Original Article Cytogenet Genome Res 2009;124:228–238 Accepted after revision: September 11, 2008 DOI: 10.1159/000218128 by A. Houben Identification of a Maize Neocentromere in an Oat-Maize Addition Line a b a c b a, d C.N. Topp R.J. Okagaki J.R. Melo R.G. Kynast R.L. Phillips R.K. Dawe a b Department of Plant Biology, University of Georgia, Athens, Ga. , Department of Agronomy and Plant Genetics, c University of Minnesota, St. Paul, Minn. , USA; Jodrell Laboratory, Royal Botanic Gardens, Kew, Surrey , UK; d Department of Genetics, University of Georgia, Athens, Ga. , USA Key Words Centromeres must be positionally stable – otherwise CENH3 ؒ Centromere ؒ Epigenetic ؒ Kinetochore ؒ Maize ؒ homologous chromosomes will not pair correctly and can Neocentromere ؒ Oat be lost at high frequencies during meiosis. The stability is perplexing because centromeres are not determined in a strictly genetic sense [Dawe and Henikoff, 2006]. A spe- Abstract cial histone called centromeric histone H3 (CENH3) re- We report a neocentromere event on maize chromosome 3 places standard histone H3 and creates an environment that occurred due to chromosome breakage. The neocen- that demarcates centromeres from surrounding chroma- tromere lies on a fragment of the short arm that lacks the tin. Several other proteins are required to build the ki- primary centromere DNA elements, CentC and CRM. It is netochore over a centromere, but CENH3 is widely con- transmitted in the genomic background of oat via a new sidered the ‘centromere identifier’ [Warburton et al., 1997; centromere (and kinetochore), as shown by immunolocal- Malik and Henikoff, 2001; Van Hooser et al., 2001]. Al- ization of the oat CENH3 protein. Despite normal transmis- though centromere chromatin typically forms on tandem sion of the maize fragment in most progeny, neocentro- arrayed satellite repeats or special retrotransposon fami- meres appear to vary in size within the same tissue, as shown lies, there are no common constraints on the DNA se- by fluorescent measurements. A secondary truncation in quences CENH3 may interact with [Jiang et al., 2003]. one line lowered mitotic transmission to 3% and precipitous- Other data support and extend the idea that centromeres ly reduced the size of the chromosome. The results support are propagated by epigenetic means. Some of the best ev- the view that neocentromere formation is generally associ- idence comes from chromosome addition lines where ated with major genomic disturbances such as wide species alien centromeres are maintained by centromere proteins crosses or deletion of an existing centromere. The data fur- of the host species [Jin et al., 2004], and rare cases in which ther suggest that new centromeres may undergo a period of the centromere chromatin forms at a new locus, creating instability that is corrected over a period of several genera- a neocentromere [Maggert and Karpen, 2001; Nasuda et tions. Copyright © 2009 S. Karger AG, Basel al., 2005; Alonso et al., 2007; Marshall et al., 2008]. © 2009 S. Karger AG, Basel R. Kelly Dawe 1424–8581/09/1244–0228$26.00/0 Department of Plant Biology Fax +41 61 306 12 34 University of Georgia E-Mail [email protected] Accessible online at: Athens, GA 30602–1755 (USA) www.karger.com www.karger.com/cgr Tel. +1 706 542 1658, Fax +1 706 542 1805, E-Mail [email protected] Neocentromerization has been proposed to underlie maize neocentromere formed at a site distant from the key evolutionary events such as rapid centromere evolu- original, making a templating event in cis unlikely. We tion, hybrid incompatibility, and speciation [Ventura et also observed wide variance in the size of stably trans- al., 2001; O’Neill et al., 2004; Marshall et al., 2008]. Ex- mitting neocentromeres, suggesting to us that newly tensive work in human cell lines suggests that neocentro- formed centromeres undergo a period of epigenetic flux meres have different DNA sequences but structurally before (presumably) stabilizing. similar kinetochores [Saffery et al., 2000; Alonso et al., 2003, 2007]. In contrast, ‘classical’ neocentromeres form at terminal heterochromatic knob repeats of some plants Materials and Methods and do not share any protein similarity to the normal centromere/kinetochore [Dawe and Hiatt, 2004]. Despite Mapping of the Maize Chromosome 3 Breakage Site its presumed importance, the process of new centromere The following conditions were used to PCR amplify markers formation is not well understood. from each material: 50 ng genomic DNA, 0.2 units HotStarTaq (Qiagen), 0.5 ␮ M of each primer forward and reverse, 2.67 ␮ M One mode of neocentromere formation appears to dNTPs, and 1! supplied buffer in a 15 ␮ l total volume. The cy- involve the direct transfer of kinetochore proteins to a cling program began with a 15 min incubation at 95 ° C to activate new locus. Such a kinetochore transfer mechanism was the enzyme followed by 36 cycles of 94 ° C for 30 s, 57 ° C or 52 ° C first suggested by a study in Drosophila, where chromo- for 30 s and 72 ° C for 75 s, and finally 2 min at 72 ° C. PCR primers were either downloaded from www.maizegdb.org or designed us- somes were broken next to a centromere and the centro- ing the Primer3 program with an optimal annealing temperature mere/kinetochore moved laterally to neighboring DNA of 63 ° C [Rozen and Skaletsky, 2000]. Southern blots were per- sequences [Maggert and Karpen, 2001]. In wheat, a sim- formed using standard conditions. ilar neocentromere event occurred on a barley chromo- some that had been introduced by a wide cross. A spon- Quantitative PCR of Neocentromere Material qPCR was performed on an Eppendorf Realplex machine us- taneous breakage produced an isochromosome with no ing the following conditions: ϳ 100 ng genomic DNA, 0.375 units known centromere repeats and two mirror images of AmpliTaq Gold (Applied Biosystems ), 3 m M MgCl2 , 0.3 ␮ M of the chromosome 7 short arm. The newly formed centro- each primer forward and reverse, 200 ␮ M dNTPs, 5% DMSO, 1 ! mere was transmitted normally, although some chro- SYBR Green (Invitrogen), and 1 ! supplied buffer in a 15 ␮ l total mosome variants were produced; for example some had volume. Primers pairs are as follows: CentC F-(GATTGGGCA- TGTTCGTTGTG), R-(CACTACTTTAGGTCGAAAAC); CRM one or part of one of the 2 original arms. Immunolo- F-(CTCGTGCTCGTCAACTCAA), R-(ACCGTCACAAGTTG- calization of CENH3 and other key proteins confirmed GTGTT); OPIE F-(GATTCCTCGCAAACGGGAW), R-(CTT- that a neocentromere had formed close to the position GCCTACTCCACGTTGT); 5S rDNA F-(GATGCGATCATAC- of the original barley centromere [Nasuda et al., 2005]. CAGCACTA), R-(GAATGCAACACGAGGACTT). The cycling A common feature of most neocentromeres is their as- program began with a 5 min incubation at 95 ° C to activate the enzyme followed by 35 cycles of 95 ° C for 15 s, 53 ° C for 15 s and sociation with genome rearrangements that cause a loss 72 ° C for 30 s, and finally 1 min at 72 ° C. Fold depletion was cal- of the original centromere. It seems likely that neocen- culated by the 2– Ct method [Livak and Schmittgen, 2001] using tromeres arise as a natural means of stabilizing broken 5S rDNA as the reference standard. Each reaction was performed genomes. in triplicate wells and averaged, excluding replicates in which the We report the characterization of a second plant neo- variability exceeded one cycle. centromere. An unstable chromosome lacking a visible Fluorescence in situ Hybridization centromere was reported by Muehlbauer et al. [1999] as Root tip preparation and FISH were performed essentially as a derivative of maize chromosome 3 in an oat genomic described, except the digestion was 80 min [Lamb et al., 2007]. background. We analyzed progeny and show that the un- PCR products were amplified from maize cultivar Seneca 60, us- usual chromosome is a fragment of the chromosome 3 ing the aforementioned primers for CentC, OPIE, CRM, or as reported for CentA [Mroczek and Dawe, 2003] short arm (ch3S) and lacks known maize centromere DNA sequences. In contrast to the highly unstable de- Identification of Oat CENH3 (Avena sativa CENH3) rivative originally reported, this neocentromere now re- To generate genomic clones of the 5 ؅ region of the oatCENH3 liably transmits the maize chromosome in somatic tis- gene, primers F2 (GCACCMGGCSGTGAGGAA) and R1 sue. We cloned the oat CENH3 gene and raised an anti- (TTCCTGATCTCCCGCAGYGC) were used. From the genomic DNA sequence (GenBank accession FJ155067), new primers were body to the predicted protein in order to demonstrate the used to screen a cDNA preparation from ‘Carolina Oat’. Primers location of the new centromere. In apparent contrast to were oatCH3F2 (ACGCCCAAGAAGCAGCTCAAG) and oat- the neocentromeres formed in Drosophila and barley, the race2 (GCGACCGTGCCAGGCTTGAAC). The RTPCR prod- Maize Neocentromere in an Oat-Maize Cytogenet Genome Res 2009;124:228–238 229 Addition Line Maize Putative break site chromosome 3 short arm long arm ctg119 ctg120 ctg121ctg123 umc2263 umc1504 AY110297 umc1683 bnIg1957 AY110151 bnIg602 mmp9 umc1527 umc2002 Fig. 1. Neocentromere material does not contain maize centro- CentC mere DNA or SSR marker DNA from the maize chromosome 3 3.01.1-015.1 long arm. A series of SSR markers spanning maize chromosome 3.01.2-028.3 3.01.2-050.3 3 were used to probe a panel of chromosome 3 truncation lines, 3.01.2-038.1 BC1 F2– 4/9 ‘neocentromere’ progeny, a full maize chromosome 3 3.01.1-035.1 disomic addition line (OMAd3.1), and the oat parent of the addi- Neocentromere tion cross (Sun II). The grey bars represent BAC contigs (ctg) that OMAd3.1 correlate the SSR marker position to the IBM2 physical map. The Oat putative ch3 breakage site maps to the gap between ctg120 and Marker detected ctg121 on the short arm.