DOCSLIB.ORG

Atlas Journal

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Atlas Journal Atlas of Genetics and Cytogenetics in Oncology and Haematology Home Genes Leukemias Solid Tumours Cancer-Prone Deep Insight Portal Teaching X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA Atlas Journal Atlas Journal versus Atlas Database: the accumulation of the issues of the Journal constitutes the body of the Database/Text-Book. TABLE OF CONTENTS Volume 2, Number 2, Apr-Jun 1998 Previous Issue / Next Issue Genes FGFR1 (Fibroblast Growth Factor Receptor 1) (8p12). Jean-Loup Huret. Atlas Genet Cytogenet Oncol Haematol 1998; 2 (2): 117-125. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/FGFR1113.html LCP1 (lymphocyte cytosolic protein1) (13q14). Sylvie Galiègue-Zouitina. Atlas Genet Cytogenet Oncol Haematol 1998; 2 (2): 126-130. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/LCP1ID95.html MTCP1 (Mature T Cell Proliferation 1) (Xq28). Marc-Henri Stern. Atlas Genet Cytogenet Oncol Haematol 1998; 2 (2): 131-136. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/MTCP1ID89.html NF2 (neurofibromatosis type 2) (22q12.1-12.2) - updated. Jean-Loup Huret. Atlas Genet Cytogenet Oncol Haematol 1998; 2 (2): 137-143. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/NF2117.html MYCN (myc myelocytomatosis viral related oncogene, neuroblastoma derived) (2p24.1). Jean-Loup Huret. Atlas Genet Cytogenet Oncol Haematol 1998; 2 (2): 144-148. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/NMYC112.html POU2AF1 (POU domain, class 2, associating factor 1) (11q23.1). Sylvie Galiègue-Zouitina. Atlas Genet Cytogenet Oncol Haematol 1998; 2 (2): 149-153. [Full Text] [PDF] Atlas Genet Cytogenet Oncol Haematol 1998; 2 (2) I URL : http://AtlasGeneticsOncology.org/Genes/OBF94.html ABCB1 (7q21.2). Franck Viguié. Atlas Genet Cytogenet Oncol Haematol 1998; 2 (2): 154-160. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/PGY1ID105.html TAL1 (T-cell acute leukemia 1) (1p32) - updated. Jean-Loup Huret, Marie Claude Labastie. Atlas Genet Cytogenet Oncol Haematol 1998; 2 (2): 161-165. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/TAL1.html TCL1A (T-cell leukemia/lymphoma 1A) (14q32.1). Marc-Henri Stern. Atlas Genet Cytogenet Oncol Haematol 1998; 2 (2): 166-170. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/TCL1ID66.html TCTA (T-cell leukemia translocation-associated gene) (3p21) - updated. Jean-Loup Huret. Atlas Genet Cytogenet Oncol Haematol 1998; 2 (2): 171-174. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/TCTA.html FIM (fused in myeloproliferative disorders) (13q12). Jean-Loup Huret, Dominique Leroux. Atlas Genet Cytogenet Oncol Haematol 1998; 2 (2): 175-180. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/ZNF198ID114.html Leukaemias t(9;12)(p24;p13). Jean-Loup Huret. Atlas Genet Cytogenet Oncol Haematol 1998; 2 (2): 181-182. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Anomalies/1122t0912.html del(9q) solely. Franck Viguié. Atlas Genet Cytogenet Oncol Haematol 1998; 2 (2): 183-187. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Anomalies/del9q.html Essential thrombocythemia; Idiopathic thrombocythemia - updated. Jean-Loup Huret. Atlas Genet Cytogenet Oncol Haematol 1998; 2 (2): 188-189. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Anomalies/ET.html Acute basophilic leukemia; t(X;6)(p11;q23). Nicole Dastugue. Atlas Genet Cytogenet Oncol Haematol 1998; 2 (2): 190-191. [Full Text] [PDF] Atlas Genet Cytogenet Oncol Haematol 1998; 2 (2) II URL : http://AtlasGeneticsOncology.org/Anomalies/LAbaso1124.html t(5;14)(q33;q32) PDGFRB/TRIP11. Jean-Loup Huret. Atlas Genet Cytogenet Oncol Haematol 1998; 2 (2): 192-193. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Anomalies/t0514ANL.html t(11;16)(q23;p13). Jean-Loup Huret. Atlas Genet Cytogenet Oncol Haematol 1998; 2 (2): 194-196. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Anomalies/t1116.html t(16;21)(p11;q22). Christine Pérot. Atlas Genet Cytogenet Oncol Haematol 1998; 2 (2): 197-203. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Anomalies/t1621.html Solid Tumours Nervous system tumors: Neuroblastoma. Jérome Couturier, Daniel Satgé. Atlas Genet Cytogenet Oncol Haematol 1998; 2 (2): 204-208. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Tumors/neurob5002.html t(16;21)(p11;q22) in Ewing's tumours. Christine Pérot. Atlas Genet Cytogenet Oncol Haematol 1998; 2 (2): 209-214. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Tumors/t1621p11q22EwingID5329.html Cancer Prone Diseases Bannayan-Riley-Ruvalcaba syndrome. Jean-Loup Huret. Atlas Genet Cytogenet Oncol Haematol 1998; 2 (2): 215-218. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Kprones/BannayanID10044.html Bloom syndrome. Jean-Loup Huret. Atlas Genet Cytogenet Oncol Haematol 1998; 2 (2): 219-228. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Kprones/BLO10002.html Dubowitz syndrome. Jean-Loup Huret, Claude Léonard. Atlas Genet Cytogenet Oncol Haematol 1998; 2 (2): 229-230. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Kprones/DUB10016.html Fanconi anaemia. Atlas Genet Cytogenet Oncol Haematol 1998; 2 (2) III Jean-Loup Huret. Atlas Genet Cytogenet Oncol Haematol 1998; 2 (2): 231-237. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Kprones/FA10001.html Deep Insights Case Reports Educational Items © Atlas of Genetics and Cytogenetics in Oncology and Haematology X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA Home Genes Leukemias Solid Tumours Cancer-Prone Deep Insight Portal Teaching For comments and suggestions or contributions, please contact us [email protected]. Atlas Genet Cytogenet Oncol Haematol 1998; 2 (2) IV Atlas of Genetics and Cytogenetics in Oncology and Haematology FGFR1 (Fibroblast Growth Factor Receptor 1) (updated: old version not available) Identity Other BFGFR (basic fibroblast growth factor receptor) names FLT2 (FMS-like tyrosine kinase 2) FLG (FMS-like gene) CEK FGFBR N-SAM Hugo FGFR1 Location 8p12 FGFR1 (8p12) - Courtesy Mariano Rocchi, Resources for Molecular Cytogenetics. Laboratories willing to validate the probes are welcome : contact [email protected] DNA/RNA Transcription 2.7 mRNA Protein Atlas Genet Cytogenet Oncol Haematol 1998; 2 (2) - 117 - Protein Diagram Description 822 amino acids; 100-135 kDa glycoprotein from a 90-115 kDa protein core; tyrosine kinase receptor; contains four major domains: an extracellular domain with 2 or 3 Ig-like loops, a transmembrane domain and an intracellular domain , a juxtamembrane domain, and an intracellular domain composed of the tyrosine kinase domain (two kinase domains interrupted by a short kinase insert), and a C-terminal tail. Localisation plasma membrane Function FGF receptor with tyrosine kinase activity; binding of ligand (FGF)) in association with heparan sulfate proteoglycans induces receptor dimerization, autophosphorylation and signal transduction Homology with other FGFR (FGFR2, FGFR3, and FGFR4) Implicated in Entity stem-cell myeloproliferative disorder associated with chromosomal translocations involving 8p12; to date, seven FGFR1 partners have been described (see below) Disease stem-cell myeloproliferative disorder characterized by T- or B-cell lymphoblastic leukemia/lymphoma, myeloid hyperplasia, and peripheral blood eosinophilia, and it generally progresses to acute myeloid leukemia; specific to the 8p12 chromosomal region Prognosis very poor (median survival: 12 mths) Atlas Genet Cytogenet Oncol Haematol 1998; 2 (2) - 118 - Cytogenetics the 7 translocations are: t(6;8)(q27; p12) involving FOP (FGFR1 Oncogene Partner) t(8;9)(p12;q33) involving CEP110 (Centrosome protein 110) t(8;11)(p12;p15) t(8;12)(p12;q15) t(8;13)(p12;q12 ) involving FIM (Fused In Myeloproliferative disorder also called ZNF198 or RAMP) t(8;17)(p12;q25) t(8;19)(p12;q13.3) additional anomalies: in the t(8;9)(p12;q33): +der(9), +21; in the t(8;13)(p12;q12): +8, +der(13), +21 Hybrid/Mutated 5' FOP - 3' FGFR1 in the t(6;8) Gene 5'CEP110 - FGFR1 in the t(8;9) 5' FIM/ZNF198 - 3' FGFR1 in the t(8;13) Abnormal three fusion transcripts are identified: FOP-FGFR1, CEP110-FGFR1, and Protein FIM-FGFR1; they encode large proteins containing the N-term of either FOP or CEP110, or FIM, and the catalytic domain of FGFR1 at their C- term: N-term leucine-rich region from FOP fused to the catalytic domain of FGFR1 N-term leucine zipper motifs from CEP110 fused to the catalytic domain of FGFR1 N-term zinc fingers from FIM fused to the Tyrosine kinase domain of FGFR1in C-term Oncogenesis constitutive activation of FGFR1 Entity Pfeiffer syndrome (inborn disease) Disease one form of Pfeiffer syndrome, an autosomal dominant craniosynostosis Atlas Genet Cytogenet Oncol Haematol 1998; 2 (2) - 119 - syndrome with broad thumbs and usually no mental deficiency, is due to a mutation in amino acid 252 (Pro252Arg substitution) of FGFR1 Entity Breast cancer Disease gene amplification and overexpression in sporadic breast tumors Breakpoints External links Nomenclature Hugo FGFR1 GDB FGFR1 FGFR1 2260 fibroblast growth factor receptor 1 (fms-related tyrosine Entrez_Gene kinase 2, Pfeiffer syndrome) Cards Atlas FGFR1113 GeneCards FGFR1 Ensembl FGFR1 CancerGene FGFR1 Genatlas FGFR1 GeneLynx FGFR1 eGenome FGFR1 euGene 2260 Atlas Genet Cytogenet Oncol Haematol 1998; 2 (2) - 120 - Genomic and cartography GoldenPath FGFR1 - 8p12 chr8:38389449-38445293 - 8p12 (hg17-May_2004) Ensembl FGFR1 - 8p12 [CytoView] NCBI Genes Cyto Gene
Load more

Recommended publications
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name mature T-cell proliferation 1 Gene Symbol MTCP1 Organism Human Gene Summary This gene was identified by involvement in some t(X;14) translocations associated with mature T-cell proliferations. This region has a complex gene structure with a common promoter and 5' exon spliced to two different sets of 3' exons that encode two different proteins. This gene represents the upstream 13 kDa protein that is a member of the TCL1 family. This protein may be involved in leukemogenesis. Gene Aliases P13MTCP1, p8MTCP1 RefSeq Accession No. NC_000023.10, NG_005114.1, NT_167198.1 UniGene ID Not Available Ensembl Gene ID ENSG00000214827 Entrez Gene ID 4515 Assay Information Unique Assay ID qHsaCED0048630 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000369476, ENST00000362018, ENST00000596212, ENST00000597096 Amplicon Context Sequence TCCCCTGACCATTAAATGATGCTGTATCTGCCACAAGCGAGAGTTGTTATCCATG TAGCGCTCCTCCGGGTAGAGTTGCCACATGAGAGGTAGCTGGGAGGT Amplicon Length (bp) 72 Chromosome Location X:154293804-154293986 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 106 R2 0.9994 cDNA Cq 24.34 cDNA Tm (Celsius) 82 gDNA Cq 25.37 Page 1/5 PrimePCR™Assay Validation Report Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report MTCP1, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard
    [Show full text]
  • Mechanical Forces Induce an Asthma Gene Signature in Healthy Airway Epithelial Cells Ayşe Kılıç1,10, Asher Ameli1,2,10, Jin-Ah Park3,10, Alvin T
    www.nature.com/scientificreports OPEN Mechanical forces induce an asthma gene signature in healthy airway epithelial cells Ayşe Kılıç1,10, Asher Ameli1,2,10, Jin-Ah Park3,10, Alvin T. Kho4, Kelan Tantisira1, Marc Santolini 1,5, Feixiong Cheng6,7,8, Jennifer A. Mitchel3, Maureen McGill3, Michael J. O’Sullivan3, Margherita De Marzio1,3, Amitabh Sharma1, Scott H. Randell9, Jefrey M. Drazen3, Jefrey J. Fredberg3 & Scott T. Weiss1,3* Bronchospasm compresses the bronchial epithelium, and this compressive stress has been implicated in asthma pathogenesis. However, the molecular mechanisms by which this compressive stress alters pathways relevant to disease are not well understood. Using air-liquid interface cultures of primary human bronchial epithelial cells derived from non-asthmatic donors and asthmatic donors, we applied a compressive stress and then used a network approach to map resulting changes in the molecular interactome. In cells from non-asthmatic donors, compression by itself was sufcient to induce infammatory, late repair, and fbrotic pathways. Remarkably, this molecular profle of non-asthmatic cells after compression recapitulated the profle of asthmatic cells before compression. Together, these results show that even in the absence of any infammatory stimulus, mechanical compression alone is sufcient to induce an asthma-like molecular signature. Bronchial epithelial cells (BECs) form a physical barrier that protects pulmonary airways from inhaled irritants and invading pathogens1,2. Moreover, environmental stimuli such as allergens, pollutants and viruses can induce constriction of the airways3 and thereby expose the bronchial epithelium to compressive mechanical stress. In BECs, this compressive stress induces structural, biophysical, as well as molecular changes4,5, that interact with nearby mesenchyme6 to cause epithelial layer unjamming1, shedding of soluble factors, production of matrix proteins, and activation matrix modifying enzymes, which then act to coordinate infammatory and remodeling processes4,7–10.
    [Show full text]
  • Structural Studies of the Complex Between Akt-In and the Akt2-PH Domain Suggest That the Peptide Acts As an Allosteric Inhibitor of the Akt Kinase
    The Open Spectroscopy Journal, 2009, 3, 65-76 65 Open Access Structural Studies of the Complex Between Akt-in and the Akt2-PH Domain Suggest that the Peptide Acts as an Allosteric Inhibitor of the Akt Kinase Virginie Ropars1,2,3, Philippe Barthe1,2,3, Chi-Shien Wang4, Wenlung Chen4, Der-Lii M. Tzou4,5, Anne Descours6, Loïc Martin6, Masayuki Noguchi7, Daniel Auguin1,2,3,,¶ and Christian Roumestand*,1,2,3 1CNRS UMR 5048, Centre de Biochimie Structurale, Montpellier, France 2INSERM U554, Montpellier, France 3Université Montpellier I et II, Montpellier, France 4Department of Applied Chemistry, National Chiayi University, Chiayi 60004, Taiwan, ROC 5Institute of Chemistry, Academia Sinica, Nankang, Taipei 11529, Taiwan, ROC 6CEA, iBiTecs, Service d’Ingénierie Moléculaire des Protéines, 91191 Gif sur Yvette, France 7Division of Cancer Biology, Institute for Genetic Medicine, Hokkaido University, N15 W7, Kita-ku, Sapporo 060-0815, Japan Abstract: Serine/threonine kinase Akt plays a central role in the regulation of cell survival and proliferation. Hence, the search for Akt specific inhibitors constitutes an attractive strategy for anticancer therapy. We have previously demonstrated that the proto-oncogene TCL1 coactivates Akt upon binding to its Plekstrin Homology Domain, and we proposed a model for the structure of the complex TCL1:Akt2-PHD. This model led to the rational design of Akt-in, a peptide inhibitor spanning the A ß-strand of human TCL1 that binds Akt2 PH domain and inhibits the kinase activation. In the present report, we used NMR spectroscopy to determine the 3D structure of the peptide free in solution and bound to Akt2-PHD.
    [Show full text]
  • Leukaemia Section
    Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL INIST-CNRS Leukaemia Section Short Communication t(7;14)(q35;q32.1) TRB/TCL1A inv(14)(q11q32.1) TRA-TRD/TCL1A t(14;14)(q11;q32.1) TRA-TRD/TCL1A Tatiana Gindina Raisa Gorbacheva Memorial Institute of Children's Oncology, Hematology and Transplantation at First Pavlov St. Petersburg State Medical University, Saint-Petersburg, Russia Published in Atlas Database: June 2018 Online updated version : http://AtlasGeneticsOncology.org/Anomalies/inv14ID2049.html Printable original version : http://documents.irevues.inist.fr/bitstream/handle/2042/70184/06-2018-inv14ID2049.pdf DOI: 10.4267/2042/70184 This article is an update of : Boyer J. t(7;14)(q35;q32.1) TRB@/TCL1A. Atlas Genet Cytogenet Oncol Haematol 2001;5(3) This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2019 Atlas of Genetics and Cytogenetics in Oncology and Haematology TRD; B lymphoblastic leukaemia/lymphoma; T Abstract lymphoblastic leukaemia/lymphoma; Adult T-cell Review on t(7;14)(q35;q32), inv(14)(q11q32) and leukemia/lymphoma; T-cell prolymphocytic t(14;14)(q11;q32), with data on clinics, and the leukemia; Angioimmunoblastic T-cell lymphoma; genes involved. Chronic lymphocytic leukemia; syndrome; Mycosis Keywords fungoides; Hepatosplenic T-cell lymphoma; Acute Chromosome 7; Chromosome 14; TCL1A; TRA; myeloid leukaemia; Ataxia telangiectasia. Left: inv(14)(q11q32)and i(8q), G- banding - Courtesy Jean Luc Lai; right: inv(14)(q11q32) and t(14)(14) with i(7q), G- banding - Courtesy Tatiana Gindina. Atlas Genet Cytogenet Oncol Haematol. 2019; 23(4) 90 t(7;14)(q35;q32.1) TRB/TCL1A Gindina T inv(14)(q11q32.1) TRA-TRD/TCL1A t(14;14)(q11;q32.1) TRA-TRD/TCL1A Cytogenetics Clinics and pathology Chromosomal abnormalities are detected in most T- Disease PLL after culture with mitogens like PHA.
    [Show full text]
  • S41467-020-18249-3.Pdf
    ARTICLE https://doi.org/10.1038/s41467-020-18249-3 OPEN Pharmacologically reversible zonation-dependent endothelial cell transcriptomic changes with neurodegenerative disease associations in the aged brain Lei Zhao1,2,17, Zhongqi Li 1,2,17, Joaquim S. L. Vong2,3,17, Xinyi Chen1,2, Hei-Ming Lai1,2,4,5,6, Leo Y. C. Yan1,2, Junzhe Huang1,2, Samuel K. H. Sy1,2,7, Xiaoyu Tian 8, Yu Huang 8, Ho Yin Edwin Chan5,9, Hon-Cheong So6,8, ✉ ✉ Wai-Lung Ng 10, Yamei Tang11, Wei-Jye Lin12,13, Vincent C. T. Mok1,5,6,14,15 &HoKo 1,2,4,5,6,8,14,16 1234567890():,; The molecular signatures of cells in the brain have been revealed in unprecedented detail, yet the ageing-associated genome-wide expression changes that may contribute to neurovas- cular dysfunction in neurodegenerative diseases remain elusive. Here, we report zonation- dependent transcriptomic changes in aged mouse brain endothelial cells (ECs), which pro- minently implicate altered immune/cytokine signaling in ECs of all vascular segments, and functional changes impacting the blood–brain barrier (BBB) and glucose/energy metabolism especially in capillary ECs (capECs). An overrepresentation of Alzheimer disease (AD) GWAS genes is evident among the human orthologs of the differentially expressed genes of aged capECs, while comparative analysis revealed a subset of concordantly downregulated, functionally important genes in human AD brains. Treatment with exenatide, a glucagon-like peptide-1 receptor agonist, strongly reverses aged mouse brain EC transcriptomic changes and BBB leakage, with associated attenuation of microglial priming. We thus revealed tran- scriptomic alterations underlying brain EC ageing that are complex yet pharmacologically reversible.
    [Show full text]
  • Association of Gene Ontology Categories with Decay Rate for Hepg2 Experiments These Tables Show Details for All Gene Ontology Categories
    Supplementary Table 1: Association of Gene Ontology Categories with Decay Rate for HepG2 Experiments These tables show details for all Gene Ontology categories. Inferences for manual classification scheme shown at the bottom. Those categories used in Figure 1A are highlighted in bold. Standard Deviations are shown in parentheses. P-values less than 1E-20 are indicated with a "0". Rate r (hour^-1) Half-life < 2hr. Decay % GO Number Category Name Probe Sets Group Non-Group Distribution p-value In-Group Non-Group Representation p-value GO:0006350 transcription 1523 0.221 (0.009) 0.127 (0.002) FASTER 0 13.1 (0.4) 4.5 (0.1) OVER 0 GO:0006351 transcription, DNA-dependent 1498 0.220 (0.009) 0.127 (0.002) FASTER 0 13.0 (0.4) 4.5 (0.1) OVER 0 GO:0006355 regulation of transcription, DNA-dependent 1163 0.230 (0.011) 0.128 (0.002) FASTER 5.00E-21 14.2 (0.5) 4.6 (0.1) OVER 0 GO:0006366 transcription from Pol II promoter 845 0.225 (0.012) 0.130 (0.002) FASTER 1.88E-14 13.0 (0.5) 4.8 (0.1) OVER 0 GO:0006139 nucleobase, nucleoside, nucleotide and nucleic acid metabolism3004 0.173 (0.006) 0.127 (0.002) FASTER 1.28E-12 8.4 (0.2) 4.5 (0.1) OVER 0 GO:0006357 regulation of transcription from Pol II promoter 487 0.231 (0.016) 0.132 (0.002) FASTER 6.05E-10 13.5 (0.6) 4.9 (0.1) OVER 0 GO:0008283 cell proliferation 625 0.189 (0.014) 0.132 (0.002) FASTER 1.95E-05 10.1 (0.6) 5.0 (0.1) OVER 1.50E-20 GO:0006513 monoubiquitination 36 0.305 (0.049) 0.134 (0.002) FASTER 2.69E-04 25.4 (4.4) 5.1 (0.1) OVER 2.04E-06 GO:0007050 cell cycle arrest 57 0.311 (0.054) 0.133 (0.002)
    [Show full text]
  • Role of RUNX1 in Aberrant Retinal Angiogenesis Jonathan D
    Page 1 of 25 Diabetes Identification of RUNX1 as a mediator of aberrant retinal angiogenesis Short Title: Role of RUNX1 in aberrant retinal angiogenesis Jonathan D. Lam,†1 Daniel J. Oh,†1 Lindsay L. Wong,1 Dhanesh Amarnani,1 Cindy Park- Windhol,1 Angie V. Sanchez,1 Jonathan Cardona-Velez,1,2 Declan McGuone,3 Anat O. Stemmer- Rachamimov,3 Dean Eliott,4 Diane R. Bielenberg,5 Tave van Zyl,4 Lishuang Shen,1 Xiaowu Gai,6 Patricia A. D’Amore*,1,7 Leo A. Kim*,1,4 Joseph F. Arboleda-Velasquez*1 Author affiliations: 1Schepens Eye Research Institute/Massachusetts Eye and Ear, Department of Ophthalmology, Harvard Medical School, 20 Staniford St., Boston, MA 02114 2Universidad Pontificia Bolivariana, Medellin, Colombia, #68- a, Cq. 1 #68305, Medellín, Antioquia, Colombia 3C.S. Kubik Laboratory for Neuropathology, Massachusetts General Hospital, 55 Fruit St., Boston, MA 02114 4Retina Service, Massachusetts Eye and Ear Infirmary, Department of Ophthalmology, Harvard Medical School, 243 Charles St., Boston, MA 02114 5Vascular Biology Program, Boston Children’s Hospital, Department of Surgery, Harvard Medical School, 300 Longwood Ave., Boston, MA 02115 6Center for Personalized Medicine, Children’s Hospital Los Angeles, Los Angeles, 4650 Sunset Blvd, Los Angeles, CA 90027, USA 7Department of Pathology, Harvard Medical School, 25 Shattuck St., Boston, MA 02115 Corresponding authors: Joseph F. Arboleda-Velasquez: [email protected] Ph: (617) 912-2517 Leo Kim: [email protected] Ph: (617) 912-2562 Patricia D’Amore: [email protected] Ph: (617) 912-2559 Fax: (617) 912-0128 20 Staniford St. Boston MA, 02114 † These authors contributed equally to this manuscript Word Count: 1905 Tables and Figures: 4 Diabetes Publish Ahead of Print, published online April 11, 2017 Diabetes Page 2 of 25 Abstract Proliferative diabetic retinopathy (PDR) is a common cause of blindness in the developed world’s working adult population, and affects those with type 1 and type 2 diabetes mellitus.
    [Show full text]
  • TCL1A Expression Delineates Biological and Clinical Variability in B-Cell Lymphoma
    Modern Pathology (2009) 22, 206–215 & 2009 USCAP, Inc All rights reserved 0893-3952/09 $32.00 www.modernpathology.org TCL1A expression delineates biological and clinical variability in B-cell lymphoma Mohit Aggarwal1,4, Raquel Villuendas1, Gonzalo Gomez2, Socorro M Rodriguez-Pinilla1, Margarita Sanchez-Beato1, David Alvarez1, Nerea Martinez1, Antonia Rodriguez1, Maria E Castillo1, Francisca I Camacho1, Santiago Montes-Moreno1, Jose A Garcia-Marco3, Eva Kimby4, David G Pisano2 and Miguel A Piris1 1Molecular Pathology Programme, Spanish National Cancer Research Centre (CNIO), Madrid, Spain; 2Bioinformatics Unit, Structural Biology and Biocomputing Programme, CNIO, Madrid, Spain; 3Department of Haematology, Hospital Universitario Puerta de Hierro, Madrid, Spain and 4Division of Hematology, Department of Internal Medicine at Huddinge, Karolinska Institutet, Stockholm, Sweden The assembly of a collection of gene-expression signatures of the major types of B-cell non-Hodgkin’s lymphoma has identified increased T-cell leukemia/lymphoma 1A (TCL1) expression in multiple lymphoma types and cases, and has enabled the investigation of the functional and clinical importance of TCL1 expression. Specifically, Burkitt’s lymphoma cases show a homogeneously strong expression of TCL1, whereas diffuse large B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, chronic lymphocytic leukemia, nodal marginal zone lymphoma, and splenic marginal zone lymphoma display a striking variability in the intensity of TCL1 staining. This was validated in two independent series. A Gene-Set Enrichment Analysis of the genes correlated with TCL1A expression found that variation in the level of expression of TCL1A was significantly associated with some of the most important gene signatures recognizing B-cell lymphoma pathogenesis and heterogeneity, such as germinal center, B-cell receptor, NF-jB (and its target genes), death, MAP kinases, TNFR1, TOLL, and IL1R.
    [Show full text]
  • Supplementary Data
    Supplementary Fig. 1 A B Responder_Xenograft_ Responder_Xenograft_ NON- NON- Lu7336, Vehicle vs Lu7466, Vehicle vs Responder_Xenograft_ Responder_Xenograft_ Sagopilone, Welch- Sagopilone, Welch- Lu7187, Vehicle vs Lu7406, Vehicle vs Test: 638 Test: 600 Sagopilone, Welch- Sagopilone, Welch- Test: 468 Test: 482 Responder_Xenograft_ NON- Lu7860, Vehicle vs Responder_Xenograft_ Sagopilone, Welch - Lu7558, Vehicle vs Test: 605 Sagopilone, Welch- Test: 333 Supplementary Fig. 2 Supplementary Fig. 3 Supplementary Figure S1. Venn diagrams comparing probe sets regulated by Sagopilone treatment (10mg/kg for 24h) between individual models (Welsh Test ellipse p-value<0.001 or 5-fold change). A Sagopilone responder models, B Sagopilone non-responder models. Supplementary Figure S2. Pathway analysis of genes regulated by Sagopilone treatment in responder xenograft models 24h after Sagopilone treatment by GeneGo Metacore; the most significant pathway map representing cell cycle/spindle assembly and chromosome separation is shown, genes upregulated by Sagopilone treatment are marked with red thermometers. Supplementary Figure S3. GeneGo Metacore pathway analysis of genes differentially expressed between Sagopilone Responder and Non-Responder models displaying –log(p-Values) of most significant pathway maps. Supplementary Tables Supplementary Table 1. Response and activity in 22 non-small-cell lung cancer (NSCLC) xenograft models after treatment with Sagopilone and other cytotoxic agents commonly used in the management of NSCLC Tumor Model Response type
    [Show full text]
  • A Thyroid Hormone Receptor Coactivator Negatively Regulated by the Retinoblastoma Protein
    Proc. Natl. Acad. Sci. USA Vol. 94, pp. 9040–9045, August 1997 Biochemistry A thyroid hormone receptor coactivator negatively regulated by the retinoblastoma protein KAI-HSUAN CHANG*†,YUMAY CHEN*†,TUNG-TI CHEN*†,WEN-HAI CHOU*†,PHANG-LANG CHEN*, YEN-YING MA‡,TERESA L. YANG-FENG‡,XIAOHUA LENG§,MING-JER TSAI§,BERT W. O’MALLEY§, AND WEN-HWA LEE*¶ *Department of Molecular Medicine and Institute of Biotechnology, University of Texas Health Science Center at San Antonio, 15355 Lambda Drive, San Antonio, TX 78245; ‡Department of Genetics, Obstetrics, and Gynecology, Yale University School of Medicine, New Haven, CT 06510; and §Department of Cell Biology, Baylor College of Medicine, Houston, TX 77030 Contributed by Bert W. O’Malley, June 9, 1997 ABSTRACT The retinoblastoma protein (Rb) plays a E2F-1, a transcription factor important for the expression of critical role in cell proliferation, differentiation, and devel- several genes involved in cell cycle progression from G1 to S opment. To decipher the mechanism of Rb function at the (18). Rb inhibits E2F-1 activity by blocking its transactivation molecular level, we have systematically characterized a num- region (19–21). In contrast, Rb has been shown to have the ber of Rb-interacting proteins, among which is the clone C5 ability to increase the transactivating activity of the members described here, which encodes a protein of 1,978 amino acids of the CCAATyenhancer binding protein (CyEBP) family, and with an estimated molecular mass of 230 kDa. The corre- to be required for CyEBPs-dependent adipocyte and mono- sponding gene was assigned to chromosome 14q31, the same cytes differentiation (16–17).
    [Show full text]
  • Regulation of the Akt Kinase by Interacting Proteins
    Oncogene (2005) 24, 7401–7409 & 2005 Nature Publishing Group All rights reserved 0950-9232/05 $30.00 www.nature.com/onc Regulation of the Akt kinase by interacting proteins Keyong Du1 and Philip N Tsichlis*,1 1Molecular Oncology Research Institute, Tufts-New England Medical Center, Boston, MA 02111, USA Ten years ago, it was observed that the Akt kinase revolutionized our understanding of cell function at is activated by phosphorylation via a phosphoinositide the molecular level.These technologies also allowed 3-kinase (PI-3K)-dependent process. This discovery gene- the identification of a large array of protein–protein rated enormous interest because it provided a link between interaction motifs that facilitate our understanding of PI-3K, an enzyme known to play a critical role in cellular signal transduction by providing clues on the potential physiology, and its downstream targets. Subsequently, it function of novel signaling proteins (Barnouin, 2004; was shown that the activity of the core components of the Miller and Stagljar, 2004). ‘PI-3K/Akt pathway’ is modulated by a complex network Akt1, also known as protein kinase Ba (PKBa) of regulatory proteins and pathways. Some of the Akt- (Bellacosa et al., 1991; Coffer and Woodgett, 1991; binding partners modulate its activation by external Jones et al., 1991), is the founding member of a protein signals by interacting with different domains of the Akt kinase family composed of three members, Akt1, Akt2, protein. This review focuses on the Akt interacting and Akt3.Akt family members regulate a diverse proteins and the mechanisms by which they regulate Akt array of cellular functions, including apoptosis, cellular activation.
    [Show full text]
  • Supp Table 6.Pdf
    Supplementary Table 6. Processes associated to the 2037 SCL candidate target genes ID Symbol Entrez Gene Name Process NM_178114 AMIGO2 adhesion molecule with Ig-like domain 2 adhesion NM_033474 ARVCF armadillo repeat gene deletes in velocardiofacial syndrome adhesion NM_027060 BTBD9 BTB (POZ) domain containing 9 adhesion NM_001039149 CD226 CD226 molecule adhesion NM_010581 CD47 CD47 molecule adhesion NM_023370 CDH23 cadherin-like 23 adhesion NM_207298 CERCAM cerebral endothelial cell adhesion molecule adhesion NM_021719 CLDN15 claudin 15 adhesion NM_009902 CLDN3 claudin 3 adhesion NM_008779 CNTN3 contactin 3 (plasmacytoma associated) adhesion NM_015734 COL5A1 collagen, type V, alpha 1 adhesion NM_007803 CTTN cortactin adhesion NM_009142 CX3CL1 chemokine (C-X3-C motif) ligand 1 adhesion NM_031174 DSCAM Down syndrome cell adhesion molecule adhesion NM_145158 EMILIN2 elastin microfibril interfacer 2 adhesion NM_001081286 FAT1 FAT tumor suppressor homolog 1 (Drosophila) adhesion NM_001080814 FAT3 FAT tumor suppressor homolog 3 (Drosophila) adhesion NM_153795 FERMT3 fermitin family homolog 3 (Drosophila) adhesion NM_010494 ICAM2 intercellular adhesion molecule 2 adhesion NM_023892 ICAM4 (includes EG:3386) intercellular adhesion molecule 4 (Landsteiner-Wiener blood group)adhesion NM_001001979 MEGF10 multiple EGF-like-domains 10 adhesion NM_172522 MEGF11 multiple EGF-like-domains 11 adhesion NM_010739 MUC13 mucin 13, cell surface associated adhesion NM_013610 NINJ1 ninjurin 1 adhesion NM_016718 NINJ2 ninjurin 2 adhesion NM_172932 NLGN3 neuroligin
    [Show full text]