu cows of National Dairy Research Institute

Figure-1. Gel showing Bst YI polymorphism of BoLA-DRB3 gene.

Lane: 1-3, 7-10, 13-14, 17-19, 21: a/b (87, 199, 284 bp), Lane: 3-6, 15-16: b/b (284 bp), Lane: 20: b/e (87, 109, 199, 284 bp), Lane: 11: U: Uncut PCR-Product, Lane: 12: L-50 bp Ladder.

38 Animal Science Reporter, Volume 9, Issue 1, January, 2015

Figure-2. Gel showing Hae III polymorphism of BoLA-DRB3 gene.

Lane: 1, 4-5, 11: a/a (167, 219 bp), Lane: 2-3, 6, 10, 12-15: a/b (167, 219 bp), Lane: 9, 16: a/e (167, 219 bp), Lane: 7: U: Uncut PCR-Product. Figure-3. Gel showing Rsa I polymorphism of BoLA-DRB3 gene.

Lane: 1: b/o (30, 39, 50, 111, 284 bp), Lane: 4: a/o (30, 33, 39, 50, 54, 78, 284 bp), Lane: 2, 6: f/ n (39, 50, 54, 104, 141, 180 bp), Lane: 3,5: n/n (104, 180 bp), Lane: 7: U: Uncut PCR-Product, Lane: 8: M: 100 bp Molecular Markers.

39 Animal Science Reporter, Volume 9, Issue 1, January, 2015

(NDRI), and Director, National Bureau DRB3.2 alleles in Jersey cows. Journal of of Animal Genetic Resources (NBAGR), Dairy Science, 82 (9), 2049-2053. Karnal, India, for providing necessary Maillard, JC et al. 2003. Selection assisted by facilities for the investigation. The a BoLA-DR/DQ haplotype against authors are thankful to George Russel susceptibility to bovine dermatophilosis. of Roslin Institute, University of Genetics Selection Evolution, 35 (Suppl 1), Edinburgh, for extending unconditional S193S200. help in understanding the BoLA nomenclature. Oprzadek, J et al. 2012. Frequency of BoLA- DRB3 alleles in Polish Holstein-Friesian REFERENCES cattle. Animal Science Papers and Reports, Acharya, CP et al. 2002. Detection of BoLA- 30 (2), 91-101. DRB3.2 gene polymorphism in Gir and Pasmi, M et al. 2009. Analysis of relationship Kankrej cattle using PCR-RFLP. Indian between bovine lymphocyte antigen DRB3.2 Journal of Animal Sciences, 72 (8), 680-683. alleles, somatic cell count and milk traits in Aravindakshan, T.V.; Nainar, A.M. 1999. Iranian Holstein population. Journal of Genetic polymorphism of BoLA-DRB3 gene Animal Breeding and Genetics, 126 (4), 296- in Jersey crossbred and Ongole cattle 303. revealed by PCR-RFLP. Indian Journal of Rupp, R et al. 2007. Association of bovine Animal Sciences, 69 (6), 424-427. leukocyte antigen (BoLA) DRB 3.2 with Behl, JD et al. 2007. Characterization of immune response, mastitis, and production genetic polymorphism of the bovine and type traits in Canadian Holsteins. lymphocyte antigen DRB3.2 locus in Kankrej Journal of Dairy Science, 90 (2), 1029-1038. cattle (Bos indicus). Journal of Dairy Science, Sambrook, J et al. 1989. Molecular Cloning: 90 (6), 29973001. A Laboratory Manual, 2nd edition, Cold do Nascimento, CS et al. 2006. Association Spring Harbor Press, New York. of the bovine major histocompatibility Saravanan, R et al. 2010. Characterization of complex (BoLA) BoLA-DRB3 gene with fat bovine lymphocyte antigen BoLA-DRB 3.2 and protein production and somatic cell alleles in Indian Deoni and Ongole (Bos score in Brazilian Gyr dairy cattle (Bos indicus) breeds of cattle by PCR-RFLP. 9th indicus). Genetics and Molecular Biology, 29 World Congress on Genetics and Applied (4), 641-647. Livestock Production (WCOGALP), Leipzic, Duangjinda, M et al. 2009. Detection of Germany, 1-6 August 2010. bovine leukocyte antigen DRB3 alleles as van Eijk, MJ et al. 1992. Extensive candidate markers for clinical mastitis polymorphism of the BoLA-DRB3 gene resistance in Holstein x Zebu. Journal of distinguished by PCR-RFLP. Animal Animal Science, 87 (2), 468-476. Genetics, 23 (6), 483496. Gelhaus, A et al. 1995. Sequence and PCR- Wu, XX et al. 2010. Restriction fragment RFLP analysis of 14 novel BoLA-DRB3 length polymorphism in the exon 2 of the alleles. Animal Genetics, 26 (3), 147153. BoLA-DRB3 gene in Chinese Holstein of the Gilliespie, BE et al. 1999. Analysis and south China. Journal of Biomedical Science frequency of bovine lymphocyte antigen and Engineering, 3 (2), 221-225.