1 Evolution of alternative biosynthetic pathways for vitamin C following plastid 2 acquisition in photosynthetic eukaryotes

3

4 Glen Wheeler1, *, Takahiro Ishikawa2, Varissa Pornsaksit3, Nicholas Smirnoff3 *

5

6

7 1 Marine Biological Association, Plymouth, UK, PL1 2PB

8 2 Department of Life Science and Biotechnology, Shimane University, Shimane 690-8504, 9 Japan.

10 3 Biosciences, College of Life and Environmental Sciences, University of Exeter, EX4 4QD

11

12 *correspondence to:

13 [email protected]

14 [email protected]

15

16

17 Short title: Evolution of vitamin C biosynthesis

1

18 Abstract:

19 Ascorbic acid (vitamin C) is an enzyme co-factor in eukaryotes that also plays a critical role 20 in protecting photosynthetic eukaryotes against damaging reactive oxygen species derived 21 from the chloroplast. Many animal lineages, including primates, have become ascorbate 22 auxotrophs due to the loss of the terminal enzyme in their biosynthetic pathway, L- 23 gulonolactone oxidase (GULO). The alternative pathways found in land plants and Euglena 24 use a different terminal enzyme, L-galactonolactone dehydrogenase (GLDH). The 25 evolutionary processes leading to these differing pathways and their contribution to the 26 cellular roles of ascorbate remain unclear. Here we present molecular and biochemical 27 evidence demonstrating that GULO was functionally replaced with GLDH in photosynthetic 28 eukaryote lineages following plastid acquisition. GULO has therefore been lost repeatedly 29 throughout eukaryote evolution. The formation of the alternative biosynthetic pathways in 30 photosynthetic eukaryotes uncoupled ascorbate synthesis from hydrogen peroxide production 31 and likely contributed to the rise of ascorbate as a major photoprotective antioxidant.

2

32 Introduction:

33 Ascorbate (vitamin C) plays an essential role in eukaryotes as an enzyme co-factor in 34 hydroxylation reactions, contributing to diverse processes such as the synthesis of collagen 35 and the demethylation of histones and nucleic acids 1,2. Ascorbate also plays an antioxidant 36 role in eukaryotes to help protect against reactive oxygen species (ROS) derived from

37 metabolic activity. The majority of hydrogen peroxide (H2O2) generated in some organelles is 38 likely reduced by other antioxidant systems, such as the peroxiredoxins and glutathione 39 peroxidases in the mitochondria, and catalases in the peroxisome 3,4. However, ascorbate 40 plays an important role in protecting photosynthetic cells against ROS derived from the 41 chloroplast 5. Ascorbate peroxidase (APX), which is found in both the cytosol and the 42 chloroplast of photosynthetic eukaryotes, is central to this photoprotective role. Thylakoid-

43 and stroma-localised APX removes H2O2 produced by photosystem I through the activity of 44 the ascorbate-glutathione cycle and this process may account for 10% of photosynthetic 45 electron transport flow. Ascorbate also plays a critical role in preventing lipid peroxidation in 46 the thylakoid membranes and acts as a co-factor for violaxanthin de-epoxidase in the 47 xanthophyll cycle. In addition, ascorbate in the thylakoid lumen may prevent photoinhibition 48 in high light by directly donating electrons to the photosynthetic electron transport chain 5. 49 These roles have been demonstrated in a range of ascorbate deficient plants that display 50 sensitivity to high light and to oxidants5.

51 Photosynthetic eukaryotes arose following the endosymbiotic acquisition of a cyanobacterial 52 ancestor by a non-photosynthetic eukaryote in the Archaeplastida (Plantae) lineage 6. Several 53 other eukaryote lineages, including the diatoms, haptophytes and euglenids, subsequently 54 gained plastids through a secondary endosymbiosis with either a red or green alga. These 55 plastid endosymbioses were accompanied by lateral gene transfer on a massive scale from the 56 symbiont to the host nuclear genome (known as endosymbiotic gene transfer or EGT), giving 57 rise to the complex physiologies of photosynthetic eukaryotes 7. The plastids in the major 58 photosynthetic eukaryote lineages are all ultimately derived from the primary endosymbiosis. 59 Whilst acquisition of a photosynthetic endosymbiont may have been beneficial to the host 60 cell in many ways, the plastid is also a major source of potentially damaging ROS 8. There is

61 evidence for extensive leakage of H2O2 out of plastids via aquaporins, particularly at high 62 light intensities 9,10. Plastid acquisition is therefore associated with a greatly increased 63 requirement for cellular antioxidant systems to prevent photodamage. Cyanobacteria do not 64 possess APX or any of the known enzymes for ascorbate biosynthesis and minimise photo-

3

65 oxidative stress using alternative mechanisms, such as peroxiredoxins, catalases and 66 glutathione peroxidases 11,12. This suggests that ascorbate was most likely recruited to its 67 photoprotective role after the acquisition of the plastid in ancestral Archaeplastida 12, 68 although the evolutionary origins of ascorbate biosynthesis are unclear.

69 There is no clear evidence for ascorbate biosynthesis in prokaryotes (see Materials and 70 Methods), suggesting that the ability to synthesise ascorbate evolved in eukaryotes. The three 71 eukaryote lineages in which ascorbate biosynthesis has been examined extensively (animals, 72 plants and Euglena) all exhibit different biosynthetic pathways (Fig. 1). These pathways may 73 have arisen due to convergent evolution, or may represent modifications of an ancestral 74 pathway. An understanding of these evolutionary relationships will provide insight into the 75 cellular roles of ascorbate in eukaryotes, particularly in relation to plastid acquisition in the 76 photosynthetic lineages.

77 Animals synthesise ascorbate via D-glucuronic acid and L-gulonolactone (L-GulL), with L- 78 gulonolactone oxidase (GULO) catalysing the oxidation of L-GulL to ascorbate. Many 79 animal lineages have lost the ability to synthesise ascorbate, including haplorhine primates, 80 guinea pigs, teleost fish, some bats and passerine birds. In all of the animal ascorbate 81 auxotrophs that have been examined, the gene encoding GULO is lost 13-16. GULO uses

82 molecular O2 as its electron acceptor, resulting in H2O2 production, which may have 83 contributed to selective pressure to lose this enzyme in some animals 2,17. The inability of 84 many invertebrates to synthesise ascorbate led to early speculation that ascorbate synthesis 85 may have evolved later in metazoan evolution 18. However, whilst the loss of GULO in 86 vertebrate lineages has been extensively examined 19, little is known about its distribution in 87 invertebrates or the non-metazoan members of the holozoa. This information is required to 88 identify the selective pressures underlying the evolution of ascorbate auxotrophy in animals.

89 Two alternative routes to ascorbate biosynthesis have been identified in photosynthetic 90 eukaryotes, which both employ L-galactonolactone dehydrogenase (GLDH) as the terminal 91 enzyme instead of GULO. A pathway via D-galacturonic acid and L-galactonolactone (L- 92 GalL) was identified in Euglena 20. This pathway is analogous to the animal pathway and also 93 appears to be functional in some stramenopile algae 21,22. In contrast, ascorbate biosynthesis 94 in land plants was found to occur via a different route using D-mannose and L-galactose 23. 95 Green algae also use the 'plant pathway' 24,25, but evidence is lacking for the nature of

4

96 ascorbate biosynthesis in many other evolutionarily important lineages, most notably the 97 rhodophytes (red algae).

98 This paper focuses on the distribution of the three major pathways of ascorbate biosynthesis 99 described above. Alternative routes of ascorbate biosynthesis have been described in 100 trypanosomes and also in the fungi, which synthesise a range of ascorbate analogues (see 101 Materials and Methods)26,27. There is some evidence for the operation of alternative routes to 102 ascorbate in land plants 28-30, although molecular genetic evidence from Arabidopsis indicates 103 that the D-mannose/L-galactose pathway is the primary route of ascorbate biosynthesis (see 104 Materials and Methods) 31,32.

105 The three major pathways of ascorbate biosynthesis therefore all utilise different routes to 106 synthesise an aldonolactone precursor (L-gulonolactone, L-GulL or L-galactonolactone, L- 107 GalL), which is converted to ascorbate by either GULO (animal pathway) or GLDH (plant 108 and euglenid pathways) 20,23,26. GULO and GLDH exhibit significant sequence similarity and 109 are both members of the vanillyl alcohol oxidase (VAO) family of flavoproteins 33. These 110 similar enzymes exhibit important biochemical differences. GULO can oxidise L-GulL and L- 111 GalL, whereas GLDH is highly specific for L-GalL 34. GULO localises to the lumen of the 112 endoplasmic reticulum (ER), whereas GLDH is associated with complex I in the 35 113 mitochondrial electron transport chain . Importantly, GLDH does not generate H2O2, as it

114 uses cytochrome c rather than O2 as an electron acceptor.

115 Despite the importance of ascorbate in eukaryote physiology, it is not known how the 116 different pathways of ascorbate biosynthesis arose in animals, plants and algae or relate to its 117 differing cellular roles. This manuscript examines the origins of ascorbate biosynthesis in 118 eukaryotes and seeks to address the following important gaps in our current knowledge: 1) 119 what is the wider distribution of GULO loss and ascorbate auxotrophy in the metazoa? 2) do 120 all photosynthetic eukaryotes use an alternative terminal enzyme to animals? 3) why do two 121 different pathways using GLDH exist in photosynthetic eukaryotes? 4) which pathway is 122 used in the rhodophytes? Using a combination of molecular and biochemical analyses, we 123 present evidence that GULO is an ancestral gene in eukaryotes that has been functionally 124 replaced by GLDH in the photosynthetic lineages, resulting in the development of their 125 alternative biosynthetic pathways.

5

126 Results:

127 Distribution of GULO and GLDH in eukaryote genomes

128 To examine the origins of ascorbate biosynthesis in eukaryotes we analysed the distribution 129 of GULO and GLDH in eukaryote genomes. We found that GULO and GLDH have a 130 mutually exclusive distribution (Fig 2). GULO is absent from many metazoan genomes, 131 including all insects, supporting earlier biochemical evidence that insects are predominately 132 ascorbate auxotrophs (Supplementary File 1) 18,36. However, GULO is present in basally 133 derived metazoans, including sponges and cnidarians, and is also present in a filasterean 134 (Capsaspora owczarzaki) and in fungi (Supplementary File 1). This suggests that ascorbate 135 synthesis via GULO is an ancestral trait in the Opisthokonta that has been lost in many 136 lineages.

137 GULO is also present the Apusomonadida (Thecamonas trahens), a sister group to the 138 Opisthokonts, and in members of the Amoebozoa and Excavata. Surprisingly, we also found 139 GULO in basally derived Archaeplastida including the glaucophyte, Cyanophora paradoxa, 140 and the rhodophytes Galdieria sulphuraria and Galdieria phlegrea. The glaucophytes occupy 141 a key position in the evolution of photosynthetic eukaryotes as they diverged from the other 142 Archaeplastida before the split of the red and green algal lineages and have highly unusual 143 chloroplasts (termed cyanelles) that retain several features of the cyanobacterial 144 endosymbiont 37. GULO is absent from all other Archaeplastida genomes, although an 145 enzyme family exhibiting weak similarity to GULO has been reported in Arabidopsis 38. 146 However, this enzyme forms a distinct phylogenetic clade from all other GULO and GLDH 147 sequences and its role in de novo ascorbate biosynthesis remains unclear.

148 GLDH was found in all Archaeplastida genomes, except for Cyanophora and Galdieria, and 149 in all photosynthetic lineages that have acquired a plastid via secondary endosymbiosis 150 (including stramenopiles, cryptophytes, haptophytes, chlorarachniophytes and euglenids). 151 GLDH was present in several non-photosynthetic organisms including the oomycetes, the 152 foraminifera and in the choanoflagellates, Monosiga brevicollis and Salpingoeca rosetta. The 153 evolutionary history of algal plastids acquired by secondary endosymbiosis remains uncertain 154 and there is some evidence that non-photosynthetic stramenopile (e.g. oomycetes) and 155 rhizarian (e.g. foraminifera) lineages may have once acquired a plastid that was subsequently 156 lost 6,39,40.

6

157 Further identification of GLDH or GULO in the transcriptomes of 165 eukaryotes within the 158 Marine Microbial Eukaryote Trancriptome dataset 41 confirmed that GLDH was found 159 primarily in photosynthetic organisms (Supplementary File 2), but also in the non- 160 photosynthetic stramenopiles such as oomycetes, biocosoecids and labryinthulids and in an 161 acanthoecid choanoflagellate. The presence of GULO was restricted to non-photosynthetic 162 organisms, including the heterotrophic flagellate Palpitomonas bilix, which is a non- 163 photosynthetic relative of the Cryptophyte algae42. The exception was the presence of GULO 164 in the chromerids, Chromera velia and Vitrella brassicaformis, which are photosynthetic 165 relatives of the Apicomplexa 43.

166 Further searches of Expressed Sequence Tag (EST) and Transcriptome Shotgun Assembly 167 (TSA) databases identified a GULO sequence in the green alga, Chlorokybus atmophyticus 168 (JO192417.1)44,45. Chlorokybus represents a basal lineage in the charophyte algae, which are 169 a sister group to the land plants (Figure 2: figure supplement 1). GLDH was identified in the 170 other charophytes Klebsormidium flaccidum, Nitella mirabilis and Nitella hyalina 171 (JO285109.1, JV744884.1, JO253095.1). These searches also revealed the presence of GULO 172 in the craspedid choanoflagellate, Monosiga ovata (DC478225.1). The Craspedida subgroup 173 of the choanoflagellates is divided into two major clades; clade I contains M. brevicollis and 174 S. rosetta (which both possess GLDH) and clade II contains M. ovata 46.

175 We conclude that all photosynthetic eukaryotes use GLDH rather than GULO as the terminal 176 enzyme in ascorbate biosynthesis. The exceptions are the basally derived Archaeplastida 177 (Cyanophora, Galdieria and Chlorokybus) and the chromerids (Figure 2: figure supplement 178 2). No photosynthetic organisms were found to lack both GULO and GLDH, although both 179 genes were absent in many non-photosynthetic organisms, including all insects, Daphnia, 180 Paramecium and Dictyostelium. The genomes of many parasitic groups also appear to lack 181 both enzymes including the diplomonads, parabasalids and apicomplexa (e.g. Giardia 182 intestinalis, Trichomonas vaginalis and Plasmodium falciparum). Since all documented 183 pathways of ascorbate biosynthesis require either GULO or GLDH, organisms lacking both 184 of these enzymes are likely to be ascorbate auxotrophs 18.

185 Phylogenetic analyses of GULO and GLDH

186 A maximum likelihood tree of GULO and GLDH sequences was produced using the other 187 members of the VAO family as an outgroup to root the tree. GLDH is highly conserved and 188 the phylogenetic analyses strongly support a monophyletic origin for all GLDH sequences

7

189 (100% bootstrap support, posterior probability =1) (Fig. 3). The monophyly of eukaryote 190 GULO sequences is well supported (85% bootstrap support, posterior probability =1). This 191 clade includes trypanosome L-GalL oxidase and ascomycete D-arabinonolactone oxidase 27,47, 192 indicating that although these enzymes exhibit altered substrate specificity they should be 193 considered within the GULO clade for our evolutionary analyses. There is also moderate 194 support for the monophyly of GULO and GLDH as a clade within the VAO family, 195 supporting hypotheses that these enzymes may have originated from a gene duplication 196 event. GLDH is highly unusual amongst the VAO flavoprotein family in that it does not use

197 O2 as an electron acceptor, but mutation of a single highly conserved alanine residue in 198 GLDH is required to convert it from a dehydrogenase to an oxidase 48. The phylogenies 199 within the GULO clade and the GLDH clade are poorly resolved, and so the trees do not 200 provide evidence on the likelihood of lateral gene transfer, such as endosymbiotic gene 201 transfer (EGT) or horizontal gene transfer (HGT), of either gene. Further phylogenetic 202 analyses, individually examining each gene using unrooted trees with much greater 203 taxonomic sampling, were unable to provide greater resolution (Figure 3: figure supplement 204 1).

205 Distribution of GLDH-dependent pathways in photosynthetic organisms

206 Many of the enzymes preceding GULO or GLDH in the animal and euglenid pathways play 207 other roles within the cell, e.g. in uronic acid metabolism or providing pentose intermediates 208 49. The presence or absence of these genes is therefore not solely related to ascorbate 209 biosynthesis. However, the plant pathway of ascorbate biosynthesis contains a number of 210 dedicated enzyme steps, allowing a much clearer examination of its distribution. This also 211 enables a distinction to be made between the plant- and euglenid-type pathways, as both 212 utilise GLDH as the terminal enzyme. Plants and green algae use GDP-L-galactose 213 phosphorylase (VTC2) and L-galactose dehydrogenase to generate L-GalL 24,32,50-52, whereas 214 euglenids use D-galacturonate reductase (Fig. 1) 53. We found that L-galactose dehydrogenase 215 is present in all rhodophytes and Viridiplantae, except the prasinophytes Ostreococcus and 216 Micromonas (see Materials and Methods). Sequences exhibiting similarity to L-galactose 217 dehydrogenase were also found in the diatoms and in some metazoa, but as some of these 218 species are ascorbate auxotrophs, it appears that this enzyme may play alternative metabolic 219 roles. VTC2 is found exclusively in the Viridiplantae (including Chlorokybus), indicating that 220 the definitive ‘plant’ pathway is restricted to this lineage (Fig. 2; Supplementary Files 3-4). 221 Biochemical evidence from euglenids and stramenopiles 20-22 suggests that organisms that

8

222 lack VTC2 but possess GLDH are likely to operate a 'euglenid' pathway, with D-galacturonic 223 acid acting as the precursor of L-GalL. However, it is not clear whether this is also the case in 224 the rhodophytes. All rhodophytes possess a sequence that is highly similar to characterised L- 225 galactose dehydrogenases from plants and bacteria 50,54 and L-galactose residues are a major 226 constituent of red algal polysaccharides 55. We therefore examined whether rhodophytes 227 could synthesise ascorbate via a modified 'plant' pathway using an alternative route to L- 228 galactose.

229 Biochemical analysis of pathways in rhodophytes

230 We used the macroalga, Porphyra umbilicalis, to examine whether rhodophytes can utilise L- 231 galactose in ascorbate synthesis. We detected NAD+-dependent L-galactose dehydrogenase 232 activity in Porphyra thallus extracts (Fig. 4A). Feeding 10 mM L-galactose to Porphyra 233 thallus slices increased the concentration of ascorbate (detected as dehydroascorbate by GC- 234 MS) (Fig. 4B). As red algae synthesise GDP-L-galactose from GDP-D-mannose 56, 235 rhodophytes likely use a modified ‘plant pathway' to synthesise ascorbate, employing an 236 unidentified enzyme activity to generate L-galactose from GDP-L-galactose instead of VTC2.

237 We then examined ascorbate biosynthesis in Galdieria, which differs from all other 238 rhodophytes (Supplementary File 4) in that it possesses GULO rather than GLDH. L- 239 galactose, L-GalL and L-GulL were all effective precursors of ascorbate in G. sulphuraria 240 (Fig 4C), suggesting that L-galactose is converted to L-GalL, which may then be converted to 241 ascorbate by GULO. A positional isotopic labelling approach indicated that label from D-[1- 242 13C]-glucose was incorporated primarily into carbon 1 (C1) of ascorbate (Fig. 4D, Figure 4: 243 figure supplement 1). This labelling pattern is expected for the plant pathway, while the 244 reduction of a uronic acid intermediate in the animal or euglenid pathways would result in the 245 transfer of label from C1 of glucose into C6 of ascorbate/dehydroascorbate 26. G. sulphuraria 246 therefore uses a similar pathway to other rhodophytes, employing GULO instead of GLDH.

247 In combination, these data identify a clear difference between the Archaeplastida and the 248 photosynthetic lineages that have acquired a plastid via secondary endosymbiosis. Whilst 249 both groups use GLDH as the terminal enzyme for ascorbate synthesis, they differ in the 250 route to L-GalL, The Archaeplastida generate L-GalL via L-galactose (without inversion of 251 the carbon chain of glucose), whereas photosynthetic eukaryotes with secondary plastids 252 synthesise L-GalL via D-galacturonate, resulting in inversion of the carbon chain.

9

253 Distribution of ascorbate-dependent antioxidant systems

254 We have found that nearly all photosynthetic eukaryotes use GLDH to synthesise ascorbate, 255 suggesting that this distribution may be linked to the photoprotective role of ascorbate. We 256 therefore determined the distribution of ascorbate-dependent antioxidant mechanisms in 257 eukaryote genomes. Three main isoforms of APX are found in eukaryotes (APX, APX-R and 258 APX-CCX, a hybrid enzyme containing both ascorbate and cytochrome c peroxidase 259 domains) 11,57,58. APX and APX-R are found in nearly all photosynthetic eukaryotes and in 260 the choanoflagellates, M. brevicollis and S. rosetta. Euglena and Emiliania do not possess 261 APX or APX-R, although both possess APX-CCX, which is also found in some fungi and in 262 Capsaspora (Fig. 5). The only photosynthetic eukaryote in this analysis that lacks any 263 isoform of APX was Cyanophora paradoxa. Cyanophora also lacks all of the remaining 264 enzymes of the plant ascorbate-glutathione cycle: monodehydroascorbate reductase 265 (MDHAR), dehydroascorbate reductase (DHAR) and glutathione reductase (GR). The 266 ascorbate-dependent xanthophyll cycle is not present in glaucophytes and so Cyanophora 267 does not require ascorbate for non-photochemical quenching (Fig. 5). Moreover, the cellular 268 concentration of ascorbate in Cyanophora is either very low or absent, as we could not detect 269 ascorbate in Cyanophora extracts using GC-MS (data not shown). It is possible that ascorbate 270 analogues are present that we could not identify. However, in combination with the lack of 271 the plant ascorbate-glutathione cycle and the xanthophyll cycle, we conclude that 272 Cyanophora is unlikely to rely on ascorbate to detoxify peroxides derived from 273 photosynthesis. Cyanophora does however contain several glutathione peroxidases, 274 peroxiredoxins and catalase, as well as a unique peroxidase (symerythrin) similar to 275 rubrerythrin of prokaryotes59. These data suggest that glaucophytes rely on alternative 276 mechanisms to detoxify peroxides derived from photosynthesis. As cyanobacteria also do not 277 appear to use ascorbate for photoprotection60,61, the photoprotective role of ascorbate may 278 therefore have emerged in the Archaeplastida after the divergence of the glaucophytes.

279

10

280 Discussion

281 Distribution of pathways in eukaryotes

282 Ascorbate (vitamin C) is a very familiar metabolite to humans, so it is perhaps surprising that 283 so many aspects of its biosynthesis and metabolism remain uncharacterised. The biosynthetic 284 pathway of ascorbate in plants, which supplies the vast majority of ascorbate in the human 285 diet, remained elusive for many years 23 and the major role of ascorbate in DNA 286 demethylation emerged only very recently 1. In order to better understand the cellular roles of 287 ascorbate, we have examined the distribution of the three major pathways of ascorbate 288 biosynthesis in eukaryotes. We identify that the Opisthonkonts (animals and fungi), the 289 Amoebozoa and the non-photosynthetic representatives of the Excavata and CCTH 290 (Hacrobia) use GULO for ascorbate biosynthesis. In contrast, the photosynthetic organisms in 291 the Archaeplastida, CCTH (Hacrobia), SAR and the photosynthetic members of the Excavata 292 (euglenids) use GLDH. In these photosynthetic organisms, the combination of molecular and 293 biochemical evidence suggests that the non-inversion pathway via L-galactose (plant 294 pathway) is restricted to Archaeplastida, whereas the inversion pathway via D-galacturonate 295 (euglenid pathway) is used by photosynthetic eukaryotes that acquired plastids via secondary 296 endosymbiosis. The important exceptions to these trends are: firstly, that GLDH is found in 297 several non-photosynthetic organisms, notably in some choanoflagellates (Opisthokonts) and 298 stramenopiles and secondly, that GULO is found in several basally derived members of the 299 Archaeplastida.

300 The evolutionary origins of GULO and GLDH

301 The processes underlying the distribution of the different terminal enzymes are therefore 302 central to our understanding of the evolution of ascorbate biosynthesis. The mutually 303 exclusive distribution of two highly conserved and functionally similar genes in eukaryotes 304 may be explained by either of two evolutionary scenarios: an ancient gene duplication in the 305 last common eukaryote ancestor (ancient paralogy) followed by differential loss of either 306 gene, or lateral gene transfer of a novel gene followed by functional replacement of the 307 ancestral gene 62. It is likely that one of these evolutionary scenarios underlies the distribution 308 of GULO and GLDH amongst eukaryotes (Fig 6).

309 The model of ancient paralogy requires that both genes were present in the last common 310 eukaryote ancestor, where they both presumably contributed to ascorbate biosynthesis, and

11

311 were then differentially lost by every eukaryote lineage. This requires that these two 312 functionally similar enzymes co-existed in multiple lineages throughout eukaryote evolution 313 without significant functional divergence. The distribution of GULO and GLDH in the 314 Archaeplastida and in the choanoflagellates suggests that these enzymes may have coexisted 315 for a time in these lineages (Figure 2: figure supplement 1). However, there are no clear 316 examples of extant eukaryotes that possess both enzymes, which would be expected if they 317 have co-existed extensively throughout eukaryote evolution. The ancient paralogy model also 318 requires extensive loss of both GULO and GLDH. There is clear evidence for multiple 319 independent losses of GULO in animals and indications that GULO activity may be 320 deleterious under certain conditions, providing a potential selective pressure for gene loss 321 17,63. Similar evidence for the loss of GLDH in eukaryotes is lacking. In addition, Arabidopsis 322 mutants that lack GLDH cannot correctly assemble mitochondrial complex I 64, suggesting 323 that loss of GLDH is likely to have many wider impacts on metabolism.

324 The broad distribution of GULO supports an ancient evolutionary origin for this gene. It is 325 present in all of the eukaryote supergroups, including basally-derived lineages within the 326 CCTH (Hacrobia) and Archaeplastida and also in the Apusomonads. Although GLDH is also 327 present in most of the eukaryote supergroups (except the Amoebozoa), its distribution is 328 primarily restricted to lineages that have acquired a plastid or to isolated lineages (e.g. 329 choanoflagellates). Whilst we cannot discount an ancient origin for GLDH in the last 330 common eukaryote ancestor, its distribution may also be reasonably explained by the lateral 331 gene transfer model.

332 In the lateral gene transfer scenario, either GULO or GLDH could represent a novel gene that 333 arose in a specific lineage. However, the distribution of GULO cannot be reasonably 334 explained by lateral gene transfer, as this requires horizontal gene transfer (HGT) on a 335 massive scale specifically into non-photosynthetic eukaryotes. In contrast, the distribution of 336 GLDH can be largely explained by endosymbiotic gene transfer (EGT) during plastid 337 acquisition. GLDH may have arisen specifically in ancestral Archaeplastida after the 338 divergence of the glaucophytes and functionally replaced the ancestral gene (GULO). GLDH 339 could then have been transferred to the other photosynthetic lineages via EGT, resulting in 340 the replacement of GULO in lineages that acquired their plastids via secondary 341 endosymbiosis (Fig. 7). The presence of GLDH in some non-photosynthetic eukaryotes may 342 be explained by the evolutionary acquisition of a plastid that was subsequently lost. For 343 example, there is some evidence to support plastid loss in non-photosynthetic stramenopiles,

12

344 although the number and timing of plastid acquisition events via secondary endosymbiosis 345 remains a subject of significant debate6. The choanoflagellates have not acquired a plastid at 346 any stage, but there is evidence for large scale horizontal gene transfer (HGT) from algae into 347 this lineage, including the HGT of APX 65. Choanoflagellates may therefore have acquired 348 GLDH via HGT along with these other algal genes. EGT of GLDH is a more parsimonious 349 scenario than ancient paralogy, as it requires fewer independent loss events. However, the 350 poor resolution of the phylogenies within the GLDH clade means that direct evidence for 351 either EGT or HGT between lineages is lacking.

352 Evolution of alternative pathways

353 Both the ancient paralogy and EGT evolutionary scenarios are plausible in the wider context 354 of ascorbate biosynthesis. However, the EGT scenario provides a clear rationale to explain 355 why photosynthetic eukaryotes with primary plastids exhibit a different pathway from those 356 with secondary plastids. Our biochemical evidence suggests that ancestral Archaeplastida 357 developed a non-inversion pathway via L-galactose that employed the broad specificity of 358 GULO to oxidise L-GalL. The development of GLDH in ancestral Archaeplastida would have 359 led to the eventual replacement of GULO in all red and green algal lineages, except Galdieria 360 and Chlorokybus, resulting in the non-inversion plant-type pathway found in extant 361 Archaeplastida. In the photosynthetic eukaryotes with secondary plastids, it is likely that the 362 host initially synthesised ascorbate via an animal-type pathway (involving inversion of chain 363 and GULO) and that the red or green algal symbiont used a plant-type pathway (involving 364 non-inversion of the carbon chain and GLDH). However, neither pathway appears to operate 365 in photosynthetic eukaryotes with secondary plastids, which instead use a euglenid-type 366 pathway. We propose that EGT of GLDH from the symbiont could have resulted in 367 functional replacement of GULO in the animal-type pathway of the host, leading to a hybrid 368 biosynthetic pathway that employed D-galacturonate rather than D-glucuronate as an 369 intermediate in order to provide L-GalL as a substrate for GLDH. The hybrid pathway 370 therefore involves inversion of the carbon chain of D-glucose and GLDH. The generation of a 371 hybrid pathway suggests that photosynthetic eukaryotes with secondary plastids only 372 acquired GLDH by EGT rather than the entire plant pathway.

373 In conclusion, the distribution of GULO and GLDH in eukaryotes may be explained by either 374 of two evolutionary models; ancient paralogy followed by differential gene loss or EGT of 375 GLDH followed by GULO loss. We favour the EGT scenario as the most parsimonious and

13

376 the most consistent with the biochemical evidence, but we cannot rule out either scenario 377 based on the current evidence. Therefore our evolutionary analyses do not allow us to 378 definitively identify the origin of GLDH. However, they do enable clear conclusions to be 379 made on the loss of GULO. Both evolutionary models support GULO as an ancestral gene in 380 the last common eukaryote ancestor, indicating that GULO has been lost in almost all 381 photosynthetic eukaryotes. Therefore, we can conclude that photosynthetic eukaryotes 382 encountered strong selective pressure to replace the function of GULO in ascorbate 383 biosynthesis.

384 Selective pressures underlying evolution of ascorbate biosynthesis

385 The critical role of ascorbate in photoprotection has been demonstrated in a diversity of 386 photosynthetic eukaryotes, including land plants, green algae, diatoms and euglenids 25,66-68. 387 Our analyses indicate that many photosynthetic eukaryotes possessed GULO prior to plastid 388 acquisition, whereas almost all extant photosynthetic lineages use GLDH to synthesise 389 ascorbate. The selective pressure to replace GULO in ascorbate biosynthesis following 390 plastid acquisition could therefore be linked to the photoprotective role of ascorbate. One

391 intriguing possibility is that the production of H2O2 by GULO may have limited the ability of 392 the host cell to protect itself against ROS derived from the chloroplast.

393 Ancestral eukaryotes developed multiple antioxidant mechanisms to protect themselves from 394 ROS derived from organelles such as the peroxisome and the mitochondria. However, the 395 acquisition of a photosynthetic cyanobacterial endosymbiont in the Archaeplastida would 396 have resulted in a greatly increased requirement for cellular antioxidants to protect the host

397 cell from H2O2 secreted by the plastid. Ascorbate, synthesised in the host cell but not in the 398 cyanobacterial endosymbiont, appears to have been recruited to this role after the divergence 399 of the glaucophytes. The recruitment of ascorbate as a major cellular antioxidant in 400 photosynthetic eukaryotes may have led to an increased requirement for ascorbate

401 biosynthesis. However, ascorbate biosynthesis via GULO results in the production of H2O2 in 402 the ER lumen. In mammalian cells, this results in a damaging depletion and oxidation of the 403 glutathione pool when ascorbate synthesis is increased by feeding L-GulL 17,69. Ancestral 404 photosynthetic eukaryotes may have been unable to balance their increasing requirements for 405 ascorbate biosynthesis with maintenance of the redox status within the ER, providing

406 selective pressure to uncouple ascorbate biosynthesis from H2O2 production.

14

407 This hypothesis is consistent with the presence of GULO rather than GLDH in the 408 glaucophytes. As glaucophytes do not appear to use ascorbate for photoprotection, ascorbate 409 biosynthesis would not have been subjected to the same selective pressures as other 410 photosynthetic eukaryotes. This rationale may also apply to the retention of GULO in 411 Galdieria, which is likely to have both possessed both GULO and GLDH. Galdieria is 412 photosynthetic and expresses a functional APX 70, but it is very sensitive to even moderate 413 light intensities and grows primarily in an endolithic environment utilising heterotrophic 414 carbon sources 71. Thus, photo-oxidative stress in this environment may be minimal, reducing 415 the selective pressure in Galdieria to replace GULO.

416 Evolution of ascorbate auxotrophy in animals

417 The evolution of vitamin auxotrophy underpins many important nutritional and ecological 418 interactions between organisms 72. The selective pressures resulting in GULO loss in animals

419 represent a combination of the costs of ascorbate synthesis (including detoxification of H2O2 420 derived from GULO), the physiological requirements for ascorbate and the ecological factors 421 that determine the supply of dietary ascorbate throughout their life cycle. The development of 422 the photoprotective role of ascorbate in photosynthetic eukaryotes would have significantly 423 altered its availability to many heterotrophic organisms. The leaves of land plants have 424 particularly high cellular concentrations of ascorbate relative to other photosynthetic 12 425 eukaryotes , which may result from their inability to remove intracellular H2O2 via diffusion 426 to an aquatic medium. Our dataset reveals that in almost all documented cases of ascorbate 427 auxotrophy in animals, the major source of dietary ascorbate derives from GLDH rather than 428 GULO (Table 1). This is the case even for insectivorous animals, as insects appear to lack 429 GULO and must also obtain ascorbate in their diet, primarily from land plants. Thus, the 430 replacement of GULO with GLDH in photosynthetic organisms may have ultimately been an 431 important contributory factor in the loss of GULO in many animal auxotrophs.

432 The pseudogenisation of GULO in primates, bats and guinea pigs is one of the best known 433 examples of evolutionary gene loss 16. Through a wider analysis of ascorbate biosynthesis, 434 we have identified that GULO has also been lost in photosynthetic eukaryotes. Photosynthetic 435 eukaryotes functionally replaced GULO with an alternative terminal enzyme, GLDH, which

436 uncoupled ascorbate biosynthesis from H2O2 production and potentially aided the important 437 photoprotective role of ascorbate. These developments in photosynthetic eukaryotes may

15

438 have ultimately contributed to the loss of GULO in many herbivorous animals, by influencing 439 their supply of dietary ascorbate.

440

16

441 Materials and Methods

442 Bioinformatics

443 A broad range of eukaryote genomes were selected for detailed analyses (Supplementary File 444 5). Sequence similarity searches were used to identify candidate genes involved in ascorbate 445 biosynthesis. Genomic searches were initially performed using BLASTP with mouse or 446 Arabidopsis proteins. All instances of protein absence were confirmed using TBLASTN 447 against the genome with additional searches using sequences from closely related organisms. 448 Sequence similarity searches of transcriptomic datasets were used to identify trends in the 449 presence of ascorbate biosynthesis genes, but were not used to infer absence. Proteins 450 recovered from sequence similarity searches were identified using a combination of BLAST 451 score, manual inspection of conserved residues in multiple sequence alignments and their 452 position in phylogenetic trees generated by both neighbour-joining and maximum likelihood 453 method within the MEGA5 software package 73.

454 For detailed phylogenetic analysis of GULO and GLDH, multiple sequence alignments were 455 generated using MUSCLE. Poorly aligned regions were removed by manual inspection and 456 the alignments were further refined using GBLOCKS 0.91b to remove ambiguously aligned 457 sites 74, resulting in an alignment of 263 amino acids. ProtTest 75 was used to determine the 458 best substitution model (WAG with gamma and invariant sites) 76. Maximum likelihood 459 phylogenetic trees were generated using PhyML3.0 software with 100 bootstraps. Bayesian 460 posterior probabilities were calculated using BEAST v1.8 77, running for 10,000,000 461 generations, with a burn-in of 1,000,000 generations. As the phylogenetic relationships 462 within the GLDH clade were not well resolved, further unrooted phylogenetic analyses of 463 GLDH were performed using an individual multiple sequence alignment to allow more 464 positions to be used.

465 Biochemical analyses of ascorbate metabolism in rhodophytes

466 Galdieria sulphararia 074G was grown in Galdieria Medium (GM) (CCCryo, Potsdam- 467 Golm, Germany) at 30ºC, light intensity 50 μmol m-2 s-1. Porphyra umbilicalis was collected

468 from Maer Rocks, Exmouth, UK (50° 36′ 31.6′′ N 3° 23′ 27.0′′ W). L-Galactose 469 dehydrogenase activity was measured in ammonium sulphate (50% saturation) precipitates of 470 Porphyra thallus protein extracts 50. To determine the impact of exogenous precursors on 471 ascorbate, Galdieria cultures or slices of Porphyra thallus were incubated with sugars or

17

472 aldonic acid lactones (25 mM Galdieria, 10 mM Porphyra) for 24 h in GM or artificial sea 473 water (Instant Ocean, Aquarium Systems, Sarrebourg, France). Galdieria cultures (15 ml) 474 were harvested by centrifugation and extracted with 0.5 ml 80% methanol containing 0.1% 475 formic acid using sonication in the presence of glass beads. Porphyra thallus was powdered 476 in liquid nitrogen followed by homogenisation in 80% methanol (0.1 g thallus in 0.5 ml 477 extractant). Homogenates were centrifuged (10 min at 16,000 g, 4 °C). Supernatants (100 µl) 478 were dried into glass vials, methoximated trimethylsilyl derivatives were prepared 78 and 479 analysed by accurate mass GC-EI-qToF MS (Agilent 7200, Agilent Technologies, Santa 480 Clara, CA, USA). Derivatives were injected (0.2-0.4 µl, 1/2 to 1/50 split ratio) onto a Zebron 481 SemiVolatiles GC column (30 m analytical + 10 m guard length, 0.25 mm internal diameter, 482 0.25 µm film thickness, Phenomenex, Macclesfield, UK) using He carrier gas (1.2 ml min-1). 483 Injector temperature was 250 °C and column temperature program was 70 °C for 4 min,

484 followed by an increase to 310 °C at 15 °C/min. The column was held at the final 485 temperature for 6 min. Compounds were fragmented at 70 eV and MS spectra were collected 486 (50-600 amu at 5 spectra s-1). Ascorbate is oxidised to dehydroascorbate (DHA) during 487 derivatisation and DHA was identified by co-chromatography and comparison of accurate 488 mass spectra with an ascorbate standard. The position of stable isotope incorporation from [1- 489 13C]-D-glucose and [6-13C]-D-glucose into ascorbate was identified using mass spectra 490 obtained from injection of [1-13C]-ascorbate derivatives. C6 of DHA was found in fragments 491 with m/z values of 157.046 and 245.1029, while m/z 316.1038 contained C1 and C6. 13C 492 enrichment was assessed by the relative abundance of m+1 for each fragment relative to the 493 12C ascorbate standard.13C-labelled compounds were obtained from Omicron Biochemicals 494 (South Bend, IN, USA) and all other chemicals were from Sigma-Aldrich (Dorset, UK).

495 Molecular analyses

496 Reverse transcriptase PCR was used to verify the expression of GULO in Cyanophora 497 paradoxa (CCAP 981/1) and confirm its coding sequence. RNA was prepared using the 498 TRIzol method (Invitrogen) from Cyanophora paradoxa cultures grown in standard medium 499 (MWC), at 20ºC, 16:8 light:dark, light intensity 50 µmol m-2 s-1. Reverse-transcriptase PCR 500 was performed using a gene specific primer (GGAACTCCTCGAACTTGGGG) for reverse 501 transcription, followed by amplification of a 1017 base pair region using the following PCR 502 primers: GTCGCCCCTTCTGAGCATAG (forward) and CATGAGCGCGTCGAAGTCT 503 (reverse). NCBI accession number KJ957823.

18

504 Euglena transcriptome sequencing

505 Euglena gracilis (strain Z) was grown in Koren-Hutner medium (KH) under continuous 506 illumination (24 μmol m-2 s-1) at 26°C. RNA was harvested by the TRIzol method and used to 507 prepare cDNA. Paired end reads were generated by Illumina sequencing technology resulting 508 in a total of 193,472,913 reads. De novo assembly was carried out using Trinity 79, followed 509 by further clustering with TGICL 80. 510 511 Alternative routes for ascorbate biosynthesis

512 The three major routes of ascorbate biosynthesis described in Figure 1 are well supported by 513 biochemical and molecular evidence. However, there is some evidence to suggest that some 514 classes of eukaryotes may use alternative routes to ascorbate or use multiple routes. These 515 pathways are reviewed comprehensively elsewhere 26,52,81 but the implications for our 516 findings are highlighted below.

517 i) Land plants

518 Ascorbate in land plants is synthesised predominately via a non-inversion pathway through 519 GDP-D-mannose and L-galactose in which carbon atom 1 (C1) of the precursor hexose 520 remains as C1 in ascorbate 26,82. Genetic evidence from a range of ascorbate-deficient 521 Arabidopsis mutants indicates that the D-mannose/L-galactose pathway is the primary route 522 of ascorbate biosynthesis 5,31,32,83. For example, Arabidopsis vtc2 vtc5 double mutants lacking 523 GDP-L-Gal phosphorylase activity are not viable unless supplemented with ascorbate, 524 suggesting no other route can supply sufficient ascorbate to rescue this defect 32. However, a 525 number of other routes to ascorbate in plants have been proposed. Plants can potentially use 526 D-galacturonate as an ascorbate precursor, and this alternative route may contribute to 527 ascorbate synthesis in certain tissue types, such as fruits 28,84. GDP-L-gulose, formed during 528 the activity of GDP-mannose epimerase in vitro 30, could provide L-GulL, which could 529 contribute to ascorbate synthesis via the GULO-like enzymes found in land plants 38. 530 Overexpression of Arabidopsis GULO-like genes in tobacco cell lines increased cellular 531 ascorbate concentration in the presence of exogenous L-GulL 38. Oxidation of myo-inositol is 532 another potential source of L-GulL 29,85. However, more definitive biochemical and genetic 533 evidence for these alternative pathways is required in order to assess whether these pathways 534 contribute significantly to ascorbate biosynthesis in plants. The evidence for the alternative 535 pathways is largely based on increased ascorbate production after ectopic expression of genes

19

536 or addition of exogenous substrates. This approach leaves open the possibility that these 537 pathways are not active in wild type plants. The critical experiments, in which the proposed 538 enzymes are mutated or knocked out, have not been reported.

539 Our evolutionary analyses indicate that GULO and GLDH co-existed in ancestral 540 Archaeplastida, suggesting that multiple pathways of ascorbate biosynthesis were operational 541 in these organisms. Whilst the 'plant pathway' via GLDH is clearly the primary biosynthetic 542 route in extant land plants, the presence of minor alternative pathways such as those listed 543 above may reflect this ancestry of shared pathways.

544 ii) Prasinophytes

545 The genomes of the prasinophyte algae Ostreococcus and Micromonas are unusual amongst 546 the Viridiplantae in that they lack L-galactose dehydrogenase and GDP-mannose 547 pyrophosphorylase 25. However, it is likely that these prasinophytes can generate GDP-D- 548 mannose, either through an unidentified alternative enzyme activity (as proposed in brown 549 algae 86) or through the transferase activity of VTC2. Furthermore, we identified L-fucose (6- 550 deoxy-L-galactose) dehydrogenase in all Ostreococcus and Micromonas genomes. L-fucose 551 dehydrogenase also exhibits activity with L-galactose 87 and it therefore may functionally 552 replace L-galactose dehydrogenase in these prasinophytes. Analysis of the Marine Microbial 553 Eukaryote Transcriptome dataset revealed that L-fucose dehydrogenase is present in many 554 other prasinophytes including members of the Prasinococcales, Pycnococcaceae and the 555 Pyramimonadaceae. The only prasinophyte identified with L-galactose dehydrogenase was 556 Nephroselmis pyriformis (Nephroselmidophyceae). The Chlorodendrophyceae lineage 557 containing Tetraselmis spp. also possess L-galactose dehydrogenase.

558 iii) Trypanosomes

559 GULO from trypanosomes exhibits activity with D-AraL or L-GalL but not L-GulL, and is 560 therefore referred to as L-GalL oxidase 27,88,89. The source of L-GalL in trypanosomes has not 561 been determined. We did not find evidence for L-galactose dehydrogenase or the other 562 enzymes in the D-mannose/L-galactose pathway in trypanosome genomes.

563 iv) Fungi

564 The fungi synthesise a range of ascorbate analogues, including 6-deoxy-L-ascorbate, 565 ascorbate glycosides and the five carbon analogue, D-erythroascorbate 26. Yeasts synthesise

20

566 D-erythroascorbate from D-arabinose via D-AraL and these final steps are therefore analogous 567 to the D-mannose/L-galactose pathway. Deletion of ALO1 encoding D-AraL oxidase in 568 Saccharomyces cerevisiae results in increased sensitivity to oxidative stress but the mutants 569 are still viable 47. Until both the biosynthesis and the physiological roles of these analogues 570 are better understood, it is difficult to understand how the biosynthesis of the fungal ascorbate 571 analogues may have evolved.

572 v) Prokaryotes

573 There is little evidence to suggest that prokaryotes synthesise ascorbate de novo. GULO and 574 GLDH are essentially absent from prokaryotes. Extensive sequence similarity searches 575 identified a single GULO sequence in the cyanobacterium Rivularia sp PCC 7116 576 (WP_015122198.1), but all other cyanobacteria lack GULO. An enzyme exhibiting L-GulL 577 dehydrogenase activity has been cloned from Mycobacterium tuberculosis and a similar 578 enzyme is present in a range of other prokaryotes 90. While the presence of this enzyme 579 suggests some prokaryotes have the capacity for ascorbate synthesis, specific evidence for in 580 vivo ascorbate biosynthesis is lacking. There is a single report indicating that some 581 cyanobacteria contain very low concentrations of ascorbate 91, although the analytical method 582 used (2,4-dinitrophenylhydrazine) may not be sufficiently specific for ascorbate at these 583 concentrations 92. Prokaryotes lack ascorbate peroxidase and it is likely that early reports of 584 ascorbate peroxidase activity in cyanobacteria were due to the activity of other forms of 585 peroxidase 60.

586 vi) Chromerids

587 The chromerids are photosynthetic relatives of the apicomplexa 43 and are the only organisms 588 in our analyses that have acquired a plastid via secondary endosymbiosis and retained GULO. 589 Chromera velia utilises the xanthophyll cycle for non-photochemical quenching 93, 590 suggesting that ascorbate performs a photoprotective role in chromerids by acting as a co- 591 factor for violaxanthin de-epoxidase (VDE). We found homologues of VDE and VDE-like 592 proteins in the C. velia transcriptome, as well as monodehydroascorbate reductase 593 (MDHAR). The presence of GULO rather than GLDH in C. velia may relate to the unusual 594 mitochondria of apicomplexans. Apicomplexans lack complex I of the mitochondrial electron 595 transport chain 94, which may have influenced their ability to acquire and/or utilise GLDH, as 596 GLDH is incorporated into complex I in land plants 35. However, the genomes of the parasitic

21

597 apicomplexa all appear to lack both GULO and GLDH. It should be noted that dinoflagellates 598 also lack mitochondrial complex I but possess GLDH (Supplementary File 2). 599

22

600 Acknowledgements

601 The authors acknowledge funding from the Exeter University Science Strategy Fund, 602 Biotechnology and Biological Sciences Research Council (BB/G021678) and the Natural 603 Environment Research Council (NE/J021008/1). Hannah Florance (Exeter University Mass 604 Spectrometry Facility) provided analytical assistance. The Euglena transcriptome was 605 sequenced by the Exeter University Sequencing Service with assistance from Konrad 606 Paszkiewicz and Karen Moore. Access to the Marine Microbial Eukaryote Transcriptome 607 Sequencing Project (MMETSP) was provided by National Center for Genome Resources. 608 This paper is dedicated to the memory of Frank A. Loewus (1919-2014) who pioneered 609 research into ascorbate biosynthesis.

610 611 Competing interests 612 The authors declare no competing interests. 613

23

614 References

615

616 1 Blaschke, K. et al. Vitamin C induces Tet-dependent DNA demethylation and a 617 blastocyst-like state in ES cells. Nature 500, 222-226, doi:10.1038/nature12362 618 (2013). 619 2 Mandl, J., Szarka, A. & Banhegyi, G. Vitamin C: update on physiology and 620 pharmacology. British journal of pharmacology 157, 1097-1110, doi:10.1111/j.1476- 621 5381.2009.00282.x (2009). 622 3 Mhamdi, A., Noctor, G. & Baker, A. Plant catalases: peroxisomal redox guardians. 623 Arch Biochem Biophys 525, 181-194, doi:10.1016/j.abb.2012.04.015 (2012). 624 4 Sies, H. Role of metabolic H2O2 generation: redox signaling and oxidative stress. J 625 Biol Chem 289, 8735-8741, doi:10.1074/jbc.R113.544635 (2014). 626 5 Smirnoff, N. Vitamin C: The Metabolism and Functions of Ascorbic Acid in Plants. 627 Adv Bot Res 59, 107-177, doi:Doi 10.1016/B978-0-12-385853-5.00003-9 (2011). 628 6 Keeling, P. J. The endosymbiotic origin, diversification and fate of plastids. Philos 629 Trans R Soc Lond B Biol Sci 365, 729-748, doi:10.1098/rstb.2009.0103 (2010). 630 7 Timmis, J. N., Ayliffe, M. A., Huang, C. Y. & Martin, W. Endosymbiotic gene 631 transfer: organelle genomes forge eukaryotic chromosomes. Nature Reviews. Genetics 632 5, 123-135, doi:10.1038/nrg1271 (2004). 633 8 Dorrell, R. G. & Howe, C. J. What makes a chloroplast? Reconstructing the 634 establishment of photosynthetic symbioses. J Cell Sci 125, 1865-1875, 635 doi:10.1242/jcs.102285 (2012). 636 9 Mubarakshina, M. M. et al. Production and diffusion of chloroplastic H2O2 and its 637 implication to signalling. J Exp Bot 61, 3577-3587, doi:10.1093/jxb/erq171 (2010). 638 10 Naydov, I. A., Mubarakshina, M. M. & Ivanov, B. N. Formation kinetics and H2O2 639 distribution in chloroplasts and protoplasts of photosynthetic leaf cells of higher 640 plants under illumination. Biochemistry. Biokhimiia 77, 143-151, 641 doi:10.1134/S0006297912020046 (2012). 642 11 Zamocky, M., Furtmuller, P. G. & Obinger, C. Evolution of structure and function of 643 Class I peroxidases. Arch Biochem Biophys 500, 45-57, 644 doi:10.1016/j.abb.2010.03.024 (2010). 645 12 Gest, N., Gautier, H. & Stevens, R. Ascorbate as seen through plant evolution: the rise 646 of a successful molecule? J Exp Bot 64, 33-53, doi:10.1093/jxb/ers297 (2013). 647 13 Cui, J., Pan, Y. H., Zhang, Y., Jones, G. & Zhang, S. Progressive pseudogenization: 648 vitamin C synthesis and its loss in bats. Mol Biol Evol 28, 1025-1031, 649 doi:10.1093/molbev/msq286 (2011). 650 14 Nishikimi, M., Fukuyama, R., Minoshima, S., Shimizu, N. & Yagi, K. Cloning and 651 chromosomal mapping of the human nonfunctional gene for L-gulono-gamma-lactone 652 oxidase, the enzyme for L-ascorbic acid biosynthesis missing in man. J Biol Chem 653 269, 13685-13688 (1994). 654 15 Nishikimi, M., Kawai, T. & Yagi, K. Guinea pigs possess a highly mutated gene for 655 L-gulono-gamma-lactone oxidase, the key enzyme for L-ascorbic acid biosynthesis 656 missing in this species. J Biol Chem 267, 21967-21972 (1992). 657 16 Drouin, G., Godin, J. R. & Page, B. The genetics of vitamin C loss in vertebrates. 658 Current genomics 12, 371-378, doi:10.2174/138920211796429736 (2011). 659 17 Banhegyi, G., Csala, M., Braun, L., Garzo, T. & Mandl, J. Ascorbate synthesis- 660 dependent glutathione consumption in mouse liver. FEBS Lett 381, 39-41 (1996).

24

661 18 Chatterjee, I. B. Evolution and the biosynthesis of ascorbic acid. Science 182, 1271- 662 1272 (1973). 663 19 Yang, H. Conserved or lost: molecular evolution of the key gene GULO in vertebrate 664 vitamin C biosynthesis. Biochemical genetics 51, 413-425, doi:10.1007/s10528-013- 665 9574-0 (2013). 666 20 Shigeoka, S., Nakano, Y. & Kitaoka, S. The biosynthetic pathway of L-ascorbic acid 667 in Euglena gracilis Z. Journal of nutritional science and vitaminology 25, 299-307 668 (1979). 669 21 Grun, M. & Loewus, F. A. L-Ascorbic-acid biosynthesis in the euryhaline diatom 670 Cyclotella cryptica. Planta 160, 6-11, doi:10.1007/BF00392459 (1984). 671 22 Helsper, J. P., Kagan, L., Hilby, C. L., Maynard, T. M. & Loewus, F. A. L-Ascorbic 672 Acid Biosynthesis in Ochromonas danica. Plant Physiol 69, 465-468 (1982). 673 23 Wheeler, G. L., Jones, M. A. & Smirnoff, N. The biosynthetic pathway of vitamin C 674 in higher plants. Nature 393, 365-369, doi:10.1038/30728 (1998). 675 24 Running, J. A., Burlingame, R. P. & Berry, A. The pathway of L-ascorbic acid 676 biosynthesis in the colourless microalga Prototheca moriformis. J Exp Bot 54, 1841- 677 1849, doi:10.1093/jxb/erg207 (2003). 678 25 Urzica, E. I. et al. Impact of oxidative stress on ascorbate biosynthesis in 679 Chlamydomonas via regulation of the VTC2 gene encoding a GDP-L-galactose 680 phosphorylase. J Biol Chem 287, 14234-14245, doi:10.1074/jbc.M112.341982 681 (2012). 682 26 Loewus, F. A. Biosynthesis and metabolism of ascorbic acid in plants and of analogs 683 of ascorbic acid in fungi. Phytochemistry 52, 193-210, doi:Doi 10.1016/S0031- 684 9422(99)00145-4 (1999). 685 27 Logan, F. J., Taylor, M. C., Wilkinson, S. R., Kaur, H. & Kelly, J. M. The terminal 686 step in vitamin C biosynthesis in Trypanosoma cruzi is mediated by a FMN- 687 dependent galactonolactone oxidase. Biochem J 407, 419-426, 688 doi:10.1042/BJ20070766 (2007). 689 28 Badejo, A. A. et al. Translocation and the alternative D-galacturonate pathway 690 contribute to increasing the ascorbate level in ripening tomato fruits together with the 691 D-mannose/L-galactose pathway. J Exp Bot 63, 229-239, doi:10.1093/jxb/err275 692 (2012). 693 29 Lorence, A., Chevone, B. I., Mendes, P. & Nessler, C. L. myo-inositol oxygenase 694 offers a possible entry point into plant ascorbate biosynthesis. Plant Physiol 134, 695 1200-1205, doi:10.1104/pp.103.033936 (2004). 696 30 Wolucka, B. A. & Van Montagu, M. GDP-mannose 3',5'-epimerase forms GDP-L- 697 gulose, a putative intermediate for the de novo biosynthesis of vitamin C in plants. J 698 Biol Chem 278, 47483-47490, doi:10.1074/jbc.M309135200 (2003). 699 31 Conklin, P. L. et al. Genetic evidence for the role of GDP-mannose in plant ascorbic 700 acid (vitamin C) biosynthesis. Proc Natl Acad Sci U S A 96, 4198-4203 (1999). 701 32 Dowdle, J., Ishikawa, T., Gatzek, S., Rolinski, S. & Smirnoff, N. Two genes in 702 Arabidopsis thaliana encoding GDP-L-galactose phosphorylase are required for 703 ascorbate biosynthesis and seedling viability. Plant J 52, 673-689, 704 doi:10.1111/j.1365-313X.2007.03266.x (2007). 705 33 Leferink, N. G., Heuts, D. P., Fraaije, M. W. & van Berkel, W. J. The growing VAO 706 flavoprotein family. Arch Biochem Biophys 474, 292-301, 707 doi:10.1016/j.abb.2008.01.027 (2008). 708 34 Smirnoff, N. L-ascorbic acid biosynthesis. Vitamins and hormones 61, 241-266 709 (2001).

25

710 35 Schertl, P. et al. L-galactono-1,4-lactone dehydrogenase (GLDH) forms part of three 711 subcomplexes of mitochondrial complex I in Arabidopsis thaliana. J Biol Chem 287, 712 14412-14419, doi:10.1074/jbc.M111.305144 (2012). 713 36 Dadd, R. H. Insect nutrition: current developments and metabolic implications. 714 Annual review of entomology 18, 381-420, doi:10.1146/annurev.en.18.010173.002121 715 (1973). 716 37 Price, D. C. et al. Cyanophora paradoxa genome elucidates origin of photosynthesis 717 in algae and plants. Science 335, 843-847, doi:10.1126/science.1213561 (2012). 718 38 Maruta, T. et al. The contribution of Arabidopsis homologs of L-gulono-1,4-lactone 719 oxidase to the biosynthesis of ascorbic acid. Bioscience, biotechnology, and 720 biochemistry 74, 1494-1497 (2010). 721 39 Tyler, B. M. et al. Phytophthora genome sequences uncover evolutionary origins and 722 mechanisms of pathogenesis. Science 313, 1261-1266, doi:10.1126/science.1128796 723 (2006). 724 40 Glockner, G. et al. The Genome of the Foraminiferan Reticulomyxa filosa. Curr Biol 725 24, 11-18, doi:10.1016/j.cub.2013.11.027 (2014). 726 41 Keeling, P. J. et al. The Marine Microbial Eukaryote Transcriptome Sequencing 727 Project (MMETSP): Illuminating the Functional Diversity of Eukaryotic Life in the 728 Oceans through Transcriptome Sequencing. PLoS Biol 12, e1001889, 729 doi:10.1371/journal.pbio.1001889 (2014). 730 42 Yabuki, A. et al. Palpitomonas bilix represents a basal cryptist lineage: insight into 731 the character evolution in Cryptista. Scientific reports 4, 4641, doi:10.1038/srep04641 732 (2014). 733 43 Janouskovec, J., Horak, A., Obornik, M., Lukes, J. & Keeling, P. J. A common red 734 algal origin of the apicomplexan, dinoflagellate, and heterokont plastids. Proc Natl 735 Acad Sci U S A 107, 10949-10954, doi:10.1073/pnas.1003335107 (2010). 736 44 Leliaert, F. et al. Phylogeny and Molecular Evolution of the Green Algae. Crit Rev 737 Plant Sci 31, 1-46, doi:Doi 10.1080/07352689.2011.615705 (2012). 738 45 Timme, R. E., Bachvaroff, T. R. & Delwiche, C. F. Broad Phylogenomic Sampling 739 and the Sister Lineage of Land Plants. Plos One 7, doi:ARTN e29696 DOI 740 10.1371/journal.pone.0029696 (2012). 741 46 Jeuck, A., Arndt, H. & Nitsche, F. Extended phylogeny of the Craspedida 742 (Choanomonada). Eur J Protistol 50, 430-443, doi:10.1016/j.ejop.2014.06.001 743 (2014). 744 47 Huh, W. K. et al. Characterisation of D-arabinono-1,4-lactone oxidase from Candida 745 albicans ATCC 10231. European journal of biochemistry / FEBS 225, 1073-1079 746 (1994). 747 48 Leferink, N. G. et al. Identification of a gatekeeper residue that prevents 748 dehydrogenases from acting as oxidases. J Biol Chem 284, 4392-4397, 749 doi:10.1074/jbc.M808202200 (2009). 750 49 Linster, C. L. & Van Schaftingen, E. Vitamin C. Biosynthesis, recycling and 751 degradation in mammals. The FEBS journal 274, 1-22, doi:10.1111/j.1742- 752 4658.2006.05607.x (2007). 753 50 Gatzek, S., Wheeler, G. L. & Smirnoff, N. Antisense suppression of L-galactose 754 dehydrogenase in Arabidopsis thaliana provides evidence for its role in ascorbate 755 synthesis and reveals light modulated l-galactose synthesis. Plant J 30, 541-553 756 (2002). 757 51 Laing, W. A., Wright, M. A., Cooney, J. & Bulley, S. M. The missing step of the L- 758 galactose pathway of ascorbate biosynthesis in plants, an L-galactose

26

759 guanyltransferase, increases leaf ascorbate content. Proc Natl Acad Sci U S A 104, 760 9534-9539, doi:10.1073/pnas.0701625104 (2007). 761 52 Linster, C. L. et al. Arabidopsis VTC2 encodes a GDP-L-galactose phosphorylase, the 762 last unknown enzyme in the Smirnoff-Wheeler pathway to ascorbic acid in plants. J 763 Biol Chem 282, 18879-18885, doi:10.1074/jbc.M702094200 (2007). 764 53 Ishikawa, T. et al. Functional characterization of D-galacturonic acid reductase, a key 765 enzyme of the ascorbate biosynthesis pathway, from Euglena gracilis. Bioscience, 766 biotechnology, and biochemistry 70, 2720-2726 (2006). 767 54 Hobbs, M. E., Williams, H. J., Hillerich, B., Almo, S. C. & Raushel, F. M. l- 768 Galactose metabolism in Bacteroides vulgatus from the human gut microbiota. 769 Biochemistry 53, 4661-4670, doi:10.1021/bi500656m (2014). 770 55 Percival, E. Polysaccharides of Green, Red and Brown Seaweeds - Their Basic 771 Structure, Biosynthesis and Function. Brit Phycol J 14, 103-117 (1979). 772 56 Su, J. C. & Hassid, W. Z. Carbohydrates and nucleotides in the red alga Porphyra 773 perforata. I. Isolation and identification of carbohydrates. Biochemistry 1, 468-474 774 (1962). 775 57 Fawal, N. et al. PeroxiBase: a database for large-scale evolutionary analysis of 776 peroxidases. Nucleic Acids Res 41, D441-444, doi:10.1093/nar/gks1083 (2013). 777 58 Lazzarotto, F. et al. Ascorbate peroxidase-related (APx-R) is a new heme-containing 778 protein functionally associated with ascorbate peroxidase but evolutionarily divergent. 779 New Phytologist 191, 234-250, doi:10.1111/j.1469-8137.2011.03659.x (2011). 780 59 Cooley, R. B., Arp, D. J. & Karplus, P. A. Symerythrin structures at atomic resolution 781 and the origins of rubrerythrins and the ferritin-like superfamily. J Mol Biol 413, 177- 782 194, doi:10.1016/j.jmb.2011.08.019 (2011). 783 60 Bernroitner, M., Zamocky, M., Furtmuller, P. G., Peschek, G. A. & Obinger, C. 784 Occurrence, phylogeny, structure, and function of catalases and peroxidases in 785 cyanobacteria. J Exp Bot 60, 423-440, doi:10.1093/jxb/ern309 (2009). 786 61 Latifi, A., Ruiz, M. & Zhang, C. C. Oxidative stress in cyanobacteria. FEMS 787 microbiology reviews 33, 258-278, doi:10.1111/j.1574-6976.2008.00134.x (2009). 788 62 Keeling, P. J. & Inagaki, Y. A class of eukaryotic GTPase with a punctate distribution 789 suggesting multiple functional replacements of translation elongation factor 1-alpha. 790 Proc Natl Acad Sci U S A 101, 15380-15385, doi:10.1073/pnas.0404505101 (2004). 791 63 Hiller, M. et al. A "forward genomics" approach links genotype to phenotype using 792 independent phenotypic losses among related species. Cell reports 2, 817-823, 793 doi:10.1016/j.celrep.2012.08.032 (2012). 794 64 Pineau, B., Layoune, O., Danon, A. & De Paepe, R. L-galactono-1,4-lactone 795 dehydrogenase is required for the accumulation of plant respiratory complex I. J Biol 796 Chem 283, 32500-32505, doi:10.1074/jbc.M805320200 (2008). 797 65 Nedelcu, A. M., Miles, I. H., Fagir, A. M. & Karol, K. Adaptive eukaryote-to- 798 eukaryote lateral gene transfer: stress-related genes of algal origin in the closest 799 unicellular relatives of animals. Journal of evolutionary biology 21, 1852-1860, 800 doi:10.1111/j.1420-9101.2008.01605.x (2008). 801 66 Ishikawa, T. et al. Euglena gracilis ascorbate peroxidase forms an intramolecular 802 dimeric structure: its unique molecular characterization. Biochem J 426, 125-134, 803 doi:10.1042/BJ20091406 (2010). 804 67 Lavaud, J. & Kroth, P. G. In diatoms, the transthylakoid proton gradient regulates the 805 photoprotective non-photochemical fluorescence quenching beyond its control on the 806 xanthophyll cycle. Plant Cell Physiol 47, 1010-1016, doi:10.1093/pcp/pcj058 (2006). 807 68 Mellado, M., Contreras, R. A., Gonzalez, A., Dennett, G. & Moenne, A. Copper- 808 induced synthesis of ascorbate, glutathione and phytochelatins in the marine alga Ulva

27

809 compressa (Chlorophyta). Plant physiology and biochemistry : PPB / Societe 810 francaise de physiologie vegetale 51, 102-108, doi:10.1016/j.plaphy.2011.10.007 811 (2012). 812 69 Puskas, F. et al. Gulonolactone oxidase activity-dependent intravesicular glutathione 813 oxidation in rat liver microsomes. FEBS Lett 430, 293-296 (1998). 814 70 Sano, S. et al. Characterization of ascorbate peroxidases from unicellular red alga 815 Galdieria partita. Plant Cell Physiol 42, 433-440 (2001). 816 71 Oesterhelt, C., Schmalzlin, E., Schmitt, J. M. & Lokstein, H. Regulation of 817 photosynthesis in the unicellular acidophilic red alga Galdieria sulphuraria. Plant J 818 51, 500-511, doi:10.1111/j.1365-313X.2007.03159.x (2007). 819 72 Helliwell, K. E., Wheeler, G. L. & Smith, A. G. Widespread decay of vitamin-related 820 pathways: coincidence or consequence? Trends in genetics : TIG 29, 469-478, 821 doi:10.1016/j.tig.2013.03.003 (2013). 822 73 Tamura, K. et al. MEGA5: molecular evolutionary genetics analysis using maximum 823 likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 824 28, 2731-2739, doi:10.1093/molbev/msr121 (2011). 825 74 Talavera, G. & Castresana, J. Improvement of phylogenies after removing divergent 826 and ambiguously aligned blocks from protein sequence alignments. Systematic 827 biology 56, 564-577, doi:10.1080/10635150701472164 (2007). 828 75 Abascal, F., Zardoya, R. & Posada, D. ProtTest: selection of best-fit models of protein 829 evolution. Bioinformatics 21, 2104-2105, doi:10.1093/bioinformatics/bti263 (2005). 830 76 Whelan, S. & Goldman, N. A general empirical model of protein evolution derived 831 from multiple protein families using a maximum-likelihood approach. Mol Biol Evol 832 18, 691-699 (2001). 833 77 Drummond, A. J., Suchard, M. A., Xie, D. & Rambaut, A. Bayesian phylogenetics 834 with BEAUti and the BEAST 1.7. Mol Biol Evol 29, 1969-1973, 835 doi:10.1093/molbev/mss075 (2012). 836 78 Lisec, J., Schauer, N., Kopka, J., Willmitzer, L. & Fernie, A. R. Gas chromatography 837 mass spectrometry-based metabolite profiling in plants. Nature protocols 1, 387-396, 838 doi:10.1038/nprot.2006.59 (2006). 839 79 Haas, B. J. et al. De novo transcript sequence reconstruction from RNA-seq using the 840 Trinity platform for reference generation and analysis. Nature protocols 8, 1494- 841 1512, doi:10.1038/nprot.2013.084 (2013). 842 80 Pertea, G. et al. TIGR Gene Indices clustering tools (TGICL): a software system for 843 fast clustering of large EST datasets. Bioinformatics 19, 651-652 (2003). 844 81 Smirnoff, N. Ascorbate biosynthesis and function in photoprotection. Philos Trans R 845 Soc Lond B Biol Sci 355, 1455-1464, doi:10.1098/rstb.2000.0706 (2000). 846 82 Loewus, F. A. & Jang, R. The conversion of C14-labeled sugars to L-ascorbic acid in 847 ripening strawberries. II. Labeling patterns in the free sugars. J Biol Chem 232, 505- 848 519 (1958). 849 83 Conklin, P. L. et al. Arabidopsis thaliana VTC4 encodes L-galactose-1-phosphatase, a 850 plant ascorbic acid biosynthetic enzyme. J Biol Chem 281, 15662-15670, 851 doi:10.1074/jbc.M601409200 (2006). 852 84 Isherwood, F. A. & Mapson, L. W. Biological synthesis of ascorbic acid: the 853 conversion of derivatives of D-galacturonic acid into L-ascorbic acid by plant extracts. 854 Biochem J 64, 13-22 (1956). 855 85 Lisko, K. A. et al. Ontogenetic changes in vitamin C in selected rice varieties. Plant 856 Physiol Bioch 66, 41-46, doi:DOI 10.1016/j.plaphy.2013.01.016 (2013). 857 86 Michel, G., Tonon, T., Scornet, D., Cock, J. M. & Kloareg, B. Central and storage 858 carbon metabolism of the brown alga Ectocarpus siliculosus: insights into the origin

28

859 and evolution of storage carbohydrates in Eukaryotes. New Phytol 188, 67-81, 860 doi:10.1111/j.1469-8137.2010.03345.x (2010). 861 87 Schachter, H., Sarney, J., McGuire, E. J. & Roseman, S. Isolation of 862 diphosphopyridine nucleotide-dependent L-fucose dehydrogenase from pork liver. J 863 Biol Chem 244, 4785-4792 (1969). 864 88 Kudryashova, E. V., Leferink, N. G., Slot, I. G. & van Berkel, W. J. Galactonolactone 865 oxidoreductase from Trypanosoma cruzi employs a FAD cofactor for the synthesis of 866 vitamin C. Biochim Biophys Acta 1814, 545-552, doi:10.1016/j.bbapap.2011.03.001 867 (2011). 868 89 Wilkinson, S. R., Prathalingam, S. R., Taylor, M. C., Horn, D. & Kelly, J. M. Vitamin 869 C biosynthesis in trypanosomes: a role for the glycosome. Proc Natl Acad Sci U S A 870 102, 11645-11650, doi:10.1073/pnas.0504251102 (2005). 871 90 Wolucka, B. A. & Communi, D. Mycobacterium tuberculosis possesses a functional 872 enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase. The 873 FEBS journal 273, 4435-4445, doi:10.1111/j.1742-4658.2006.05443.x (2006). 874 91 Telor, E., Huflejt, M. E. & Packer, L. Hydroperoxide Metabolism in Cyanobacteria. 875 Archives of Biochemistry and Biophysics 246, 396-402, doi:Doi 10.1016/0003- 876 9861(86)90485-6 (1986). 877 92 Roe, J. H. Comparative analyses for ascorbic acid by the 2,4-dinitrophenylhydrazine 878 method with the coupling reaction at different temperatures: a procedure for 879 determining specificity. J Biol Chem 236, 1611-1613 (1961). 880 93 Kotabova, E., Kana, R., Jaresova, J. & Prasil, O. Non-photochemical fluorescence 881 quenching in Chromera velia is enabled by fast violaxanthin de-epoxidation. FEBS 882 Lett 585, 1941-1945, doi:10.1016/j.febslet.2011.05.015 (2011). 883 94 Danne, J. C., Gornik, S. G., Macrae, J. I., McConville, M. J. & Waller, R. F. 884 Alveolate mitochondrial metabolic evolution: dinoflagellates force reassessment of 885 the role of parasitism as a driver of change in apicomplexans. Mol Biol Evol 30, 123- 886 139, doi:10.1093/molbev/mss205 (2013). 887 95 Yoon, H. S., Hackett, J. D. & Bhattacharya, D. A genomic and phylogenetic 888 perspective on endosymbiosis and algal origin. Journal of Applied Phycology 18, 475- 889 481, doi:10.1007/s10811-006-9054-6 (2006). 890 96 Johnson, M. D., Oldach, D., Delwiche, C. F. & Stoecker, D. K. Retention of 891 transcriptionally active cryptophyte nuclei by the ciliate Myrionecta rubra. Nature 892 445, 426-428, doi:10.1038/nature05496 (2007). 893 97 Adler, L. N., Gomez, T. A., Clarke, S. G. & Linster, C. L. A novel GDP-D-glucose 894 phosphorylase involved in quality control of the nucleoside diphosphate sugar pool in 895 Caenorhabditis elegans and mammals. J Biol Chem 286, 21511-21523, 896 doi:10.1074/jbc.M111.238774 (2011). 897 98 Chan, C. X. et al. Porphyra (Bangiophyceae) Transcriptomes Provide Insights Into 898 Red Algal Development And Metabolism. Journal of Phycology 48, 1328-1342, 899 doi:DOI 10.1111/j.1529-8817.2012.01229.x (2012). 900 99 Chan, C. X. et al. Red and Green Algal Monophyly and Extensive Gene Sharing 901 Found in a Rich Repertoire of Red Algal Genes. Current Biology 21, 328-333, 902 doi:DOI 10.1016/j.cub.2011.01.037 (2011). 903 100 Milton, K. & Jenness, R. Ascorbic-Acid Content of Neotropical Plant-Parts Available 904 to Wild Monkeys and Bats. Experientia 43, 339-342, doi:Doi 10.1007/Bf01945577 905 (1987). 906 101 Birney, E. C., Jenness, R. & Ayaz, K. M. Inability of bats to synthesise L-ascorbic 907 acid. Nature 260, 626-628 (1976).

29

908 102 Cui, J., Yuan, X., Wang, L., Jones, G. & Zhang, S. Recent loss of vitamin C 909 biosynthesis ability in bats. PLoS One 6, e27114, doi:10.1371/journal.pone.0027114 910 (2011). 911 103 Dabrowski, K. Gulonolactone oxidase is missing in teleost fish. The direct 912 spectrophotometric assay. Biol Chem Hoppe Seyler 371, 207-214 (1990). 913 104 Desjardins, L. M., Castell, J. D. & Kean, J. C. Synthesis of Dehydroascorbic Acid by 914 Subadult Lobsters (Homarus-Americanus). Can J Fish Aquat Sci 42, 370-373, 915 doi:Doi 10.1139/F85-048 (1985). 916 105 Hapette, A. M. & Poulet, S. A. Application of High-Performance Liquid- 917 Chromatography to the Determination of Ascorbic-Acid in Marine Plankton. J Liq 918 Chromatogr 13, 357-370, doi:Doi 10.1080/01483919008049549 (1990). 919 106 Pierre, L. L. Synthesis of ascorbic acid by the normal fatbody of the cockroach, 920 Leucophaea maderae (F.), and by its symbionts. Nature 193, 904-905 (1962).

921

922

923

30

924 Figure Legends

925 Figure 1: Major ascorbate biosynthetic pathways in eukaryotes

926 The scheme depicts the three major ascorbate biosynthetic pathways found in eukaryotes 927 20,23,49. The plant pathway (also known as the Smirnoff-Wheeler or D-mannose/L-galactose

928 pathway) involves no inversion of the carbon chain (i.e. C1 of D-glucose becomes C1 of L- 929 ascorbate), whereas the euglenid and animal pathways involve inversion of the carbon chain 930 in the conversion from uronic acid to aldonolactone (i.e. C1 of D-glucose becomes C6 of L- 931 ascorbate). Our analyses focus on enzymes with a dedicated role in ascorbate biosynthesis 932 (shown in red): GULO – L-GulL oxidase; VTC2 - GDP-L-galactose phosphorylase; VTC4 – 933 L-galactose-1-phosphate phosphatase; L-galDH – L-galactose dehydrogenase; GLDH – L- 934 GalL dehydrogenase. The other enzymes are: PGM - phosphoglucomutase; UGP - UDP-D- 935 glucose pyrophosphorylase; UGDH - UDP-D-glucose dehydrogenase; UGUR - UDP- 936 glucuronidase; GlcUAR - D-glucuronate reductase; SMP30 – regucalcin/lactonase; GAE - 937 UDP-D-glucuronate-4-epimerase; GalUAR - D-galacturonate reductase. Enzyme names are 938 not listed for steps where multiple enzymes may be involved or where specific enzymes have 939 not been identified.

940

941 Figure 2: Coulson plot indicating the taxonomic distribution of the different ascorbate 942 pathways

943 40 eukaryote genomes were analysed for the presence of genes in the ascorbate biosynthetic 944 pathways. The two potential terminal enzymes in the pathway are boxed. GLDH is common 945 to both the 'plant' and 'euglenid' type pathways. A schematic tree depicts the currently 946 accepted phylogenetic relationships between organisms. The predicted route of ascorbate 947 biosynthesis in each organism is shown. Note that 'euglenid' and 'rhodophyte' type pathways 948 cannot currently be distinguished from sequence analysis alone and the predictions are based 949 on biochemical evidence. Asterisk denotes a genome assembly was not available for Euglena 950 gracilis and its transcriptome was analysed (methods). Grey circles in VTC4 represent the 951 presence of a highly similar enzyme, myo-inositol-1-phosphate phosphatase that exhibits L- 952 galactose-1-phosphatase activity. GULO in trypanosomes and yeasts acts to oxidise the 953 alternative substrates L-galactonolactone or D-arabinonolactone respectively. VTC3 is not a 954 biosynthetic enzyme, but represents a dual function Ser/Thr protein kinase/protein

31

955 phosphatase 2C that may play a regulatory role in the plant pathway. Black cross represents a 956 pseudogene encoding a non-functional enzyme. Organisms with sequenced genomes that 957 were found to lack both of the terminal enzymes in the known pathways (GULO and GLDH) 958 are likely to be ascorbate auxotrophs and were not included in the plot. These include Giardia 959 intestinalis, Trichomonas vaginalis, Entamoeba invadens, Plasmodium falciparum and 960 Perkinsus marinus.

961 Figure 2: figure supplement 1: Distribution of GULO and GLDH in the Archaeplastida

962 A schematic tree demonstrating the currently accepted phylogenetic positions of the major 963 lineages in the Archaeplastida 44,95. The presence of either GULO or GLDH in representatives 964 of each lineage is shown. The boxes denote the Viridiplantae (green), Rhodophyta (red) and 965 Glaucophyta.

966 Figure 2: figure supplement 2: Distribution of the different ascorbate pathways

967 The schematic tree summarises the distribution of the two terminal enzymes in ascorbate 968 biosynthesis, along with VTC2, the first committed enzyme in plant pathway. Blue lines 969 indicate photosynthetic lineages derived by the primary endosymbiosis (of a 970 cyanobacterium). Red or green lines indicate lineages that have become photosynthetic 971 following a secondary endosymbiosis event with either a red or a green alga respectively. It 972 should be noted that the timing and origin of many secondary endosymbioses remain unclear, 973 particularly within the SAR supergroup where several non-photosynthetic lineages within the 974 stramenopiles, alveolates and even rhizaria may potentially have lost an ancestral plastid. 975 GULO is found in basally derived lineages of the Archaeplastida, Excavata, Opisthokonta, 976 Amoebozoa and the CCTH group. In contrast, GLDH is found predominately in 977 photosynthetic eukaryotes, although it is also found in non-photosynthetic stramenopiles and 978 rhizaria and also in some choanoflagellates. Lineages where there is biochemical evidence 979 determining inversion or non-inversion of the carbon chain in the conversion from D-glucose 980 to ascorbate are shown.

981

982 Figure 3: Phylogenetic analysis of L-gulonolactone oxidase and L-galactonolactone 983 dehydrogenase

32

984 A maximum likelihood phylogenetic tree demonstrating the relationships between 985 aldonolactone oxidoreductases involved in ascorbate biosynthesis. A multiple sequence 986 alignment of 263 amino acid residues was used with alditol oxidases from the vanillyl alcohol 987 oxidase (VAO) family acting as the outgroup. Photosynthetic organisms are shown in green. 988 There is strong support for a monophyletic origin for GLDH in eukaryotes. Bootstrap values 989 >80% are shown above nodes (100 bootstraps) and Bayesian posterior probabilities >0.95 are 990 shown below (10000000 generations), except for selected key nodes (circled) where all 991 values are displayed.

992 Figure 3: figure supplement 1: Phylogenetic analysis of L-galactonolactone 993 dehydrogenase

994 An unrooted maximum likelihood phylogenetic tree of GLDH. To improve resolution of 995 GLDH phylogeny, an individual phylogenetic analysis was performed using a larger 996 alignment (302 amino acids) with greater taxonomic sampling (151 sequences), although 997 relationships between major taxonomic groups remain poorly resolved. Bootstrap values 998 >70% are shown (100 bootstraps).

999

1000 Figure 4: Biochemical evidence for a modified D-mannose/L-galactose pathway in 1001 rhodophytes

1002 A) Crude extracts of Porphyra umbilicalis thallus demonstrate L-galactose dehydrogenase 1003 activity using 5 mM L-galactose (L-Gal) as a substrate. No activity was demonstrated with 5 1004 mM L-fucose (6-deoxy-L-galactose) as a substrate. The result is representative of three 1005 different enzyme preparations. B) Feeding 10 mM L-Gal to Porphyra thallus for 24 h resulted 1006 in an accumulation of ascorbate (detected as dehydroascorbate - DHA). D-mannose (10 mM) 1007 did not cause an increase in ascorbate in Porphyra, but exogenous D-mannose does not 1008 elevate ascorbate in land plants even though it is an intermediate in ascorbate biosynthesis. 1009 The bar chart shows mean peak areas of selected fragments (± s.d.). n=3. C) Feeding 1010 ascorbate precursors (25 mM) to Galdieria sulphararia from both the plant and animal 1011 pathways results in increased cellular ascorbate (detected as dehydroascorbate using GC-MS) 1012 (± s.d.). The extent of the increase in cellular ascorbate is influenced by the rate of conversion 1013 of the intermediate and the rate of its uptake into the cell. n=3. D) Feeding D-[1-13C]-glucose 1014 (25 mM) to Galdieria sulphararia results in enrichment of 13C in the 316/317 m/z fragment

33

1015 of dehydroascorbate (which includes C1), but not in the 245/246 m/z or 157/158 m/z 1016 fragment (which exclude C1) (± s.d.). In contrast, feeding D-[6-13C]-glucose (25 mM) labels 1017 all fragments, suggesting that they all include C6. In combination, this labelling pattern 1018 indicates plant-like non-inversion of the carbon chain in the conversion of hexoses to 1019 ascorbate. n=3.

1020 Figure 4: figure supplement 1: Positional isotopic labelling of ascorbate biosynthesis

1021 Analysis of ascorbate by GC-MS. Ascorbate is oxidised to dehydroascorbate during the 1022 derivatisation process and representative accurate mass spectra are shown. Analysis of a L-[1- 1023 13C]-ascorbate standard indicates that the m/z 316 fragment of dehydroascorbate contains C1 1024 whilst other fragments (m/z 157 and 245) do not. Dehydroascorbate from G. sulphuraria 1025 extracts exhibits an identical retention time and mass spectra to that of the ascorbate standard.

1026

1027 Figure 5: Coulson Plot showing the distribution of photoprotective ascorbate-dependent 1028 enzymes

1029 Eukaryote genomes were analysed for the presence of enzymes from the plant ascorbate- 1030 glutathione cycle, the xanthophyll cycle and other ascorbate-dependent enzymes. We found 1031 that eukaryotes possess two distinct isoforms of GSH reductase. PeroxiBase was used to 1032 distinguish between the different forms of ascorbate peroxidase 57. Boxes highlight the 1033 terminal enzymes in the biosynthetic pathway and the ascorbate peroxidase family (APX, 1034 APX-R and APX-CCX). MDHAR - monodehydroascorbate reductase; DHAR - 1035 dehydroascorbate reductase; GR-I - glutathione reductase isoform I; GR-II - glutathione 1036 reductase isoform II; APX - ascorbate peroxidase; APX-R - ascorbate peroxidase-related; 1037 APX-CCX - hybrid ascorbate peroxidase/cytochrome c peroxidase; VDE - violaxanthin de- 1038 epoxidase; VDE-like - violaxanthin de-epoxidase like; AO - ascorbate oxidase.

1039

1040 Figure 6: Evolutionary scenarios for GULO and GLDH

1041 The scheme illustrates two most likely evolutionary scenarios responsible for the distribution 1042 of GULO and GLDH in eukaryotes. In the ancient paralogy scenario, an ancient gene 1043 duplication in the last common eukaryote ancestor results in the presence of two functionally 1044 similar genes, GULO and GLDH, followed by differential loss of either gene in each lineage.

34

1045 In the endosymbiotic gene transfer (EGT) scenario, GULO represents the ancestral gene and 1046 GLDH represents a novel gene that arose in a specific lineage. EGT of GLDH (red dashed 1047 arrow) to other photosynthetic lineages (green ovals) enables functional replacement of the 1048 ancestral gene. Note that GULO represents an ancestral gene in both of these evolutionary 1049 scenarios.

1050

1051 Figure 7: A proposed evolutionary model of ascorbate biosynthesis

1052 The scheme illustrates the proposed events in the EGT evolutionary model of eukaryote 1053 ascorbate biosynthesis. In this scenario, ancestral eukaryotes synthesised ascorbate via 1054 GULO. GLDH arose in the Archaeplastida following primary endosymbiosis of a 1055 cyanobacterium, after the divergence of the glaucophyte lineage. GLDH functionally replaced 1056 GULO in the red and green algal lineages, coinciding with the rise of the photoprotective role 1057 of ascorbate. Plastid acquisition via secondary endosymbiosis of either a green or red alga 1058 resulted in endosymbiotic gene transfer of GLDH and replacement of GULO. As these 1059 organisms became the dominant primary producers in many ecosystems, a series of trophic 1060 interactions (dotted lines) resulted in the loss of GULO in non-photosynthetic organisms, 1061 either by providing a ready supply of dietary ascorbate (resulting in ascorbate auxotrophy in 1062 heterotrophic organisms) or through putative horizontal gene transfer of GLDH (e.g. 1063 choanoflagellates). For clarity, not all potential trophic interactions are shown.

1064

1065

35

1066 Table 1: Dietary sources of ascorbate in animal ascorbate auxotrophs

1067 Major sources of dietary ascorbate were identified in known animal auxotrophs. This 1068 information allows us to assess which terminal enzyme contributed to the production of 1069 dietary ascorbate. In nearly all cases the major source of dietary ascorbate is most likely to 1070 have been derived from GLDH. Phylogenetic analyses suggest GULO has been lost on 1071 multiple independent occasions throughout the Chiroptera (bats). Although ancestral bats 1072 may have been primarily insectivores, various sources of dietary ascorbate may have 1073 contributed to GULO loss. The passerine birds that are unable to synthesise ascorbate are 1074 primarily herbivores or insectivores. However, some members of the Lanius genus (shrikes) 1075 feed also on small vertebrates, in addition to insects. Most teleost fish are believed to be 1076 ascorbate auxotrophs due to loss of GULO. As zooplankton (primarily crustacea) are also 1077 ascorbate auxtrophs, phytoplankton are likely to be the ultimate source of dietary ascorbate. 1078 Reports suggest the ability of crustacea to synthesise ascorbate is either absent or very weak, 1079 although the taxonomic sampling and currently available genomic resources are limited. 1080 Most, but not all, phytophagous insects have a dietary requirement for ascorbate, and we did 1081 not find GULO in any insect genomes. Note also that some species of insect (e.g. 1082 cockroaches) may obtain ascorbate from eukaryote endosymbionts, which may allow them to 1083 survive on ascorbate-poor diets.

36

1084 Supplementary File 1: Distribution of GULO and GLDH in opisthokont and 1085 apusomonad genomes

1086 Genomes of the opisthokonts (including animals and fungi) were examined for the presence 1087 of GULO and GLDH. Strikethrough indicates non-functional pseudogenes. The absence of 1088 GULO is well documented in the known ascorbate auxotrophs such as haplorhine primates,

1089 guinea pigs, bats, teleost fish and passerine birds. Some fungi (e.g. ascomycetes) use D-

1090 arabinonolactone oxidase to produce five carbon ascorbate analogue, erythroascorbate. D- 1091 arabinonolactone oxidase has different substrate specificity to GULO, but exhibits a high 1092 degree of sequence similarity and has been classed as GULO in the table.

1093 Supplementary File 2: Identification of GULO and GLDH in marine microbial 1094 eukaryote transcriptomes

1095 Data from the Marine Microbial Eukaryote Transcriptome Sequencing Project (MMETSP, 1096 http://marinemicroeukaryotes.org/) were analysed for the terminal enzymes in ascorbate 1097 biosynthesis. This dataset contains 679 transcriptomes from 320 different species. Sequence 1098 similarity searches used a stringent length cut off to avoid ambiguous results from 1099 incompletely sequenced gene products (minimum length 300 amino acids). Using these 1100 criteria, we identified GULO or GLDH in 165 species. Although the absence of a gene in a 1101 transcriptome cannot be used to infer absence, we found no examples of organisms that 1102 possess both GULO and GLDH, even when a more relaxed length criterion was used 1103 (minimum length 100 amino acids). Note that the underlined GLDH sequences from the 1104 ciliates Myrionecta and Strombidinopsis are 100% identical to sequences recovered from 1105 their prey (respectively Geminigera cryophila and Isochrysis galbana). These sequences may 1106 therefore be due to contamination. Alternatively, as both these ciliates exhibit kleptoplasty, 1107 the presence of algal GLDH sequences in the ciliate transcriptome may also represent 1108 examples of plastid-related nuclear genes that are retained and transcribed to aid plastid 1109 function 96. In the latter scenario, these ciliates could therefore use GLDH to temporarily 1110 synthesise ascorbate during plastid acquisition.

1111 Supplementary File 3: Identification of VTC2 in marine microbial eukaryote 1112 transcriptomes

1113 Data from the Marine Microbial Eukaryote Transcriptome Sequencing Project (MMETSP) 1114 was analysed for VTC2, encoding GDP-L-galactose phosphorylase, the first committed step

37

1115 in land plant ascorbate biosynthesis. Sequence similarity searches used a stringent cut off to 1116 avoid ambiguous results from incompletely sequenced gene products (minimum length 300 1117 amino acids). VTC2 was identified in 37 species, all of which belong to the Chlorophyta. 1118 Genes exhibiting weak similarity to GDP-L-galactose phosphorylase, which may represent 1119 homologues of GDP-D-glucose phosphorylase 97, were not included in these results.

1120 Supplementary File 4: Distribution of ascorbate biosynthetic genes in Archaeplastida 1121 transcriptomes

1122 Rhodophyte transcriptomes from the Marine Microbial Eukaryote Transcriptome Sequencing 1123 Project (MMETSP) or Genbank98,99 were examined for the presence of ascorbate biosynthesis 1124 genes. The rhodophytes transcriptomes all exhibit the pathway found in the genomes of 1125 Cyanidioschyzon merolae, Chondrus crispus and Porphyridium purpureum, possessing 1126 GLDH rather than GULO. Chlorokybus atmophyticus is a green alga belonging to the 1127 Streptophyte lineage containing land plants and charophyte algae. The Chlorokybus 1128 transcriptome appears unique amongst the Viridiplantate in that it contains GULO rather than 1129 GLDH. All of the other enzymes of the plant pathway are present.

1130 Supplementary File 5: Genome resources used in this study

1131 A list of the eukaryote genomes used to study the distribution of genes relating to ascorbate 1132 biosynthesis and metabolism.

38

Animal Primary dietary Ultimate dietary Enzyme for References auxotroph source of ascorbate source of ascorbate ascorbate synthesis Primates Land plants GLDH 100 Guinea pig Land plants GLDH Bats Land plants GLDH 100-102 Insects Land plants GLDH Fish Phytoplankton GLDH Blood GULO Passerine birds Land plants GLDH 16 Insects Land plants GLDH Small vertebrates GULO Teleost fish Zooplankton Phytoplankton GLDH 103 (crustacea) Phytoplankton GLDH Crustacea Phytoplankton GLDH 104,105 Phytophagous Land plants GLDH 36,106 insects 1133

1134 Table 1: Dietary sources of ascorbate in animal auxotrophs

39 Figure 1

Animal Plant Euglena pathway pathway pathway

D-glucose- 6P D-fructose-6P D-glucose-6P 1 6 1 6 1 6

PGM PMI PGM D-glucose- 1P D-mannose-6P D-glucose-1P UTP UTP UGP UGP PMM PPi PPi UDP-D- glucose D-mannose-1P UDP-D-glucose 2 NAD+ GTP 2 NAD+ UGDH VTC1 UGDH 2 NADH PPi 2 NADH UDP-D- glucuronate GDP-D-mannose UDP-D-glucuronate GAE GME GDP-L-galactose UDP-D-galacturonate Pi PPi UGUR VTC2 UDP GDP UTP L-galactose-1P D-galacturonate-1P

VTC4 Pi Pi D-glucuronate L-galactose D-galacturonate + NADPH NAD NADPH L-galDH GlcUAR GalUAR + NADP+ NADH NADP L-gulonate L-galactonate L-galactonate

SMP30 SMP30

L-gulono- lactone L-galactono-lactone L-galactono- lactone

O2 cyt c ox cytc ox GULO GLDH GLDH HO22 cyt c red cytc red L-ascorbate L-ascorbate L-ascorbate 1 6 1 6 1 6 Figure 2 Plant Animal pathway pathway

3 E C a D predicted plastid VTC3 GM VT 2 VTC4 L-g lDHGL H GULO SMP 0 pathway Archaeplastida Arabidopsis thaliana Oryza sativa streptophyte Zea mays Selaginella moellendorffii Physcomitrella patens chlorophyceae Chlamydomonas reinhardtii Volvox carteri trebouxiophyte Chlorella variabilis Ostreococcus tauri prasinophyte Ostreococcus lucimarinus Micromonas RCC 299 florideophyceae Chondrus crispus porphyridiophyceaePorphyridium purpureum Cyanidioschyzon merolae cyanidiophyceae Galdieria sulphuraria Galdieria phlegrea glaucophyte Cyanophora paradoxa SAR oomycete Phytophthora sojae Thalassiosira pseudonana diatom Phaeodactylum tricornutum Fragilariopsis cylindrus brown algae Ectocarpus siliculosus Paramecium tetraurelia ciliate Tetrahymena thermophila chlorarachniophyte Bigelowiella natans foraminifera Reticulomyxa filosa CCTH haptophyte Emiliania huxleyi cryptophyte Guillardia theta Excavata Trypanosoma brucei euglenozoa Euglena gracilis* heterolobosea Naegleria gruberi Amboebozoa mycetozoa Dictyostelium discoideum acanthopodina Acanthamoeba castellanii Opisthokonta Homo sapiens Mus musculus metazoa Drosophila melanogaster Trichoplax adhaerens Monosiga brevicollis choanoflagellates Salpingoeca rosetta filasterea Capsaspora owczarzaki fungi Saccharomyces cerevisiae Gonapodya prolifera apusozoa Thecamonas trahens

animal euglenid plant rhodophyte Figure 3

100 Zea mays GRMZM2G469969_P01 1.00 99 Oryza sativa LOC_Os12g04520.1 1.00 Arabidopsis thaliana AT3G47930.1 -- 0.99 Physcomitrella patens Phpat.014G081200.1.p Selaginella moellendorffii 98882

100 Gonapodya prolifera 134127 1.00 Gonapodya prolifera 293868 Cyanidioschyzon merolae CMD093C Chondrus crispus CDF40225.1 Chlorella variabilis 28225

90 Monosiga brevicollis XP 001748157.1 1.00 GLDH Salpingoeca sp. EGD82570.1 L-galactonolactone Emiliania huxleyi 70809 dehydrogenase Volvox carteri Vocar20014064m Ectocarpus siliculosus CBJ29466.1

-- Ostreococcus tauri 16741 1.00 Micromonas sp. RCC299 58063 Thalassiosira pseudonana XP 002289008.1 91 1.00 91 Phaeodactylum tricornutum XP 002184261.1 1.00 Fragilariopsis cylindrus 183441 Bigelowiella natans 34824

100 Phytophthora sojae 112240 1.00 Euglena gracilis AB914478 Reticulomyxa filosa ETO19508.1

100 Trypanosoma brucei XP 844937 1.00 Trypanosome 82 100 Trypanosoma cruzi XP 816445 L-galactonolactone 0.85 1.00 oxidase Leishmania donovani XP 003860002.1 84 1.00 Pichia angusta EFW97597.1 100 Candida albicans XP 719313.1 1.00 Ascomycete 100 Saccharomyces cerevisiae YML086C D-arabinonolactone 1.00 oxidase 85 100 Aspergillus terreus XP 001210939.1 1.00 1.00 Trichoderma reesei EGR45951.1 Cyanophora paradoxa Contig8391

100 Galdieria sulphuraria EME30498.1 1.00 Galdieria phlegrea 148.g396.t1 Naegleria gruberi XP 002681771.1 GULO Acanthamoeba castellanii XP 004336118.1 L-gulonolactone

100 Cryptococcus neoformans XP 568647.1 oxidase group 1.00 Agaricus bisporus EKV43644.1

100 Mucor circinelloides EPB90180.1 1.00 Rhizopus microsporus 267357 Capsaspora owczarzaki XP 004346410.1

100 Mus musculus NP 848862.1 1.00 -- Rousettus leschenaultii ADP88813.1 1.00 Ciona intestinalis XP 002122023.1 Trichoplax adhaerens XP 002108035.1 Physcomitrella patens XP 001767708.1 100 Plant 1.00 100 Arabidopsis thaliana NP 564393.1 L-gulonolactone 1.00 Oryza sativa NP 001050492.1 oxidase-like 100 1.00 Gluconolactone oxidase VAO Bigelowiella natans 130886

99 Paenibacillus sp. HGF5 WP 009591143.1 1.00 100 Solitalea canadensis YP 006255631.1 Bacterial 1.00 L-gulonolactone 83 Rhodococcus erythropolis YP 002767554.1 dehydrogenase 1.00 Mycobacterium tuberculosis O06804 100 Alditol oxidase VAO 1.00

0.2 Figure 4

A B 2 5000 x10 ) 0.010 L-galactose

L-fucose area 4000

control (peak 3000

0.005 2000 Absorbance

1000 Dehydroascorbate 0.000 0 0 4000 -Gal time (s) -Glc -Man L D D Control C D 2

10 ) 10000

x m/z 157 16 C1 of Asc

area 8000 absent m/z 245 std) 12 (peak 6000 C1 of Asc Asc m/z 316 present to 8 4000 enrichment

C 13 relative 4 2000 (% Dehydroascorbate 0 0

13 13

-Gal D-[1- C]-Glc D-[6- C]-Glc D-Glc L -GulL -GalL L L Control Figure 5

H AR AR X X- PX-R D GLD GULO MDH DH GR-I GR-II AP A AP CCX VE VDE-like AO Archaeplastida Arabidopsis thaliana Oryza sativa streptophyte Zea mays Selaginella moellendorffii Physcomitrella patens chlorophyte Chlamydomonas reinhardtii Volvox carteri trebouxiophyte Chlorella variabilis Ostreococcus tauri prasinophyte Ostreococcus lucimarinus Micromonas RCC 299 Chondrus crispus rhodophyte Cyanidioschyzon merolae Galdieria sulphuraria glaucophyte Cyanophora paradoxa SAR oomycete Phytopthora sojae Thalassiosira pseudonana diatom Phaeodactylum tricornutum Fragilariopsis cylindrus brown algae Ectocarpus siliculosus ciliate Paramecium tetraurelia chlorarachniophyte Bigelowiella natans CCTH haptophyte Emiliania huxleyi cryptophyte Guillardia theta Excavata Trypanosoma brucei Euglena gracilis* Naegleria gruberi Amboebozoa Dictyostelium discoideum Acanthamoeba castellanii Opisthokonta Homo sapiens metazoa Mus musculus Drosophila melanogaster Trichoplax adhaerens choanoflagellates Monosiga brevicolis Salpingoeca rosetta filasterea Capsaspora owczarzaki Saccharomyces cerevisae fungi Gonapodya prolifera Figure 6

Ancient paralogy

GLDH GULO GLDH GLDH GULO GLDH GULO GLDH GLDH GULO GLDH GULO GLDH GLDH GULO GULO GLDH GULO

GLDH GULO

Endosymbiotic gene transfer

GLDH GULO GLDH GLDH GULO GLDH GULO GLDH GLDH GULO GULO

GULO GULO GULO

GLDH GULO Figure 7

eukaryote ancestor glaucophytes 1° endosymbiosis

GULO ascorbate for GULO photoprotection GLDH

GULO GULO VTC2

non-photosynthetic land plants, red algae eukaryotes green algae

VTC2

GULO GLDH GLDH

2° endosymbiosis

dietary GLDH horizontal GLDH endosymbiotic ascorbate gene transfer GULO gene transfer? GULO

e.g. choano- e.g. diatoms, e.g. primates flagellates Euglena

GULO GLDH GLDH