DOCSLIB.ORG

Identification of a Maize Neocentromere in an Oat-Maize Addition Line

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Identification of a Maize Neocentromere in an Oat-Maize Addition Line Original Article Cytogenet Genome Res 2009;124:228–238 Accepted after revision: September 11, 2008 DOI: 10.1159/000218128 by A. Houben Identification of a Maize Neocentromere in an Oat-Maize Addition Line a b a c b a, d C.N. Topp R.J. Okagaki J.R. Melo R.G. Kynast R.L. Phillips R.K. Dawe a b Department of Plant Biology, University of Georgia, Athens, Ga. , Department of Agronomy and Plant Genetics, c University of Minnesota, St. Paul, Minn. , USA; Jodrell Laboratory, Royal Botanic Gardens, Kew, Surrey , UK; d Department of Genetics, University of Georgia, Athens, Ga. , USA Key Words Centromeres must be positionally stable – otherwise CENH3 ؒ Centromere ؒ Epigenetic ؒ Kinetochore ؒ Maize ؒ homologous chromosomes will not pair correctly and can Neocentromere ؒ Oat be lost at high frequencies during meiosis. The stability is perplexing because centromeres are not determined in a strictly genetic sense [Dawe and Henikoff, 2006]. A spe- Abstract cial histone called centromeric histone H3 (CENH3) re- We report a neocentromere event on maize chromosome 3 places standard histone H3 and creates an environment that occurred due to chromosome breakage. The neocen- that demarcates centromeres from surrounding chroma- tromere lies on a fragment of the short arm that lacks the tin. Several other proteins are required to build the ki- primary centromere DNA elements, CentC and CRM. It is netochore over a centromere, but CENH3 is widely con- transmitted in the genomic background of oat via a new sidered the ‘centromere identifier’ [Warburton et al., 1997; centromere (and kinetochore), as shown by immunolocal- Malik and Henikoff, 2001; Van Hooser et al., 2001]. Al- ization of the oat CENH3 protein. Despite normal transmis- though centromere chromatin typically forms on tandem sion of the maize fragment in most progeny, neocentro- arrayed satellite repeats or special retrotransposon fami- meres appear to vary in size within the same tissue, as shown lies, there are no common constraints on the DNA se- by fluorescent measurements. A secondary truncation in quences CENH3 may interact with [Jiang et al., 2003]. one line lowered mitotic transmission to 3% and precipitous- Other data support and extend the idea that centromeres ly reduced the size of the chromosome. The results support are propagated by epigenetic means. Some of the best ev- the view that neocentromere formation is generally associ- idence comes from chromosome addition lines where ated with major genomic disturbances such as wide species alien centromeres are maintained by centromere proteins crosses or deletion of an existing centromere. The data fur- of the host species [Jin et al., 2004], and rare cases in which ther suggest that new centromeres may undergo a period of the centromere chromatin forms at a new locus, creating instability that is corrected over a period of several genera- a neocentromere [Maggert and Karpen, 2001; Nasuda et tions. Copyright © 2009 S. Karger AG, Basel al., 2005; Alonso et al., 2007; Marshall et al., 2008]. © 2009 S. Karger AG, Basel R. Kelly Dawe 1424–8581/09/1244–0228$26.00/0 Department of Plant Biology Fax +41 61 306 12 34 University of Georgia E-Mail [email protected] Accessible online at: Athens, GA 30602–1755 (USA) www.karger.com www.karger.com/cgr Tel. +1 706 542 1658, Fax +1 706 542 1805, E-Mail [email protected] Neocentromerization has been proposed to underlie maize neocentromere formed at a site distant from the key evolutionary events such as rapid centromere evolu- original, making a templating event in cis unlikely. We tion, hybrid incompatibility, and speciation [Ventura et also observed wide variance in the size of stably trans- al., 2001; O’Neill et al., 2004; Marshall et al., 2008]. Ex- mitting neocentromeres, suggesting to us that newly tensive work in human cell lines suggests that neocentro- formed centromeres undergo a period of epigenetic flux meres have different DNA sequences but structurally before (presumably) stabilizing. similar kinetochores [Saffery et al., 2000; Alonso et al., 2003, 2007]. In contrast, ‘classical’ neocentromeres form at terminal heterochromatic knob repeats of some plants Materials and Methods and do not share any protein similarity to the normal centromere/kinetochore [Dawe and Hiatt, 2004]. Despite Mapping of the Maize Chromosome 3 Breakage Site its presumed importance, the process of new centromere The following conditions were used to PCR amplify markers formation is not well understood. from each material: 50 ng genomic DNA, 0.2 units HotStarTaq (Qiagen), 0.5 ␮ M of each primer forward and reverse, 2.67 ␮ M One mode of neocentromere formation appears to dNTPs, and 1! supplied buffer in a 15 ␮ l total volume. The cy- involve the direct transfer of kinetochore proteins to a cling program began with a 15 min incubation at 95 ° C to activate new locus. Such a kinetochore transfer mechanism was the enzyme followed by 36 cycles of 94 ° C for 30 s, 57 ° C or 52 ° C first suggested by a study in Drosophila, where chromo- for 30 s and 72 ° C for 75 s, and finally 2 min at 72 ° C. PCR primers were either downloaded from www.maizegdb.org or designed us- somes were broken next to a centromere and the centro- ing the Primer3 program with an optimal annealing temperature mere/kinetochore moved laterally to neighboring DNA of 63 ° C [Rozen and Skaletsky, 2000]. Southern blots were per- sequences [Maggert and Karpen, 2001]. In wheat, a sim- formed using standard conditions. ilar neocentromere event occurred on a barley chromo- some that had been introduced by a wide cross. A spon- Quantitative PCR of Neocentromere Material qPCR was performed on an Eppendorf Realplex machine us- taneous breakage produced an isochromosome with no ing the following conditions: ϳ 100 ng genomic DNA, 0.375 units known centromere repeats and two mirror images of AmpliTaq Gold (Applied Biosystems ), 3 m M MgCl2 , 0.3 ␮ M of the chromosome 7 short arm. The newly formed centro- each primer forward and reverse, 200 ␮ M dNTPs, 5% DMSO, 1 ! mere was transmitted normally, although some chro- SYBR Green (Invitrogen), and 1 ! supplied buffer in a 15 ␮ l total mosome variants were produced; for example some had volume. Primers pairs are as follows: CentC F-(GATTGGGCA- TGTTCGTTGTG), R-(CACTACTTTAGGTCGAAAAC); CRM one or part of one of the 2 original arms. Immunolo- F-(CTCGTGCTCGTCAACTCAA), R-(ACCGTCACAAGTTG- calization of CENH3 and other key proteins confirmed GTGTT); OPIE F-(GATTCCTCGCAAACGGGAW), R-(CTT- that a neocentromere had formed close to the position GCCTACTCCACGTTGT); 5S rDNA F-(GATGCGATCATAC- of the original barley centromere [Nasuda et al., 2005]. CAGCACTA), R-(GAATGCAACACGAGGACTT). The cycling A common feature of most neocentromeres is their as- program began with a 5 min incubation at 95 ° C to activate the enzyme followed by 35 cycles of 95 ° C for 15 s, 53 ° C for 15 s and sociation with genome rearrangements that cause a loss 72 ° C for 30 s, and finally 1 min at 72 ° C. Fold depletion was cal- of the original centromere. It seems likely that neocen- culated by the 2– Ct method [Livak and Schmittgen, 2001] using tromeres arise as a natural means of stabilizing broken 5S rDNA as the reference standard. Each reaction was performed genomes. in triplicate wells and averaged, excluding replicates in which the We report the characterization of a second plant neo- variability exceeded one cycle. centromere. An unstable chromosome lacking a visible Fluorescence in situ Hybridization centromere was reported by Muehlbauer et al. [1999] as Root tip preparation and FISH were performed essentially as a derivative of maize chromosome 3 in an oat genomic described, except the digestion was 80 min [Lamb et al., 2007]. background. We analyzed progeny and show that the un- PCR products were amplified from maize cultivar Seneca 60, us- usual chromosome is a fragment of the chromosome 3 ing the aforementioned primers for CentC, OPIE, CRM, or as reported for CentA [Mroczek and Dawe, 2003] short arm (ch3S) and lacks known maize centromere DNA sequences. In contrast to the highly unstable de- Identification of Oat CENH3 (Avena sativa CENH3) rivative originally reported, this neocentromere now re- To generate genomic clones of the 5 ؅ region of the oatCENH3 liably transmits the maize chromosome in somatic tis- gene, primers F2 (GCACCMGGCSGTGAGGAA) and R1 sue. We cloned the oat CENH3 gene and raised an anti- (TTCCTGATCTCCCGCAGYGC) were used. From the genomic DNA sequence (GenBank accession FJ155067), new primers were body to the predicted protein in order to demonstrate the used to screen a cDNA preparation from ‘Carolina Oat’. Primers location of the new centromere. In apparent contrast to were oatCH3F2 (ACGCCCAAGAAGCAGCTCAAG) and oat- the neocentromeres formed in Drosophila and barley, the race2 (GCGACCGTGCCAGGCTTGAAC). The RTPCR prod- Maize Neocentromere in an Oat-Maize Cytogenet Genome Res 2009;124:228–238 229 Addition Line Maize Putative break site chromosome 3 short arm long arm ctg119 ctg120 ctg121ctg123 umc2263 umc1504 AY110297 umc1683 bnIg1957 AY110151 bnIg602 mmp9 umc1527 umc2002 Fig. 1. Neocentromere material does not contain maize centro- CentC mere DNA or SSR marker DNA from the maize chromosome 3 3.01.1-015.1 long arm. A series of SSR markers spanning maize chromosome 3.01.2-028.3 3.01.2-050.3 3 were used to probe a panel of chromosome 3 truncation lines, 3.01.2-038.1 BC1 F2– 4/9 ‘neocentromere’ progeny, a full maize chromosome 3 3.01.1-035.1 disomic addition line (OMAd3.1), and the oat parent of the addi- Neocentromere tion cross (Sun II). The grey bars represent BAC contigs (ctg) that OMAd3.1 correlate the SSR marker position to the IBM2 physical map. The Oat putative ch3 breakage site maps to the gap between ctg120 and Marker detected ctg121 on the short arm.
Load more

Recommended publications
  • The U.S. Oats Industry (AER-573)
    C. in îtates U-- '^— ^ nentof >^^ Agriculture The U.S. Economic Research Service Oats Industry Agricultural EcofKmriic Report Linwood A. Hoffman Number 573 Janet Livezey Additional copies of this report... can be purchased from the Superintendent of Documents, U.S. Government Printing Office, Washington, DC 20402. Ask for The U.S. Oats Industry (AER-573). Write to the above address for price and ordering instructioas. For faster service, call the GPO order desk at 202-783-3238 and charge your purchase to your Visa, MasterCard, Choice, or GPO Deposit Account. A 25-percent bulk discount is available on orders of 100 or more copies shipped to a single address. Please add 25 percent extra for postage for shipments to foreign addresses. Microfiche copies (Í6.50 for each report plus Í3 for processing) can be purchased from the order desk. National Technical Information Service, 5285 Port Royal Road, Springfield, VA 22161. Enclose check or money order, payable to NTIS. For faster service, call NTIS at 703-487-4650 and charge your purchase to your Visa, MasterCard, American Express, or NTIS Deposit Account. NTIS will ship rush orders within 24 hours for an extra Í10; charge your rush order by calling 800-336-4700. The Economic Research Service has no copies for free mailing. The U.S. OATS INDUSTRY, by Linwood A. Hoffman and Janet Livezey. Commodity Economics Division, Economic Research Service, U.S. Department of Agriculture. Agricultural Economic Report No. 573. ABSTRACT U.S. farmers produced about 16 percent of the total world oats production during 1980-85, down from more than 29 percent during 1960-64 when the United States was the largest producer.
    [Show full text]
  • Plant-Based Recipes
    A collection of 100% PLANT-BASED RECIPES Breakfasts and smoothies p.02 Starters p.05 Mains p.06 Sweet treats p.12 Break- fasts and smooth- ies: Overnight Oats with Shiro Miso serves 1 The miso gives these oats their pleasant ‘umami’ taste (the ‘new’ fifth taste sensation). If you need to eat breakfast away from home, make this in an empty jam jar, and give your taste buds a treat! Nutrition Information: (Approximate nutrition information per serving with fresh fruit/ berries, nuts and maple syrup) Energy (kcals) 349 Fat (g) 12.6 Saturates (g) 1.3 Carbs (g) 47.1 Sugar (g) 5.5 Fibre (g) 6.7 Protein (g) 8.5 INGREDIENTS: METHOD: ½ cup (45 g) of porridge oats ¾ cup (180 mls) of Oatly Oat Drink 1. Mix all of the ingredients except the (preferably Whole/Barista Edition) topping in a bowl (or jam jar), cover and ½ tbsp white Shiro Miso paste leave in ‘fridge for at least 3 hours, but ideally overnight. Topping - your choice from maple 2. Remove from the ‘fridge and, if you syrup, fresh fruit/berries and wish, add more oat drink, until you get roasted nuts the desired consistency. 3. Top with your chosen toppings and enjoy! 02 Avocado & Strawberry smoothie INGREDIENTS: serves 2 This creamy smoothie is quick to make 300 ml Oatly Oat Drink and refreshing at any time of day. 150 g frozen strawberries ½ ripe avocado, peeled Nutrition Information: Juice of ½ lemon (Approximate nutrition information per serving) 1 tbsp maple or agave syrup 2 tsp chia seeds Energy (kcals) 182 Fat (g) 7.8 Saturates (g) 1.1 Carbs (g) 23.9 METHOD: Sugar (g) 13.6 Fibre (g) 4.9 1.
    [Show full text]
  • Torrefaction of Oat Straw to Use As Solid Biofuel, an Additive to Organic Fertilizers for Agriculture Purposes and Activated Carbon – TGA Analysis, Kinetics
    E3S Web of Conferences 154, 02004 (2020) https://doi.org/10.1051/e3sconf/202015402004 ICoRES 2019 Torrefaction of oat straw to use as solid biofuel, an additive to organic fertilizers for agriculture purposes and activated carbon – TGA analysis, kinetics Szymon Szufa1, Maciej Dzikuć2 ,Łukasz Adrian3, Piotr Piersa4, Zdzisława Romanowska- Duda5, Wiktoria Lewandowska 6, Marta Marcza7, Artur Błaszczuk8, Arkadiusz Piwowar9 1 Lodz University of Technology, Faculty of Process and Environmental Engineering, Wolczanska 213, 90-924 Lodz,, Poland, [email protected] 2 University of Zielona Góra, Faculty of Economics and Management, ul. Licealna 9, 65-246 Zielona Góra, Poland, [email protected] 3 University of Kardynal Stefan Wyszyński, Faculty of Biology and Environmental Science, Dewajtis 5, 01-815 Warszawa, Poland, [email protected] 4 Lodz University of Technology, Faculty of Process and Environmental Engineering, Wolczanska 213, 90-924 Lodz,, Poland, [email protected] 5 Laboratory of Plant Ecophysiology, Faculty of Biology and Environmental Protection, University of Lodz, Banacha str. 12/16, 90-131 Łódź, Poland, [email protected] 6 University of Lodz, Chemical Faculty, Tamka 13, 91-403 Łódź, Poland, [email protected] 7 AGH University of Science and Technology, Faculty of Energy and Fuels, al. Mickiewicza 30, 30- 059 Krakow, Poland, [email protected] 8 Czestochowa University of Technology, Institute of Advanced Energy Technologies, Dabrowskiego 73, 42-200, Czestochowa, Poland, [email protected] 9 Wroclaw University of Economics, Faculty of Engineering and Economics, Komandorska 118/120 , 53-345 Wrocław, Poland, [email protected] Abstract.
    [Show full text]
  • Expanding the Production of Oats and Small Grains in Iowa and Minnesota Prepared by the Sustainable Food Lab and Practical Farmers of Iowa 4/27/15
    Expanding the production of oats and small grains in Iowa and Minnesota Prepared by the Sustainable Food Lab and Practical Farmers of Iowa 4/27/15 Introduction Iowa is ranked 1st in the nation in corn and soybean production and Minnesota is ranked 4th in corn and 3rd in soybean production. Corn and soybeans are by far the most dominant crops in these landscapes, farmed by some of the most sophisticated farmers on some of the best soils in the world. The system optimizes for production of corn and soybeans to the exclusion of almost all other crops. The productivity of these systems and the infrastructure (support services, product development, and policy) that has grown to support these systems have been designed for efficiency in the production of these crops at the exclusion of diversity. While the system itself is a marvel, the loss of farming with a third or fourth crop in rotation has resulted in unintended consequences, including insufficient crop diversity to enhance soil quality, and a decline in the supply of small grains (oats, wheat, rye, barley) in a region that is home to some of the largest processors of small grains in the country. Commercial Rationale Supply Oats, once one the most popular crops grown in the Upper Midwest, have been declining in production for years as a system and markets have been developed to optimize the production of corn and soybeans. U.S. farmers planted 3.03 million acres of oats in 2014, down from 23.3 million in 1968. Growing corn and soy instead of oats is also contributing to a decline in oat production in Canada, one of the world’s largest net exporters of oats, and a key source of supply for the US.
    [Show full text]
  • Processing, Nutritional Composition and Health Benefits of Finger Millet
    a OSSN 0101-2061 (Print) Food Science and Technology OSSN 1678-457X (Dnline) DDO: https://doi.org/10.1590/fst.25017 Processing, nutritional composition and health benefits of finger millet in sub-saharan Africa Shonisani Eugenia RAMASHOA1*, Tonna Ashim ANYASO1, Eastonce Tend GWATA2, Stephen MEDDDWS-TAYLDR3, Afam Osrael Dbiefuna JODEANO1 Abstract Finger millet (Eleusine coracana) also known as tamba, is a staple cereal grain in some parts of the world with low income population. The grain is characterized by variations in colour (brown, white and light brown cultivars); high concentration of carbohydrates, dietary fibre, phytochemicals and essential amino acids; presence of essential minerals; as well as a gluten-free status. Finger millet (FM) in terms of nutritional composition, ranks higher than other cereal grains, though the grain is extremely neglected and widely underutilized. Nutritional configuration of FM contributes to reduced risk of diabetes mellitus, high blood pressure and gastro-intestinal tract disorder when absorbed in the body. Utilization of the grain therefore involves traditional and other processing methods such as soaking, malting, cooking, fermentation, popping and radiation. These processes are utilised to improve the dietetic and sensory properties of FM and equally assist in the reduction of anti-nutritional and inhibitory activities of phenols, phytic acids and tannins. However, with little research and innovation on FM as compared to conventional cereals, there is the need for further studies on processing methods, nutritional composition, health benefits and valorization with a view to commercialization of FM grains. Keywords: finger millet; nutritional composition; gluten-free; antioxidant properties; traditional processing; value-added products. Practical Application: Effects of processing on nutritional composition, health benefits and valorization of finger millet grains.
    [Show full text]
  • Ornamental Grasses for Kentucky Landscapes Lenore J
    HO-79 Ornamental Grasses for Kentucky Landscapes Lenore J. Nash, Mary L. Witt, Linda Tapp, and A. J. Powell Jr. any ornamental grasses are available for use in resi- Grasses can be purchased in containers or bare-root Mdential and commercial landscapes and gardens. This (without soil). If you purchase plants from a mail-order publication will help you select grasses that fit different nursery, they will be shipped bare-root. Some plants may landscape needs and grasses that are hardy in Kentucky not bloom until the second season, so buying a larger plant (USDA Zone 6). Grasses are selected for their attractive foli- with an established root system is a good idea if you want age, distinctive form, and/or showy flowers and seedheads. landscape value the first year. If you order from a mail- All but one of the grasses mentioned in this publication are order nursery, plants will be shipped in spring with limited perennial types (see Glossary). shipping in summer and fall. Grasses can be used as ground covers, specimen plants, in or near water, perennial borders, rock gardens, or natu- Planting ralized areas. Annual grasses and many perennial grasses When: The best time to plant grasses is spring, so they have attractive flowers and seedheads and are suitable for will be established by the time hot summer months arrive. fresh and dried arrangements. Container-grown grasses can be planted during the sum- mer as long as adequate moisture is supplied. Cool-season Selecting and Buying grasses can be planted in early fall, but plenty of mulch Select a grass that is right for your climate.
    [Show full text]
  • World Demand, Future Risk and Where Food Use Is Going Global Food Demand
    World Demand, future risk and where food use is going Global Food Demand • To meet global food demand in 2050, agricultural production must be 60 percent higher by weight than in 2005. Alexandratos and Bruinsma, 2012 Global Food Demand • Increases in food demand are due to: – population growth, – changes in diets, – higher incomes – and urbanization Global Food Demand • Global agricultural production for commodities in major commodities is projected to grow at 1.5% annually, on average, compared to 2.1% in the previous decade. • Overall demand for agricultural products (including food, feed, fibre and biofuels) is expected to increase 1.1 percent per year from 2005/07 to 2050, down from 2.2 percent per year in the past four decades. Cereals and Oilseed Increases – World cereals production must increase by 940 million tonnes to reach 3 billion tonnes; – meat production must increase by 196 million tonnes to reach 455 million tonnes; – and oilseed crops by must increase by 133 million tonnes to reach 282 million tonnes. Canada Share of Global Food Demand If the increases are realized – Canadian cereals production would need to increase 28.2 MMT by 2050; – Canadian oilseed production by 5.87 MMT Population • The world population, is forecasted to increase 32% Population • Asia will remain the world’s most populous region in the 21st century, but Africa will gain ground • The world population is expected to rise throughout the 21st century, although this growth is projected to decelerate markedly in 2050 to 2100. Dietary Change • Sugar, fat, and animal product consumption are increasing in almost all regions of the world Dietary Change • Food consumption is increasing on a global scale—from 2,250 calories per person per day in 1961 to 2,750 calories in 2007 to a projected 3,070 calories by 2050 • Despite increased consumption, South Asia and sub-Saharan Africa will continue to have the lowest daily food caloric intake per capita.
    [Show full text]
  • Mississippi Wheat and Oat Variety Trials 2019
    MISSISSIPPI WHEAT & OAT VARIETY TRIALS, 2019 Information Bulletin 540 • August 2019 MISSISSIPPI’S OFFICIAL VARIETY TRIALS TECHNICAL ADVISORY COMMITTEE Erick Larson, Chairman Keith Daniels MSU Extension Service Superintendent Grain Crops Specialist MAFES Research Centers Plant and Soil Sciences Mississippi State University Mississippi State University Darrin Dodds Tom Allen Department Head Plant Pathologist Plant and Soil Sciences Delta Research and Extension Center Mississippi State University Stoneville, Mississippi Josh White John Blanton Manager, Forage Variety Testing Interim Associate Director, MAFES Plant and Soil Sciences Mississippi State University Mississippi State University Wes Burger Associate Director, MAFES Mississippi State University NOTICE TO USER This Mississippi Agricultural and Forestry Experiment Station Information Bulletin is a summary of research conducted at locations shown on the map on the second page. It is intended for the use of colleagues, cooperators, and sponsors. The interpretation of data presented herein may change after additional experimentation. Information included herein is not to be construed either as a recommendation for use or as an endorsement of a specific variety or product by Mississippi State University or the Mississippi Agricultural and Forestry Experiment Station. This report contains data generated as part of the Mississippi Agricultural and Forestry Experiment Station research program. Joint sponsorship by the organizations listed on pages 4-5 is gratefully acknowledged. Trade names
    [Show full text]
  • Oat Protein: Health Benefits and Product Applications
    OAT PROTEIN: HEALTH BENEFITS AND PRODUCT APPLICATIONS Innovating to Meet Nutrition, Health, and Wellness Needs Every Day To learn more about Tate & Lyle ingredients and innovations, please visit www.foodnutritionknowledge.info and www.tateandlyle.com. MAKING FOOD EXTRAORDINARY PROTEIN INTAKE RECOMMENDATIONS AND NEEDS Protein as a macronutrient has increased in developing Protein is required to meet countries, the consumption of protein in these countries remains nutritional needs and to support 5 health and well-being.1 This inadequate. Additionally, the macronutrient is needed to meet protein consumed is generally low human nitrogen requirements and quality, lacking some of the amino acids required for proper growth provide indispensable amino acids 5 (also known as essential amino and development. acids). Amino acids are classified Not every protein source provides as those that cannot be synthesised all of the amino acids needed for by the body (indispensable or growth and development, and not essential) and those that the body all protein is equally bioavailable can synthesise (dispensable or from food sources; however, nonessential).2 However, some are bioavailability can change with • Dietary protein plays essential also conditionally indispensable, food processing.6-8 roles in the body, both structurally becoming essential under specific (muscle and bone) and functionally pathological or physiological Protein quality 2 (biochemical processes, conditions. Protein is an important Protein digestibility, a component structural and functional
    [Show full text]
  • Food Applications of Oat, Sorghum, and Triticale Protein Products
    4409 * Food Applications of Oat, Sorghum, and Triticale Protein Products J.E. CLUSKEY, Y. VICTOR WU, J.S. WALL, and G.E. INGLETT, Northern Regional Research Center, SEA/ARS/USDA, Peoria, IL USA ABSTRACT methods have been reported but have not as yet been Oat, sorghum, and triticale protein products offer adopted industrially. These processes involve aqueous wet considerable potential as food supplements. Each has milling fractionation of the groat flour complex, a mechani­ special characteristics applicable to improved food cal separation of flour components by air classification, and product development. High protein or high lysine separation of the protein fraction from the oat flour in lines of these grains have been dev'eloped in recent aqueous and nonaqueous media. years. Oat, sorghum, and triticale proteit:t fractions Iller milling: The wet milling process, a nonconventional have been separated from their grains by wet and dry method, was developed for producing oat protein concen­ milling procedures and also by air classification. trate, starch, and residue fractions from oat groats having Recent research is reviewed here concerning produc­ moderate and high protein contents (1). The optimum tion and applications of the protein products. yield of protein was obtained in dilute alkali solution at pH 10 (2). The protein was isoelectrically precipitated, centri­ fuged, and isolated. The process yields three main products OAT PROTEIN PRODUCTS (protein concentrate, starch. and gum), all of which offer Oats, the fourth largest cereal crop in the United States much food and nonfood industrial application potential. and the fifth largest in the world, are an important feed Concentrates prepared by this method have a good amino grain for livestock and poultry in the temperate regions of acid profL!e and good nitrogen solubility around pH 2.5 and the world.
    [Show full text]
  • Construction of Neocentromere-Based Human Minichromosomes by Telomere-Associated Chromosomal Truncation
    Construction of neocentromere-based human minichromosomes by telomere-associated chromosomal truncation Richard Saffery*, Lee H. Wong*, Danielle V. Irvine, Melissa A. Bateman, Belinda Griffiths, Suzanne M. Cutts, Michael R. Cancilla, Angela C. Cendron, Angela J. Stafford, and K. H. Andy Choo† The Murdoch Children’s Research Institute, Royal Children’s Hospital, Flemington Road, Melbourne 3052, Australia Edited by John A. Carbon, University of California, Santa Barbara, CA, and approved March 1, 2001 (received for review October 3, 2000) Neocentromeres (NCs) are fully functional centromeres that arise chromosomes. We describe here the production of mitotically ectopically in noncentromeric regions lacking ␣-satellite DNA. stable NC-based human MiCs containing a fully functional Using telomere-associated chromosome truncation, we have pro- human NC derived from the 10q25 region of the mardel(10) duced a series of minichromosomes (MiCs) from a mardel(10) marker chromosome (27, 28). marker chromosome containing a previously characterized human NC. These MiCs range in size from Ϸ0.7 to 1.8 Mb and contain Experimental Protocols single-copy intact genomic DNA from the 10q25 region. Two of Cell Culture and Transfection. BE2Cl-18–5f (abbreviated 5f) was these NC-based Mi-Cs (NC-MiCs) appear circular whereas one is cultured as described (28). HT1080 and derivatives were cultured in linear. All demonstrate stability in both structure and mitotic DMEM (GIBCO͞BRL) with 10% FCS. Hygromycin (Roche Mo- transmission in the absence of drug selection. Presence of a lecular Biochemicals), puromycin (Sigma), or zeocin (Invitrogen) functional NC is shown by binding a host of key centromere- were added to medium at 250 ␮g͞ml, 1 ␮g͞ml, or 200 ␮g͞ml, associated proteins.
    [Show full text]
  • Molecular Characterization of an Analphoid
    Altieri et al. Molecular Cytogenetics 2014, 7:69 http://www.molecularcytogenetics.org/content/7/1/69 CASE REPORT Open Access Molecular characterization of an analphoid supernumerary marker chromosome derived from 18q22.1➔qter in prenatal diagnosis: a case report Vincenzo Altieri1†, Oronzo Capozzi2†, Maria Cristina Marzano3, Oriana Catapano4, Immacolata Di Biase4, Mariano Rocchi2* and Giuliana De Tollis1* Abstract Background: Small supernumerary marker chromosomes (sSMC) occur in 0.072% of unselected cases of prenatal diagnoses, and their molecular cytogenetic characterization is required to establish a reliable karyotype-phenotype correlation. A small group of sSMC are C-band-negative and devoid of alpha-satellite DNA. We report the molecular cytogenetic characterization of a de novo analphoid sSMC derived from 18q22.1→qter in cultured amniocytes. Results: We identified an analphoid sSMC in cultured amniocytes during a prenatal diagnosis performed because of advanced maternal age. GTG-banding revealed an sSMC in all metaphases. FISH experiments with a probe specific for the chromosome 18 centromere, and C-banding revealed neither alphoid sequences nor C-banding-positive satellite DNA thereby suggesting the presence of a neocentromere. To characterize the marker in greater detail, we carried out additional FISH experiments with a set of appropriate BAC clones. The pattern of the FISH signals indicated a symmetrical organization of the marker, the breakpoint likely representing the centromere of an inverted duplicated chromosome that results in tetrasomy of 18q22.1→qter. The karyotype after molecular cytogenetic investigations was interpreted as follows: 47,XY,+inv dup(18)(qter→q22.1::q22.1→neo→qter) Conclusion: Our case is the first report, in the prenatal diagnosis setting, of a de novo analphoid marker chromosome originating from the long arm of chromosome 18, and the second report of a neocentromere formation at 18q22.1.
    [Show full text]