A Systematic Revision of the Viola Pedatifida Group and Evidence for the Recognition

Home , Pombalia, Viola appalachiensis, Viola brittoniana, Viola cucullata, Viola hirsutula, Viola macloskeyi

A Systematic Revision of the Viola pedatifida Group and Evidence for the Recognition

of Viola virginiana, a New Narrow Endemic of the Virginia Shale Barrens

A thesis presented to

the faculty of

the College of Arts and Sciences of Ohio University

In partial fulfillment

of the requirements for the degree

Master of Science

Bethany A. Zumwalde

August 2015

This thesis titled

A Systematic Revision of the Viola pedatifida Group and Evidence for the Recognition

of Viola virginiana, a New Narrow Endemic of the Virginia Shale Barrens

BETHANY A. ZUMWALDE

has been approved for

the Department of Environmental and Plant Biology

and the College of Arts and Sciences by

Harvey E. Ballard, Jr.

Associate Professor of Environmental and Plant Biology

Robert Frank

Dean, College of Arts and Sciences 3

ABSTRACT

ZUMWALDE, BETHANY A., M.S., August 2015, Environmental and Plant Biology

A Systematic Revision of the Viola pedatifida Group and Evidence for the Recognition of Viola virginiana, a New Narrow Endemic of the Virginia Shale Barrens

Director of Thesis: Harvey E. Ballard, Jr.

The genus Viola (Violaceae) encompasses 1,000-1,100 species and includes one of the largest North American groups, the "acaulescent blue" violets (subsection Boreali-

Americanae). In the subsection, the Viola pedatifida species group is distinctive in producing only divided leaf blades. Presently the group consists of Viola pedatifida G.

Don., Viola brittoniana Pollard, and Viola subsinuata (Greene) Greene. Recent fieldwork in the mountains of Virginia suggested that disjunct populations of V. pedatifida were different than Midwestern populations. Macromorphological, micromorphological, genetic, and ecological data were analyzed to compare taxa. Phenetic analyses of leaf, flower, cleistogamous capsule and seed variables and scanning electron microscopic examinations of seed coats and petal trichomes distinguished four species. Genetic studies using four microsatellite loci and microhabitat data indicated genetic and ecological differentiation among the four species. All evidence support recognition of the

Virginia violet as a narrowly endemic species, Viola virginiana Zumwalde & H. E.

Ballard. 4

DEDICATION

This thesis is dedicated to my sister, Amanda Huff

ACKNOWLEDGMENTS

I wish to express my appreciation to my advisor, Dr. Harvey Ballard, for his infinite support, advice, and scientific expertise. I would also like to thank my committee members, Drs. Morgan Vis and David Rosenthal, for their assistance and valuable input.

I would like to especially recognize Benjamin Gahagen for his helpful guidance and direction on many fronts of my graduate work. Thank you to Harlan Svoboda for his endless support, nomenclatural expertise, and all of his assistance in the micromorphological section of my research. I would like to recognize Dr. Martin

Kordesch and the Department of Physics at Ohio University for granting me access to use their scanning electron microscope and materials. I thank Ohio University and the

Graduate Student Senate at Ohio University for providing funding for my research. I would like to recognize and thank those who have contributed their various time and efforts to my research: Donnie Day, Toddrick Roth, Chris Benson, Bailey Hunter, David

Robson, Colin Kruse, Anne Sternberger, Alexander Meyers, and Erik Anderson. Also, thank you to John Townsend for his collaboration, monitoring of the new species, and for granting me access and use of pictures. Thank you to Tom Wieboldt, Otto Gockman,

Steve Young, Craig Freeman, and Irvine Wilson for sending specimens for ecological and molecular analyses. Additional thanks to the Missouri Botanical Garden (MO),

Smithsonian Institution (US), New York Botanical Garden (NY), Harvard University

(GH), and the Virginia Polytechnic Institute and State University (VPI) for providing herbarium specimens.

TABLE OF CONTENTS

Page

Abstract ...... 3 Dedication ...... 4 Acknowledgments...... 5 List of Tables ...... 8 List of Figures ...... 9 Chapter 1: Introduction ...... 10 Taxonomic History of the Viola pedatifida Group ...... 13 A New Endemic Species ...... 18 Objectives ...... 20 Chapter 2: Macromorphological phenetic studies ...... 22 Introduction ...... 22 Methods ...... 22 Results ...... 26 Leaf Character Analyses ...... 26 Floral Character Analyses ...... 27 Cleistogamous Capsule and Seed Character Analysis ...... 28 Univariate Analyses ...... 28 Discussion ...... 29 Chapter 3: Micromorphological Study ...... 44 Introduction ...... 44 Methods ...... 45 Results and Discussion ...... 49 Chapter 4: Genetic Study ...... 59 Introduction ...... 59 Methods ...... 60 Results and Discussion ...... 63 Chapter 5: Ecological Study ...... 68 Introduction ...... 68 7

Methods ...... 69 Results and Discussion ...... 70 Biogeography and Habitat Descriptions ...... 71 V. brittoniana ...... 71 V. pedatifida ...... 73 V. subsinuata ...... 74 V. virginiana ...... 76 Chapter 6: Taxonomic Revision ...... 79 Key to Species of the Viola pedatifida Group ...... 79 Descriptions of the Taxa ...... 81 References ...... 92 Appendix 1: Additional Macromorphological Traits Examined ...... 97 Appendix 2: Specimens Examined ...... 98 Appendix 3: Raw Presence/ Absence (0/1) Data Matrix of Alleles ...... 110

LIST OF TABLES

Table 1. A comparison of the major treatments of the V. pedatifida group ...... 17

Table 2. Variables used in statistical and phenetic analyses ...... 25

Table 3. Variable-variate correlation of leaf matrix data ...... 33

Table 4. Variable-variate correlation of leaf matrix data following step-wise removal ... 34

Table 5. Variable-variate correlation of floral matrix data ...... 36

Table 6. Variable-variate correlation of floral matrix data following step-wise removal 37

Table 7. Variable-variate correlation of seed matrix data ...... 39

Table 8. Variable-variate correlation of seed matrix data following step-wise removal .. 39

Table 9. SEM examined specimens ...... 48

Table 10. Characterization of micromorphological structures of petal trichomes ...... 52

Table 11. Characterization of micromorphological structures of seed coats ...... 58

Table 12. Voucher information for populations analyzed in genetic studies ...... 62

Table 13. Screened microsatellite primers ...... 63

Table 14. Amplified alleles for microsatellite loci ...... 67

Table 15. Microhabitat soil analysis data ...... 71

LIST OF FIGURES

Figure 1. Canonical variates analysis of leaf macromorphological variables ...... 32

Figure 2. Canonical variates analysis of floral macromorphological variables ...... 35

Figure 3. Canonical variates analysis of seed macromorphological variables ...... 38

Figure 4. Univariate analyses of leaf, flower, and seed variables...... 43

Figure 5. SEM micrographs of petal trichomes ...... 52

Figure 6. Light microscopy photographs and corresponding SEM micrographs of representative seeds of taxa ...... 53

Figure 7. Seed SEM micrographs of Viola brittoniana ...... 54

Figure 8. Seed SEM micrographs of Viola pedatifida ...... 55

Figure 9. Seed SEM micrographs of Viola subsinuata ...... 56

Figure 10. Seed SEM micrographs of Viola virginiana...... 57

Figure 11. Principal coordinates analysis (PCoA) of genetic data ...... 66

Figure 12. Geographic distributions of examined herbarium specimens of V. brittoniana f. brittoniana and V. brittoniana f. pectinata...... 73

Figure 13. Geographic distribution of examined herbarium specimens of V. pedatifida . 74

Figure 14. Geographic distribution of examined herbarium specimens of V. subsinuata 76

Figure 15. Geographic distribution of examined herbarium specimens of V. virginiana. 77

Figure 16. Distributions of previously recognized taxa according to BONAP...... 78

CHAPTER 1: INTRODUCTION

The Violaceae is a family of angiosperms encompassing approximately 1,000-

1,100 species and 23 currently recognized genera (Ballard 2014, Wahlert et al. 2014,

Paula-Souza & Ballard 2015). The largest genus within the family, Viola, consists of approximately 580-620 species or ~60-75% of the family (Ballard 1992, 2007, 2014).

Four sections of the genus Viola occur in temperate eastern North America: Melanium

(pansies), Chamaemelanium (yellow-flowered violets), Viola (rostrate violets), and

Plagiostigma (most acaulescent, or “stemless” violets; both blue and white flowered).

The section Plagiostigma includes the subsection Boreali-Americanae (the infamous

“acaulescent blue” group), all of which are perennial and herbaceous (Gil-ad 1995,

1997). The members of Boreali-Americanae are stemless, with flowers and leaves arising independently from the horizontal or ascending rhizome; and all produce blue to purple- colored chasmogamous flowers in the spring as well as cleistogamous flowers in the late spring and summer. Subsection Boreali-Americanae has been treated by specialists and taxonomists to consist of 6 to 29 species (Brainerd 1921; Brainerd & Baird 1942;

Gleason & Cronquist 1991; McKinney 1992; Gil-ad 1995, 1997).

The subsection Boreali-Americanae has been considered to be one of the most problematic in vascular plant systematics. This designation is based partly on reported extensive phenotypic plasticity of some species, common interspecific hybridization, and putative introgression and initial F1 hybrids and individuals representing later-generation derivatives will in many cases produce at least a few viable seeds from the cleistogamous

(self-pollinating), resulting in gene flow ("introgression" or “Mendelian segregation”, 11

Brainerd 1913, 1924, Gil-ad 1997, 1998). The only apparent barriers to gene flow in this group are ecological specificity. In localities where multiple species co-occur, “hybrid swarms” may exist with individuals of intermediate morphologies. Numerous hybrids have been reported, comprising most of the possible combinations between sympatric species. Some hybrids are frequently encountered wherever the putative parental species are present (Brainerd 1924; Ballard 1999; Gil-ad 1995, 1997, 1998).

The breeding system of Boreali-Americanae consists of vegetative, showy chasmogamous flowers (which promote out-crossing), and reduced and closed cleistogamous flowers (which force self-pollination). This type of breeding structure produces both homogenous and heterogenous populations, which are strongly affected by the stability of the environment (Beattie 1976).

Certain species tend to be morphologically similar in appearance making it difficult to differentiate between them, especially at certain times of the year (e.g., spring flowering, before leaves have achieved their final shape and size). An example would be the Great Plains Viola missouriensis Greene and the Great Lakes Viola affinis Leconte. In addition, some species are quite similar in flower whereas they may diverge substantially in various traits of cleistogamous fruits and seeds; this was documented initially by

Brainerd in a series of early papers (1904a, 1904b, 1905, 1909, 1910, 1913, 1921, 1924) and later demonstrated extensively by Gil-ad (1995, 1997, 1998). Unfortunately, the very low frequency of specimens collected in mature cleistogamous fruit has made positive discrimination between closely related species or between species and interspecific hybrids challenging. There is also evident widespread variation of vegetative characters 12 within species, presumably due to phenotypic plasticity or hybridization. Extensive studies have emphasized environmental influence of vegetative and reproductive characters in Viola such as leaf form and dissection, stipules, leaf size, development of chasmogamy and cleistogamy (Gershoy 1934; Borgstrom 1939; Russell 1960; Valentine

1962; Yost 1987; Culley 2002).

Boreali-Americanae is an ancient group derived from allopolyploidy, resulting from the merger of an ancient taxon of diploid section Chamaemelanium and two taxa from different allotetraploid lineages, a Stolonosae taxon and a Rostratae taxon

(Marcussen et al. 2012). Members of Boreali-Americanae all have a meiotic chromosome of 2n= 54; and this has been hypothesized to be from chromosome fusion from the expected 2n=56 (Clausen 1929). Although, all polyploid groups in the Northern

Hemisphere engage in significant hybridization among certain species (Brainerd 1924;

Valentine 1962; Ballard 1992), hybridization is particularly extensive and taxonomically problematic in Boreali-Americanae. While hybrids in other lineages are primarily sterile and fail to form viable seeds, it has been shown that many interspecific hybrids in

Boreali-Americanae will produce a small percentage of viable seeds from the cleistogamous capsules. Hybridization often distorts morphological differences between the parental taxa; and through later-generation gene flow (referred to early on by

Brainerd as "Mendelian segregation" and by others such as Russell later as

"introgression") modifying certain traits in local populations (Brainerd 1904, 1906, 1910;

Gershoy 1929). Several taxa, such as Viola subsinuata (Greene) Greene [known prior to

1990 as Viola palmata L.], have been treated in various ways. Some specialists have 13 considered Viola subsinuata as a distinct species (Gleason & Alexander 1952, McKinney

1992, Ballard 1994), or as a weak variety of the Midwestern and Great Plains prairie birdfoot violet, Viola pedatifida (Gleason & Cronquist 1991), but recently it has been dismissed as a series of hybrid derivatives on the basis of putatively intermediate features

(Gil-ad 1995, 1997, 1998). However, no studies have utilized genetic markers to determine the evolutionary and taxonomic status of these taxa, nor have previous studies made use of extensive herbarium collections in conjunction with field observations.

Taxonomic History of the Viola pedatifida Group

The Boreali- Americanae subsection can be partitioned into three well- delineated groups of species based on leaf division: (1) a very broad group with undivided leaves and homophyllous leaf development (all leaves are similar in shape and lack of lobing); (2) the “Viola palmata” group, a heterophyllous set of species with the earliest smallest leaves and sometimes the last leaves of the season undivided but the mid-season leaves shallowly lobed to deeply divided; and (3) the “Viola pedatifida” group, a homophyllous group with all leaf blades lobed or divided and the focus of this study. Members of all three groups within Boreali-Americanae hybridize freely within and among groups.

The “Viola pedatifida” group currently consists of three recognized taxa: Viola pedatifida G. Don., Viola brittoniana Pollard, and Viola subsinuata (Greene) Greene. All taxa have suffered at least some degree of taxonomic controversy related to their relative distinctness from other species, and interpretations of the breadth of morphological variation and its meaning. The distinctions and status of V. brittoniana and V. pedatifida 14 have been controversial and the two taxa have been treated as species, subspecies, and varieties by various authors, with Gleason and Cronquist (1991) synonymizing the two,

McKinney (1992) treating them as subspecies, and Brainerd (1921), Becker (1925),

Fernald (1950), Gleason (1952), Russell (1965), and Gil-ad (1995) maintaining them as distinct species. In Viola brittoniana, a sporadic and relatively rare, nearly undivided

"pectinate-toothed" phenotype, Viola pectinata E. P. Bicknell, often co-occurs with typical deeply divided-leaved individuals and was treated by Brainerd (1921), Fernald

(1950) and Gleason (1952) as a distinct species, while Russell (1965) and McKinney

(1992) considered the phenotype a trivial instance of leaf dimorphism without taxonomic worth, and Gil-ad (1997) reduced it to a form under Viola brittoniana. The taxonomic and evolutionary status of V. subsinuata, and its nomenclature, has also been debated.

Amidst a flurry of massive lumping in the violets and other groups, Gleason and

Cronquist (1991) reduced V. pedatifida to a variety of V. palmata L. because of the apparent intergradation of the two across the northeastern states. Regardless, the uniformly lobed or divided leaves clearly place it as a somewhat close morphological relative to V. brittoniana and V. pedatifida (or as a hybrid assemblage involving those species and various unlobed-leaved taxa, as proposed by Gil-ad). New field evidence pertaining to disjunct populations of “V. pedatifida” that inhabit the shale barrens region in the mountains of western Virginia suggests that a fourth distinct species may also belong to this group (pers. observations by Dr. Ballard, T. Wieboldt, and J. Townsend).

Regardless of the taxonomic treatment, V. pedatifida has been reported to hybridize frequently with other violets in close proximity by Brainerd (1913), Russell 15

(1965) and Gil-ad (1995, 1997). In the narrow sense, this taxon inhabits somewhat calcareous mesic, black-soil prairies and similar prairie- like sites in the western Great

Lakes region westward to the Great Plains and southward into the Southwest region.

Viola brittoniana occupies edges of peaty salt marshes and meadows in the northeastern Atlantic Coast states and the borders of swamps and streams further south in

Virginia, North and South Carolina. Many original populations have been extirpated during human settlement of the Atlantic Coast, and most of the extant populations are presently found in the New Jersey pine-barrens and southward. All authors have recognized the similar morphology of V. brittoniana and V. pectinata, with the latter distinguished primarily by its coarsely toothed but otherwise undivided leaves. All populations of the latter are reportedly very small and it usually grows with V. brittoniana and/or V. cucullata Aiton (an undivided-leaved species of marshes in the region that it closely resembles). Although no one has previously proposed hybridization as the basis for the morphological traits of Viola pectinata, it has no unique features and combines the traits of V. brittoniana and V. cucullata, and typically grows with one or both species. Its taxonomic distinctions and evolutionary status remain unclear. Due to its rarity and sporadic distribution (completely encompassed by V. brittoniana), and apparent intermediate morphological characters between V. brittoniana and V. cucullata suggesting hybrid origin, this violet requires further study. It is maintained here as a form of Viola brittoniana, following Gil-ad (1997, 1998).

The taxon treated here as Viola subsinuata was first described by Greene (1898) as a variety of Viola emarginata and raised to species rank the subsequent year. This is 16 the same homophyllous lobed- or divided-leaved taxon that earlier taxonomists from the turn of the last century until the early 1990s attributed to the name Viola palmata L.

Independently, McKinney (1992) and Ballard (1994) discovered that the type material of

Linnaeus's Viola palmata actually represented the heterophyllous violet then-called Viola triloba Schwein., and that the latter species must unfortunately be named Viola palmata

L. instead. The earliest available name for the homophyllous lobed-leaved taxon previously referred to Viola palmata was Viola subsinuata (Greene) Greene. Gil-ad

(1995) addressed Viola palmata L. in the sense of Brainerd and other early taxonomists, and Viola subsinuata (Greene) Greene separately, but argued that neither should be maintained as a distinct species because of the lack of unique features in Viola subsinuata or apparent intermediate traits indicative of hybrid origin in "Viola palmata".

One continuing problem that affects literature and reliability of distributional information is the challenging nomenclature surrounding V. subsinuata (Greene) Greene and Viola palmata L. Linnaeus's description of Viola palmata can be interpreted either in support of a heterophyllous violet or a homophyllous one, and no publications in the late

1700s and early 1800s make mention of a homophyllous lobed-leaved violet at all.

Brainerd was the first taxonomist to distinguish the homophyllous cut-leaved taxon from the heterophyllous taxa and applied the name Viola palmata L. to the homophyllous lobed- or divided-leaved populations, apparently using only Linnaeus' description.

McKinney (1992) pointed out—and Ballard independently confirmed—that the lectotype material of Viola palmata in the Linnaean herbarium cannot represent the homophyllous- leaved taxon but instead has all the traits of the similar widely distributed heterophyllous- 17 leaved violet treated until recently as Viola triloba. In other words, the homophyllous- leaved violet belonging to the “Viola pedatifida” group could not continue with the name

Viola palmata L. because the name was misapplied, and the latter name properly belongs to (and is an earlier name for) Viola triloba. McKinney (1992) also provided the earliest available name for the homophyllous-leaved violet, V. subsinuata (Greene) Greene. Not all taxonomists have agreed with this name change, and references for these violets in the literature as well as distributional records in databases and atlases are currently very confused.

Table 1 correlates names of taxa in the Viola pedatifida group as treated by different specialists and taxonomists, including this revision. The table highlights the diversity of opinion held by various authors concerning the distinctness and taxonomic rank or status of members of the group. This study aims to provide evidence for a revision of the taxa in the Viola pedatifida group and for recognition of a probable new species that is narrowly endemic to the shale barrens region of western montane Virginia.

Table 1.

A Comparison of the Major Treatments of the V. pedatifida Group

Brainerd Gleason & Russell McKinney Gil-ad Zumwalde (1921 & Cronquist (1965) (1992 & 2002) (1997) (Present) 1924) (1991) V. V. V. palmata var. V. pedatifida V. brittoniana f. V. brittoniana f. brittoniana brittoniana palmata subsp. brittoniana brittoniana brittoniana V. V. V. brittoniana f. V. brittoniana f. V. brittoniana V. brittoniana pectinata brittoniana pectinata pectinata V. V. V. palmata var. V. pedatifida V. pedatifida V. pedatifida pedatifida pedatifida pedatifida subsp. pedatifida V. palmata var. V. palmata V. palmata V. subsinuata hybrid V. subsinuata palmata Not treated Not treated Not treated Not treated Not treated V. virginiana 18

A New Endemic Species

The new species will be referred to as Viola virginiana Zumwalde & H. E.

Ballard or by the common name of the “shale woodland violet” in this study. Robert Platt

(1951) was the first to document the shale woodland violet but reported this specimen as what he believed to be disjunct populations of the Midwestern Viola pedatifida in the

Mid-Appalachian shale barrens region of Virginia. Reports from this area have since been ignored in all taxonomic and floristic literature regarding violets of the region.

Herbarium specimens of the shale woodland violet from the Virginia Polytechnic

Institute (VPI) were obtained on loan.

Dr. Ballard revisited these shale woodland populations for study of phenological and morphological characteristics in Virginia during 2013. He noted that the flowering period and vegetative characters are quite different than that of typical V. pedatifida. The shale woodland violet was almost completely past chasmogamous flowering and well into chasmogamous fruit in the first week of May 2013, while all other species in the area were still at peak chasmogamous flower (including Viola palmata growing near or among the shale woodland violet on the slopes). One of the morphological differences of the shale woodland violet from the other members of the group is the degree of leaf dissection. It is one order higher in the Virginian populations and also has a "petiolate"

(distinct slender stalks) nature of the lateral and terminal primary divisions of the leaf blade. The shale woodland violet also has a number of floral and fruit traits that are unlike V. pedatifida or V. brittoniana but similar to V. subsinuata such as broad, rounded 19 sepals, cleistogamous flowers produced on short prostrate peduncles, and purple-blotched capsules.

Due to discrepancies in flowering times, unusual ecological habitat (calcareous shale woodlands), and morphological characteristics, these populations were tentatively hypothesized to represent a new species of violet strictly endemic to two counties, Bath and Alleghany, Virginia. All 12 populations thus far known occupy two adjacent mountain ranges, Beard Mountain and Short Mountain, that straddle Alleghany and Bath counties. While several populations appear to have hundreds or possibly thousands of individuals, most are quite small. Populations are sporadic over the two mountains, based on field surveys of Dr. Ballard, Virginia state botanist John Townsend, and Virginia

Polytechnic Institute herbarium curator Tom Wieboldt. More populations are assumed to exist in the mountain ranges. However, brief surveys conducted by Ballard during summer 2013 around the perimeter of the small region and some distance away, in apparently similar shale barrens and shale woodland habitat, revealed no populations of this violet, and non-violet plants present at all these sites showed clear evidence of acidic shale substrate that is apparently avoided by the "shale woodland" violet. In contrast, all the populations of the shale woodland violet grow among plants, some of which suggest a pronounced calcareous shale substrate in the immediate vicinity. The shale woodland violet requires intensive field and laboratory studies on taxonomic, geographic, and ecological grounds.

The populations of Viola virginiana are still presently designated as Viola pedatifida and have a conservation status listed as G5 (globally secure) S1 (critically 20 imperiled), and the species is considered as "endangered" by the Virginia Department of

Conservation and Recreation (NatureServe 2013). However, this study provides support for recognition of these populations as a new species endemic to the mountains of two counties in western Virginia, and the state rarity listing may shift to G2 S1 (imperiled, globally endangered) in the near future. The new species may well deserve federal listing as well, given the very restricted world range, confinement to a particular ecological zone, and few relatively small populations.

Objectives

The “Viola pedatifida” group poses many problems for systematists because it includes taxa that are morphologically similar and hybridize frequently with other species. Five extensive interdisciplinary research objectives aim to clarify consistent morphological distinctions and resolve the relationships and evolutionary status of these violets. These studies will also provide evidence regarding the recognition of Viola virginiana as a new endemic species.

1. Phenetic study of macromorphological traits in the “V. pedatifida” group to assist

in delimiting species.

2. Micromorphological study utilizing micrographs of scanning electron

microscopic (SEM) examinations of petal trichomes and seed coats to discern

additional features to distinguish taxa and identify hybrids in the group.

3. Genetic studies using microsatellite markers to estimate the genetic distinctness

and relationships of taxa and to identify potential hybrids. 21

4. Comparison of microhabitats for taxa and assessment of the extent of ecological

differentiation in the group.

5. Taxonomic revision of the “Viola pedatifida” group, incorporating the above

information.

CHAPTER 2: MACROMORPHOLOGICAL PHENETIC STUDIES

Introduction

The use of phenetic analyses on herbarium specimens was first described by

Sokal and Crovello (1970). These analyses use multivariate statistical approaches to delimit taxa based on morphological differences. Phenetic analyses have been successful in providing useful information for other troublesome Violaceae groups (Ballard &

Wujek 1994; Ballard et al. 2001). These analyses have provided information on morphological characters that have demonstrated usefulness in differentiating taxa in

Viola.

Methods

Over 1,000 herbarium specimens of Viola were studied from the following herbaria: BHO, GH, MO, NCU, NY, OS, US and VPI (abbreviations follow Holmgren et al. 1990). Initial herbarium studies included assignment of specimens to recognizable taxa based on easily observable macromorphological traits, as defined in taxon descriptions given in various publications by Brainerd (1913, 1921, 1924), Gleason &

Alexander (1952) and Gil-ad (1995, 1997). During specimen examinations and scrutiny of the literature, a substantial number of readily measured quantitative traits were identified for subsequent phenetic analysis. Useful characters were chosen following

Ballard & Wujek (1994) as well as those of Gil-ad (1995, 1997) and included features of the leaves, flowers, and cleistogamous listed in Table 2. An additional list of macromophological traits not used in phenetic analyses can be found in Appendix 1.

Separate data matrices of macromorphological characters were created for leaves, 23 flowers, and fruits to optimize the sample size because few specimens had easily measured features of leaves and flowering or fruiting traits evident on the same herbarium sheet, and none had leaves, flowers and cleistogamous capsules with mature seeds together. Specimens included in the data sets are referred to as OTU’s (operational taxonomic units). Seventy-four OTU’s were used for leaf character analyses, 66 for floral analyses, and 35 for seed analyses. Continuous morphological characters were measured from herbarium specimens and additional dried, unmounted field collections.

Measurements were taken using a Ballard radiometer as devised by Ballard & Wujek

(1994) and the software program ImageJ (Rasband 2011) to the nearest 0.1 mm. Leaf measurements were taken from the largest expanded leaf. Floral measurements were taken on mature chasmogamous flowers. A single seed from mature, dehisced cleistogamous capsules was measured. Viola subsinuata was included in initial seed analyses, but was removed from the data set due to the very small sample size available.

Given the uncertain status of V. brittoniana f. pectinata, it was excluded from the phenetic studies presented here.

Group differences were tested using multivariate analyses. Canonical variates analyses (CVA) and principal components analyses (PCA) were implemented using the program Number Cruncher’s Statistical Software 10 (NCSS 10). Correlated variables were examined and variables with R2 values greater than 0.95 were removed until all variables were below this threshold. The results of the CVA were the most successful at grouping OTU's and portraying relationships among them, and are shown in the results.

If initial analyses resulted in an a priori group being fully separated by a 95% confidence 24 interval in the plot, that group was removed from the next data set, utilizing the step-wise removal method of Sebola & Balkwill (2013), and the analysis was rerun to examine resolution of the remaining groups. The sequential removal process was terminated when maximum separation of one group was achieved.

Univariate analyses were conducted on each variable to discriminate which characters were most useful individually in delimiting taxa, using NCSS 10. For each analysis, the data were first tested for normality using a parametric one-way ANOVA and a non-parametric Kruskal-Wallis test. If the data were normal, a Tukey-Kramer multiple comparison test was used to determine differences among groups. If the data were not normal, Duncan’s multiple comparison tests were used. Univariate analyses provided information on how well the taxa can be discriminated with individual variables and which characters were of particular taxonomic importance. 25

Table 2.

Variables Used in Statistical and Phenetic Analyses, with precision given in parentheses

Leaf characters 1. Leaf radius 0° (0.1mm) 2. Leaf radius 30° (0.1 mm) 3. Leaf radius 60° (0.1 mm) 4. Leaf radius 90° (0.1 mm) 5. Leaf radius 120° (0.1 mm) 6. Leaf radius 150° (0.1 mm) 7. Leaf radius 180° (0.1 mm) 8. Apical angle (1°) 9. Basal sinus angle (1°) 10. Petiole length (0.1 mm) 11. Percent area of dissection of blade (1.0%) 12. Central division- maximum number of divisions 13. Lateral division- maximum number of divisions Floral characters 14. Peduncle length (0.1 mm) 15. Bottom sepal length (0.1 mm) 16. Bottom sepal width (0.1 mm) 17. Sepal apex angle (1°) 18. Auricle length (0.1 mm) 19. Spur height (0.1 mm) 20. Spur petal length (0.1 mm) 21. Spur petal width (0.1 mm) 22. Lateral petal length (0.1 mm) 23. Lateral petal width (0.1 mm) 24. Upper petal length (0.1 mm) 25. Upper petal width (0.1 mm) Cleistogamous capsule & seed characters 26. Seed length (0.1 mm) 27. Seed width (0.1 mm) 28. Caruncle length (0.1 mm) 29. Capsule length (0.1 mm) 30. Capsule width (0.1 mm) 31. Seed weight (0.1 mg) 32. Seed length:width ratio (0.1 mm) 33. Capsule length:width ratio (0.1 mm) 26

Results

Leaf Character Analyses

In the three most deeply divided-leaved taxa, leaf blades show at least two main orders of leaf cutting. The first, ternate division results in a central division and two lateral divisions (one on each side of the blade). The blade may be further divided in the second order, with the central or lateral divisions themselves lobed, and even a third or fourth order of division may be found on the central and/or lateral divisions. The numbers of central or lateral divisions are traits that simply represent the total the number of lobes on each primary segment of the leaf blade.

The initial CVA on leaf variables, after the removal of correlated variables, used

14 characters (Figure 1). Axes CV1-CV3 contributed to 100% of the variation of groups

(Table 3). In this analysis, V. subsinuata was strongly separated from the remaining three taxa. The separation of V. subsinuata was most influenced by the following variables

(Table 3): narrower apical angle and fewer central and lateral divisions on the lamina on the CV1 axis; fewer lateral divisions, longer petiole length, and greater leaf blade area

(less dissected leaf) on the CV2 axis; and smaller apical angle (more acute apex), narrower basal sinus angle (more cordate base), and smaller leaf measurement for the

180º angle (with greatest width of blade nearer the base than the middle) on the CV3 axis.

Following removal of V. subsinuata and correlated variables, the second leaf character set included 13 characters. CVA revealed strong separation of V. brittoniana from the other two taxa and a slight overlap of 95% confidence intervals of V. pedatifida and V. virginiana (Figure 1). Axes CV1-CV2 contributed to 100% of the total variation (Table 27

4). The separation of groups was most influenced by the following variables on corresponding axes (Table 3): a narrower apical angle, fewer central divisions and fewer lateral divisions on the CV1 axis; and the narrower apical angle, smaller basal sinus angle, and fewer lateral divisions on the CV2 axis.

Floral Character Analyses

The initial CVA of floral characters, after the removal of correlated variables, used 13 characters (Figure 2A). In this analysis, V. brittoniana was separated from the remaining three taxa. Axes CV1-CV3 contributed to 100% of the variation of groups (

Table 5). The separation of V. brittoniana from the remaining taxa was most influenced by the following variables on corresponding axes: longer and narrower sepals, and longer auricleson the CV1 axis; longer peduncle, narrower sepals and shorter upper petal on the

CV2 axis; and longer and narrower sepals, and longer spur on the CV3 axis. Following removal of V. brittoniana and removal of correlated variables, the CVA used 13 characters. This analysis revealed slight overlap of 95% confidence intervals of V. pedatifida, V. subsinuata, and V. virginiana (Figure 2B) indicating distinct differences of taxa. Axes CV1-CV2 contributed to 100% of the total variation (Table 6). The separation of groups was most influenced by the following variables on corresponding axes (Table 3): shorter peduncle, shorter auricles and narrower sepals of V. virginiana on the CV1 axis; and shorter and narrow sepals of V. virginiana and a shorter spur of V. subsinuata on the CV2 axis. 28

Cleistogamous Capsule and Seed Character Analysis

The initial analysis of cleistogamous capsule and seed variables after the removal of correlated variables resulted in a data set of eight character (Figure 3). In this analysis, there was no strong separation of any taxa according to the 95% confidence intervals; however, the OTU's of the groups themselves barely overlapped, indicating that capsule and seed traits provide significant taxonomic value in distinguishing Viola brittoniana, V. pedatifida and V. virginiana. The initial analysis of all taxa included V. subsinuata despite its small sample size (Figure 3A). In this figure the separation of taxa on CV

Axis 1 was based on the shorter, narrower seeds and shorter caruncle of V. brittoniana.

The Axis of CV2 separated taxa based upon V. pedatifida’s long capsules and V. brittoniana’a smaller seeds. Axis CV3 separated taxa based upon V. pedatifida’s longer and wider capsules and V. brittoniana‘s shorter caruncle. The subsequent removal of V. subsinuata was necessary to better show distinctions between the remaining taxa (Figure

3B). In this analysis, axes CV1-CV2 contributed to 100% of the variation of groups

(Table 7) and the separation was most influenced by the following variables on the CV1 axis: shorter seeds and caruncle of V. brittoniana, and longer capsules of V. pedatifida.

On the CV2 axis, the taxa were separated by the shorter seeds and capsules of V. brittoniana and the greater capsule length to width ratio of V. pedatifida.

Univariate Analyses

Univariate analyses (Figure 4) revealed that the following characters were not statistically significant alone in differentiating taxa based on the means of OTU’s: leaf radii 120, 150, and 180; spur petal length and lateral petal width for floral characters; and 29 capsule width, caruncle length, and seed weight for fruit characters. Characters that were determined to be useful in differentiating the two most morphologically similar taxa, V. virginiana and V. pedatifida, were: leaf radii 30 and 60, basal sinus angle, and lateral divisions; peduncle length, bottom sepal length and width, sepal apex, auricle length, spur height, spur petal length, lateral petal length for floral traits; and capsule length for fruit characters. The number of lateral divisions in the leaf blade was the only character in the analyses that differed significantly among all four taxa. Nevertheless, combinations of leaf traits were adequate to distinguish all four taxa, and leaf traits plus flower or fruit traits were successful in distinguishing all four taxa unambiguously.

Discussion

Phenetic analyses in this study provide evidence for macromorphological distinctness of Viola brittoniana, Viola subsinuata, Viola pedatifida, and the newly proposed species Viola virginiana. Specifically, the leaf and floral CVA with the applied step-wise removal method provided more evidence for distinctness than CVA applied to capsules and seed traits. It was to be expected that V. pedatifida and V. virginiana would likely overlap in these analyses due to morphological similarity; however, the 95% confidence intervals only slightly overlapped in some analyses, the individual OTUs were separated into different clusters providing evidence for distinctness.

Analyses of the eight macromorphological capsule and seed characters measured for the phenetic analysis did not provide complete separation of themselves in distinguishing taxa. Nevertheless, specimens of the taxa were largely segregated, with minimal overlap among the clusters, suggesting that fruit characters do provide some 30 degree of differentiation. This could be resolved by measuring additional or different characters or possibly measuring more specimens. For instance, no attempt was made to quantify the divergent peduncle position of the cleistogamous capsules or the unique color pattern of the seeds documented in each taxon, and these features would presumably provide additional phenetic separation.

Overall, the multivariate and univariate analyses showed that shallowly lobed and more acute, more cordate leaf blades separated Viola subsinuata from the other three taxa, and that the three taxa diverged in the "rank order" of leaf blade dissection and leaf blade width, with V. brittoniana having simply ternately or biternately divided ovate blades, V. pedatifida having bi- to triternately divided broadly ovate to reniform blades, and V. virginiana having tri- to tetraternately divided orbicular blades. Flowers of Viola brittoniana were the most different, with longer narrower sepals, longer auricles, shorter upper petals and longer spur, while V. pedatifida, V. subsinuata and V. virginiana diverged in various features of peduncle, sepals and auricles, and spur length. Fruiting characters provided further distinctions, for instance by the tendencies of smaller seed size and shorter caruncle in V. brittoniana and larger, relatively narrower capsules of V. pedatifida. Although many traits included in the phenetic analyses were not statistically shown to differ among taxa by themselves, groups of traits in combination, both within each structure (leaf, flower and fruit) and together consistently distinguished all four morphologically recognizable taxa. Additional qualitative features, such as color pattern of cleistogamous capsules and seeds, would provide further discrimination among the taxa. 31

To provide further evidence for the morphological distinction of taxa, the investigation of the micromorphology of distinctive seed characters is examined in

Chapter 3 of this thesis.

. Figure 1. (A) Canonical variates analysis (CVA) of 14 leaf morphological variables from

74 OTUs. (B) CVA following the step-wise removal of V. subsinuata of 13 unstandardized leaf morphological variables from 64 OTUs. 33

Table 3.

Correlations Between Variables and CV Axes Used for Leaf Matrix Data Corresponding to Figure 2

Variable CV1 CV2 CV3 Apical Angle 0.32 0.26 -0.35 Basal Sinus Angle 0.06 -0.03 -0.53 Leaf Radius 0 -0.03 -0.09 0.01 Leaf Radius 30 -0.05 -0.14 0.22 Leaf Radius 120 0.01 -0.09 0.06 Leaf Radius 150 0.04 -0.03 0.04 Leaf Radius 180 0.02 -0.05 -0.26 Central Divisions 0.48 -0.01 0.16 Lateral Divisions 0.57 -0.50 -0.04 Petiole Length -0.11 -0.31 0.02 Percent Area -0.12 0.27 0.09 Ratio Radius 30 0.11 0.06 0.20 Ratio Radius 60 0.15 0.10 0.25 Ratio Radius 90 0.19 0.11 0.02

Individual Percentage 84.80 12.50 2.60 Total Percentage 84.80 97.40 100.00 Note: Bolded numbers represent variables that contributed to the most separation of taxa in the CVA analysis.

Table 4.

Correlations Between Variables and CV Axes Used for Leaf Matrix Data Following the

Step-Wise Removal Method Corresponding to

Figure 1

Variable CV1 CV2 Apical Angle -0.37 0.36 Basal Sinus Angle -0.01 0.35 Leaf Radius 0 0.06 -0.06 Leaf Radius 30 0.09 -0.27 Leaf Radius 120 0.01 -0.12 Leaf Radius 150 -0.03 -0.06 Leaf Radius 180 0.02 0.16 Central Divisions -0.45 -0.22 Lateral Divisions -0.35 -0.43 Petiole Length 0.24 -0.23 Percent Area 0.01 0.16 Ratio Radius 30 -0.13 -0.13 =Ratio Radius 60 -0.19 -0.14

Individual Percentage 91.60 91.60 Total Percentage 8.40 100.00 Note: Bolded numbers represent variables that contributed to the most separation of taxa in the CVA analysis depicted in Figure 2B.

Figure 2. (A) Canonical variates analysis (CVA) of 13 floral morphological variables from 66 OTUs and (B) CVA following the step-wise removal of V. brittoniana, employed on 13 unstandardized floral morphological variables from 66 OTUs.

Table 5.

Correlations Between Variables and CV Axes for Floral Matrix Data of V. virginiana, V. pedatifida, V. brittoniana, and V. subsinuata

Variable CV1 CV2 CV3 Peduncle Length -0.14 -0.37 -0.10 Sepal Length -0.25 -0.16 -0.51 Sepal Width 0.06 -0.53 -0.38 Sepal Apex 0.31 -0.35 0.14 Aurical Length -0.72 -0.04 -0.16 Spur Length -0.03 0.08 -0.70 Spur Height 0.06 0.19 -0.02 Spur Petal Length -0.11 -0.32 -0.13 Spur Petal Width 0.06 -0.06 -0.02 Lateral Petal Length -0.07 -0.29 -0.14 Lateral Petal Width -0.03 -0.07 0.23 Upper Petal Length -0.03 -0.38 0.05 Upper Petal Width -0.04 -0.09 -0.15

Individual Percentage 77.60 14.40 8.00 Total Percentage 77.60 92.00 100.00 Note: Bolded numbers represent variables that contributed to the most separation of taxa in the CVA analysis.

Table 6.

Correlations Between Variables and CV Axes for Floral Matrix Data of V. virginiana, V. pedatifida, and V. subsinuata Following the Step-Wise Removal Method with V. brittoniana removed.

Variable CV1 CV2 Peduncle Length -0.38 0.11 Sepal Length -0.23 0.47 Sepal Width -0.38 0.43 Sepal Apex -0.12 -0.03 Aurical Length -0.40 0.01 Spur Length 0.07 0.62 Spur Height 0.15 0.01 Spur Petal Length -0.29 0.13 Spur Petal Width -0.02 0.03 Lateral Petal Length -0.24 0.13 Lateral Petal Width -0.07 -0.19 Upper Petal Length -0.30 -0.02 Upper Petal Width -0.08 0.14

Individual Percentage 72.10 72.10 Total Percentage 27.90 100.00 Note: Bolded numbers represent variables that contributed to the most separation of taxa in the CVA analysis.

Figure 3. (A) CVA of eight seed morphological variables from 38 OTUs and (B) CVA following the step-wise removal of V. subsinuata of six unstandardized seed morphological variables from 35 OTUs.

Table 7.

Correlations Between Variables and CV Axes for Seed Matrix Data of V. virginiana, V. pedatifida, V. brittoniana and V. subsinuata.

Variable CV1 CV2 CV3 Seed Length -109.53 144.53 4.97097 Seed Width 237.643 -137.06 -16.267 Caruncle Length 12.7576 -12.918 22.8558 Capsule length -3.6581 8.6107 -22.046 Capsule width -11.251 -23.243 76.0684 Seed weight 0.53781 -1.6914 3.91417 Seed Ratio- Length:Width 12.228 -13.287 2.75363 Capsule ratio- Length:Width -0.9303 -1.9867 5.86123

Individual Percentage 58.4 38.4 3.2 Total Percentage 58.4 96.8 100 Note: Bolded numbers represent variables that contributed to the most separation of taxa in the CVA analysis.

Table 8.

Correlations Between Variables and CV Axes for Seed Matrix Data of V. virginiana, V. pedatifida, and V. brittoniana.

Variable CV1 CV2 Seed Length -0.80 -0.29 Caruncle Length -0.26 -0.19 Capsule Length -0.19 -0.40 Seed Weight -0.13 0.07 Seed Length Ratio 0.14 -0.14 Capsule Length Ratio 0.01 -0.36

Individual Percentage 51.20 51.20 Total Percentage 48.80 100.00 Note: Bolded numbers represent variables that contributed to the most separation of taxa in the CVA analysis.

Figure 4. Box and whisker plots of univariate analyses of leaf, flower, and seed variables for taxa within the Viola pedatifida group with each colored circle representing outliers, boxes representing the inner and outer quartile values and a line inside each box showing the median value, whiskers showing the range, and letters comparing significant (p<0.05) similarities (same letter) and differences (different letter) of means between taxa.

CHAPTER 3: MICROMORPHOLOGICAL STUDY

Introduction

Taxa in the V. pedatifida group were confirmed to be generally macromorphologically different in phenetic studies of leaf and reproductive characters in

Chapter 2. Phenetic studies of seed characters did not completely separate Viola brittoniana, V. pedatifida and V. virginiana based on 95% confidence intervals, but

OTU's of the groups barely overlapped, suggesting at least strongly divergent tendencies in capsule and seed traits among the three taxa. The analysis of micromorphological structures, in combination with results from the macromorphological study, was hypothesized to strengthen the evidence for delimitation of all four taxa as distinct species.

The micromorphology of lateral petal trichomes and seed coats was first employed to delimit orthospecies and hybrids in Viola subsect. Boreali-Americanae by

Gil-ad (1998). Scanning electron microscopy (SEM) in Gil-ad’s study successfully revealed species-level distinctions in the primary and secondary structure of seeds and trichomes, and was reported to document intermediate features of putative parental species in instances of potential hybrid individuals or taxa of hybrid origin. Gil-ad

(1998) recognized as separate species two taxa of the Viola pedatifida group, Viola brittoniana and Viola pedatifida, but excluded Viola subsinuata in his study as a result of macromorphological features and micromorphological features of lateral petal trichomes and seeds that he inferred as evidence of hybrid status or hybrid origin. Additionally,

SEM has previously been employed in Viola to examine differences in pollen grains 45 among members of the Viola nuttallii complex (Fabijan et al. 1987), pollen morphology of Viola section Melanium Ging. (Horb 1994), and leaf vestiture and style morphology in the Viola walteri complex (Ballard and Wujek 1994). Differences in the micromorphology of seed coats have also been helpful in delimiting taxa in the Violaceae genus Hybanthus (Seo 2010).

The micromorphological approach by Gil-ad (1998) was replicated to include other taxa from the Viola pedatifida group. The objectives of this study were to: 1) examine additional samples of petal trichomes and seed coats with SEM over the range of the four taxa in the Viola pedatifida group besides those samples used by Gil-ad; 2) compare results from additional samples to those of Gil-ad’s (1998) study including Viola virginiana; and 3) determine whether micromorphological features of lateral petal trichomes and seed coats provide additional distinctions among the four taxa in the group, or support Gil-ad's contention of a hybrid origin or hybrid assemblage for Viola subsinuata. Given the uncertain status of Viola brittoniana f. pectinata, that taxon was excluded from the micromorphological studies.

Methods

The methods employed closely followed those of Gil-ad (1995). Seed and petal trichomes of each taxon were obtained from field collections when available and were supplemented with herbarium specimens (Table 9). Three specimens across the geographic range of each taxon were examined. Trichomes were obtained from lateral petals, and only mature, fully pigmented seeds produced from chasmogamous or 46 cleistogamous capsules were used. At least two seeds per capsule and five petal trichomes per sample were examined to confirm consistency in samples.

Prior to SEM preparation, seed samples were imaged using an Olympus SZ261 binocular dissecting microscope and video camera imaging system, with cellSens version

1.3 software. Seeds were rinsed three times in distilled water and allowed at least 48 hours to air dry before mounting. Petal trichomes were removed from the flower and affixed directly to the stub. Trichomes and seeds were mounted on carbon tape on an aluminum stub and covered with gold on a Pelco SC-4 Sputter Coater for 40 seconds at

7mA. Specimens were visualized using an S-2460N Natural Scanning Electron

Microscope at an accelerating voltage of 25 kV and at a working distance of 10 mm.

Seeds were magnified at 150X at the end of the seed opposite from the caruncle for an overview image and further magnified at 500X on a location that best exemplified the details of the seed coat surface for a close-up image. Petal trichomes were magnified at

1000X at the apex. Micrographs were produced using the program NORAN System Six and can be found in Figure 5, Figure 6, Figure 8-10. All SEM activities were conducted at the Department of Physics and Astronomy at Ohio University.

The characterization of micromorphological structures and traits on the petal trichomes follow terminology of Gil-ad (1998). Width of trichomes was measured from the images using ImageJ (Rasband 2011). Micromorphological characterization of the seed coat also followed terminology of Gil-ad (1998), who utilized the terms and classifications developed by Barthlott (1981, 1984, 1990) to describe and categorize seed coat morphology by primary structure (shape) and secondary structure (on cell walls of 47 primary structure). Tertiary structure (epicuticular secretions) was not used to categorize seeds as it was not present on any samples. Petal trichome descriptions can be found in

Table 10, and seed coat descriptions are provided in Table 11.

Table 9.

SEM Examined Specimens

Taxon Material Collection and source Locality Figure S Wilson & Wilson s.n. Virginia. Henrico County. 7-A (BHO) S Brainerd 17 (US) Vermont. Norfolk County: 7-B; 6- Middlebury. 1(A-C) S Dowell 6279 (US) Maryland. Prince George's County: 7-C Hyattsville. brittoniana PT Ballard & Benson s.n. North Carolina. 5-1A (BHO) PT Batchelder s.n.(NY) Massachusettes. Middlesex County: 5-1B Carlisle. PT Rusk & Svenson 4474 New Jersey. Burlington County: 5-1C (MO) Pemberton S Freeman 25213 (BHO) Kansas. Shawnee County: Wakarusa. 8-A S Gockman s.n.(BHO) Minnesota. Ramsey County: St. Paul. 8-B S Gibson3381 (MO) Missouri. Lawrence County: Woods 8-C; 6- Prairie. 2(A-C) pedatifida PT Legler 8104 (MO) Colorado. Las Animas County: 5-2A Vermejo Park Ranch. PT Stephens 10875 (MO) Kansas. Pottawatomie County: E. 5-2B Blaine. PT Palmer 1764 (MO) Missouri. Jasper County: Webb City. 5-2C S Ballard (BHO) Ohio. Adams County: Edge of 9-A Appalachia S Ballard & Zink 13-047 Virginia. Floyd County: Buffalo 9-B; 6- (BHO) Mountain. 3(A-C) S Ballard & Zink 13-026 Virginia. Giles County: Mtn. Lake 9-C (BHO) Biological Station. subsinuata PT Small 3132 Virginia. Smyth County: Clinch Mtn. 5-3A Wildlife Mgt. Area. PT Ross s.n. New York. Tompkins County: New 5-3B Ithaca. PT Braun s.n. Ohio. Adams County: Buzzard 5-3C Roosh. S Townsend 4543 (VPI) Virginia: Bath County: Beards 10-A; 6- Mountain (Site 2). 4(A-C) S Ballard & Zink 13035 Virginia: Bath County: Copeland. 10-B (BHO) S Zumwalde & Hunter Virginia: Bath County: Beards 10-C (BHO) Mountain (Site 4). virginiana PT Zumwalde & Ballard Virginia: Bath County: County Line 5-4A (BHO) Barrens. PT Zumwalde & Ballard Virginia: Bath County: Beards 5-4B (BHO) Mountain. PT Townsend (BHO) Virginia: Bath County: Brushy 5-4C Hollow. 49

Results and Discussion

The results from the micromorphological analysis of seed and petal trichome characters have provided additional evidence for the delimitation of taxa in the V. pedatifida group; however, the taxa represent differences from each other, more variability than expected was observed with each taxon. Petal trichome micrographs from V. brittoniana and V. pedatifida corresponded very closely with those presented by

Gil-ad (1995, 1998), and were similar to each other in shape, being narrowly linear throughout, gradually tapering to a narrowly rounded apex. The trichomes of Viola pedatifida were the narrowest of the four taxa and most long-tapering to the narrowly acutish apex. The cuticular folds on V. pedatifida were generally finer and less prominent, and shorter than those of V. brittoniana, but in both the folds were mostly closer together than those of V. subsinuata and V. virginiana, separated by no more than the width of the folds. The trichomes of V. subsinuata and V. virginiana differed from those of Viola brittoniana and V. pedatifida in shape, being broadly linear to slightly or conspicuously clavate and broadly rounded at the apex. The cuticular folds of Viola subsinuata were somewhat variable, in one sample prominent, thick and not spaced more than a fold width (in Figure 5-3a), , in another sample finer and less prominent, separated by less than a fold width (Figure 5-3b), and in the third one sample, having very fine, convoluted and densely packed folds (Figure 5-3c). The cuticular folds of Viola virginiana were generally similar among the samples, being the most widely spaced of all the taxa (one to three fold widths apart), somewhat shorter than those in V. subsinuata and often quite sinuate. Generally, the petal trichomes belonging to the same taxon were 50 distinguishable from those of other taxa, although the trichomes of Viola subsinuata were more variable in various traits than the trichomes of other taxa. Therefore, petal trichomes provide additional evidence for recognizing the four taxa in this group as distinct species. They also indicate a greater degree of variation in Viola subsinuata and support the concept that this taxon may represent a species complex. In comparing the petal trichomes of V. subsinuata with those of V. pedatifida and of V. sororia (in Gil-ad

1998), no overwhelming evidence was observed in support of considering V. subsinuata as a hybrid assemblage, although the number of distinctive features is few.

Seed characters provided additional useful information for the delimitation of taxa. The seeds coats of V. brittoniana and V. pedatifida conformed to the observations of Gil-ad (1998). The seed coats of V. brittoniana exhibited intercrossed thickenings of the periclinal walls and smooth, circular plates with shallow pits (Figure 7). The seed coats of V. pedatifida have unevenly ribbed periclinal walls with irregular thickenings

(Figure 8). Seed coats of V. subsinuata were widely variable. Seeds from the Ohio

(Figure 9A) and Giles Co., Virginia (Figure 9C) populations of V. subsinuata have smooth, raised periclinal walls that are similar to the seeds of V. virginiana. The seed examined of V. subsinuata from Floyd Co., Virginia resembled the seed coats of V. brittoniana. As in the petal trichomes, comparing micromorphological features of seed coats in V. pedatifida, V. sororia and the three samples of V. subsinuata, features found in the latter were not compellingly intermediate between the first two species, but were quite variable, suggesting hypotheses that this character for this taxon is either highly variable or could possibly represent a species complex. The extent of variation in 51 micromorphology of petal trichomes and seed coats of this taxon across its range should be investigated further. The micromorphology of V. virginiana seeds differed from any seed in Boreali-Americanae examined by Gil-ad (1999) in possessing uneven-periclinal walls with smooth raised plates (Figure 10).

In addition to the micromorphological differences among taxa, the seeds of each taxon are visually different in color pattern when examined by light microscopy (Figure

6). The seeds of V. brittoniana (Figure 6A) and V. pedatifida (Figure 6B) are dark yellow-orange to brown; however, the seeds of V. brittoniana are generally smaller than those of V. pedatifida. Seeds of V. subsinuata are medium gray with dark dash-like marks (Figure 6C) and generally resemble the seeds of V. virginiana, but the seeds of V. virginiana bear dense and minute, round black spots instead of separated, large linear markings (Figure 6D).

Macromorphological traits of leaves, flowers, capsules and seeds provided additional evidence for taxa delimitation than micromorphological observations.

However, more variation was seen between samples of each taxon. This may indicate that micromorphological characters may not provide substantial evidence for the delimitation of taxa as indicated by Gil-ad (1998). It is advised that micromorphological data should be further investigated to encompass more specimen samples and be used as additional evidence for macromorphological differences between taxa.

Figure 5. SEM micrographs of lateral petal trichomes from taxa in the Viola pedatifida group. 1 (A, B, C). Viola brittoniana. 2 (A, B, C). Viola pedatifida 3 (A, B, C). Viola subsinuata. 4 (A, B, C). Viola virginiana.

Table 10.

Characterization of Micromorphological Structures of Petal Trichomes

Taxon Type/Shape Curving of cuticular folds Spacing of cuticular folds V. brittoniana Linear Linear or curved Dense V. pedatifida Cylindrical Linear or curved Dense V. subsinuata Clavate Variable Widely spaced V. virginiana Clavate Linear or curved Widely spaced

Figure 6. Light microscopy photographs and corresponding SEM micrographs of representative seeds of taxa from the Viola pedatifida group. 1A, 1B, 1C. Viola brittoniana. 2A, 2B, 2C. Viola pedatifida. 3A, 3B, 3C. Viola subsinuata. 4A, 4B, 4C.

Viola virginiana.

Figure 7. Seed SEM micrographs of Viola brittoniana from populations in the following locations: Virginia (A), Massachusetts (B), and Maryland (C).

Figure 8. Seed SEM micrographs of Viola pedatifida from populations in the following locations: Kansas (A), Minnesota (B), and Missouri (C).

Figure 9. Seed SEM micrographs of Viola subsinuata from populations in the following loacations: Ohio (A), Floyd Co., Virginia (B), and Giles Co., Virginia (C).

Figure 10. Seed SEM micrographs of Viola virginiana from three populations in Bath

Co., Virginia: Beards Mountain- Site 2 (A), Copeland (B), and Beard’s Mountain- Site 4

(C). 58

Table 11.

Characterization of Micromorphological Structures of Seed Coats

Taxon Primary sculpture Secondary Structure V. brittoniana Isodiametric Reticulate prominent thickenings, anticlinal cell boundaries with segmented internal thickenings V. pedatifida Unevenly ribbed Irregular, reticulate thickenings V. subsinuata Superficially tetra-, Raised thickenings with internally reticulate cell penta-, or hexagonal boundaries isodiametric cells. V. virginiana Isodiametric Irregular, porous raised thickenings

CHAPTER 4: GENETIC STUDY

Introduction

Genetic studies using nuclear microsatellite markers often provide useful data to evaluate the distinctness of morphological (phenetic) taxa, assess relationships of taxa, and identify hybrid derivatives. Microsatellites are short-sequence repeats (SSR) dispersed throughout the genome and are characterized as markers using a PCR based method with fluorescently labeled primer pairs. They are a reliable genetic marker because they are highly polymorphic at the species and population level in most vascular plants, are repeatable across variable DNA concentrations and differing lab conditions, are codominant, and have bi-parental inheritance (Goldstein 1999). In numerous studies, microsatellites have shown to be effective in determining population genetic diversity, gene flow, hybridization processes, allopolyploid parentage, and phylogeographic patterns (Olson et. al 1989; Selkoe & Toonen 2006; Ricca & Shaw 2010).

There is preliminary evidence suggesting that microsatellite markers have potential in differentiating taxa and determining hybrids in the Boreali-Americanae group, through the research efforts of undergraduates Kyle Grubbs and Richard Janssen

(unpublished data). Primers for microsatellites have been identified by Dr. Ballard in the

Boreali-Americanae using a "next generation" shotgun sequencing approach (Meglécz et al. 2011, Takayama et al. 2011); several primer pairs isolated from Viola sororia Willd. have already been tested and deemed polymorphic. Four loci have been screened and determined to amplify well in all species tested, including those of the Viola pedatifida group, and to potentially provide polymorphism in preliminary trials. These loci have 60 confirmed hypotheses of hybridization in numerous other vascular plant groups, when tested with leaf samples of putative parental species and plants possessing intermediate traits suggestive of hybridization. Given the uncertain status of Viola brittoniana f. pectinata, that taxon was excluded from the genetic studies.

Methods

DNA was extracted from leaf tissue of 194 specimens consisting of 52 individuals from five populations of V. pedatifida, 54 individuals from five populations of V. subsinuata, 57 individuals from five populations of V. virginiana, and 31 individuals from five populations of V. brittoniana.

The technique implemented for this study followed that of Culley et al. (2013).

This method first tests microsatellite primer pairs by performing a PCR reaction that includes a forward primer that is tagged with the DNA sequence of choice of the 5’ end, a labeled tail primer consisting of the same tail sequence but with a fluorescent label on the

5’ end, and an unaltered reverse primer. In this PCR reaction, the forward tailed primer is supplied at a reduced concentration to make sure it is used up for the subsequent reactions that would incorporate the labeled fluorescent tail.

Four loci were characterized in two sets of multiplex PCR reactions (4 primer pairs in each reaction) using a Qiagen Multiplex PCR kit. The primer pairs were distributed in the two reactions per DNA sample such that the greatest separation of

“alleles” in the four loci is maintained; each of the four primer pairs were tagged with a different fluorophore (red, yellow, green and orange). Batches of 96 amplified samples were submitted to the Ohio State University Plant-Microbe Genomics facility for 61 genotyping. For the taxa V. pedatifida, V. subsinuata, and V. virginiana, five geographically separated populations per taxon were genetically characterized, with a minimum of 10 individuals per population being amplified for the four loci tested. Only three populations of V. brittoniana were available.

Due to the allodecaploid (10X) nature of the genome in these members of the

Boreali-Americanae lineage, a special approach was necessary in order to accommodate for the expected "fixed heterozygosity" stemming from multiple homoeologous copies of each genome. To analyze the microsatellite data, each amplified fragment for a given locus was treated as a separate "allele", scored in a binary manner as presence (1) or absence (0) for the corresponding locus. These data were analyzed using a principal coordinates analysis in the software program PAST (Hammer et al. 2013), with the presence/absence data converted first to a similarity matrix using the DICE coefficient.

The DICE coefficient is commonly used for presence/ absence data of codominant markers such as microsatellites (Kosman & Leonard 2005; Babaei et al. 2012).

Table 12.

Voucher Information for Populations Analyzed in Genetic Studies

No. of Population Taxon Individuals Locality of Populations No. Analyzed 572 V. pedatifida 12 IN, Lowe Prairie, Mike Homoya & Roger Hedge 513 V. pedatifida 10 Nebraska 565 V. pedatifida 11 MI, Kalamazoo Co., XY Avenue Prairie. Ballard, Kyle Strohl & Ballard Sr. 3790 V. pedatifida 10 MN, St. Paul. 25213 V. pedatifida 9 KS. Shawnee Co. 38°57'04"N, 95°41.49"W. E 1/2, NW 1/4. Wakarusa, 4 mi N. Grant Bradbury Park. Sent by Craig C. Freeman. 1 September 2014 570 V. subsinuata 11 MI, Steinbach Woods W of Ann Arbor, plants locally frequent along trail in sandy loam of dry- mesic ecotone between higher dry-mesic forest and lowland swamp, found 1 plant in one spot and dozens in a different area of the forest closer to Mill Creek along trail, Ballard & Kyle Strohl, 26 May 2013; Ballard 13-020 563 V. subsinuata 11 OH, Steidtmann Reserve south of Bowling Green, locally frequent along trail from parking area in dry-mesic sandy loam of higher ground, Ballard & Kyle Strohl, 22 May 2013; Ballard 13-013 590 V. subsinuata 10 VA, 1/2 mile south of MLBS on Mountain Lake Road, east side, 14 Aug 2013, H. Ballard & A. Stuart 13-047 [population sample] 601 V. subsinuata 10 OH, Edge of Appalachia. September 2014. Collected by H. Ballard & Ohio Flora class. 599 V. subsinuata 12 VA, County Line Barrens. 4/19/2014. B. Zumwalde, H. Ballard D. Day, D. Robson 597 V. virginiana 11 VA, County Line Barrens. 4/19/2014. B. Zumwalde, H. Ballard D. Day, D. Robson 596 V. virginiana 12 VA, Brushy Gap (Behind Admin bldg). 4/19/2014. B. Zumwalde, H. Ballard D. Day, D. Robson 593 V. virginiana 11 VA, Copeland East 4 Site. 4/26/2014. B. Zumwalde, H. Ballard, D. Day, D. Robson 592 V. virginiana 11 VA, Beard Mtn 4. 4/27/2014. B.Zumwalde, H. Ballard, D.Day, D.Robson 606 V. virginiana 12 VA, Beard Mtn 2. 8/21/2014. B. Zumwalde, B. Hunter 600 V. brittoniana 10 VA, Collected on property of Martha Wilson Trust by Irvine Wilson. Powerline transmission row in bottomland of Chickahoming Rd. Henrico County, VA. August 25, 2014. 37°31'47.35 N 77°13'47.19" W 507 V. brittoniana 10 New England, 5/22/02, Arthur Haines s.n. 607 V. brittoniana 11 NY, Albany. Collected by Steve Young. 10/10/2014

Table 13.

Screened Microsatellite Primers

Primer 5' Dye Primer sequence (5' to 3') Reverse tail sequence (3' to 5') name CJSU2 6FAM TTCCACCCTCCTAGGTAATCTT TTGATGAACTGGATTGATAA C AGGA AQLMF VIC TTCGAACTCCATCTCTACTTAT TTGAGACTTTGGTGAAAGAT TGTC TATTTG CIHYO NED GGAAAGAAACCAACATGTGC AAAGGAAGGAACAGAAATGC AA A8GO9 PET TAAAGCGACGTGGGTGAGTT TCAAGTTGGAGTTCACACCT GTA AL6ZK 6FAM GAATCATTGGCTGACTTGGG TGTAAAACGACGGCCAGT

B02H7 VIC TCGACTCCATGTTTGCTGAA TAGGAGTGCAGCAAGCAT

BU08C NED TATCCCAAGACACCCAATGC CACTGCTTAGAGCGATGC

A8IM2 PET GGTTTAACGTCGCTCCTTGA CTAGTTATTGCTCAGCGGT

BUJQQ 6FAM TTCAAACTTTGTTGCAACTTCATC TGTAAAACGACGGCCAGT

GR180 VIC GTATCTGGCGAGCTTCAACG TAGGAGTGCAGCAAGCAT

A8NZ7 NED TGGTGGTGATGGAAGAAGAGA CACTGCTTAGAGCGATGC

CL5W8 PET AAGGCATGACAAGTGGCAAT CTAGTTATTGCTCAGCGGT

Note: Primers in bold represent those that have been genotyped thus far

Results and Discussion

Results from the principal coordinate analysis, based upon only four microsatellite loci, show promising evidence for genetic dissimilarity of Viola virginiana from Viola pedatifida (Figure 11). Although microsatellites are valuable genetic markers, in each group, the number of minimally sufficient polymorphic loci needed to demonstrate (or refute) genetic differentiation must be evaluated with preliminary study.

An additional concern with polyploids is the "fixed heterozygosity" of multiple homoeologous copies that often diminishes the observed differentiation of taxa. 64

Generally, 8 to 20 loci are used in studies of diploid species groups. Examination of the allelic data from four microsatellite loci in the Viola pedatifida group reveals overlap of some individuals of Viola virginiana and the other three taxa, but complete apparent overlap of Viola brittoniana and V. subsinuata. An examination of the allelic data for the overlapping individuals of all taxa showed that, in many cases, amplifications of overlapping individuals resulted in fewer unique (private) alleles and a larger relative number of similar alleles. Additional data from several other loci would likely provide more species-diagnostic alleles and increase the differentiation among species. Other analyses in PAST using different coefficients of similarity (such as Jaccard's index and

Euclidean distance, not shown), gave different extents of overlap or separation for certain species.

The numbers of amplified alleles of each taxa for each microsatellite marker was characterized in Table 14. This table revealed that two loci, CIHYO and CJSU2, did not amplify as many alleles as the other two loci, A8G09 and AQLMF. This could be due to a smaller sample size, a problem with the amplification process, or the number of repeats of repeated sequences for each locus may just be too similar among the taxa. The comparison of loci also revealed that V. brittoniana had the lowest number of alleles using all loci except CIHYO. V. virginiana had the highest number of amplified alleles using the loci AQLMF and CIHYO. This could be explained by the high polyploidy of the taxa within this group and the fixed heterozygous condition, thus making the plants more resistant to the loss of genetic diversity despite the taxon’s very narrow endemic geographic range. V. pedatifida had the highest number of amplified in the locus CJSU2 65 and was also highly amplified in AQLMF. V. subsinuata amplified the most alleles using the locus A8G09 and showed relatively high numbers of alleles in all other loci except

AQLMF. The ranges of the alleles for this taxon were also very high indicating that some populations may include hybrids or represent multiple taxa and requires more intensive study to clarify this issue.

Eight additional loci have been preliminarily screened for polymorphisms and are planned to be genotyped for the same samples, to provide additional separation in future genetic analyses. Genotyping efforts in this study provide at least preliminary evidence that microsatellite variation will be successful with the additional primer pairs, and suggest that the four taxa are probably genetically different in nuclear microsatellites.

Figure 11. Principal coordinates analysis (PCoA) from the results of four microsatellite loci used to show the genetic distinctness of taxa. Circles represent 95% confidence intervals.

Table 14

Allele numbers and size ranges per population and per taxon, recovered from four microsatellite loci genotyped in the Viola pedatifida group. Populations that amplified and genotyped for substantially fewer alleles and expressed a substantially narrower range of allele sizes than other populations of the same taxon are highlighted in gray. See Table 12 for more specific voucher information. Taxon DNA # or Collector A8GO9 AQLMF CIHYO CJSU2 #, State (# samples) # Range # Range # Range # Range brittoniana HB507, New 4 136-166 12 101-239 8 102-180 9 54-114 England (6) brittoniana HB600, Virginia (8) 10 100-268 12 107-239 8 102-150 6 57-102 brittoniana HB607, New York 9 130-562 7 101-239 3 132-150 7 57-114 (5) brittoniana 14 100-562 18 101-239 12 102-180 10 54-114 SUBTOTAL pedatifida HB513, Nebraska 17 100-562 14 104-239 3 135-147 9 54-114 (9) pedatifida HB565, Michigan 13 115-451 15 101-239 7 111-147 10 51-114 (11) pedatifida HB572, Indiana (12) 18 100-442 18 101-239 6 111-147 10 57-114 pedatifida Gerdes 3790, 8 100-187 10 101-188 6 111-150 14 54-114 Minnesota (6) pedatifida Freeman25213, 11 115-586 9 107-167 6 120-150 8 57-99 Kansas (5) pedatifida 30 100-586 26 101-239 9 111-150 16 51-114 SUBTOTAL subsinuata HB563, Ohio (10) 27 100-535 9 107-239 16 102-150 4 57-99 subsinuata HB570, Michigan 14 103-442 5 101-239 6 102-141 8 57-105 (8) subsinuata HB590, Virginia (9) 7 136-442 6 110-254 9 117-159 12 54-114 subsinuata HB599, Virginia 21 100-592 6 104-239 11 102-159 14 54-114 (10) subsinuata HB601, Ohio (7) 14 112-499 7 104-239 14 102-162 7 57-102 subsinuata 37 100-592 16 101-254 19 102-162 17 54-114 SUBTOTAL virginiana HB592, Virginia (9) 12 106-442 15 101-251 16 102-168 11 57-114 virginiana HB593, Virginia 19 115-442 14 104-239 14 111-168 10 54-114 (11) virginiana HB596, Virginia 15 115-442 16 101-239 15 102-177 7 57-114 (11) virginiana HB597, Virginia (5) 10 100-442 8 101-176 7 102-172 5 57-114 virginiana HB606, Virginia 12 121-442 14 101-176 7 105-150 8 54-114 (10) virginiana 28 100-442 28 101-251 22 102-177 13 54-114 SUBTOTAL

CHAPTER 5: ECOLOGICAL STUDY

Introduction

Ecological niche data provide useful information for understanding species distributions, especially those that may be strictly endemic with limited geographic ranges. Extensive ecological studies have been illuminating for the Hawaiian violets

(Havran 2008), but have not been conducted with mainland North American violets. In particular, soil moisture and pH co-varied and provided the bulk of descriptive information in separating the locally sympatric Hawaiian violets in Havran's (2008) studies of ecological differentiation. In Gil-ad’s (1995) broad studies of violets in the

Boreali-Americanae, he conducted limited trials on soil characteristics with very few samples of two species, but he lacked the resources to explore the ecological aspects of other species in his dissertation research. However, he did note the importance of information concerning potential ecological differentiation among species.

The Mid-Appalachian shale barrens have been extensively studied by Platt (1951) and Keener (1983). In a series of experiments, Platt (1951) determined that shale barren endemism is not related to soil nutrients or moisture in the C horizon of the soil, but instead have adapted to the temperature, moisture, and subsurface of the edaphatic medium. Keener (1983) described the physical habitat of the shale barren region as being found on southern facing slopes steeper than 20º with relatively sparse vegetation and a rainy and temperate climate. Keener (1983) also indicated that shale barren endemics thrive under low herbaceous competition and tend to avoid extinction by their capacity to occupy niches that competitive species cannot grow. Keener (1983) also suggested that 69 speciation of endemics was due to an initial migration from the southwestern United

States and geographic isolation of diploid populations or ecotypic differentiation of subsets of adjacent species within the Appalachian forests.

This ecological study will further analyze the microhabitat of the highly endemic new species, V. virginiania, and to compare the pH and moisture ratio contents with those of other taxa within the V. pedatifida group.

Methods

In total, five populations of V. virginiana in Alleghany and Bath counties of

Virginia were studied and monitored. The following field observations were recorded in representative quadrats at each site and can be found in Table 15: slope, aspect, percent canopy cover, and general soil type(s) occupied.

Fifteen 1 m2 quadrats were positioned at each site in a semi-random fashion to include at least one specimen of V. virginiana across a visually uniform and recognizable habitat (namely, open shale barrens or shale woodland) and distributed to span any apparent environmental gradients. All measured ecological factors except for soil chemistry were recorded in these quadrats to characterize the microenvironment occupied by plants of the new species.

Three soil cores were taken within each quadrat centered on plants of the new species. The three cores were combined into a single sample. Soil core batch samples were placed in labeled paper lunch sacks and weighed to the nearest 0.01 g in the field with a portable balance. The sacks were then air-dried and reweighed 5-7 days later to obtain dry weight. The ratio of dry to moist soil weight was calculated as the percent 70 water content. Dried samples were analyzed to obtain pH using a glass electrode method

(McLean 1982). Soil samples from natural populations of V. pedatifida, V. brittoniana, and V. subsinuata were sent via collaborators for a comparative preliminary analysis to determine pH and soil moisture.

Light availability was estimated 1 meter above the center of fifteen quadrats using a densitometer. A small number of living plants from each study site were brought back from each field trip and maintained in the Ohio University greenhouse for subsequent study and observations.

Results and Discussion

The results from the comparative study of taxa suggest distinct differences in soil moisture and pH between taxa. The results of the microhabitat of V. virginiana from this study corresponded to a review of the habitat of the Mid-Appalachian shale barrens by

Keener (1983) and Platt (1951). Plants of V. virginiana tend to grow in isolated populations on very steep slow, where competition is very low and soil moisture is relatively high. V. virginiana occupies a much more moist and acidic microhabitat than

V. pedatifida and this information can be used as supporting evidence on ecological grounds for the delimitation of taxa. It is suggested that future studies should aim to gather more samples from the full extent of each taxon’s distribution range. These studies have the potential to be very revealing and could provide further comprehensive evidence of the divergence of microhabitats in Viola.

Table 15.

Ecological Data for Taxa in the Viola pedatifida Group.

Populations Moisture Aspect Slope Light Taxon pH Analyzed Ratio 127.1 virginiana 5 84.1% ± 0.8 5.39 ± 0.5 31.36º 52.91% (Southeast)

pedatifida 3 77.3% ± 0.8 6.30 ± 0.4 N/A N/A N/A

1 87.4% ± 0.0 4.24 ± 0.0 N/A N/A N/A brittoniana

subsinuata 1 87.3% ± 0.0 7.02 ± 0.0 N/A N/A N/A

Note: Aspect, slope, and canopy cover was not collected for the taxa V. pedatifida, V. brittoniana, and V. subsinuata in this study and was listed as N/A in the table above.

Biogeography and Habitat Descriptions

The biogeography of each taxon described in this study were compiled using information from the online phytogeographic database BONAP (Biota of North America

Program) (Kartesz 2015) and from the mapping of herbarium specimens of those examined for this study (See Appendix 2) using the software BRAHMS (Botanical

Research and Herbarium Management System) (Filer 2010).

V. brittoniana

Viola brittoniana is found along the eastern coastal plain. In the northern half of its range, in New Jersey northwards, it typically grows in open sites with moist sandy soils, bordering salt marshes or ecologically similar meadow environments (Russell

1965). Gil-ad (1995) reported that this violet is usually found in a sandy loam substrate.

In the southern half of its range, from Virginia to North Carolina, its habitat is commonly 72 under forest canopy, in moist to saturated loamy or mucky soils along streams and the borders of swamps (Ballard, pers. comm.). BONAP documents V. brittoniana extending as far south as South Carolina but this could be a result of misidentification and confusion with V. septemloba (Figure 16A). Mapping of herbarium specimens revealed no specimens south of North Carolina (Figure 12). In the southern half of its range, where its habitat becomes more forested, it is often replaced in open sites (especially in pine savannas) by the more southern V. septemloba Leconte. Generally, Viola brittoniana is uncommon to rare throughout its range, state-listed as threatened or endangered, if not presumed extirpated, in nearly every state. A quite rare and sporadic taxon, described originally as Viola pectinata E. P. Bicknell, has been treated at various ranks and even synonymized under Viola brittoniana. Reportedly differing from typical Viola brittoniana only in nearly undivided leaf blades but with prominently "pectinate" teeth on the lateral margins near the base of the blades, it has most often been found in close association with both V. brittoniana and V. cucullata, although in Virginia and North

Carolina it sometimes occurs alone. With conflicting evidence concerning its taxonomic and evolutionary identity, it is maintained as a form, f. pectinata (E. P. Bicknell) Gil-ad, but is mapped in a different color from f. brittoniana. It is listed for conservation purposes in a few states (e.g., New Jersey) separately from V. brittoniana.

Figure 12. Geographic distributions of examined herbarium specimens of V. brittoniana f. brittoniana and V. brittoniana f. pectinata.

V. pedatifida

V. pedatifida inhabits rich mesic black-soil prairies and prairie relicts in the

Midwest (McKinney 1992; Ballard 1994). It shows a decided inclination toward calcareous substrates. BONAP (Figure 16B) indicates its range to extend from Arizona in the west to Ohio and southern Ontario (where it is state-endangered) in the north and

Louisiana in the south. Mapped herbarium specimens are presented in Figure 13. At present, the only confirmed and truly typical specimen of Viola pedatifida in the eastern 74

Great Lakes region is represented by collections of Edward Moseley, taken in the late

1800s on Marblehead Peninsula in Ottawa County of northwestern Ohio, now presumed extirpated. All literatures reports and herbarium specimens of Viola pedatifida east of southwestern Michigan are referable to Viola subsinuata (see below). The geographic distribution of this species closely follows the Great Plains and Prairie Peninsula vegetation zone. In Illinois, Indiana and Michigan, the species is now imperiled and state- listed; since the early 1980s, most known strip prairie sites formerly harboring populations of it in Michigan have been severely decimated or completely destroyed by unregulated railway and road operations.

Figure 13. Geographic distributions of examined herbarium specimens of V. pedatifida.

V. subsinuata

The true distribution of V. subsinuata is not adequately characterized in current online atlases and databases, partly due to nomenclatural confusion with Viola palmata L. 75 and partly due to mistaken associations with morphologically similar hybrids involving

Viola pedatifida and unlobed-leaved species within the range of Viola pedatifida.

McKinney (1992) noted that this taxon occurs in mesic woods from Vermont to northeastern Georgia and as far west as Wisconsin and Illinois, the western portion of his attributed range mistakenly encompassing Viola pedatifida hybrids. The geographic map provided by BONAP (Figure 16C) shows the range as being much greater than even

McKinney suggested but also may be due to misidentifications by botanists unfamiliar with the taxon. Russell (1965) provided a generally accurate portrayal of this taxon's range, although he included Viola pedatifida hybrids in southwestern Michigan. No maps adequately portray the substantial number of historical locations for this taxon in Ohio, confirmed at The Ohio State University. The range is provided in Figure 14. Preliminary evidence presented here suggests that Viola subsinuata is likely a heterogeneous species complex with at least three and probably four different gene pools, as originally noted by

Brainerd in various publications, and Cronquist and Alexander (1952). Although

Brainerd suggested these were merely ecotypes and undeserving of formal recognition, subtle distinctions among them suggest otherwise, and future macromorphological, micromorphological and genetic studies based on both field and herbarium materials will clarify the taxonomic situation. 76

Figure 14. Geographic distributions of examined herbarium specimens of V. subsinuata.

V. virginiana

Populations of this violet are only known from Alleghany and Bath counties of western montane Virginia, in the mountain range north of the town of Clifton Forge. The highly restricted geographic distribution of this new species has been confirmed through comprehensive examinations of collections at several of the largest North American herbaria and also herbaria in Virginia, West Virginia and North Carolina; nearly all of the specimens for this violet reside at the Virginia Polytechnic Institute in Blacksburg. Platt's

(1950) report of this has been ignored by nearly all lay taxonomists and all specialists, except for botanists in Virginia. Until recently, Virginia botanists regarded their populations as disjunct representatives of Viola pedatifida. The present studies have provided convincing systematic evidence that the shale woodland violet is wholly distinct 77 from all other homophyllous cut-leaved violets and deserves recognition as a new species. This taxon occupies a very strict geographical range in a very specific habitat, occupying soils at the more calcareous end of the soil spectrum, and mostly under greater canopy cover in the shale barrens region of western Virginia. Thus, it is now termed more accurately a "shale woodland" species rather than a member of the open "shale barrens" vegetation. Generally, this member of the broader shale barrens region in the mid-

Appalachian region is suddenly one of the rarest and most restricted of the shale barrens endemics, vying for the title of "rarest" with Clematis addisonii Britton and Clematis viticaulis Steele, two herbaceous climbers wholly restricted to western Virginia, where they inhabit a few shale barrens sites in the same region as the new Viola species. The distribution is shown in Figure 15. Most a few populations lie within the Douthat State

Park, others on Beards and Short Mountains and along or near roads appear to be on private lands. The species may deserve federal listing under the Endangered Species Act.

Figure 15. Geographic distributions of examined herbarium specimens of V. virginiana. 78

Figure 16. Distributions of previously recognized taxa according to BONAP (Biota of

North America Project): A) V. brittoniana; B) Viola pedatifida; C) Viola subsinuata.

CHAPTER 6: TAXONOMIC REVISION

Names and descriptions of new taxa below do not constitute valid and effective publication in the printed version of this thesis or in the online version. The manuscript submitted for publication in printed form later will be used as the vehicle for valid publication of names.

Key to Species of the Viola pedatifida Group

1. Leaf blades with lateral margins at base "pectinate" with prominent sharply acute teeth but otherwise unlobed...... V. brittoniana f. pectinata

1. Leaf blades shallowly lobed or divided to deeply bi-, tri- or tetraternately divided...... 2

2. Leaf blades shallowly palmately lobed to moderately biternately dissected with

5–11 segments of approx. equal size and shape; petioles and at least abaxial

surface of leaf blades sparsely to moderately long-pubescent; seeds medium gray

with conspicuous dark to blackish elongate "dashes"...... ………V. subsinuata

2. Leaf blades ternately, bi-, tri- or tetraternately divided; foliage glabrous or

minutely short-pubescent; seeds either grayish with numerous minute dark to

blackish round spots, or uniformly yellowish- to orange-brown and unspotted...... 3

3. Foliage strictly glabrous; adaxial surface of leaf blades distinctly darker

than lower; largest leaf blades triternately (rarely tetraternately) divided,

basal portion of terminal and lateral segments constricted into a slender

elongate "petiolule" distinctly narrower than the distal lobes; spurred petal

glabrous within; cleistogamous capsule purple-spotted, borne on short

prostrate peduncle well below the summit of the petioles, sometimes 80 arching up just before dehiscence; seeds pinkish-gray to medium gray with dense minute blackish spots; shale woodlands, Alleghany and Bath counties of w. VA………..…….....…….….…………………V. virginiana

3. Foliage finely ciliate along margins, minutely appressed-pubescent along veins of both blade surfaces; both surfaces essentially the same color; largest leaf blades ternately to biternately (rarely tri-ternately) divided, basal portion of terminal and lateral segments not distinctly constricted; spurred petal densely bearded within; cleistogamous capsule green, unspotted, on erect long peduncle borne near or above the summit of the petioles; seeds uniformly dark orange-yellow to yellowish-brown, unspotted; open sites.…...... ………………………………………………………….....…4

4. Largest leaf blades mostly ternately or sometimes biternately

divided, primary portion of the terminal segment commonly

distinctly broader than its lateral lobes or the primary portion of the

lateral segments; seeds 1.3–1.8 mm long; eastern Atlantic

coast……………………………...... …V. brittoniana f. brittoniana

4. Largest leaf blades biternately (rarely triternately) divided,

primary portion of the terminal segment not distinctly broader than

its lateral lobes or the primary portion of the lateral segments;

seeds 1.7–2.2 mm long; mesic blacksoil prairies, Great Plains east

to MI, n. OH…………………………………….……V. pedatifida 81

Descriptions of the Taxa

Viola brittoniana Pollard, Bot. Gaz. 26: 332. 1898. Britton's violet, Northern coast violet.

Substitute name of Viola atlantica Britton, Bull. Torr. Bot. Club 24:92. 1897, not Pomel,

Nouv. Mat. Fl. Atl.: 215. 1874. Viola pedatifida G.Don subsp. brittoniana (Pollard)

L.E.McKinne, Sida Bot. Misc. 7: 22. 1992. Type. USA. New York. Richmond Co.:

Staten Island, along salt meadows, 8 June 1888, N. L. Britton s.n. (lectotype, erroneously designated by McKinney (1992) as holotype: NY!).

Hybrids involving Viola brittoniana:

Viola ×davisii House [Viola affinis × brittoniana], Bull. New York State Mus. Nat. Hist.

254: 503. 1924.

Viola ×eamesii House [Viola brittoniana × subsinuata, listed originally as Viola

brittoniana × palmata], Bull. New York State Mus. Nat. Hist. 254: 507. 1924.

Viola ×insolita House [Viola brittoniana × sororia, listed originally as Viola brittoniana

× papilionacea], Bull. New York State Mus. Nat. Hist. 254: 507. 1924.

Viola ×egregia House [Viola brittoniana × sororia], Bull. New York State Mus.

Nat. Hist. 266: 25. 1925.

Viola ×holmiana House [Viola brittoniana × emarginata], Bull. New York State Mus.

Nat. Hist. 254: 507. 1924.

Viola ×marylandica House [Viola brittoniana × sagittata], Bull. New York State Mus.

Nat. Hist. 254: 507. 1924. 82

Viola ×muleafordiae Pollard [Viola brittoniana × fimbriatula, specific epithet originally

misspelled as 'muleafordae'], Proc. Biol. Soc. Washington 15: 203. 1902.

Viola ×notabilis E. P. Bicknell [Viola brittoniana × cucullata], Torreya 4: 131. 1904.

Viola ×lavandulacea E. P. Bicknell [Viola brittoniana × lanceolata], Torreya 4: 130.

1904.

Viola brittoniana × palmata

Viola brittoniana × septemloba

Acaulescent 5–26 cm tall, homophyllous perennial herb, from succulent short to somewhat elongate vertical to ascending rhizome, with slender unbranched or weakly branched roots; stolons absent; leaves ascending to spreading; stipules free, linear- lanceolate to ovate-lanceolate, membranous, margins irregularly glandular-fimbriate, glabrous, eciliate; petioles longer than blade, glabrous; largest leaf blades 32–75 × 23–95 cm, homophyllous, blades of smallest leaves shallowly lobed especially at base, larger leaves deeply ternately or (at least the terminal segment) biternately divided, the primary portion of the terminal segment commonly distinctly broader than its lateral lobe, adaxial surface green finely appressed-pubescent along veins, abaxial surface green commonly tinged with purple and glabrous, outline narrowly to broadly ovate, base subtruncate to cordate, margins entire proximally, irregularly serrulate distally, ciliolate, apex acute to obtuse; chasmogamous peduncle held among the leaves, glabrous; chasmogamous flower

14–26 mm long; lowest sepal lanceolate, acute, margins scarious-margined, irregularly ciliate (occasionally eciliate), glabrous; auricles short or developed, rounded to subquadrate, apex entire or erose, elongating to 2–3 mm in fr, glabrous, irregularly 83 ciliate; corolla color blue to purple, throat white; spur short-globose; spurred pet beard dense, lateral pet beards dense, trichomes narrowly linear; style slender, slightly expanded into scoop-shaped truncate apex; cleistogamous flowers present in summer, on peduncles similar to chasmogamous flowers but commonly shorter than the leaves; chasmogamous and cleistogamous capsules 9–18 mm long, oblong-ovoid, yellow-green drying tan, glabrous; seeds 1.3–1.8 mm long, obovoid, medium dark to dark orange- yellow to orange-brown, unspotted; 2n=54. Moist to seasonally inundated sandy soils of fields, meadows, trail edges, and forest clearings adjacent to rivers and coastal marshes, also peaty river shores; Atlantic coast, MA s. to SC. Chasmogamous flower Apr–Jun, chasmogamous fruit May–Jul, cleist fr Jul–Aug. infrequent to rare; secure, concern: CT,

DE, MA, MD, NY, NC, NJ, SC, VA.

Taxonomic comments. Occasional plants within the known range of V. brittoniana have larger leaf blades moderately divided, ciliate along margins and sparsely hirtellous along veins, and smallest leaves completely undivided. These have often been attributed to V. septemloba but are not typical, and they show signs of hybrid derivation from V. brittoniana and V. sagittata. Gil-ad (1997) listed the name Viola baxteri House as a synonym of Viola brittoniana Pollard. However, the description and type material clearly characterize the plants as having distinctly villous leaf blades and petioles, and cleistogamous capsules on prostrate peduncles. Moreover, the type was collected in woodlands in northwestern New York well off the Atlantic Coastal Plain. House's plant is an exact match for the eastern Great Lakes phenotype of Viola subsinuata (Greene)

Greene, and for the moment is included under that species. The taxonomic and 84 evolutionary status of Viola pectinata E. P. Bicknell is still debatable and is presently under study. For the present, it is here treated as f. pectinata (E. P. Bicknell) Gil-ad under

Viola brittoniana. Preliminary evidence arguing against this status includes the Viola cucullata haplotype recovered in chloroplast spacer sequences from two New England populations of V. pectinata, high levels of chasmogamous and cleistogamous seed production and viability observed in North Carolina populations and reported elsewhere, and subtle differences from Viola brittoniana in petal trichome and seed coat micromorphology noted by Gil-ad (1997) [but generally disregarded] support the hypothesis that V. pectinata may be a recurrently produced series of fertile later- generation hybrid derivatives from Viola brittoniana and Viola cucullata. Range wide sampling and more intensive study is needed.

Viola pedatifida G. Don, Gen. Hist. 1: 320. 1831. Prairie bird's-foot violet. Viola palmata

L. var. pedatifida (G. Don) Cronquist in Gleason & Cronquist, Manual Pl. Northeastern

U.S., ed. 2: 864. 1991. Type: "North America...Clt. 1826" (holotype: not found).

Viola delphinifolia Nutt. ex Torr. & A.Gray, Fl. N. Amer. 1: 136. 1838.

Hybrids involving Viola pedatifida:

Viola ×bernardii (Greene) Greene [Viola pedatifida × sororia], Pittonia 5: 123. 1903.

Viola pedatifida G. Don var. bernardii Greene, Pittonia 3: 259. 1898.

Viola indivisa Greene, Pittonia 5: 124, pl. 13. 1903.

Viola fallacissima Greene, Leafl. bot. observ. 1(4): 185. 1906. 85

Viola perpensa Greene, Leafl. bot. observ. 1(4): 184. 1906.

Viola ×wilmattae Pollard & Cockerell [Viola nephrophylla × pedatifida], Proc. Biol. Soc.

Washington 15: 178. 1902.

Viola pedatifida × sagittata

Acaulescent 9–27 cm tall, homophyllous perennial herb, from succulent short or occasionally somewhat elongate vertical to ascending rhizome, with slender to moderately stout weakly branched roots; stolons absent; leaves erect or ascending; stipules free, linear-lanceolate to ovate-lanceolate, membranous, margins irregularly glandular-fimbriate, glabrous, eciliate or sparsely ciliolate; petioles longer than the blade, glabrous or sparsely to moderately hirtellous, at least basally; largest leaf blades 20–55 ×

30–87 mm, homophyllous, blades of smallest leaves shallowly to moderately lobed, larger leaves deeply biternately (occasionally triternately) divided, the primary portion of the terminal segment not distinctly broader than lateral lobes on it or primary portions of, green and glabrate to sparsely appressed-hirtellous on adaxial surface, green often tinged with purple and glabrate to moderately appressed-hirtellous on abaxial surface, outline broadly ovate to reniform, base broadly cuneate or truncated to subcordate, margins entire, ciliolate, apex obtuse to truncate; chasmogamous peduncle held among or above the leaves, glabrous or sparsely hirtellous; chasmogamous flower 14–25 mm long; lowest sep lanceolate, sharply acute, margins scarious-margined, ciliate, glabrous; auricles short to somewhat developed, subquadrate, apex entire, elongating to 2.9 mm, glabrous, ciliate; corolla color blue to purple, throat white; spur short-globose; spurred pet beard dense, 86 lateral pet beards dense, trichomes narrowly linear; style slender, slightly expanded into scoop-shaped truncate apex; cleistogamous flowers present in summer, similar to chasmogamous flowers, peduncles nearly or quite as tall as the petioles; chasmogamous and cleistogamous capsules 9–12 mm long, oblong-ovoid, green drying tan, glabrous; seeds 1.7–2.2(2.5) mm long, obovoid, light to medium yellowish-brown, unspotted;

2n=54. Rich organic loam of dry-mesic and mesic prairies; Great Plains and Prairie

Province, w. MI and w. IN to AB, s. to nw. AR, e. OK, NM and AZ, slightly disjunct

(and now extirpated) on Marblehead Peninsula, OH. Chasmogamous flower Apr–May, chasmogamous fruit May–Jun, cleistogamous fruit May–Aug. Infreq to rare; secure, concern: IN, MI, OH (VA is a new species, see V. virginiana)..

Taxonomic comments. A very uniform species, almost strictly confined to mesic prairies and prairie-like sites. Previously reported disjunct populations of this species in the mountains of w. VA are a new shale woodland species, V. virginiana.

Viola subsinuata (Greene) Greene, Pittonia 4: 4. 1899. Early violet, Hand-leaved violet.

Viola emarginata (Nutt.) Leconte var. subsinuata Greene, Pittonia 3: 313. 1898. Type:

Tennessee. Cocke Co.: Within 3 mi. of Woleaf Creek Station, 11 Sep 1897, Kearney 615

(holotype: NDG, image seen!).

Viola baxteri House, Bull. New York State Mus. Nat. Hist. 254: 500. 1924. Type: New

York. Ontario Co.: Fishers, June 2, 1916, H. D. House s.n. (syntype: NY97505!).

Hybrids involving Viola subsinuata: 87

Viola ×angellae Pollard, [Viola palmata L. × subsinuata, as Viola palmata × triloba

Schwein.] Torreya 2: 24. 1902.

Viola ×discors House [Viola affinis Leconte × subsinuata, as Viola affinis × palmata],

Bull. New York State Mus. Nat. Hist. 254: 503. 1924.

Viola ×excerpta House [Viola fimbriatula Sm. × subsinuata], Bull. New York State Mus.

Nat. Hist. 254: 501. 1924

Viola ×convicta House [Viola fimbriatula Sm. × subsinuata, as Viola baxteri ×

fimbriatula], Bull. New York State Mus. Nat. Hist. 254: 506. 1924.

Viola ×mistura House [Viola sagittata Aiton × subsinuata, as Viola palmata × sagittata ],

Bull. New York State Mus. Nat. Hist. 254: 500. 1924.

Viola ×modica House [Viola sororia Willd. × subsinuata, as Viola palmata ×

papilionacea], Bull. New York State Mus. Nat. Hist. 254: 500. 1924.

Viola ×peckiana House [Viola sororia Willd. × subsinuata, as Viola palmata × sororia],

Bull. New York State Mus. Nat. Hist. 254: 500. 1924.

Viola ×ravida House [Viola hirsutula Brainerd × subsinuata, as Viola hirsutula ×

palmata], Bull. New York State Mus. Nat. Hist. 254: 502. 1924.

Viola ×ryoniae House [Viola cucullata × subsinuata, as Viola cucullata × palmata,

specific epithet originally misspelled as 'ryonii'], Bull. New York State Mus. Nat.

Hist. 254: 505. 1924.

Acaulescent 5–31 cm tall, homophyllous perennial herb, from succulent short to elongate ascending rhizome, with slender unbranched or branched roots; stolons absent; leaves 88 ascending; stipules free, linear-lanceolate to ovate-lanceolate, membranous, margins irregularly glandular-fimbriate, glabrous, eciliate or ciliate; petioles about as long as to longer than the blade, villous; largest leaf blades 23–90 × 26–95 mm, homophyllous, smaller leaves shallowly to moderately lobed, larger leaves shallowly to deeply divided into 5–11(15) linear to narrowly ovate lobes, or biternately (rarely triternately) dissected, pale to medium green on both sides, adaxial surface sparsely to moderately hirtellous or hispidulous (rarely glabrous), abaxial surface villous (rarely glabrous), outline narrowly ovate to ovate, base cordate, margins entire to irregularly or remotely serrate, ciliate or eciliate, apex acute to obtuse; chasmogamous peduncle held among the leaves, glabrous to sparsely villous; chasmogamous flower 14–25 mm long; lowest sep broadly lanceolate to ovate, obtuse to rounded (rarely acute), margins scarious-margined, ciliate or eciliate, glabrous; auricles short, rounded, apex entire, not elongating in fruit or elongating to 1 mm, glabrous, eciliate or ciliate; corolla color blue to purple, throat white; spur short- globose; spurred pet beard absent (infrequently sparse to dense), lateral pet beards dense, trichomes slightly to moderately broadened distally; style slender, slightly expanded into scoop-shaped truncate apex; cleistogamous flowers present in summer, different from chasmogamous, peduncle prostrate, arching just before dehiscence, shorter than petioles, glabrous or villous, capsule 6–8 mm long, oblong-ovoid or short-ovoid to subglobose, green drying tan, with faint spots or heavy purple blotches, glabrous; seeds 2.0–2.3 mm long, obovoid to broadly obovoid, medium rose-gray to dark gray-brown, with purple

'dashes' or irregular to dense black blotches; 2n=54. Sandy or rocky loam of dry-mesic forests, calciphilic and often associated with limestone; primarily Western Allegheny 89

Plateau and Appalachians extending into e. Great Lakes, VT and MA to se. MI, s. to nw.

GA, ne. AL, e. KY and sw. OH. Chasmogamous flower Apr–May, chasmogamous fruit

Apr–Jun, cleistogamous fruit May–Aug.

Taxonomic comments. Nomenclatural confusion between this and V. palmata L. as misapplied by Brainerd and others, as well as taxonomic confusion between plants of this and de novo hybrids involving Viola pedatifida and unlobed-leaved species, have rendered distributional information grossly inaccurate and highly suspect. This is almost certainly a species complex, supported by micromorphological evidence from petal trichomes and seed coats in this thesis, encompassing cryptic taxa that may deserve species status, as well as widespread local hybridization of such cryptic taxa with unlobed-leaved species. Viola subsinuata in the broad sense expresses a wide range of variation in foliage pubescence, leaf blade dissection and lobing, floral features, cleistogamous capsule and seed traits, and is the focus of current studies. The species as a whole shows a strong predilection for moist loamy alkaline substrates, often overlying limestone or mafic formations, in contrast to Viola palmata L. with its preference for drier acidic sandy soils.

Viola virginiana Zumwalde & H. E. Ballard. Virginia violet.

Type: USA. Virginia. Bath Co.: 29 April 2014, Zumwalde & Ballard s.n. (holotype:will be submitted to MO!).

Acaulescent 4–19 cm tall, homophyllous perennial herb, from succulent short to somewhat elongate vertical to horizontal rhizome, with slender branched roots; stolons 90 absent; leaves spreading; stipules free, linear-lanceolate to ovate-lanceolate, membranous, margins irregularly glandular-fimbriate, glabrous, eciliate; petioles about as long as to longer than the blade, glabrous; largest leaf blades 35–110 × 45–150 mm, homophyllous, smallest leaves moderately lobed, larger leaves deeply triternately or tetraternately dissected, the primary portion of the terminal segment not distinctly broader than its lateral lobes or the primary portion of the lateral segments, medium to dark (gray-

)green above, pale green below, both surfaces glabrous, outline broadly ovate to reniform or orbicular, base subcordate to cordate, margins entire, eciliate, apex rounded; chasmogamous peduncle held above the leaves early in flower, often among the leaves later, glabrous; chasmogamous flower 14–21 mm long; lowest sep ovate-lanceolate to narrowly ovate, obtuse or rounded, margins broadly scarious-margined, eciliate or sparsely ciliate, glabrous; auricles short, rounded or subquadrate, apex entire, not elongating in fr, glabrous, eciliate; corolla color blue to purple, exposed proximal portion of pet white, throat white; spur short-globose; spurred pet beard absent or sparse, lateral pet beards dense, trichomes narrowly linear; style slender, slightly expanded into scoop- shaped truncate apex; cleistogamous flowers present in summer, different from chasmogamous, peduncle prostrate, arching just before dehiscence, shorter than petioles, glabrous, capsule 6–9 mm long, short-ovoid, green drying tan, with fine irregular purple blotches, glabrous; seeds 2.0 mm long, broadly obovoid, rose-gray to light brown, with dense minute black spots. Dryish to seasonally moist alkaline sand and rock outcrops in shale woodlands; Alleghany and Bath Cos., VA. Chasmogamous flower Apr, 91 chasmogamous fruit May, cleistogamous fruit May–Aug. Infrequent to rare; secure, concern: VA [as V. pedatifida].

REFERENCES

Babaei, N., Abdullah, N., Saleh, G., & Abdullah, T. Isolation and characterization of microsatellite markers and analysis of genetic variability in Curculigo latifolia Dryand. Mol. Bio. Rep., 39: 9869-9877.

Ballard, H. E. 1992. Systematics of Viola Section Viola in North America north of Mexico. M.S. thesis, Central Michigan University, Mt. Pleasant, Michigan.

Ballard, H. E. 1994. Violets of Michigan. Michigan Botanist 33: 131-199.

Ballard, H. E. 2007. Violaceae. In: Heywood, V. H., R. K. Brummitt, A. Culham, and O. Seberg, Flowerowering plant families of the world. Royal Botanic Gardens, Kew, England. 331-333.

Ballard, H. E. & D. Wujek. 1994. Evidence for the recognition of Viola appalachiensis. Systematic Botany 19: 523-538.

Ballard H. E., K. J. Sytsma and R. R. Kowal. 1998. Shrinking the violets: Phylogenetic relationships of infrageneric groups in Viola (Violaceae) based on internal transcribed spacer DNA sequences. Systematic Botany 23: 439–458.

Ballard, H. E., D. A. Casamatta, M. M. Hall, R. A. McCauley, M. C. Segovia Salcedo, and R. G. Verb. 2001. Phenetic analysis shows conspecifity between Hispaniolan Viola domingensis Urban and North American Viola macloskeyi sensu lato (Violaceae). Brittonia 53: 122-136.

Ballard, H. E., Jr., J. Paula Souza, and G. A. Wahlert. 2014. Violaceae. Pp. 303-322 In: Kubitzki, K. (ed.), The families and genera of vascular plants. Springer-Verlag, Berlin.

Beattie, A.J. 1976. Plant dispersion, pollination, and gene flowerow in Viola. Oecologia 25: 291-300.

Becker, W. 1925. Viola. In: Engler, A., and L Prantl, Die Natürlichen Pfloweranzenfamilien. 21 Band. Parietales and Opuntiales. Duncker and Humblot, Berlin, Germany: 363-376.

Borgstrom, G. 1939. Formation of cleistogamic and chasmogamic flowers in wild violets as a photoperiodic response. Nature 144: 514-515.

Brainerd E. 1904a. Hybridism in the genus Viola. Rhodora 6: 213-224.

Brainerd E. 1904b. Hybridism in the genus Viola III. Rhodora 8: 49-61. Brainerd E. 1905. Notes on New England violets II. Rhodora 7: 1-9. 93

Brainerd E. 1909. Another hybrid between a white and a blue violet. Rhodora 11: 115– 116.

Brainerd E. 1910. Viola palmate and its allies. Bulletin of the Torrey Botanical Club 37: 181-190.

Brainerd E. 1913. Four hybrids of Viola pedatifida. Bulletin of the Torrey Botanical Club 40: 249-260.

Brainerd, E. 1921. Violets of North America. Vermont Agricultural Experiment Station Bulletin 224.

Brainerd, E. 1924. Some natural violet hybrids of North America. Vermont Agricultural Experiment Station Bulletin 239.

Brainerd, E. and V. Baird. 1942. Wild Violets of North America. University of California Press, Berkeley and Los Angeles, California.

Clausen, J. 1929. Chromosome number and relationship of some North American species of Viola. Annals of Botany 43: 741-764.

Culley, T. M. 2002. Reproductive biology and delayed selfing in Viola pubescens (Violaceae), an understory herb with chasmogamous and cleistogamous flowers. International Journal of Plant Sciences 163: 113-122.

Culley, T. M., Stamper, T. I., Stokes, R. L., Brzyski, J. R., Hardiman, N. A., Klooster, M. R., & Merritt, B. J. 2013. An efficient technique for primer development and application that integrates fluorescent labeling and multiplex PCR. App. in Plant Sci., 1(10).

Excoffier, L. L. Guillaume, and S. Schneider. 2007. Arlequin (version 3.0): An integrated software package for population genetic analysis. Evolutionary Bioinformatics Online. 2005; 1: 47-50. Accessed: Biohttp://www.ncbi.nlm.nih.gov/pmc/articles/PMC2658868/

Fernald, M.L. 1950. Gray’s Manual of Botany, ed. 8. American Book Company, New York, New York: 1022-1042.

Filer, D. L. 2010. Botanical research and herbarium management system – BRAHMS. Training guide with worked examples.. Dept of Plant Sciences, Univ. of Oxford, http://dps.plants. ox.ac.uk/bol/content/documentation/BRAHMStraining2010.Pdf

Gershoy, A. 1928. Studies in North American violets. I. General considerations. Vermont Agricultural Experiment Station Bulletin 279.

Gershoy, A. 1934. Studies in North American violets. III. Chromosome numbers and species characters. Vermont Agricultural Experiment Station Bulletin 367.

Gil-ad, N. L. 1995. Systematics and evolution of Viola L. subsection Boreali-Americanae (W. Becker) Brizicky. Ph.D. dissertation, University of Michigan, Ann Arbor, Michigan.

Gil-ad, N. L. 1997. Systematics of Viola subsection Boreali-Americanae. Boissiera 53: 1- 130.

Gil-ad, N. L. 1998. The micromorphologies of seed coats and petal trichomes of the taxa of Viola subsect. Boreali-Americanae (Violaceae) and their utility in discerning orthospecies from hybrids. Brittonia 50: 91-121.

Gleason, H. A. and E. J. Alexander. 1952. Violaceae. The New Britton and Brown Illustrated Flowerora of the Northeastern United States and Adjacent Canada vol. 2. Pp. 553-567.

Gleason, H. A. & A. Cronquist. 199l. Manual of vascular plants of northeastern United States and adjacent Canada, ed. 2. New York Botanical Garden Press, Bronx.

Goldstein, D. B. and C. Schlotterer. 1999. Microsatellites: evolution and applications. Oxford University Press, Oxford.

Greene, E. L. 1899. Four new violets. Pittonia 4: 64–67.

Hammer, O., D. A. T. Harper, and P. D. Ryan. 2013. PAST: Paleontological Statistics Software package for education and data analysis. Accessed: http://palaeo- electronica.org/2001_1/past/issue1_01.html

Havran, J. C. 2008. Ecology and evolution of the Hawaiian violets. Doctoral dissertation, Ohio University, Athens, OH.

Holmgren, P. K., N. H. Holmgren, and L. C. Bernett. 1990. Index herbariorum, part I: the herbaria of the world, 8th ed. Bronx: New York Botanical Garden.

Horb, O. V. 1994. Pollen morphology of section Melanium Ging. of genus Viola L. of Ukraine. Ukr. Bot. Zh. 51: 78–85.

Kartesz, J.T., The Biota of North America Program (BONAP). 2015. North American Plant Atlas. (http://bonap.net/napa). Chapel Hill, N.C. [maps generated from Kartesz, J.T. 2015. Floristic Synthesis of North America, Version 1.0. Biota of North America Program (BONAP). (in press)].

Keener, C. S. 1983. Distribution and biohistory of the endemic flora of the Mid- Appalachian Shale Barrens. Botanical Review 49 (1): 65-115.

Kosman, E. and K.J. Leonard. 2005. Similarity coefficients for molecular markers in studies of genetic relationships between individuals for haploid, diploid, and polyploidy species. Mol. Ecol. 14: 415-424.

Marcussen, T., K. S. Jakobsen, J. Danihelka, H. E. Ballard, K. Blaxland, A. K. Brysting, and B. Oxelman. 2012 [“2011”]. Inferring species networks from gene trees in high- polyploid North American and Hawaiian violets (Viola, Violaceae). Systematic Biology 60: 1-20.

McKinney, L. E. 1992. A taxonomic revision of the acaulescent blue violets (Viola) of North America. Sida, Botanical Miscellany 7.

McLean, E. O. 1982. Soil pH and lime requirement. In Page, A. L., R.H. Miller and D.R. Keeney (eds.) Methods of soil analysis. Part 2- Chemical and microbiological properties. (2nd Ed.). Agronomy 9:199-223.

Meglécz, E., C. Costedoat, V. Debut, A. Gilles, T. Malausa, N. Pech, and J.-F. Martin. 2010. QDD: A user-friendly program to select microsatellite markers and design primers from large sequencing projects. Bioinformatics Applications Note 26: 403-404.

NatureServe. 2013. NatureServe Explorer: An online encyclopedia of life [web application]. Version 7.1. NatureServe, Arlington, Virginia. http://www.natureserve.org/explorer

Olson, M., L. Hood, C. Cantor, and D. Botstein. 1989. A common language for physical mapping of the human genome. Science 245: 1434-1435.

Paula-Souza, J. and H. E. Ballard, Jr. 2014. Re-establishment of the name Pombalia and new combinations from the polyphyletic Hybanthus (Violaceae). Phytotaxa 183: 1-15. http://dx.doi.org/10.11646/phytotaxa.183.1.1

Platt, R. B. 1950. Two mid-Appalachian violets. Castanea 15: 126-129.

Pritchard, J. K., M. Stephens, and P. Donnelly. 2000. Inference of population structure using multilocus genotype data. Genetics 155: 945–959.

Rasband, W. 1997-2011. ImageJ. Retrieved from http://imagej.nih.gov/ij

Ricca, M. and A. J. Shaw. 2010. Allopolyploidy and homoploid hybridization in the Sphagnum subsecundum complex (Sphagnaceae: Bryophyta). Biological Journal of the Linnaean Society 99: 135–151. 96

Russell, N. H. 1960. Studies in the photoperiodic responses of violets (Viola). Southwestern Naturalist 5: 177-186.

Russell, N. H. 1965. Violets (Viola) of the central and eastern United States: an introductory survey. Sida 1: 1-113.

Selkoe, K. A. and R. J. Toonen 2006. Microsatellites for ecologists: A practical guide to using and evaluating microsatellite markers. Ecological Letters 9: 615–629.

Sokal, R. R. and T. J. Crovello. 1970. The biological species concept: A critical evaluation. The American Naturalist 104: 127-153.

Takayama, K., P. López S., C. König, G. Kohl, J. Novak, and T. F. Stuessy. 2011. A simple and cost-effective approach for microsatellite isolation in non-model plant species using small-scale 454 pyrosequencing. Taxon 60: 1441-1449.

Valentine, D. H. 1962. Variation and evolution in the genus Viola. Preslia 34: 190-206.

Wahlert, G. A., T. Marcussen, J. de Paula-Souza, M. Feng, and H. E. Ballard, Jr. 2014. A phylogeny of the Violaceae (Malpighiales) inferred from plastid DNA sequences: Implications for generic diversity and intrafamilial taxonomy. Systematic Botany 39: 239-252.

Yost, S. E. 1987. The effect of shade on petiole length in the Viola fimbriatula-sagittata complex (Violaceae). Brittoniana 39: 180-187.

APPENDIX 1: ADDITIONAL MACROMORPHOLOGICAL TRAITS EXAMINED

Traits V. virginiana V. pedatifida V. subsinuata V. brittoniana V. pectinata Leaf Entirely Finely Ciliolate or Glaborous , Villous pubescence glaborous ciliate along glaborous eciliate margins Leaf dissection 3-4 orders 2-3 orders 2 (rarely 3) 2-3 orders 1 order orders Leaf divisions Distinct No No No No petiolate Chasmogamous Declined Erect Erect Erect Erect flower peduncle Sepal shape Oblong, Lanceolate, Lanceolate to Lanceolate, Lanceolate, obtuse to narrowly ovate acute acute rounded acute Sepal auricles Short, Conspicuous Short, Short or Short or rounded , quadrate rounded developed, developed, rounded rounded Spurred petal Absent Present, Absent Present, dense Present, beard numerous (infrequently hairs dense hairs hairs sparse to dense) Chasmogamous Ovoid to Long-ovoid, oblong, ovoid Oblong, ovoid Oblong, fruit shape short- ovoid ellipsoid ovoid Chasmogamous Green drying Green Green drying Yellow/green Yellow/green fruit color tan drying tan tan drying tan drying tan Cleistogamous Short and Long and Short, Short, erect Short, fruit peduncle prostrate erect prostrate prostrate Cleistogamous Short- ovoid Long-ovoid, oblong, ovoid Oblong, ovoid Oblong, fruit shape ellipsoid ovoid Cleistogamous Green drying Green Green drying Yellow/green Yellow/green fruit color tan, drying tan, tan, faint drying tan drying tan red/purple unspotted purple spots spotted Peak anthesis Mid-April Mid-May Late Late April/ Late April/ April/Early Early May Early May May Seed color gray to yellowish- Gray to dark yellowish yellowish brown, dense brown, brown, dense brown to brown to spots unspotted dash marks orange, orange, unspotted unspotted 98

APPENDIX 2: SPECIMENS EXAMINED

Viola brittoniana Pollard f. brittoniana

USA. Connecticut. Fairfield Co.: Stratford, 11/06/1899, Eames, E.H. s.n. (MO); Stratford, 11/06/1899, Eames, E.H. s.n. (NY); Stratford, 31/05/1901, Eames, E.H. s.n. (NY); Fairfield Co, 24/04/1893, E.H.E. s.n. (US); Stratford, 31/05/1901, Eames, E.H., 135 (NY). Delaware. Kent Co.: Bombay Hook, 10/06/1880, Commons, A. s.n. (NY); Sussex Co.: Bethany Beach, 14/05/1946, Ripley, H.D., Barneby, R.C. 7308 (NY); Rehoboth, 08/07/1908, Williamson, C.S. s.n. (NY); Along Railroad, 3/4 mile north of Howland's Glade; 3 miles NW of Rehoboth, 09/05/1936, Tatnall, R.R. s.n. (GH). Maryland. Baltimore Co.: Lakeland, 04/05/1901, Pond, R.H. s.n. (MO); Cecil Co.: Near Stony Run, 00/06/1913, Holm, T. s.n. (MO); In Cane Break: Stony run, 03/06/1913, Tidestrom, I., 6311 (US); Prince Georges Co.: Near Riverdale, 08/06/1905, House, H.D., 988 (MO); near Riverdale, 01/05/1905, House, H.D., 626 (NY); Sandy barren, Hyattsville, 25/06/1899, Maxon, W.R., Pollard, C.L. s.n. (MO); , 28/09/1913, Greene, E.L. s.n. (US); Washington D.C, 00/05/1893, J.H.B. s.n. (NY); Sandy barren, Hyattsville, 25/06/1899, Maxon, W.R., Pollard, C.L. s.n. (NY); Riverdale, 08/06/1905, House, H.D., 988 (GH); Hyattsville, 25/06/1899, Pollard, C.L., Maxon, W.R. s.n. (NY); Hyattsville, 14/05/1899, Maxon, W.R., Pollard, C.L. s.n. (US); Hyattsville, 06/07/1910, Dowell, P., 6279 (US); Patuxent Research Refuge, 11/08/1938, Hotchkiss, N., 6011 (US); Near Hyattsville, 30/04/1916, Hitchcock, A.S. s.n. (US); Riverdale, 01/05/1905, House, H.D., 638 (US); D.C., Near Riverdale, 14/05/1899, Maxon, W.R., 117 (US); D.C., Near Riverdale, 00/00/1905, House, H.D., 988 (US); Bladensburg, D.C, 09/05/1817, C.L.D. s.n. (US); D.C., Hyattsville, 14/05/1899, Maxon, W.R., 123 (US); Hyattsville, 14/05/1899, Maxon, W.R., 123 (US); Talbot Co.: 0.5 miles N.E. of Trappe Station, 30/09/1945, Earle, E.C., 4189 (GH); 30/04/1898, Greene, E.L. s.n. (US). Massachusetts. Middlesex Co.: Carlisle, Concord River, 19/05/1910, Batchelder, C.F. s.n. (US); Concord, Concord river, 30/05/1894, Churchill, J.R. s.n. (MO); Carlisle, Concord River, 19/05/1910, Batchelder, C.F. s.n. (NY); Norfolk Co.: Dedham, 26/05/1905, Brainerd, E. s.n. (MO); Dedham, 18/08/1905, Brainerd, E. s.n. (MO); Brookline, 17/06/1910, Dodge, C.K. s.n. (NY); Dedham, along the Charles River, 23/08/1910, Brainerd, E. s.n. (US); Dedham, along the Charles River, 23/08/1910, Brainerd, E. s.n. (US); Dedham, along the Charles River, 23/08/1910, Brainerd, E. s.n. (MO); Dedham, along the Charles River, 23/08/1910, Brainerd, E. s.n. (NY). New Jersey. Atlantic Co.: Great Island, 01/06/1890, ? s.n. (NY); Burlington Co.: Grassy bank roadside 5 miles south of pemberton, 24/05/1931, Rusk, H.M., Svenson, H.K. 4474 (MO); Burlington Co.: Near Vincentown, 24/05/1931, Drushil, J.A., 7804 (MO); Camden Co.: Transplanted from Springdale, NJ, May 1907, Witmer Stone donor, ex horto E. Brainerd 18, 22/05/1910, Brainerd, E., 18 (MO); Springdale, 10/05/1903, Stone, W.S., 5114 (NY); Springdale, 27/06/1903, Herb, W.S., 5115 (GH); Springdale, 27/06/1903, Herb, W.S., 5115 (NY); Springdale, 10/05/1903, Herb, W.S., 5114 (GH); Gloucester Co.: S.W. along P.R.R., Mickletion, 13/06/1918, Long, B., 19033 (GH); Middlesex Co.: Woodbridge, 30/05/1890, Churchill, 99

J.R. s.n. (MO); Weston's Mills, 08/05/1945, Edwards, J.L. s.n. (NY); Metuchen, 12/05/1907, Mackenzie, K.K. s.n. (NY); Metuchen, 12/05/1907, Mackenzie, K.K. s.n. (MO); Dayton, Vicinity of New Brunswick, 10/05/1904, House, H.D. s.n. (NY); Cheesequake, 16/05/1936, Pride, G. s.n. (GH); Milltown, 20/08/1904, Brainerd, E. s.n. (GH); 2 miles past Dayton, 30/07/1916, Miller, W.D., 1511 (NY); Milltown, 25/05/1895, I.A.B. s.n. (NY); Milltown, 25/05/1895, I.A.B. s.n. (NY); Keasbey, 00/09/1908, Mackenzie, K.K., 3928 (NY); Browntown, 30/05/1914, Wiegman, W.H. s.n. (NY); Spotswood, 07/05/1933, Chrysler, M.A. s.n. (NY); Monmouth Co.: Eatontown, 00/10/1917, ?, 8206 (NY); Matawan, 04/06/1916, Miller, W.D., 1507 (NY); Morris Co.: West café, Cam House swamp, 20/05/1912, O.A.B, 10764 (GH); Ocean Co.: Tom's river, 30/05/1907, Mackenzie, K.K., 2589 (NY); Tom's River, 30/05/1907, Mackenzie, K.K., 2589 (MO); Pine Barrens, Tom's River, 30/05/1907, Eggleston, W.W. s.n. (GH); Point Pleasant, 15/05/1918, Lithium, H.H. s.n. (NY); , Knieskern s.n. (MO). New York. Chemung Co.: Elmira, 05/06/1894, Lucy, T.F., 804 (US); Monmouth Co.: Long Island, Ferres landing, 00/06/1891, S.L.C. s.n. (NY); Nassau Co.: Woodmere, Long island, 00/05/1915, Killip, E.P. s.n. (MO); Long Island, Westbury, Hempstead plains, 16/05/1919, Flushing, C.J. s.n. (NY); Long Island, Meadowbrook, 16/08/1919, Ferguson, W.C., 15 A (NY); Long Island, Hempstead, 13/05/1916, Wilson, P. s.n. (NY); Hempstead Plains, Meadowbrook, Long Island, 25/08/1902, Mulford, F.A. s.n. (NY); Valley stream, Long Island, 06/06/1903, Haven, L.T. s.n. (NY); Transplanted from Hempstead Plains, NY, Sep 1904, Miss Mulford donor, ex horto E. Brainerd 22, 23/08/1910, Brainerd, E., 22 (NY); Transplanted from Hempstead Plains, NY, Sep 1904, Miss Mulford donor, ex horto E. Brainerd 22, 23/08/1910, Brainerd, E., 22 (US); Long Island, near Amityville, 18/05/1928, Ferguson, W.C., 7431 (NY); Long Island, W. Hempstead, 23/05/1920, Ferguson, W.C. s.n. (NY); Long Island, East Hewlett Park, 28/05/1914, Bicknell, E.P., 6132 (NY); Long Island, Laurelton, 04/06/1926, Ferguson, W.C., 4826 (NY); Long Island, Mineola, 08/05/1918, Ferguson, W.C. s.n. (NY); Long Island, Meadowbrook, 11/06/1920, Ferguson, W.C. s.n. (NY); Long Island, Garden City, 28/05/1904, Mulford, F.A. s.n. (GH); Long Island, Garden City, 28/05/1904, Mulford, F.A. s.n. (NY); Long Island, Meadowbrook, 17/05/1919, Ferguson, W.C. s.n. (NY); Long Island, Hempstead plains, Miss Millford, 00/00/1905, Eggleston, W.W. s.n. (NY); Long Island, Hempstead plains, 13/06/1902, Mulford, F.A. s.n. (NY); Long Island, 30/05/1924, Roosevelt, 2896 (NY); Long Island, 18/10/1908, Bicknell, E.P. s.n. (NY); Long Island, Wantagh, 11/06/1927, Ferguson, W.C., 5614 (NY); Long Island, Mirrick, 17/09/1928, Ferguson, W.C., 7141 (NY); Long Island, Hempstead plains, Plain edge, 11/10/1924, Ferguson, W.C., 3582 (NY); Long Island, Massapequa, 23/05/1924, Ferguson, W.C., 2868 (NY); Long Island, Garden City, 26/05/1920, Ferguson, W.C. s.n. (NY); Oceanside, Long Island, 22/08/1909, Bicknell, E.P., 6069 (NY); Valley Stream, Long Island, 20/05/1904, Bicknell, E.P., 6123 (NY); Long Island, Hempstead, 13/05/1916, Wilson, P. s.n. (NY); Long Island, Valley Stream, 11/06/1904, Bicknell, E.P., 6124 (NY); Hempstead, L.I, 21/07/1899, Clute, W.N., Wilson, P. s.n. (NY); Hempstead, Long Island, 18/05/1916, House, H.D. s.n. (NY); Long Island, Toward Franklin Sq, 22/05/1910, Bicknell, E.P., 6128 (NY); Long Island, Hempstead Plains, Garden City, 28/05/1904, Mulford, F.A. s.n. (NY); Long Island, Rosedale, 16/05/1903, Bicknell, E.P., 6122 (NY); 100

Orange Co.: Tuxedo Park, 00/00/1898, Lewis Jr, W.H. s.n. (NY); Queens Co.: Long Island, South Jamaica, 23/05/1929, Ferguson, W.C., 7447 (NY); Richmond Co.: Staten island, New Dorp, 08/06/1888, Britton, N.L. s.n. (NY); Staten island, New Dorp, 08/06/1888, Britton, N.L. s.n. (NY); Staten Island, along salt meadows, 08/06/1888, Britton, N.L. s.n. (NY); Staten Island, South Ave, 09/06/1907, Dowell, P., 4767 (MO); New Dorp, 10/07/1899, Davis, W.T., Tyler, A.A. s.n. (MO); Arlington, Staten Island, 17/05/1902, Magee, E.E. s.n. (GH); Staten Island, Oakwood, 00/09/1897, ? s.n. (NY); Staten Island, Arlington, 21/05/1910, Hollick. A. s.n. (NY); Staten Island, New Dorp, 13/05/1897, Tyler, A.A. s.n. (US); Suffolk Co.: Kings park, 21/05/1927, Ferguson, W.C. s.n. (NY); Long Island, State park, East Islip, 02/06/1927, Ferguson, W.C., 5526 (NY). North Carolina. Bladen Co.: Bladen Lakes State Forest, rt. 242, 50 yards N of 1324 [=Dowd Dairy Road], 07/04/1976, Uttal, L.J., 11754 (VPI); Bladen Co.: 13/04/1941, ? s.n. (NY); Chowan Co.: 2 miles east of Edenton, 18/06/1927, Wiegand, K.M., Manning, W.E. 2077 (GH); Columbus Co.: Columbus Co., 2.1 miles north of Pireway on N.C. 905, 25/04/1958, Bell, C.R., 11426 (NCU); Columbus Co.: Columbus Co., Road banks of N.C. 242 at bridge over swamp, 2.3 miles north of Cerro Gordo, 25/04/1958, Bell, C.R., 11386 (NCU); Cumberland Co.: 8 miles east of Fayetteville, 10/04/1938, Godfrey, R.K., 3385 (GH); Cumberland Co.: Cumberland Co., River Oaks property, just north of Methodist College, west side of Cape Fear River, 18/04/2005, Sorrie, B.A., Williams, C. 11527 (NCU); Currituck Co.: Currituck Co., 2.3 miles north of Grandy on US. 158, 08/05/1958, Ahles, H.E., Ashworth, R.P. 40163 (NCU); Currituck Co., 5.8 miles north northwest of Currituck on Tull Creek, 25/06/1958, Ahles, H.E., Duke, J.A. 44516 (NCU); Currituck Co.: Currituck Co., Tull Creek, 6.3 miles northwest of Currituck, 08/05/1958, Ahles, H.E., Ashworth, R.P. 40165 (NCU); Gates Co.: Gates Co., 2.6 miles northeast of the intersection of U.S. Routes 13 and 158 northeast of Winton, ca 5-6 meters south of U.S. 13, 22/04/1991, Gil-ad, N.L., 454 (NCU); Harnett Co.: Harnett Co., Upper Little River, approx. 7.5 mi. s.w. of Lillington, 08/05/1957, Laing, H., 1237 (NCU); Harnett Co.: East side of Cape Fear River, 4 km south of route 217 bridge. Costal Plain Province, 27/04/2005, Sorrie, B.A., 11542 (US); Harnett Co., near Upper Little River, 1.8 mi. n.w. of junction 6.6 mi. s. of Lillington on NC 210, 10/04/1957, Laing, H., 918 (NCU); Hertford Co.: Hertford Co., 3 miles n. of Bethlehem on N. C. 45, 03/05/1959, Ahles, H.E., 52703 (NCU); Jones Co.: Jones Co., Croatan National Forest, Compartment 40, southwest of FS 146 at a point 0.3 mile northwest of junction with FS 120, southwest of Haywood Landing, 11/04/1991, LeBlond, R.J., 1951 (NCU); Moore Co.: Moore Co., bordering lake, Whispering Pines, 18/04/1973, Carter III, J.H., 483 (NCU); Norfolk Co.: Below Great Bridge, 25/04/1897, Small, J.K. s.n. (NY); Northampton Co.: Northampton Co., Authors Creek, 2.2 miles west northwest of Garysburg on NC. 46, 18/04/1958, Ahles, H.E., Duke, J.A. 38361 (NCU); Perquimans Co.: Perquimans Co., 1.6 miles northeast of Bethel, then 1.2 miles east on dirt road, 30/07/1958, Ahles, H.E., Duke, J.A. 48030 (NCU); Richmond Co.: Richmond Co., 4.6 miles ese. of Ellerbe on Rocky Fork Creek, 08/05/1959, Ahles, H.E., 52695 (NCU); Robeson Co.: 4.8 miles northeast of Fairmont on N.C. 41, 09/04/1962, Ahles, H.E., Radford, A.E.; Ornduff, R. & Baker, P. 56512 (VPI); Robeson Co.: Robeson Co., 5.5 mi. S of St. Pauls along US 301, 01/05/1959, Britt, R.F., 2897 (NCU); , 09/04/1962, Ahles, H.E., Radford, A.E.; Orndorff, 101

R. & Baker, P. 56512 (NCU); Wake Co.: About 5 miles S.E. of Varina, Highway #55, 25/04/1951, Blomquist, H.L. s.n. (NY); Lake Johnson, 4 miles southwest of Raleigh, 23/04/1938, Godfrey, R.K., 3685 (GH); Below Bridge, 25/04/1897, Small, J.K. s.n. (NY); Washington Co.: Washington Co., 4 miles ne. of Plymouth, 26/04/1958, Radford, A.E., 32374 (NCU). Pennsylvania. Bucks Co.: Tullytown, 24/05/1900, Crawford, J. s.n. (MO); Penn Valley, 13/05/1900, Porter, D.M. s.n. (MO); Tullytown, 24/05/1900, Crawford, J. s.n. (GH); Tullytown, 24/05/1900, Crawford, J. s.n. (US). Virginia. Elizabeth City Co.: Buckroe, Coast, 15/05/1912, Robinson, B.L., 395 (GH); Hampton, 29/04/1894, Churchill, J.R. s.n. (MO); Buckroe, Coast, 18/05/1912, Robinson, B.L., 394 (GH); Greensville Co.: Near Three Creek, north of Emporia, 05/04/1939, Fernald, M.L., Long, B. 9756 (MO); North of Emporia, Near Three Creek, 05/04/1939, Fernald, M.L., Long, B. 9756 (GH); Henrico Co.: Bvd. St. extended, 08/04/1943, Lusley, F.S. s.n. (VPI); Norfolk Co.: Norfolk, 00/04/1875, Churchill, J.R. s.n. (MO); East of North Landing, 06/05/1935, Fernald, M.L., Griscom, L. 4467 (GH); 2 miles west of Bowers Hill, 02/05/1944, Hubricht, L., 2388 B (MO); Prince Georges Co.: South of Petersburg, 08/06/1938, Fernald, M.L., Long, B. 8373 (GH); South of The Crater, 20/06/1936, Fernald, M.L., Long, B. 5852 (GH); South of The Crater, 20/06/1936, Fernald, M.L., Long, B. 5852 (NY); Princess Anne Co.: North of Blackwater River, 07/08/1934, Fernald, M.L., Long, B. 4054 (GH); Swales back of dunes, rifle range, south of Rudy Inlet, 31/07/1934, Fernald, M.L., Long, B. 4053 (NY); Munden, 06/05/1935, Fernald, M.L., Griscom, L. 4468 (GH); Rifle range, south of Rudy Inlet, 30/07/1934, Fernald, M.L., Long, B. 4053 (US); Rifle range, south of Rudy Inlet, 04/08/1934, Fernald, M.L., Long, B. 4053 (VPI); Sand Bridge, 19/06/1935, Fernald, M.L., Long, B. 4676 (GH); Rifle range, south of Rudy Inlet, 05/05/1935, Fernald, M.L., Griscom, L. 4469 (GH); Southampton Co.: Newsom Grove school, 14/06/1939, Fernald, M.L., Bayard, L. 10335 (MO); About 2.5 miles east of Drewryville, 09/04/1938, Fernald, M.L., Long, B. 7912 (GH); Newsom Grove school, 14/06/1939, Fernald, M.L., Long, B. 10335 (GH); Surry Co.: Open argillaceous roadside east of Springs Grove, 05/04/1938, Fernald, M.L., Long, B. 7911 (GH); East of Shriug Grove, 05/04/1938, Fernald, M.L., Long, B. 7911 (NY); 26/04/1897, Small, J.K. s.n. (NY); Crawford, 27/05/1902, Nash, G.V., 2196 (NY); , 21/05/1904, Taylor, N., 15550 (NY); Virginia Beach: near Dam Neck, Va. Beach, on W side of Prosperity Road (Va. Beach Quad), 01/05/1980, Stevens, C.E., 15841 (VPI).

Viola brittoniana Pollard f. pectinata (E.P.Bicknell) Gil-ad

USA. Connecticut. Fairfield Co.: Original from Stratford, Conn., [collected by] Eames, nursery, 25/05/1907, Eggleston, W.W. s.n. (GH). Delaware. Sussex Co.: Bethany Beach, 14/05/1946, Ripley, H.D., Barneby, R.C. 7308 (NY); New Jersey. Cape May Co.: Near North Branch Pond Creek, 03/06/1916, Long, B., 14868 (GH); Near North Branch Pond Creek, 03/06/1916, Long, B., 14868 (NY); Cold Springs, 03/06/1916, Mackenzie, K.K., 6977 (NY); Middlesex Co.: 00/09/1908, Mackenzie, K.K., 3915 (NY). New York. Nassau Co.: Woodmere, Long Island, 12/06/1904, Bicknell, E.P. s.n. (GH); Nassau Co.: 102

[Nassau Co.] southwestern Long Island, Woodmere, in low ground near or at the borders of salt marshes with V. brittoniana, 21/05/1904, Bicknell, E.P. s.n. (GH,NY). North Carolina. Gates Co.: Gates Co., 3 miles southwest of jct. US. 13 and NC. 37 on US. 13 (northwest of Gates), 26/06/1958, Ahles, H.E., Duke, J.A. 44742 (NCU); Gates Co., 1 mile west of Gates, 01/08/1958, Ahles, H.E., Duke, J.A. 48377 (NCU); Richmond Co.: Richmond Co., 5.6 miles ese. of Ellerbe on Rocky Fork Creek, 08/05/1959, Ahles, H.E., 52696 (NCU). Virginia. Princess Anne Co.: near Rifle Range, south of Rudy Inlet, 05/05/1935, Fernald, M.L., Griscom, L. 4463 (GH); Wood-road, 30/07/1934, Long, B., Fernald, M.L. 4051 (GH); Richmond Co.: Grown at Port Richmond, Staten Island, Midland Beach, 22/05/1910, Dowell, P., 6162 (GH).

Viola pedatifida G.Don

CANADA. Alberta. Starland Co.: Craigmyle District, 11/06/1921, Brinkman, A.H., 74 (NY); Strathcona Co.: Fort Saskatchewan, Alta, 22/05/1930, Turner, G.H., 61 (NY). Manitoba. Provencher Dist.: Dominion City, 2 milles à l'est, 26/05/1958, Boivin, B., 11763 (GH); Souris Dist.: Rivière Souris à l'ouest de Dalny, Ecorre de la coulée, 03/06/1960, Boivin, B., 13430 (NY); Mount Royal, 30/05/1915, Thompson, S.L., 89 (MO); West Selkirk, 00/05/1896, Macoun, J., 12445 (NY); Collected long the line of the Grant Trunk Pacific Railway, W. of Portage la Prairie, 01/06/1906, Herriot, W., 70462 (GH); , 00/00/1898, Thompson, E.S. s.n. (MO); Souris River, about 8 miles north of Minto (Route 10), 14/06/1950, Scoggan, H.J., Baldwin, W.W. 7182 (GH); Collected along the lines of Grand Trunk Pacific Railway, W. of Portage la Prairie, 01/06/1906, Herriot, W., 70462 (NY); Collected along the line of the Grand Trunk Pacific Railway, North of Carberry, 14/06/1906, Macoun, J., Herriot, W. 70461 (NY); , 20/05/1939, Denike, W.N., C- 7 (NY).

USA. Arizona. Yavapai Co.: Mogollon Mts, 25/05/1887, Meams, E.A. s.n. (NY); Mogollon Mts, 24/05/1887, Meams, E.A. s.n. (NY). Colorado. Door Co.: Wahatoya Canyon, 29/05/1900, Rydberg, P.A., Vreeland, F.K. 5873 (NY); Las Animas Co.: Vermejo Park Ranch: In left hand fork Martinez Canyon 5.8 air mi SW of junction of Martinez Canyon and Long Canyon, 22/05/2008, Legler, B., 8104 (NY); 00/00/1874, Thurber, G. s.n. (NY); , 00/00/1870, Hulse, G.W. s.n. (NY); St. Vrain River, 26/05/1873, Coulter, J.M. s.n. (NY). Illinois.Champaign Co.: Cottonwood Sta., Urbana, 26/05/1910, Pease, A.S. s.n. (GH); by I.C.R.R., 1-1/2 m. s. of Champaign, 29/04/1909, Pease, A.S., 11827 (GH); Cook Co.: W. Pullman, Chicago, 03/05/1915, Johnson, F.W., 1638 (NY); Palatine, 17/05/1948, Chase, V.H., 9363 (NY); Palos Park, 29/05/1915, Johnson, F.W., 1725 (NY); DuPage Co.: Naperville, 10/05/1898, Umbach, L.M. s.n. (MO); Lisle, 19/05/1900, Umbach, L.M. s.n. (GH); Warrenville, 11/05/1897, Umbach, L.M. s.n. (MO); Fulton Co.: Canton, , Coulter, J.M. s.n. (NY); Henderson Co.: Oquawka, 00/05/1896, Patterson, H.N. s.n. (NY); Henderson Co.: Near Oquawka, 07/05/1872, Patterson, H.N. s.n. (NY); Oquawka, 04/05/1942, Patterson, H.N., 216 (NY); Oquawka, 00/05/1875, Patterson, H.N. s.n. (MO); Oquawka, Banks of the Mississippi, 00/05/1875, Patterson, H.N. s.n. (NY); Henry Co.: Galva, 00/06/1909, Chase, V.H. s.n. (NY); LaSalle Co.: West 103 of Ottawa, 10/05/1899, Johnson, C.F. s.n. (NY); Ottawa, 10/05/1899, Johnson, C.F. s.n. (MO); McHenry Co.: Ringwood, , Vasey, G. s.n. (NY); McLean Co.: Bloomington, 00/04/1869, Congdon, E.N. s.n. (NY); Near Bloomington, 00/05/1883, Underwood, L.M. s.n. (NY); Menard Co.: Athens, 00/00/1861, Hall, E. s.n. (NY); Ogle Co.: Pine Creek Wds., Mt. Morris, 22/05/1909, Sherff, E.E. s.n. (GH); Peoria Co.: Peoria, 00/04/1915, McDonald, F.E. s.n. (MO); Peoria, 00/04/1915, McDonald, F.E. s.n. (GH); Peoria, 00/05/1904, McDonald, F.E. s.n. (GH); Peoria, 00/04/1915, McDonald, F.E. s.n. (NY); Peoria, 00/04/1915, McDonald, F.E. s.n. (MO); Winnebago Co.: Fountaindale, 00/00/1867, Bebb, M.S. s.n. (NY); 08/05/1848, Mead, J.B. s.n. (NY); N. Illinois, 00/00/1859, Bebb s.n. (NY); N. Illinois, , Bebb s.n. (NY); Mead, S.B. s.n. (NY); Mead, S.B. s.n. (NY); , 00/08/1845, Mead, S.B. s.n. (NY); Lehamfaign, 22/05/1885, ? s.n. (NY). Indiana. Benton Co.: 21/05/1933, McCoy, S. s.n. (NY); Jasper Co.: 2 miles east of Goodland, 30/06/1928, Welch, W.H., 851 (NY); Newton Co.: R.R. Prairie at crossing 3 mi. E. of Kentland, 12/05/1932, McKee, M., 1198 (NY). Iowa. Ames Co.: Story, High School Prairie, 01/06/1968, Davise, G., 1110 (MO); Armstrong Emmet Co.: 23/05/1897, Cratty, R.I. s.n. (MO); Benton Co.: , ? s.n. (MO); Black Hawk Co.: Along the Illinois Central Gulf Railroad tracks north of Cedar City; SE1/4 S6 T89N R13W, 10/05/1981, Lammers, T., 4082 [a] (MO); Boone Co.: 5.5 sect.30, R25W, T84N, 03/05/1952, Tanner, W.D. s.n. (GH); Clay Co.: Peterson Twp., Sec. 30, 2 miles northwest of Peterson, 08/05/1941, Hayden, A., 7487 (MO); Peterson Twp, One mile northwest of Peterson, 09/05/1940, Hayden, A., 7486 (NY); Decatur Co.: 18/05/1904, Anderson, J.P. s.n. (MO); , 04/05/1896, Fitzpatrick, T.J., Fitzpatrick, M.F.L. s.n. (NY); Dickinson Co.: NW 1/4 Sec. 17, Lakeville Twp, 17/06/1955, Thorne, R.F., 15981 (NY); Emmet Co.: High Lake Twp., Sec. 6, 15/05/1934, Hayden, A., 10171 (GH); High Lake Twp., Sec. 6, 15/05/1934, Hayden, A., 10171 (NY); Floyd Co.: Charles City, 21/05/1875, Arthur, J.C. s.n. (NY); Marshall Co.: Marshaltown, 15/05/1897, Ball, C.R., 480 (MO); Minerva, 00/06/1876, ? s.n. (NY); Muscatine Co.: S.E. of Salisbury bridge, 26/05/1923, Shimek, B. s.n. (NY); east of Cedar River railroad bridge, west of Bayfield, 08/05/1920, Shimek, B. s.n. (MO); Scott Co.: Davenport, 00/00/1886, Parry, C.C. s.n. (MO); Davenport, 00/05/1891, Ross, E.A. s.n. (MO); Story Co.: Ames, 03/05/1897, Ball, C.R., 326 (MO); Isaac Walton property, East of Ames, Story Co., Iowa, 25/05/1958, Barnum, A.H., 834 (GH); Franklin Twp., Sec. 18, 3 miles northwest of Ontario, 15/05/1935, Hayden, A., 10173 (NY); Warren Co.: Indianola, 00/04/1889, Sauck, A.J. s.n. (NY); Indianola, 00/00/1889, Parker, G.H. s.n. (NY); South Indianola, 00/05/1889, ? s.n. (NY); Woodbury Co.: Sioux City Twp., Planted in the garden on the Morningside Branch Library at Sioux City by Mrs. J. Ed Johnson, Contributed by Mrs. M.A. Clark, taken in Wodbury Co, 08/10/1938, Hayden, A., 11382 (NY); Oaktown, 00/05/1889, Ross, E.A. s.n. (NY). Kansas. Douglas Co.: Lawrence. 1.5 mi. W jct. Hwy. 56&59, S side Sutton Cemetery. T15S, R19E, sect.4, 13/04/1986, Kuhn, C., 404 (NY); Jackson Co.: Greenwood, 00/05/1879, Broadhead, G.C. s.n. (MO); Lee's Summit, 13/05/1917, Hoffmann, R. s.n. (MO); Jefferson Co.: Lawrence, 1 mile E.,2.5 S. Ozawkie Open prairie hillside. Mowed annually, 14/04/1968, Stephens, S., 19868 (GH); Johnson Co.: Along 9th street, West lenexa, 23/04/1966, Henderson, N.C., 66- 117 (MO); Linn Co.: 1 mi. west Pleasanton, 14/05/1929, Anderson, E. s.n. (MO); Pottawatomie Co.: Manhattan, 26/04/1899, Rumble, J.T. s.n. (MO); 2.5 Miles E. 104

Blaine Upoand, rocky, hillside pasture, 15/05/1967, Stephens, S., 10875 (GH); Manhattan, 19/08/1892, Norton, J.S. s.n. (MO); Manhattan, 00/00/1884, Bassler, T. s.n. (NY); 2.5 Miles E. Blaine Upoand, rocky, hillside pasture, 15/05/1967, Stephens, S., 10875 (NY); Riley Co.: 00/00/1896, Norton, J.B., 31 a (MO); , 09/10/1895, Norton, J.B., 31 (MO); , 09/10/1895, Norton, J. .B., 31 (NY); Between Pawpaw and Hackberry, 27/04/1952, Rogerson, C.T. s.n. (NY); Upper Hackberry ravine, 06/05/1951, Rogerson, C.T., Shaffer, R.L. s.n. (NY); , 00/00/1896, Norton, J.B., 31 a (NY); Shawnee Co.: Topeka, 04/05/1891, Smyth, B.B., 105 (NY); Wilson Co.: 4 miles east, 1 south. Neodesha, 00/04/1969, Stephens, S., 30050 (GH); Lawrence, 4 miles E., 1 S. Neodesha, 22/05/1969, Stephens, S., 30050 (NY); Woodson Co.: Lawrence, 9 miles S., 1 E. Yates Center, 18/04/1968, Stephens, S., 19876 (GH); 9 mi. S.m [&?] 1 E. Yates Center, 18/04/1969, Stephens, S., 19876 (NY). Michigan. Kalamazoo Co.: 3 miles west of Vicksburg, 28/05/1940, Rapp, F.W., 4549 (NY). Minnesota. Anoka Co.: 11 miles north of Minneapolis, 21/05/1903, Rosendale, C.A. s.n. (US); North of Minneapolis, 21/05/1903, Rosendahl, C.O., 1227 (MO); 11 mi. N of Minneapolis, 21/05/1903, Rosendahl, C.O., 1227 (NY); Near Fish Lake, 26/06/1935, McCoy, S., 3921 (NY); Moore Lake, 05/09/1926, Rydberg, P.A., 9612 (NY); Grant Co.: 1/2 mile south of Elboar lake, 27/05/1940, Moore, G.W., Pheney, B.O. 12832 (MO); Hennepin Co.: Minneapolis, 00/05/1892, Burglehaus, F.H. s.n. (MO); Minneapolis, 26/05/1891, Burglehaus, F.H. s.n. (MO); Kandeyohi Co.: 1.8 miles west of Paynesville, on highway 55, 25/05/1940, Moore, G.W., Phinney, B.O. 12647 (GH); Meeker Co.: Original prairie string along the railroad right of way;.5 miles west of Elder Valley, on highway 55, 25/05/1940, Moore, G.W., Phinney, B.O. 12614 (NY); Sherburne Co.: Sherburne National Wildlife refuge, about 2.5 miles southeast of Santiago, 16/05/1986, Smith, W.R., 11409 (NY); Todd Co.: Staples, 23/05/1912, Chandonnet, Z.L., 6 (GH); Wabasha Co.: 27/06/1935, McCoy, S., 3974 (NY). Missouri. Anoka Co.: 11 miles north of Minneapolis, 21/05/1903, Rosendahl, C.O., 1227 (GH); Atchison Co.: Watson, 25/04/1894, Bush, B.F., 19 (MO); Brickyard hill wildlife area, 2 mi E of Watson, T65N R42W SO1, 01/06/1993, Summers, B., Yatskievych, G. & WGNSS Botany Field Trip 5689 (MO); Barry Co.: between Beaver, Ark., and Eagle Rock, 26/04/1925, Palmer, J., 29802 (MO); Benton Co.: Along U.S. #65, about 4 miles from Lincoln, 29/04/1966, Henderson, N.C., 66- 175 (MO); Boone Co.: Columbia, 00/00/1902, Gary, L.B., 578 (GH); Cass Co.: 00/04/1891, ? s.n. (MO); Along old railroad embankment about 2 miles southeast of Belton, 13/05/1966, Henderson, N.C., 66- 252 (MO); Greenwood, 10/05/1912, Bush, B.F., 6689 A (GH); , 00/05/1865, Engelmann, G. s.n. (MO); Daviess Co.: near Winston, 28/05/1934, Steyermark, J.A., 7871 (MO); Greene Co.: Springsfield, Railroad tracks, 18/04/1908, Kellogg, J.H. s.n. (MO); Brookline, 25/04/1908, Kellogg, J.H. s.n. (MO); Harrison Co.: Upland prairie along r.r., T. 66 N., R. 27 W., sect. 1 and 36, just southwest of Andover, 6 miles north of Blythedale, 24/06/1941, Steyermark, J.A., 40356 (MO); Jackson Co.: Lee's Summit, 18/04/1897, Bush, B.F., 270 (MO); Dodson, 08/05/1917, Hoffmann, R. s.n. (MO); Lee's Summit, 13/05/1917, Hoffmann, R. s.n. (MO); Lee's Summit, 08/06/1906, Bush, B.F., 3934 (GH); Lee's Summit, 18/04/1897, Bush, B.F., 270 (MO); Lee's Summit, 09/05/1897, Mackenzie, K.K. s.n. (MO); Lee's Summit, 06/07/1900, Mackenzie, K.K. s.n. (NY); Levasy, 18/05/1902, Bush, B.F., 1677 (MO); Lee's Summit, 08/06/1906, Bush, B.F., 3934 105

(NY); Lee's Summit, 08/06/1906, Bush, B.F., 3934 (MO); Little Blue, 24/05/1896, Bush, B.F., 783 (MO); Levasy, 18/05/1902, Bush, B.F., 1677 (NY); Lee's Summit, 28/05/1899, Mackenzie, K.K., 8 (NY); Levasy, 18/05/1902, Bush, B.F., 1677 (US); Independence, 00/00/1835, Geyer, A. s.n. (MO); Jackson Co.: Lee's Summit, 06/07/1900, Mackenzie, K.K. s.n. (NY); Jasper Co.: Webb City, 05/04/1909, Palmer, E.J., 1644 (MO); Webb City, 23/04/1909, Palmer, J., 1764 (NY); Carthage, 09/04/1911, Palmer, E.J., 3330 (NY); Webb City, 04/05/1909, Palmer, E.J., 1644 (MO); Webb City, 19/04/1903, Palmer, E.J., 561 (MO); Webb City, 12/04/1903, Palmer, E.J., 561 (MO); Carthage, 03/05/1926, Palmer, E.J., 29875 (MO); Webb City, 23/04/1909, Palmer, E.J., 1764 (GH); Webb City, 23/04/1909, Palmer, E.J., 1764 (MO); Along R.R. Carthage, 19/04/1911, Palmer, E.J., 3346 (MO); Webb City, Along R.R, 19/04/1911, Palmer, E.J., 3346 (MO); Carthage, 09/04/1911, Palmer, E.J., 3330 (MO); Lawrence Co.: 1.25 mi S and 0.75 mi west of junction of state highway 174 and County Road K; T28N R36W S36 NW4 of SW4, 20/04/2001, Gibson, S., 3381 (MO); Newton Co.: Leawood, 10/05/1912, Bush, B.F., 6689 A (NY); Joplin, 05/05/1926, Bush, B.F., 10427 (MO); Leawood, 10/05/1912, Bush, B.F., 6689 a (US); Pettis Co.: Along a railroad, paralleling U.S. #50, about 3 miles west of Dresden, 29/04/1966, Henderson, N.C., 66- 172 (MO); 3 miles east of Sedalia, 27/04/1935, Steyermark, J.A., 18755 [a] (MO); , 07/05/1935, Bush, B.F., 14766 (MO); Sedalia, 09/05/1926, Palmer, J., 30006 (GH); Sedalia, 09/05/1890, Pringle, C.G. s.n. (MO); Sedalia, 09/05/1926, Palmer, E.J., 30006 (MO); Saint Louis Co.: Saint Louis, 00/04/1841, Engelmann, G., 892 (MO); Saint Louis, 00/04/1838, Riehl, N., 182 (MO); Saint Louis, 00/04/1838, Riehl, N., 182 (NY); Saint Louis, 00/04/1842, Geyer, A. s.n. (NY); Saint Louis, 00/04/1841, Engelmann, G., 892 (NY); St. Louis, 00/04/1862, Engelmann, G. s.n. (NY); Saint Louis, 00/05/1844, Engelmann, G. s.n. (MO); St. Louis, 00/04/1842, Engelmann, G. s.n. (MO); , Nuttall, T. s.n. (NY). Nebraska. Adams Co.: Hastings, 00/05/1886, Powell, B. s.n. (NY); Cherry Co.: Slagle Creek valley 10 miles south of Valentine, 18/06/1936, Tolstead, W.L., 348 a (GH); Cuming Co.: 2.5 miles south of wisner and 4 miles west, 01/05/1974, Churchill, S.P., 2795 (MO); Howard Co.: Lawrence. 1 mile south,3.5 east of saint paul Sandhill prairie pasture dry, firm, sandy soil. Few plants, 14/05/1970, Stephens, S., 37932 (GH); Jefferson Co.: 2 miles East of Herbine and 4.5 miles North, 27/04/1974, Churchill, S.P., 2744 (NY); Kearney Co.: Minden, , Beaupert, N.S. s.n. (MO); Lancaster Co.: Airport north of Havelock, (Lincoln), 06/05/1934, Morrison, J.L., 945 (MO); Lincoln, 30/04/1900, Hedgcock, G.G. s.n. (MO); Lincoln, 1 mile North of University place, 21/04/1934, Moorison, J.L. s.n. (US); Lincoln, 25/04/1900, Hunter, A.A. s.n. (MO); 2 miles north of 7th street from the intersection with superior street at Lincoln, 07/05/1973, Churchill, S.P. s.n. (MO); Lincoln, , ? s.n. (NY); West Lincoln, 24/04/1915, Muenscher, W.C., 3156 (GH); Lincoln, 27/04/1900, Hedgcock, G.G. s.n. (MO); Lincoln, 25/04/1900, Hunter, A.A. s.n. (MO); Lincoln, Belmont high prairie, 10/05/1923, Armstrong, E. s.n. (NY); Nuckolls Co.: 00/05/1896, Hedgcock, G.G. s.n. (MO); Richardson Co.: 1 mile west of the Lone Star School, southwest of Salem. Elev. 1200 ft, 03/05/1940, Reynolds, H.C., 2995 (MO); 2 mi. S.E. Rulo, 29/04/1968, Stephens, S., 20009 (GH); 2 mi. SE. Rulo, 29/04/1968, Stephens, S., 20009 (NY); Stanton Co.: Across from the 'peace' church on highway 35 (4.5 miles northeast of junction 275 and 35 on highway 35), 19/05/1973, Churchill, S.P., 728 (MO); 106

Lawrence, 5 miles W., 8 N. Stanton, 15/05/1971, Stephens, S., 47188 (NY); Across from the 'peace' church on highway 35 (4.5 miles northeast of junction 275 and 35 on highway 35), 19/05/1973, Churchill, S.P., 728 (NY); Thomas Co.: Halsey, 10/05/1903, Mall, Knopy s.n. (MO); Halsey, 10/06/1903, Mell, Knopf s.n. (MO). New Mexico. Colfax Co.: Chicorico Canon [Sugarite Canyon], 00/05/1897, John, S. s.n. (GH); Vermejo Park ranch: In Jones Canyon 2.4 air mi NW of its junction with the Canadian River; 11 air mi WNW of Raton, 02/06/2008, Legler, B., 8337 (NY); Rio Arriba Co.: Tierra Amarilla, 18/04/1911, Eggleston, W.W., 6477 (US); Union Co.: Near Sierra Grande, Volcanic Hills, 18/06/1911, Standley, P.S., 6072 (US). North Dakota. Benson Co.: Pleasant Lake, 21/05/1910, Lunell, L.J. s.n. (NY); Benson Co.: Butte, 20/05/1906, Leeds, J.L. s.n. (NY); Leeds, 10/06/1900, Lunell, L.J. s.n. (GH); Pleasant Lake, 21/05/1912, Lunell, L.J. s.n. (NY); Butte, 31/05/1908, Lunell, L.J. s.n. (GH); Butte, 28/05/1905, Lunell, J., Leeds, N.D. s.n. (NY); Butte, 02/07/1905, Lunell, J., Leeds, N.D. s.n. (NY); , 28/05/1911, Leeds, J.L. s.n. (US); , 10/06/1906, Leeds, J.L. s.n. (NY); Burke Co.: Portal, 13/06/1908, Barber, M.A. s.n. (GH); Kidder Co.: Steele, 22/06/1950, Stones, A.A., 1192 (US); Morton Co.: Mandan, 00/00/1915, Sarvis, J.T., 21 (US); Sioux Co.: Cannon Ball, 30/05/1912, Bergman, H.F., 1566 (NY); 18/05/1912, Bergman, H.F., 1440 (MO). Ohio. Ottawa Co.: Marblehead, 11/09/1898, Moseley, E.L. s.n. (GH). Oklahoma. Muskogee Co.: Muskogee, 06/04/1908, Brainerd, E. s.n. (NY); Near Muskogee, 11/04/1910, Brainerd, E., 120 (NY); Muskogee, 11/04/1910, Brainerd, E. s.n. (GH); Muskogee, 11/04/1910, Brainerd, E. s.n. (MO); Saskatchawan. : 00/00/1858, Bourgeau, E. s.n. (NY). South Dakota. Beadle Co.: 18/05/1890, Douglas, E. s.n. (MO); Brookings Co.: Brookings, 00/05/1910, White, D.E. s.n. (MO); Brookings, 10/05/1902, Johnson, A.S. s.n. (MO); Brookings, 12/05/1897, Carter, L.M. s.n. (NY); Brookings, 15/05/1894, Thornber, J.J. s.n. (MO); Clay Co.: Vermillion, 07/05/1911, Visher, S.S., 4039 (MO); Custer Co.: Black Hills, Custer, 04/06/1892, Rydberg, P.A., 543 (NY); Dane Co.: Madison, 00/05/1892, Mauson, C. s.n. (NY); Lawrence Co.: 11/06/1929, Palmer, J., 37155 (MO); , 11/06/1929, Palmer, J., 37155 (GH); Pennington Co.: Black Hills National Forest, Redfern, 13/05/1910, Murdoch, J., 4034 (NY); Black Hills National Forest, Redfern, 13/05/1910, Murdoch, J., 4034 (GH); Black Hills, 04/06/1892, Rydberg, P.A. s.n. (US). Wisconsin. Dane Co.: Madison, 00/00/1861, Hale, T.J. s.n. (NY); Madison, 00/00/1860, Hale, T.J. s.n. (NY); Madison, 00/00/1881, Trelease, W. s.n. (MO); Madison, , ? s.n. (NY); Racine Co.: Racine, 20/06/1899, Wadmond, S.C. s.n. (MO); Sauk Co.: T9N R6E, sec.7, 29/05/1949, Seymour, F.C., Jones, F.R. 10560 (GH); Walworth Co.: Whitewater, 13/05/1893, Abbott, W.H., 79 (NY). Wyoming. Crook Co.: 7 miles northwest [of] Hulett, 05/06/1935, Ownbey, M., 573 a (MO); Hulett, Crook Co.: 7 miles northwest, 05/06/1935, Ownbey, M., 573 a (NY); Phinneys, 12/05/1904, Somes, M.P., 2486 (NY); ? s.n. (NY).

Viola subsinuata (Greene) Greene

Connecticut. Hartford Co.: Simsbury, , ? s.n. (NY). Georgia. Walker Co.: Maddox Gap on Taylor Ridge E of Lafayette, 01/04/1951, McDowell, G.W., 12253 (MO); 16/04/1900, ? s.n. (MO). Indiana. Wells Co.: High ground east of lakes in Jackson Tp, 22/05/1904, Dream, C.C. s.n. (MO). Kentucky. Harlan Co.: Top black Mt. Elev. 4100 ft. Lynch, 107

18/05/1940, McFarland, F.T., 82 (MO). Massachusetts. Berkshire Co.: Sheffield, 06/08/1920, Churchill, J.R. s.n. (MO). Michigan. St. Clair Co.: Transplanted from garden of F. F. Forbes, Brookline, Mass., August 1907, Sent from Port Huron, Mich., by C. K. Dodge, ex horto E. Brainerd, 17/06/1910, Brainerd, E., 99 (NY); Transplanted from garden of F. F. Forbes, Brookline, Mass., August 1907, Sent from Port Huron, Mich., by C. K. Dodge, ex horto E. Brainerd, 17/06/1910, Brainerd, E., 99 (MO). New Jersey. Essex Co.: Eagle Rocky, 04/07/1905, Mackenzie, K.K., 1446 (MO); Orange, 00/05/1905, Angell, M. s.n. (MO); Orange, 00/05/1899, Angell, M. s.n. (MO); Pasoie Co.: 14/05/1924, Dunslow, H.M. s.n. (NY); Sussex Co.: Culver's lake, 31/05/1919, Miller, W.D., 1508 (NY); Union Co.: Union Village, 05/07/1918, Miller, W.D., 1509 (NY). New York. Monroe Co.: near Kennedy Pond, Mendon, 02/06/1917, Metcalf, F.P., Baxter, M.S. 8475 [a] (MO); Monroe Co.: Sea Breeze, 03/09/1910, Brainerd, E. s.n. (MO); Onondaga Co.: Syracuse, 00/05/1887, Underwood, L.M. s.n. (NY); Near Syracuse, 00/05/1899, Goodrich, L.L. s.n. (MO); Onondaga Co.: Syracuse, 13/05/1890, Underwood, L.M. s.n. (NY); Tompkins Co.: Near Ithaca, 06/05/1941, Ross, R.D. s.n. (VPI); Tompkins Co.: 0.5 miles north of Esty Glen, 11/07/1920, Wiegand, K.M., 13717 [c] (MO); Tompkins Co.: McGourans woods, 06/05/1941, Ross, R.D., 11877 (VPI); Ithaca, 02/05/1878, Trelease, W. s.n. (MO); North of Macadam Road, Fall Creek, Ithaca, 21/07/1917, Gershoy, A., Bechtel, A.R. 8473 (MO); Ithaca, 12/05/1941, Ross, R.D. s.n. (VPI); Ithaca, 08/05/1941, Ross, R.D. s.n. (VPI). North Carolina. Alleghany Co.: Alleghany Co., 4.5 mi. ne. of Sparta, 02/05/1958, Radford, A.E., 32730 (NCU); Alleghany Co., 4.5 miles ne. of Sparta, 02/05/1958, Radford, A.E., 32734 (NCU); Avery Co.: Avery Co., 1 mile south of Senia on US. 19E, 03/05/1958, Ahles, H.E., Ashworth, R.P. 39440 (NCU); Bladen Co.: Bladen Co., Browns Creek, 1.5 mile south of Elizabethtown on U.S. Rt#701, 20/04/1957, Ahles, H.E., Ramseur, G. 23533 (NCU); Catawba Co.: Catawba Co., by Henry River at Brookford, 29/04/1957, Bell, C.R., 6804 (NCU); Catawba Co., mombo on Catawba River, 11/05/1960, Ahles, H.E., McNeely, J. 53344 (NCU); Clay Co.: Clay Co., northeast slope of Chunky Gal Mt, 06/05/1968, Leonard, S.W., Radford, A.E. 1426 (NCU); Durham Co.: Durham Co., Driveway near bypass to Durham on Hwy 54 out of Chapel Hill, 22/04/1965, Bernstein, L., 136 (NCU); Graham Co.: Graham Co., 4.3 miles west from Santeetlah Gap near Santeetlah Creek, 29/05/1956, Ahles, H.E., Radford, A.E. 13327 (NCU); Graham Co.: Graham Co., 0.2 miles west of Graham-Swain County line, northeast of Round Top, 29/05/1956, Radford, A.E., Ahles, H.E. 13169 (NCU); Graham Co., 4.3 miles west from Santeetlah Gap near Santeetlah Creek, 29/05/1956, Radford, A.E., Ahles, H.E. 13327 (NCU); Henderson Co.: [Henderson Co.] Flat Rock, 05/05/1986, Memminger, E.R. s.n. (NCU); Iredell Co.: Iredell Co., 1 mile south of Patterson Creek on NC. 115, then 0.7 miles west-southwest, 01/07/1958, Ahles, H.E., Duke, J.A. 45199 (NCU); Lee Co.: Lee Co., N. C. 1 mi. above Lockville Dam, near the Deep River, 28/07/1958, Beard, L.S., 1540 (NCU); Madison Co.: madison Co., 0.1 mile west of Devils Fork Gap on NC. 212, 08/10/1958, Ahles, H.E., Duke, J.A. 50672 (NCU); Mitchell Co.: Mitchell Co., 1.7 miles north of Bandana on NC. 80, 02/05/1958, Ahles, H.E., Ashworth, R.P. 39276 (NCU); Orange Co.: [Orange Co.] in the vicinity of Chapel Hill, 08/04/1998, Ashe, W.W. s.n. (NCU); Orange Co., Clear Water Lake, south of Chapel Hill, 23/04/1960, Ahles, H.E., Jackson, E.V. 53230 108

(NCU); Orange Co.: Orange Co., in Battle Park, about 1/2 mile from Chapel Hill, 13/04/1940, Radford, Stewart 406 a (NCU); Orange Co.: [Orange Co., Chapel Hill], by road behind stadium, 18/04/1949, Kirk, D.E., 72 (NCU); Orange Co., Battle Park, UNC Campus, 01/04/1959, Whitlock, P.A., 70 (NCU); Polk Co.: Polk Co., Tryon, 20/04/1922, Peattle, D.C., 1673 (NCU); Swain Co.: Swain Co., 3.4 miles from N.C. Rt. 28 on Mica Knob Road, 06/06/1956, Ahles, H.E., 14127 (NCU); Watauga Co.: Watauga Co., 1.8 miles south of Aho on dirt road, 04/05/1958, Ahles, H.E., Ashworth, R.P. 39555 (NCU); Wilkes Co.: Wilkes Co., west end of Sunland Orchards, Brushy Mts, 03/05/1941, Radford, Stewart 1919 (NCU); Wilkes Co.: Wilkes Co., 4 miles east of Moravian Falls, 13/05/1956, Radford, A.E., 11231 (NCU); Yancey Co.: Yancy [sic!-Yancey] Co., 1-3/4 miles east of Micaville, 03/06/1947, Radford, A.E. s.n. (NCU). Ohio. Adams Co.: Buzzard[roost] Rock, 14/05/1939, Bartley, F., Pontius, L.L. 737 (NY); 1 mile N. of West Union, 27/05/1957, Braun, E.L. s.n. (US); Buzzard Roost Rock, 12/05/1934, Braun, E.L. s.n. (GH); Delaware Co.: Lewis Center, 18/05/1924, Crane, R., 2157 (NY). Pennsylvania. Berks Co.: Kutztown, 00/05/1906, Eggleston, W.W. s.n. (MO); Lehigh Co.: Close to road trail on wooded slope above road along (W. side) Indian Creek about 1/4 to 3/8 mile S.E. by S. of Powder Valley, P.O. crossroads, 07/08/1927, Pretz, H.W., 13034 (VPI); Monroe Co.: Paradise Valley, 07/07/1894, Saunders, C.F. s.n. (MO); Philadelphia Co.: Philadelphia, 01/05/1898, Saunders, C.F. s.n. (MO). South Carolina. Greenville Co.: Table rock reservoir watershed, Chestnut Cove, 07/05/1993, Hill, S.R., 24980 (NY); Pickens Co.: Rt. 178, 1.3 mi S of North Carolina line, N of rocky Bottom. Elev. Ca. 2100 ft. Steep slope,, 02/05/1991, Hill, S.R., 22216 (NY). Tennessee. Blount Co.: Smoky Mt., Cades Cove area, 03/05/1957, ?, 1052 (MO). Virginia. Augusta Co.: Bl. Ridge Pkwy., MP 23+, beside Pkwy, 06/05/1969, Freer, R.S., 12343 (VPI); Bath Co.: Hot Springs, 11/05/1916, Hunnewell, F.W., 4060 (VPI); Bath Co.: Warm Springs Mt., Warm Springs, 04/06/1943, F.W.H., 17811 (VPI); Floyd Co.: Buffalo Mt. along 727 just before it meets fire tower road, 09/05/1976, Porter, D.M., 2022 (VPI); Floyd Co.: South slope of Buffalo Mountain, fire tower road, 0.5 miles N of 727, 21/04/1976, Uttal, L.J., 11822 (VPI); Floyd Co.: Roadside on the fire tower road of Buffalo Mt, 03/04/1976, Burrell, C., Mattingly, L. 12 (VPI); Buffalo Mt- Along roadside on fire tower road below summit. Only one seen, 25/04/1976, Porter, D.M., Spalding, E.G. 1978 (VPI); Montgomery Co.: Poor Mt, 24/04/1938, D.M.P s.n. (VPI); Walnut hill. Ca 6 m. NE of Blacksburg on #628, 09/05/1978, Smyth, M.L., 4327 (VPI); Montgomery Co.: By # 628 just above bog. Walnut Hill, ca 6 m N.E. of Blacksburg on #628. Unusual, 21/05/1979, Smyth, M.L., 5157 (VPI); Page Co.: Elk Wallow Shelter, rare along path in somewhat disturbed ground, 07/06/1964, Fosberg, F.R., 45478 (US); Stony man Mountain and vacinity in the blue ridge, near Luray, 26/08/1901, Steele, E.S., 106 (MO); Patrick Co.: Blue ridge Mts. At highway #8 near Stuart Patrick Co, , Patterson, P.M. s.n. (VPI); Prince Edward Co.: Farmville, 00/04/1935, Stevens s.n. (VPI); Pulaski Co.: Along VA. 764 (Big Reed Island Creek), 0.8 mi. E. of 693, 07/05/1970, Uttal, L.J., 6967 (VPI); Roanoke Co.: Bent Mtn. on side, 12/05/1938, Patterson, P.M. s.n. (VPI); Smyth Co.: Clinch Mountain Wildlife Management Area beside main road, 17/05/1978, Small, V.L. s.n. (VPI); Smyth Co.: Pond Mountain, E. Marion. Altitude: 3000 Ft, 25/05/1892, Small, J.K. s.n. (MO). 109

Viola virginiana Zumwalde & H.E.Ballard

USA. Virginia. Bath Co.: Small, SSE'ly- facing shale barren woodland about midslope in Brushy Hollow. About 0.4 mi E of Wilson Creek, southern portion of Douthat State Park, about 4 mi N of Clifton Forge (alleghany Co), Va. Elevation: 1500 ft, 02/05/2006, Wieboldt, T.F., 11784 (VPI); Alleghany Co.: Scattered frequently over shaly slopes, woods, and barrens on SW end of Rough Mountain. Specimen taken at GPS coordinates: N37'52.748', W79'44.855', ca 5.5 mi NE of Clifton Forge. Station first reported by R.B. Platt in Castanea 15:128129(1950), 24/04/2007, Wieboldt, T.F., Huber, F. 11873 (VPI); Bath Co.: located on U.S. Forest Service property 0.9km northeast of Copeland and 12.6km south-southwest of Milboro Springs, just west of railroad tracks, 05/05/2008, Townsend, J.F., 3932 (VPI); Douthat State Park, directly behind state park headquarters, East of Wilson Creek and St. Rt. 629 about 5 miles N of Clifton Forge, 02/05/2006, Wieboldt, T.F., 11768 (VPI).

110

APPENDIX 3: RAW PRESENCE/ ABSENCE (0/1) DATA MATRIX OF ALLELES

AMPLIFIED FOR FOUR MICROSATELLITE LOCI IN THE VIOLA PEDATIFIDA

GROUP

Locus (Allele size below): A8GO9 Taxon, Sample, 10 10 10 10 11 11 11 12 12 12 13 13 13 13 14 14 # Region 0 3 6 9 2 5 8 1 4 7 0 3 6 9 2 5 1 brit_507_NeEn 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 2 brit_507_NeEn 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 3 brit_507_NeEn 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 4 brit_507_NeEn 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 brit_507_NeEn 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 6 brit_507_NeEn 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 7 brit_600_VA 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 8 brit_600_VA 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 9 brit_600_VA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 10 brit_600_VA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 11 brit_600_VA 1 0 0 1 0 1 0 0 0 0 0 0 1 0 1 0 12 brit_600_VA 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 13 brit_600_VA 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 14 brit_600_VA 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 15 brit_607_NY 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 16 brit_607_NY 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 17 brit_607_NY 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 18 brit_607_NY 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 19 brit_607_NY 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0

111

Locus (Allele size below) 1 Taxon, Sample, 4 15 15 15 16 16 16 17 17 17 18 19 19 20 23 23 # Region 8 1 4 7 3 6 9 2 5 8 7 3 6 8 2 8 1 brit_507_NeEn 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 brit_507_NeEn 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 brit_507_NeEn 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 brit_507_NeEn 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 5 brit_507_NeEn 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 6 brit_507_NeEn 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 7 brit_600_VA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 8 brit_600_VA 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 9 brit_600_VA 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 brit_600_VA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 11 brit_600_VA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 12 brit_600_VA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 13 brit_600_VA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 14 brit_600_VA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 15 brit_607_NY 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 16 brit_607_NY 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 17 brit_607_NY 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 18 brit_607_NY 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 19 brit_607_NY 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0

112

Locus (Allele size below) 2 Taxon, Sample, 4 25 25 26 26 26 28 28 29 30 31 35 36 41 42 42 # Region 4 6 9 2 5 8 6 9 8 7 0 8 4 5 1 4 1 brit_507_NeEn 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 brit_507_NeEn 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 brit_507_NeEn 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 4 brit_507_NeEn 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 brit_507_NeEn 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 6 brit_507_NeEn 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 7 brit_600_VA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 8 brit_600_VA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 9 brit_600_VA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 brit_600_VA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 11 brit_600_VA 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 12 brit_600_VA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 13 brit_600_VA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 14 brit_600_VA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 15 brit_607_NY 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 16 brit_607_NY 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 17 brit_607_NY 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 18 brit_607_NY 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 19 brit_607_NY 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0

113

Locus (Allele size below) AQLMG 4 Taxon, Sample, 3 44 45 49 53 53 56 58 59 10 10 10 11 11 11 11 # Region 6 2 1 9 5 8 2 6 2 1 4 7 0 3 6 9 1 brit_507_NeEn 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 2 brit_507_NeEn 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 brit_507_NeEn 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 4 brit_507_NeEn 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 5 brit_507_NeEn 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 6 brit_507_NeEn 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 7 brit_600_VA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 8 brit_600_VA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 9 brit_600_VA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 brit_600_VA 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 0 11 brit_600_VA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 12 brit_600_VA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 13 brit_600_VA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 14 brit_600_VA 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 15 brit_607_NY 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 16 brit_607_NY 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 17 brit_607_NY 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 18 brit_607_NY 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 19 brit_607_NY 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0

114

Locus (Allele size below) 1 Taxon, Sample, 2 12 13 13 14 14 14 14 15 15 15 16 16 16 17 17 # Region 5 8 4 7 0 3 6 9 2 5 8 1 4 7 0 3 1 brit_507_NeEn 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 2 brit_507_NeEn 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 3 brit_507_NeEn 1 0 0 0 0 1 1 0 0 1 1 0 0 0 0 0 4 brit_507_NeEn 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 5 brit_507_NeEn 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 6 brit_507_NeEn 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 7 brit_600_VA 0 0 1 0 0 0 0 1 1 0 0 0 0 0 0 0 8 brit_600_VA 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 9 brit_600_VA 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 10 brit_600_VA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 11 brit_600_VA 0 0 0 0 0 1 1 1 1 0 0 0 0 0 0 0 12 brit_600_VA 0 0 1 0 0 0 0 1 1 0 0 0 0 0 0 1 13 brit_600_VA 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 14 brit_600_VA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 15 brit_607_NY 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 16 brit_607_NY 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 17 brit_607_NY 0 0 1 0 1 1 0 0 0 0 0 0 0 0 0 0 18 brit_607_NY 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 19 brit_607_NY 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0

115

Locus (Allele size below) CIHYO 1 Taxon, Sample, 7 18 18 22 23 23 25 25 10 10 10 11 11 11 12 12 # Region 6 2 8 4 6 9 1 4 2 5 8 1 4 7 0 3 1 brit_507_NeEn 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 2 brit_507_NeEn 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 3 brit_507_NeEn 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 4 brit_507_NeEn 0 0 0 1 0 0 0 0 1 0 0 1 0 1 0 0 5 brit_507_NeEn 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 6 brit_507_NeEn 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 7 brit_600_VA 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 8 brit_600_VA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 9 brit_600_VA 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 10 brit_600_VA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 11 brit_600_VA 0 0 0 1 0 1 0 0 0 1 0 1 0 0 0 0 12 brit_600_VA 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 13 brit_600_VA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 14 brit_600_VA 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 15 brit_607_NY 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 16 brit_607_NY 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 17 brit_607_NY 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 18 brit_607_NY 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 19 brit_607_NY 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0

116

Locus (Allele size below) 1 Taxon, Sample, 2 12 13 13 13 14 14 14 15 15 15 15 16 16 16 17 # Region 6 9 2 5 8 1 4 7 0 3 6 9 2 5 8 7 1 brit_507_NeEn 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 2 brit_507_NeEn 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 3 brit_507_NeEn 1 0 0 1 0 0 0 0 1 0 0 1 0 0 0 0 4 brit_507_NeEn 1 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 5 brit_507_NeEn 1 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 6 brit_507_NeEn 1 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 7 brit_600_VA 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 8 brit_600_VA 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 9 brit_600_VA 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 10 brit_600_VA 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 11 brit_600_VA 1 0 0 1 1 0 0 0 1 0 0 0 0 0 0 0 12 brit_600_VA 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 13 brit_600_VA 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 14 brit_600_VA 1 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0 15 brit_607_NY 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 16 brit_607_NY 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 17 brit_607_NY 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 18 brit_607_NY 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 19 brit_607_NY 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0

117

Locus (Allele size below) CJSU2 1 Taxon, Sample, 8 19 23 27 # Region 0 8 1 3 51 54 57 60 63 66 72 75 78 81 84 87 1 brit_507_NeEn 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 brit_507_NeEn 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 brit_507_NeEn 1 0 0 0 0 1 1 0 0 0 0 0 1 0 0 0 4 brit_507_NeEn 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 5 brit_507_NeEn 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 1 6 brit_507_NeEn 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 1 7 brit_600_VA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 8 brit_600_VA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 9 brit_600_VA 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 1 10 brit_600_VA 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 11 brit_600_VA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 12 brit_600_VA 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 13 brit_600_VA 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 14 brit_600_VA 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 15 brit_607_NY 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 16 brit_607_NY 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 17 brit_607_NY 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 18 brit_607_NY 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 1 19 brit_607_NY 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 1

118

Locus (Allele size below)

# Taxon, Sample, Region 90 93 96 99 102 105 114 1 brit_507_NeEn 1 0 0 0 0 0 0 2 brit_507_NeEn 1 0 0 0 0 0 0 3 brit_507_NeEn 1 0 0 1 0 0 0 4 brit_507_NeEn 0 1 1 1 0 0 1 5 brit_507_NeEn 1 0 0 1 0 0 0 6 brit_507_NeEn 1 0 0 1 0 0 0 7 brit_600_VA 1 0 0 0 0 0 0 8 brit_600_VA 1 0 0 0 0 0 0 9 brit_600_VA 1 0 0 1 1 0 0 10 brit_600_VA 1 0 0 0 0 0 0 11 brit_600_VA 1 0 0 0 0 0 0 12 brit_600_VA 1 0 0 0 0 0 0 13 brit_600_VA 1 0 0 0 0 0 0 14 brit_600_VA 1 0 0 0 0 0 0 15 brit_607_NY 1 0 0 0 0 0 0 16 brit_607_NY 1 0 0 0 0 0 0 17 brit_607_NY 1 0 0 0 0 0 0 18 brit_607_NY 1 1 0 1 0 0 1 19 brit_607_NY 1 0 0 1 0 0 0

119

Locus (Allele size below) A8GO9 Taxon, Sample, 10 10 10 10 11 11 11 12 12 12 13 13 13 13 14 14 # Region 0 3 6 9 2 5 8 1 4 7 0 3 6 9 2 5 20 ped_513_NE 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 1 21 ped_513_NE 1 0 0 0 0 1 0 0 0 0 0 0 1 0 0 1 22 ped_513_NE 1 0 0 0 0 1 0 0 0 0 0 0 1 0 0 1 23 ped_513_NE 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 1 24 ped_513_NE 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 25 ped_513_NE 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 26 ped_513_NE 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 27 ped_513_NE 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 28 ped_513_NE 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 29 ped_565_MI 0 0 0 0 0 1 0 1 0 0 0 0 1 0 0 1 30 ped_565_MI 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 31 ped_565_MI 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 32 ped_565_MI 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 33 ped_565_MI 0 0 0 0 0 1 0 1 0 0 0 0 1 0 0 1 34 ped_565_MI 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 35 ped_565_MI 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 36 ped_565_MI 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 37 ped_565_MI 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 38 ped_565_MI 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0

120

Locus (Allele size below) 1 Taxon, Sample, 4 15 15 15 16 16 16 17 17 17 18 19 19 20 23 23 # Region 8 1 4 7 3 6 9 2 5 8 7 3 6 8 2 8 20 ped_513_NE 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 21 ped_513_NE 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 22 ped_513_NE 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 23 ped_513_NE 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 24 ped_513_NE 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 25 ped_513_NE 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 26 ped_513_NE 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 27 ped_513_NE 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 28 ped_513_NE 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 29 ped_565_MI 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 30 ped_565_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 31 ped_565_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 32 ped_565_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 33 ped_565_MI 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 34 ped_565_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 35 ped_565_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 36 ped_565_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 37 ped_565_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 38 ped_565_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

121

Locus (Allele size below) 2 Taxon, Sample, 4 25 25 26 26 26 28 28 29 30 31 35 36 41 42 42 # Region 4 6 9 2 5 8 6 9 8 7 0 8 4 5 1 4 20 ped_513_NE 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 1 21 ped_513_NE 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 22 ped_513_NE 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 23 ped_513_NE 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 1 24 ped_513_NE 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 1 25 ped_513_NE 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 26 ped_513_NE 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 1 27 ped_513_NE 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 28 ped_513_NE 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 29 ped_565_MI 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 30 ped_565_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 31 ped_565_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 32 ped_565_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 33 ped_565_MI 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 1 34 ped_565_MI 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 35 ped_565_MI 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 36 ped_565_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 37 ped_565_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 38 ped_565_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

122

Locus (Allele size below) AQLMG 4 Taxon, Sample, 3 44 45 49 53 53 56 58 59 10 10 10 11 11 11 11 # Region 6 2 1 9 5 8 2 6 2 1 4 7 0 3 6 9 20 ped_513_NE 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 21 ped_513_NE 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 22 ped_513_NE 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 23 ped_513_NE 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 24 ped_513_NE 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 25 ped_513_NE 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 26 ped_513_NE 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 27 ped_513_NE 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 28 ped_513_NE 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 29 ped_565_MI 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 30 ped_565_MI 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 31 ped_565_MI 0 1 1 0 0 0 0 0 0 1 0 1 0 0 1 0 32 ped_565_MI 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 33 ped_565_MI 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 34 ped_565_MI 0 1 0 0 0 0 0 0 0 0 0 1 0 0 1 0 35 ped_565_MI 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 36 ped_565_MI 0 1 0 0 0 0 0 0 0 0 0 1 0 0 1 0 37 ped_565_MI 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 38 ped_565_MI 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0

123

Locus (Allele size below) 1 Taxon, Sample, 2 12 13 13 14 14 14 14 15 15 15 16 16 16 17 17 # Region 5 8 4 7 0 3 6 9 2 5 8 1 4 7 0 3 20 ped_513_NE 0 1 0 0 0 0 1 1 0 0 0 0 0 0 0 0 21 ped_513_NE 0 1 0 0 0 0 0 0 0 0 0 0 1 1 0 0 22 ped_513_NE 0 1 0 0 0 0 0 0 0 0 0 0 1 1 0 0 23 ped_513_NE 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 24 ped_513_NE 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 25 ped_513_NE 0 1 0 0 0 0 1 1 0 0 0 0 0 0 0 0 26 ped_513_NE 0 1 0 0 0 0 1 1 0 0 0 0 0 0 0 0 27 ped_513_NE 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 28 ped_513_NE 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 29 ped_565_MI 0 1 0 0 0 0 1 1 0 0 0 0 0 0 0 0 30 ped_565_MI 0 1 1 0 0 0 1 1 0 0 0 0 0 0 0 0 31 ped_565_MI 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 32 ped_565_MI 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 33 ped_565_MI 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 34 ped_565_MI 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 35 ped_565_MI 0 0 1 0 0 0 0 0 0 0 0 0 0 1 1 0 36 ped_565_MI 0 1 1 0 0 0 0 0 0 0 0 0 0 1 1 0 37 ped_565_MI 0 1 1 0 0 1 0 0 0 0 0 0 0 0 0 0 38 ped_565_MI 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0

124

Locus (Allele size below) CIHYO 1 Taxon, Sample, 7 18 18 22 23 23 25 25 10 10 10 11 11 11 12 12 # Region 6 2 8 4 6 9 1 4 2 5 8 1 4 7 0 3 20 ped_513_NE 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 21 ped_513_NE 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 22 ped_513_NE 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 23 ped_513_NE 1 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 24 ped_513_NE 0 1 0 1 0 1 0 0 0 0 0 0 0 0 0 0 25 ped_513_NE 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 26 ped_513_NE 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 27 ped_513_NE 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 28 ped_513_NE 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 29 ped_565_MI 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 30 ped_565_MI 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 31 ped_565_MI 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 32 ped_565_MI 0 1 0 1 0 1 0 0 0 0 0 0 0 0 0 0 33 ped_565_MI 0 1 0 1 0 1 0 0 0 0 0 0 0 0 0 0 34 ped_565_MI 0 1 0 1 0 1 0 0 0 0 0 0 0 0 0 0 35 ped_565_MI 1 1 0 1 0 1 0 0 0 0 0 0 0 0 0 0 36 ped_565_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 37 ped_565_MI 0 1 0 1 0 0 0 0 0 0 0 1 0 0 1 0 38 ped_565_MI 0 1 1 0 0 0 0 0 0 0 0 0 0 0 1 0

125

Locus (Allele size below) Taxon, Sample, 12 12 13 13 13 14 14 14 15 15 15 15 16 16 16 17 # Region 6 9 2 5 8 1 4 7 0 3 6 9 2 5 8 7 20 ped_513_NE 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 21 ped_513_NE 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 22 ped_513_NE 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 23 ped_513_NE 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 24 ped_513_NE 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 25 ped_513_NE 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 26 ped_513_NE 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 27 ped_513_NE 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 28 ped_513_NE 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 29 ped_565_MI 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 30 ped_565_MI 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 31 ped_565_MI 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 32 ped_565_MI 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 33 ped_565_MI 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 34 ped_565_MI 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 35 ped_565_MI 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 36 ped_565_MI 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 37 ped_565_MI 1 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 38 ped_565_MI 0 0 1 1 0 0 1 0 0 0 0 0 0 0 0 0

126

Locus (Allele size below) CJSU2 1 Taxon, Sample, 8 19 23 27 # Region 0 8 1 3 51 54 57 60 63 66 72 75 78 81 84 87 20 ped_513_NE 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 21 ped_513_NE 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 22 ped_513_NE 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 23 ped_513_NE 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 24 ped_513_NE 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 25 ped_513_NE 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 26 ped_513_NE 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 27 ped_513_NE 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 1 28 ped_513_NE 0 0 0 0 0 1 1 0 0 0 0 0 1 0 0 1 29 ped_565_MI 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 30 ped_565_MI 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 31 ped_565_MI 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 32 ped_565_MI 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 33 ped_565_MI 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 34 ped_565_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 35 ped_565_MI 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 36 ped_565_MI 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 37 ped_565_MI 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 1 38 ped_565_MI 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0

127

Locus (Allele size below)

# Taxon, Sample, Region 90 93 96 99 102 105 114 20 ped_513_NE 0 1 1 1 0 0 1 21 ped_513_NE 0 0 0 1 0 0 0 22 ped_513_NE 0 0 0 1 0 0 0 23 ped_513_NE 0 1 1 1 0 0 1 24 ped_513_NE 0 0 0 1 0 0 0 25 ped_513_NE 0 1 1 1 0 0 1 26 ped_513_NE 0 0 0 1 0 0 0 27 ped_513_NE 1 1 1 1 0 0 0 28 ped_513_NE 1 0 0 0 0 0 0 29 ped_565_MI 0 1 1 1 0 0 1 30 ped_565_MI 0 0 0 1 0 0 0 31 ped_565_MI 0 1 0 1 1 0 1 32 ped_565_MI 0 1 1 1 0 0 1 33 ped_565_MI 0 1 1 1 0 0 1 34 ped_565_MI 0 0 0 1 1 0 0 35 ped_565_MI 0 0 0 1 0 0 1 36 ped_565_MI 0 0 0 1 0 0 1 37 ped_565_MI 1 1 0 1 0 0 1 38 ped_565_MI 0 0 0 1 0 0 0

128

Locus (Allele size below) A8GO9 Taxon, Sample, 10 10 10 10 11 11 11 12 12 12 13 13 13 13 14 14 # Region 0 3 6 9 2 5 8 1 4 7 0 3 6 9 2 5 39 ped_565_MI 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 40 ped_572_IN 1 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 41 ped_572_IN 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 42 ped_572_IN 1 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 43 ped_572_IN 1 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 44 ped_572_IN 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 45 ped_572_IN 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 46 ped_572_IN 0 0 0 0 0 1 0 1 0 0 0 0 1 0 0 1 47 ped_572_IN 0 0 0 0 0 1 0 1 0 0 0 0 1 1 0 1 48 ped_572_IN 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 49 ped_572_IN 0 0 0 0 0 0 0 1 0 0 0 0 1 1 0 0 50 ped_572_IN 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 51 ped_572_IN 0 0 0 0 0 1 0 1 0 0 0 0 1 1 0 0 52 ped_3790_MN 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 53 ped_3790_MN 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 54 ped_3790_MN 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 55 ped_3790_MN 1 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 56 ped_3790_MN 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 57 ped_3790_MN 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0

129

Locus (Allele size below) 1 Taxon, Sample, 4 15 15 15 16 16 16 17 17 17 18 19 19 20 23 23 # Region 8 1 4 7 3 6 9 2 5 8 7 3 6 8 2 8 39 ped_565_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 40 ped_572_IN 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 41 ped_572_IN 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 42 ped_572_IN 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 43 ped_572_IN 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 44 ped_572_IN 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 45 ped_572_IN 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 46 ped_572_IN 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 47 ped_572_IN 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 48 ped_572_IN 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 49 ped_572_IN 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 50 ped_572_IN 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 51 ped_572_IN 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 52 ped_3790_MN 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 53 ped_3790_MN 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 54 ped_3790_MN 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 55 ped_3790_MN 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 56 ped_3790_MN 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 57 ped_3790_MN 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

130

Locus (Allele size below) 2 Taxon, Sample, 4 25 25 26 26 26 28 28 29 30 31 35 36 41 42 42 # Region 4 6 9 2 5 8 6 9 8 7 0 8 4 5 1 4 39 ped_565_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 40 ped_572_IN 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 1 41 ped_572_IN 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 42 ped_572_IN 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 1 43 ped_572_IN 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 44 ped_572_IN 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 1 45 ped_572_IN 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 1 46 ped_572_IN 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 47 ped_572_IN 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 48 ped_572_IN 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 49 ped_572_IN 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 50 ped_572_IN 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 51 ped_572_IN 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 1 52 ped_3790_MN 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 53 ped_3790_MN 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 54 ped_3790_MN 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 55 ped_3790_MN 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 56 ped_3790_MN 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 57 ped_3790_MN 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

131

Locus (Allele size below) AQLMG 4 Taxon, Sample, 3 44 45 49 53 53 56 58 59 10 10 10 11 11 11 11 # Region 6 2 1 9 5 8 2 6 2 1 4 7 0 3 6 9 39 ped_565_MI 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 40 ped_572_IN 0 1 0 0 0 0 0 0 0 0 0 1 0 0 1 0 41 ped_572_IN 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 42 ped_572_IN 0 1 0 0 0 0 0 0 0 0 0 1 0 0 1 0 43 ped_572_IN 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 44 ped_572_IN 0 1 0 0 0 0 0 0 0 0 0 1 0 0 1 0 45 ped_572_IN 0 1 0 0 0 0 0 0 0 0 0 1 0 0 1 0 46 ped_572_IN 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 47 ped_572_IN 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 48 ped_572_IN 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 49 ped_572_IN 0 1 0 0 0 0 0 0 0 1 0 1 0 0 0 0 50 ped_572_IN 0 1 0 0 0 0 0 0 0 0 1 1 0 0 1 0 51 ped_572_IN 0 1 0 0 0 0 0 0 0 1 0 1 0 0 1 0 52 ped_3790_MN 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 53 ped_3790_MN 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 54 ped_3790_MN 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 55 ped_3790_MN 0 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 56 ped_3790_MN 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 57 ped_3790_MN 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

132

Locus (Allele size below) 1 Taxon, Sample, 2 12 13 13 14 14 14 14 15 15 15 16 16 16 17 17 # Region 5 8 4 7 0 3 6 9 2 5 8 1 4 7 0 3 39 ped_565_MI 0 0 0 0 0 1 1 1 0 0 0 0 0 0 0 0 40 ped_572_IN 0 1 0 0 0 0 0 0 0 0 0 0 0 1 1 0 41 ped_572_IN 0 1 1 0 0 0 0 0 1 0 0 0 0 1 0 0 42 ped_572_IN 0 1 0 0 0 0 0 1 1 0 0 0 0 1 0 0 43 ped_572_IN 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 44 ped_572_IN 0 1 0 0 0 0 0 0 0 0 0 0 0 1 1 0 45 ped_572_IN 0 1 0 0 0 0 0 0 0 0 0 0 0 1 1 0 46 ped_572_IN 0 1 1 0 0 1 0 0 0 0 0 0 0 1 1 0 47 ped_572_IN 0 1 0 0 0 1 0 0 0 0 0 0 0 0 1 1 48 ped_572_IN 0 1 1 0 0 0 0 0 0 0 0 0 0 1 1 0 49 ped_572_IN 1 1 1 0 0 0 1 0 1 0 0 0 0 1 0 0 50 ped_572_IN 0 1 1 0 0 0 0 0 0 0 0 0 0 0 1 1 51 ped_572_IN 0 1 1 0 0 0 0 0 0 0 0 0 0 0 1 0 52 ped_3790_MN 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 53 ped_3790_MN 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 54 ped_3790_MN 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 55 ped_3790_MN 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 56 ped_3790_MN 0 1 0 1 0 0 0 0 0 1 0 0 0 0 0 0 57 ped_3790_MN 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0

133

Locus (Allele size below) CIHYO 1 Taxon, Sample, 7 18 18 22 23 23 25 25 10 10 10 11 11 11 12 12 # Region 6 2 8 4 6 9 1 4 2 5 8 1 4 7 0 3 39 ped_565_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 40 ped_572_IN 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 41 ped_572_IN 0 1 0 1 0 1 0 0 0 0 0 0 0 0 0 0 42 ped_572_IN 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 43 ped_572_IN 0 1 0 1 0 1 0 0 0 0 0 0 0 0 0 0 44 ped_572_IN 0 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 45 ped_572_IN 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 46 ped_572_IN 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 47 ped_572_IN 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 48 ped_572_IN 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 49 ped_572_IN 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 50 ped_572_IN 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 51 ped_572_IN 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 52 ped_3790_MN 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 53 ped_3790_MN 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 54 ped_3790_MN 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 55 ped_3790_MN 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 56 ped_3790_MN 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 57 ped_3790_MN 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

134

Locus (Allele size below) 1 Taxon, Sample, 2 12 13 13 13 14 14 14 15 15 15 15 16 16 16 17 # Region 6 9 2 5 8 1 4 7 0 3 6 9 2 5 8 7 39 ped_565_MI 1 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 40 ped_572_IN 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 41 ped_572_IN 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 42 ped_572_IN 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 43 ped_572_IN 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 44 ped_572_IN 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 45 ped_572_IN 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 46 ped_572_IN 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 47 ped_572_IN 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 48 ped_572_IN 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 49 ped_572_IN 1 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 50 ped_572_IN 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 51 ped_572_IN 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 52 ped_3790_MN 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 53 ped_3790_MN 0 0 1 1 0 0 1 0 0 0 0 0 0 0 0 0 54 ped_3790_MN 0 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0 55 ped_3790_MN 0 0 1 1 0 0 1 0 0 0 0 0 0 0 0 0 56 ped_3790_MN 0 0 1 1 0 0 1 0 0 0 0 0 0 0 0 0 57 ped_3790_MN 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0

135

Locus (Allele size below) CJSU2 1 Taxon, Sample, 8 19 23 27 # Region 0 8 1 3 51 54 57 60 63 66 72 75 78 81 84 87 39 ped_565_MI 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 40 ped_572_IN 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 41 ped_572_IN 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 42 ped_572_IN 0 0 0 0 0 0 1 0 0 0 1 0 1 0 0 0 43 ped_572_IN 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 44 ped_572_IN 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 45 ped_572_IN 0 0 0 0 0 0 1 0 0 0 0 0 1 0 1 0 46 ped_572_IN 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 47 ped_572_IN 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 48 ped_572_IN 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 49 ped_572_IN 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 50 ped_572_IN 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 51 ped_572_IN 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 52 ped_3790_MN 0 0 0 0 0 1 0 0 0 1 1 0 0 0 0 1 53 ped_3790_MN 0 0 0 0 0 0 1 0 1 0 0 0 1 0 0 1 54 ped_3790_MN 0 0 0 0 0 0 1 0 0 0 0 0 1 0 1 1 55 ped_3790_MN 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 1 56 ped_3790_MN 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 57 ped_3790_MN 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0

136

Locus (Allele size below)

# Taxon, Sample, Region 90 93 96 99 102 105 114 39 ped_565_MI 1 0 0 0 0 0 0 40 ped_572_IN 0 1 1 1 0 0 1 41 ped_572_IN 0 1 1 1 0 0 1 42 ped_572_IN 1 1 1 1 0 0 1 43 ped_572_IN 0 1 1 1 0 0 1 44 ped_572_IN 0 1 1 1 0 0 1 45 ped_572_IN 0 0 1 1 0 0 1 46 ped_572_IN 1 0 1 1 0 0 1 47 ped_572_IN 1 1 1 1 0 0 0 48 ped_572_IN 1 0 1 1 0 0 0 49 ped_572_IN 1 0 1 1 0 0 0 50 ped_572_IN 1 0 1 1 0 0 1 51 ped_572_IN 0 1 1 1 0 0 1 52 ped_3790_MN 1 0 0 1 0 0 0 53 ped_3790_MN 1 0 0 1 0 0 0 54 ped_3790_MN 1 0 1 1 1 0 0 55 ped_3790_MN 1 0 0 1 0 0 0 56 ped_3790_MN 1 0 1 1 0 0 0 57 ped_3790_MN 0 1 1 1 0 0 1

137

Locus (Allele size below) A8GO9 Taxon, Sample, 10 10 10 10 11 11 11 12 12 12 13 13 13 13 14 14 # Region 0 3 6 9 2 5 8 1 4 7 0 3 6 9 2 5 58 ped_25213_KS 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 59 ped_25213_KS 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 60 ped_25213_KS 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 61 ped_25213_KS 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 62 ped_25213_KS 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 63 sub_563_OH1 0 0 0 0 0 0 0 0 0 0 1 0 0 1 1 0 64 sub_563_OH1 0 0 0 0 1 1 0 0 0 0 0 0 1 0 1 0 65 sub_563_OH1 1 0 1 0 0 0 0 0 0 1 0 0 1 0 0 0 66 sub_563_OH1 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 67 sub_563_OH1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 68 sub_563_OH1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 69 sub_563_OH1 0 0 0 0 0 1 0 1 0 0 0 1 0 0 1 0 70 sub_563_OH1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 71 sub_563_OH1 1 0 0 0 0 1 0 0 0 0 0 1 1 0 0 0 72 sub_563_OH1 0 0 0 0 0 1 0 1 0 0 0 0 1 0 0 0 73 sub_570_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 74 sub_570_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 75 sub_570_MI 0 1 0 0 0 0 0 0 0 0 0 0 1 0 1 0 76 sub_570_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0

138

Locus (Allele size below) 1 Taxon, Sample, 4 15 15 15 16 16 16 17 17 17 18 19 19 20 23 23 # Region 8 1 4 7 3 6 9 2 5 8 7 3 6 8 2 8 58 ped_25213_KS 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 59 ped_25213_KS 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 60 ped_25213_KS 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 61 ped_25213_KS 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 62 ped_25213_KS 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 63 sub_563_OH1 0 0 0 1 0 1 1 0 0 0 0 0 0 0 1 0 64 sub_563_OH1 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 65 sub_563_OH1 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 66 sub_563_OH1 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 67 sub_563_OH1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 68 sub_563_OH1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 69 sub_563_OH1 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 70 sub_563_OH1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 71 sub_563_OH1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 72 sub_563_OH1 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 73 sub_570_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 74 sub_570_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 75 sub_570_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 76 sub_570_MI 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0

139

Locus (Allele size below) 2 Taxon, Sample, 4 25 25 26 26 26 28 28 29 30 31 35 36 41 42 42 # Region 4 6 9 2 5 8 6 9 8 7 0 8 4 5 1 4 58 ped_25213_KS 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 59 ped_25213_KS 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 60 ped_25213_KS 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 61 ped_25213_KS 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 62 ped_25213_KS 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 63 sub_563_OH1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 64 sub_563_OH1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 65 sub_563_OH1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 66 sub_563_OH1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 67 sub_563_OH1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 68 sub_563_OH1 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 1 69 sub_563_OH1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 70 sub_563_OH1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 71 sub_563_OH1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 72 sub_563_OH1 0 0 0 0 0 0 0 1 0 1 0 1 0 0 0 0 73 sub_570_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 74 sub_570_MI 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 75 sub_570_MI 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 76 sub_570_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1

140

Locus (Allele size below) AQLMG 4 Taxon, Sample, 3 44 45 49 53 53 56 58 59 10 10 10 11 11 11 11 # Region 6 2 1 9 5 8 2 6 2 1 4 7 0 3 6 9 58 ped_25213_KS 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 59 ped_25213_KS 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 60 ped_25213_KS 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 61 ped_25213_KS 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 62 ped_25213_KS 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 63 sub_563_OH1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 64 sub_563_OH1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 65 sub_563_OH1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 66 sub_563_OH1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 67 sub_563_OH1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 68 sub_563_OH1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 69 sub_563_OH1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 70 sub_563_OH1 0 1 0 0 1 0 0 0 0 0 0 1 0 0 0 0 71 sub_563_OH1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 72 sub_563_OH1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 73 sub_570_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 74 sub_570_MI 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 75 sub_570_MI 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 76 sub_570_MI 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0

141

Locus (Allele size below) 1 Taxon, Sample, 2 12 13 13 14 14 14 14 15 15 15 16 16 16 17 17 # Region 5 8 4 7 0 3 6 9 2 5 8 1 4 7 0 3 58 ped_25213_KS 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 59 ped_25213_KS 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 60 ped_25213_KS 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 61 ped_25213_KS 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 62 ped_25213_KS 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 63 sub_563_OH1 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 64 sub_563_OH1 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 65 sub_563_OH1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 66 sub_563_OH1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 67 sub_563_OH1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 68 sub_563_OH1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 69 sub_563_OH1 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 70 sub_563_OH1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 71 sub_563_OH1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 72 sub_563_OH1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 73 sub_570_MI 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 74 sub_570_MI 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 75 sub_570_MI 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 76 sub_570_MI 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0

142

Locus (Allele size below) CIHYO 1 Taxon, Sample, 7 18 18 22 23 23 25 25 10 10 10 11 11 11 12 12 # Region 6 2 8 4 6 9 1 4 2 5 8 1 4 7 0 3 58 ped_25213_KS 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 59 ped_25213_KS 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 60 ped_25213_KS 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 61 ped_25213_KS 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 62 ped_25213_KS 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 63 sub_563_OH1 0 0 0 0 0 0 0 0 1 1 1 1 0 1 1 1 64 sub_563_OH1 0 0 0 0 0 0 0 0 1 1 1 1 0 1 1 1 65 sub_563_OH1 0 0 0 1 0 1 0 0 1 1 0 1 0 1 1 1 66 sub_563_OH1 0 0 0 1 0 1 0 0 0 1 0 0 0 1 1 1 67 sub_563_OH1 0 0 0 0 0 1 0 0 0 0 0 1 1 1 1 1 68 sub_563_OH1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 69 sub_563_OH1 0 0 0 1 0 1 0 0 0 1 1 1 0 1 1 1 70 sub_563_OH1 0 0 0 0 0 0 0 0 0 1 0 1 0 1 1 0 71 sub_563_OH1 0 0 0 1 0 1 0 0 0 0 0 1 0 1 1 1 72 sub_563_OH1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 73 sub_570_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 74 sub_570_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 75 sub_570_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 76 sub_570_MI 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0

143

Locus (Allele size below) 1 Taxon, Sample, 2 12 13 13 13 14 14 14 15 15 15 15 16 16 16 17 # Region 6 9 2 5 8 1 4 7 0 3 6 9 2 5 8 7 58 ped_25213_KS 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 59 ped_25213_KS 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 60 ped_25213_KS 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 61 ped_25213_KS 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 62 ped_25213_KS 0 1 0 1 0 0 1 0 1 0 0 0 0 0 0 0 63 sub_563_OH1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 64 sub_563_OH1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 65 sub_563_OH1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 66 sub_563_OH1 1 0 1 1 0 1 0 0 0 0 0 0 0 0 0 0 67 sub_563_OH1 1 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 68 sub_563_OH1 1 0 1 1 1 0 0 0 1 0 0 0 0 0 0 0 69 sub_563_OH1 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 70 sub_563_OH1 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 71 sub_563_OH1 0 0 1 1 0 1 0 1 0 0 0 0 0 0 0 0 72 sub_563_OH1 1 0 1 1 1 0 0 0 1 0 0 0 0 0 0 0 73 sub_570_MI 0 0 1 1 0 1 0 0 0 0 0 0 0 0 0 0 74 sub_570_MI 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 75 sub_570_MI 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 76 sub_570_MI 0 0 1 1 0 1 0 0 0 0 0 0 0 0 0 0

144

Locus (Allele size below) CJSU2 1 Taxon, Sample, 8 19 23 27 # Region 0 8 1 3 51 54 57 60 63 66 72 75 78 81 84 87 58 ped_25213_KS 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 59 ped_25213_KS 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 60 ped_25213_KS 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 1 61 ped_25213_KS 0 0 0 0 0 0 1 0 0 0 0 1 1 0 0 1 62 ped_25213_KS 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 63 sub_563_OH1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 64 sub_563_OH1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 65 sub_563_OH1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 66 sub_563_OH1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 67 sub_563_OH1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 68 sub_563_OH1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 69 sub_563_OH1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 70 sub_563_OH1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 71 sub_563_OH1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 72 sub_563_OH1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 73 sub_570_MI 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 1 74 sub_570_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 75 sub_570_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 76 sub_570_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

145

Locus (Allele size below)

# Taxon, Sample, Region 90 93 96 99 102 105 114 58 ped_25213_KS 1 0 0 1 0 0 0 59 ped_25213_KS 0 0 1 1 0 0 0 60 ped_25213_KS 1 1 0 1 0 0 0 61 ped_25213_KS 1 0 1 1 0 0 0 62 ped_25213_KS 1 0 0 0 0 0 0 63 sub_563_OH1 1 0 0 0 0 0 0 64 sub_563_OH1 1 0 0 0 0 0 0 65 sub_563_OH1 1 0 0 0 0 0 0 66 sub_563_OH1 1 0 0 0 0 0 0 67 sub_563_OH1 0 0 0 1 0 0 0 68 sub_563_OH1 1 0 0 0 0 0 0 69 sub_563_OH1 1 0 0 0 0 0 0 70 sub_563_OH1 1 0 0 0 0 0 0 71 sub_563_OH1 0 0 0 1 0 0 0 72 sub_563_OH1 1 0 0 0 0 0 0 73 sub_570_MI 1 1 0 1 1 0 0 74 sub_570_MI 0 0 0 1 1 0 0 75 sub_570_MI 0 0 0 0 1 0 0 76 sub_570_MI 0 0 0 0 1 0 0

146

Locus (Allele size below) A8GO9 Taxon, Sample, 10 10 10 10 11 11 11 12 12 12 13 13 13 13 14 14 # Region 0 3 6 9 2 5 8 1 4 7 0 3 6 9 2 5 77 sub_570_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 78 sub_570_MI 0 1 0 0 0 0 0 0 0 0 0 0 1 0 1 1 79 sub_570_MI 0 1 0 0 0 1 0 0 0 0 0 1 1 1 1 1 80 sub_570_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 81 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 82 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 83 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 84 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 85 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 86 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 87 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 88 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 89 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 90 sub_599_VA2 1 0 0 1 0 1 0 0 0 0 0 0 0 0 1 0 91 sub_599_VA2 0 1 0 1 1 0 0 0 0 0 1 0 0 0 1 0 92 sub_599_VA2 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 93 sub_599_VA2 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 1 94 sub_599_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 95 sub_599_VA2 0 0 1 0 1 0 1 0 0 0 0 0 0 0 1 0

147

Locus (Allele size below) 1 Taxon, Sample, 4 15 15 15 16 16 16 17 17 17 18 19 19 20 23 23 # Region 8 1 4 7 3 6 9 2 5 8 7 3 6 8 2 8 77 sub_570_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 78 sub_570_MI 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 79 sub_570_MI 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 80 sub_570_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 81 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 82 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 83 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 84 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 85 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 86 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 87 sub_590_VA1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 88 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 89 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 90 sub_599_VA2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 91 sub_599_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 92 sub_599_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 93 sub_599_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 94 sub_599_VA2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 95 sub_599_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

148

Locus (Allele size below) 2 Taxon, Sample, 4 25 25 26 26 26 28 28 29 30 31 35 36 41 42 42 # Region 4 6 9 2 5 8 6 9 8 7 0 8 4 5 1 4 77 sub_570_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 78 sub_570_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 79 sub_570_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 80 sub_570_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 81 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 82 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 83 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 84 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 85 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 86 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 87 sub_590_VA1 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 1 88 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 89 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 90 sub_599_VA2 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 1 91 sub_599_VA2 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 1 92 sub_599_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 93 sub_599_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 94 sub_599_VA2 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 95 sub_599_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

149

Locus (Allele size below) AQLMG 4 Taxon, Sample, 3 44 45 49 53 53 56 58 59 10 10 10 11 11 11 11 # Region 6 2 1 9 5 8 2 6 2 1 4 7 0 3 6 9 77 sub_570_MI 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 78 sub_570_MI 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 79 sub_570_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 80 sub_570_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 81 sub_590_VA1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 82 sub_590_VA1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 83 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 84 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 85 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 86 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 87 sub_590_VA1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 88 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 89 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 90 sub_599_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 91 sub_599_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 92 sub_599_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 93 sub_599_VA2 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 94 sub_599_VA2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 95 sub_599_VA2 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0

150

Locus (Allele size below) 1 Taxon, Sample, 2 12 13 13 14 14 14 14 15 15 15 16 16 16 17 17 # Region 5 8 4 7 0 3 6 9 2 5 8 1 4 7 0 3 77 sub_570_MI 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 78 sub_570_MI 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 79 sub_570_MI 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 80 sub_570_MI 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 81 sub_590_VA1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 82 sub_590_VA1 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 83 sub_590_VA1 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 84 sub_590_VA1 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 85 sub_590_VA1 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 86 sub_590_VA1 1 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 87 sub_590_VA1 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 88 sub_590_VA1 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 89 sub_590_VA1 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 90 sub_599_VA2 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 91 sub_599_VA2 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 92 sub_599_VA2 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 93 sub_599_VA2 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 94 sub_599_VA2 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 95 sub_599_VA2 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

151

Locus (Allele size below) CIHYO 1 Taxon, Sample, 7 18 18 22 23 23 25 25 10 10 10 11 11 11 12 12 # Region 6 2 8 4 6 9 1 4 2 5 8 1 4 7 0 3 77 sub_570_MI 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 1 78 sub_570_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 79 sub_570_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 80 sub_570_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 81 sub_590_VA1 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 82 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 83 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 84 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 85 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 86 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 87 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 88 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 89 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 90 sub_599_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 91 sub_599_VA2 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 92 sub_599_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 93 sub_599_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 94 sub_599_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 95 sub_599_VA2 0 0 0 0 0 0 0 0 1 0 1 0 0 0 1 0

152

Locus (Allele size below) 1 Taxon, Sample, 2 12 13 13 13 14 14 14 15 15 15 15 16 16 16 17 # Region 6 9 2 5 8 1 4 7 0 3 6 9 2 5 8 7 77 sub_570_MI 0 0 1 1 0 1 0 0 0 0 0 0 0 0 0 0 78 sub_570_MI 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 79 sub_570_MI 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 80 sub_570_MI 0 0 1 1 0 1 0 0 0 0 0 0 0 0 0 0 81 sub_590_VA1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 82 sub_590_VA1 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 83 sub_590_VA1 0 1 0 1 0 1 0 1 0 0 0 1 0 0 0 0 84 sub_590_VA1 0 0 0 1 0 0 1 1 0 0 0 1 0 0 0 0 85 sub_590_VA1 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 86 sub_590_VA1 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 87 sub_590_VA1 0 0 0 1 0 0 1 1 0 0 0 0 0 0 0 0 88 sub_590_VA1 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 89 sub_590_VA1 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 90 sub_599_VA2 1 0 1 0 1 0 0 0 1 0 0 0 0 0 0 0 91 sub_599_VA2 1 0 1 1 1 0 0 0 1 0 0 0 0 0 0 0 92 sub_599_VA2 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 93 sub_599_VA2 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 94 sub_599_VA2 1 0 1 1 1 0 0 0 1 0 0 0 0 0 0 0 95 sub_599_VA2 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0

153

Locus (Allele size below) CJSU2 1 Taxon, Sample, 8 19 23 27 # Region 0 8 1 3 51 54 57 60 63 66 72 75 78 81 84 87 77 sub_570_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 78 sub_570_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 79 sub_570_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 80 sub_570_MI 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 81 sub_590_VA1 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 1 82 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 83 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 84 sub_590_VA1 0 0 0 0 0 1 1 0 0 0 0 0 1 0 0 1 85 sub_590_VA1 0 0 0 0 0 1 1 0 0 0 0 1 0 0 0 0 86 sub_590_VA1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 87 sub_590_VA1 0 0 0 0 0 0 1 0 0 0 0 0 1 0 1 1 88 sub_590_VA1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 1 89 sub_590_VA1 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 90 sub_599_VA2 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 91 sub_599_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 92 sub_599_VA2 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 1 93 sub_599_VA2 0 0 0 0 0 1 1 0 0 0 0 0 1 1 0 1 94 sub_599_VA2 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 95 sub_599_VA2 0 0 0 0 0 1 1 0 0 1 0 1 0 0 0 1

154

Locus (Allele size below)

# Taxon, Sample, Region 90 93 96 99 102 105 114 77 sub_570_MI 0 0 0 0 1 0 0 78 sub_570_MI 0 0 0 0 1 0 0 79 sub_570_MI 0 0 0 0 1 1 0 80 sub_570_MI 1 0 0 0 0 0 0 81 sub_590_VA1 1 1 0 1 0 0 0 82 sub_590_VA1 1 0 0 0 0 0 0 83 sub_590_VA1 1 0 0 0 0 0 0 84 sub_590_VA1 1 0 0 1 0 0 0 85 sub_590_VA1 1 1 1 1 0 0 1 86 sub_590_VA1 1 0 0 0 0 0 0 87 sub_590_VA1 1 1 0 1 0 0 1 88 sub_590_VA1 1 1 0 1 0 0 1 89 sub_590_VA1 1 1 0 1 0 0 1 90 sub_599_VA2 1 0 0 0 0 0 0 91 sub_599_VA2 1 0 0 1 0 0 0 92 sub_599_VA2 1 1 0 1 0 0 1 93 sub_599_VA2 1 1 0 1 0 0 0 94 sub_599_VA2 1 0 1 1 0 0 0 95 sub_599_VA2 1 0 1 1 0 0 0

155

Locus (Allele size below) A8GO9 Taxon, Sample, 10 10 10 10 11 11 11 12 12 12 13 13 13 13 14 14 # Region 0 3 6 9 2 5 8 1 4 7 0 3 6 9 2 5 96 sub_599_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 97 sub_599_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 98 sub_599_VA2 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 99 sub_599_VA2 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 10 0 sub_601_OH2 0 0 0 0 0 0 1 0 1 0 0 0 0 0 1 0 10 1 sub_601_OH2 0 0 0 0 0 0 1 0 0 0 1 0 0 0 1 0 10 2 sub_601_OH2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 3 sub_601_OH2 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 10 4 sub_601_OH2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 5 sub_601_OH2 0 0 0 0 0 0 0 1 0 0 0 1 0 0 1 0 10 6 sub_601_OH2 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 10 7 virg_592_VA1 0 0 1 0 0 1 0 0 1 0 0 0 0 0 0 0 10 8 virg_592_VA1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 10 9 virg_592_VA1 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 11 0 virg_592_VA1 0 0 1 0 0 1 0 1 0 0 0 0 0 0 0 0 11 1 virg_592_VA1 0 0 1 0 0 1 0 1 0 0 0 0 0 0 0 0 11 2 virg_592_VA1 0 0 1 0 0 1 0 0 0 0 0 0 1 0 0 0 11 3 virg_592_VA1 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 11 4 virg_592_VA1 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0

156

Locus (Allele size below) 1 Taxon, Sample, 4 15 15 15 16 16 16 17 17 17 18 19 19 20 23 23 # Region 8 1 4 7 3 6 9 2 5 8 7 3 6 8 2 8 96 sub_599_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 97 sub_599_VA2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 98 sub_599_VA2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 99 sub_599_VA2 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 0 sub_601_OH2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 10 1 sub_601_OH2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 2 sub_601_OH2 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 10 3 sub_601_OH2 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 4 sub_601_OH2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 5 sub_601_OH2 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 6 sub_601_OH2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 7 virg_592_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 8 virg_592_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 9 virg_592_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 11 0 virg_592_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 11 1 virg_592_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 11 2 virg_592_VA1 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 11 3 virg_592_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 11 4 virg_592_VA1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0

157

Locus (Allele size below) 2 Taxon, Sample, 4 25 25 26 26 26 28 28 29 30 31 35 36 41 42 42 # Region 4 6 9 2 5 8 6 9 8 7 0 8 4 5 1 4 96 sub_599_VA2 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 97 sub_599_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 98 sub_599_VA2 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 1 99 sub_599_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 0 sub_601_OH2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 10 1 sub_601_OH2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 2 sub_601_OH2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 3 sub_601_OH2 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 10 4 sub_601_OH2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 5 sub_601_OH2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 6 sub_601_OH2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 10 7 virg_592_VA1 0 0 0 0 0 0 0 1 0 1 0 0 0 0 1 0 10 8 virg_592_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 9 virg_592_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 11 0 virg_592_VA1 0 0 0 0 0 0 0 1 0 1 0 0 0 0 1 0 11 1 virg_592_VA1 0 0 0 0 0 0 0 1 0 1 0 0 0 0 1 0 11 2 virg_592_VA1 0 0 0 0 0 0 0 1 0 1 0 0 0 0 1 0 11 3 virg_592_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 11 4 virg_592_VA1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0

158

Locus (Allele size below) AQLMG 4 Taxon, Sample, 3 44 45 49 53 53 56 58 59 10 10 10 11 11 11 11 # Region 6 2 1 9 5 8 2 6 2 1 4 7 0 3 6 9 96 sub_599_VA2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 97 sub_599_VA2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 98 sub_599_VA2 0 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 99 sub_599_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 0 sub_601_OH2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 1 sub_601_OH2 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 10 2 sub_601_OH2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 3 sub_601_OH2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 10 4 sub_601_OH2 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 10 5 sub_601_OH2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 6 sub_601_OH2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 7 virg_592_VA1 0 1 0 0 0 0 0 0 0 0 0 1 0 1 0 0 10 8 virg_592_VA1 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 10 9 virg_592_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 11 0 virg_592_VA1 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 11 1 virg_592_VA1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 11 2 virg_592_VA1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 11 3 virg_592_VA1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 11 4 virg_592_VA1 0 1 0 0 0 0 0 0 0 1 0 1 0 0 0 0

159

Locus (Allele size below) 1 Taxon, Sample, 2 12 13 13 14 14 14 14 15 15 15 16 16 16 17 17 # Region 5 8 4 7 0 3 6 9 2 5 8 1 4 7 0 3 96 sub_599_VA2 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 97 sub_599_VA2 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 98 sub_599_VA2 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 99 sub_599_VA2 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 10 0 sub_601_OH2 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 10 1 sub_601_OH2 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 10 2 sub_601_OH2 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 10 3 sub_601_OH2 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 10 4 sub_601_OH2 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 10 5 sub_601_OH2 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 6 sub_601_OH2 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 10 7 virg_592_VA1 0 1 0 0 0 0 0 0 0 0 0 1 1 0 1 0 10 8 virg_592_VA1 0 1 1 0 1 0 0 0 0 0 0 0 0 0 0 0 10 9 virg_592_VA1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 11 0 virg_592_VA1 0 1 0 0 0 0 0 0 0 0 0 1 1 0 1 0 11 1 virg_592_VA1 0 0 0 0 0 0 0 0 0 0 0 1 1 0 1 0 11 2 virg_592_VA1 0 1 0 1 0 0 0 0 0 0 0 1 1 0 1 0 11 3 virg_592_VA1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 11 4 virg_592_VA1 0 1 0 1 0 0 0 0 0 0 0 1 1 0 1 0

160

Locus (Allele size below) CIHYO 1 Taxon, Sample, 7 18 18 22 23 23 25 25 10 10 10 11 11 11 12 12 # Region 6 2 8 4 6 9 1 4 2 5 8 1 4 7 0 3 96 sub_599_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 97 sub_599_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 98 sub_599_VA2 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 99 sub_599_VA2 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 10 0 sub_601_OH2 0 0 0 0 0 0 0 0 1 1 1 0 0 1 0 0 10 1 sub_601_OH2 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 10 2 sub_601_OH2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 10 3 sub_601_OH2 0 0 0 0 0 0 0 0 1 1 0 0 0 0 1 0 10 4 sub_601_OH2 0 0 0 0 0 0 0 0 1 1 1 1 0 0 0 0 10 5 sub_601_OH2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 6 sub_601_OH2 0 0 0 0 0 1 0 0 1 0 1 0 0 0 0 0 10 7 virg_592_VA1 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 10 8 virg_592_VA1 0 0 0 1 0 1 1 0 0 0 0 0 0 0 1 1 10 9 virg_592_VA1 0 0 0 0 0 0 0 0 1 1 0 1 0 0 0 0 11 0 virg_592_VA1 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 11 1 virg_592_VA1 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 11 2 virg_592_VA1 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 11 3 virg_592_VA1 0 0 0 0 0 0 0 0 1 1 1 1 0 0 0 0 11 4 virg_592_VA1 0 0 0 1 0 0 0 0 0 0 0 1 0 1 1 0

161

Locus (Allele size below) 1 Taxon, Sample, 2 12 13 13 13 14 14 14 15 15 15 15 16 16 16 17 # Region 6 9 2 5 8 1 4 7 0 3 6 9 2 5 8 7 96 sub_599_VA2 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 97 sub_599_VA2 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 98 sub_599_VA2 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 99 sub_599_VA2 1 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0 10 0 sub_601_OH2 1 0 1 1 1 0 0 0 0 0 0 0 0 0 0 0 10 1 sub_601_OH2 1 0 1 1 1 0 0 0 1 0 0 0 0 0 0 0 10 2 sub_601_OH2 1 0 1 1 0 0 0 0 1 0 0 0 1 0 0 0 10 3 sub_601_OH2 1 0 1 1 1 0 0 0 1 0 0 0 0 0 0 0 10 4 sub_601_OH2 1 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 10 5 sub_601_OH2 1 0 1 1 0 0 0 1 1 0 0 0 0 0 0 0 10 6 sub_601_OH2 1 0 1 1 1 0 0 0 1 0 0 0 0 0 0 0 10 7 virg_592_VA1 0 0 1 0 0 0 0 0 1 0 0 0 0 0 1 0 10 8 virg_592_VA1 0 0 0 1 0 0 1 1 0 0 0 0 0 0 0 0 10 9 virg_592_VA1 1 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0 11 0 virg_592_VA1 1 0 1 1 1 0 0 0 1 0 0 0 0 0 0 0 11 1 virg_592_VA1 1 0 1 1 1 1 0 0 0 0 0 0 0 0 0 0 11 2 virg_592_VA1 1 0 1 1 0 0 1 0 1 0 0 0 0 0 1 0 11 3 virg_592_VA1 1 0 1 1 1 0 0 0 0 0 0 0 0 0 0 0 11 4 virg_592_VA1 1 0 1 1 0 0 1 0 0 0 0 0 0 0 1 0

162

Locus (Allele size below) CJSU2 1 Taxon, Sample, 8 19 23 27 # Region 0 8 1 3 51 54 57 60 63 66 72 75 78 81 84 87 96 sub_599_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 97 sub_599_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 98 sub_599_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 99 sub_599_VA2 0 0 0 0 0 1 1 1 0 0 0 1 1 0 1 1 10 0 sub_601_OH2 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 10 1 sub_601_OH2 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 10 2 sub_601_OH2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 3 sub_601_OH2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 4 sub_601_OH2 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 10 5 sub_601_OH2 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 1 10 6 sub_601_OH2 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 10 7 virg_592_VA1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 10 8 virg_592_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 10 9 virg_592_VA1 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 11 0 virg_592_VA1 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 1 11 1 virg_592_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 11 2 virg_592_VA1 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 1 11 3 virg_592_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 11 4 virg_592_VA1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0

163

Locus (Allele size below)

# Taxon, Sample, Region 90 93 96 99 102 105 114 96 sub_599_VA2 0 0 1 1 0 0 0 97 sub_599_VA2 0 0 0 1 0 0 0 98 sub_599_VA2 0 0 1 1 0 0 0 99 sub_599_VA2 1 0 0 0 0 0 0 100 sub_601_OH2 1 0 1 1 0 0 0 101 sub_601_OH2 1 0 1 1 0 0 0 102 sub_601_OH2 1 0 0 1 0 0 0 103 sub_601_OH2 1 0 0 1 0 0 0 104 sub_601_OH2 1 0 1 1 1 0 0 105 sub_601_OH2 1 0 0 1 1 0 0 106 sub_601_OH2 1 0 1 1 0 0 0 107 virg_592_VA1 1 1 0 0 0 0 1 108 virg_592_VA1 1 0 0 0 0 0 0 109 virg_592_VA1 1 0 0 0 0 0 1 110 virg_592_VA1 1 0 0 1 0 0 1 111 virg_592_VA1 1 1 0 0 1 0 1 112 virg_592_VA1 1 0 0 0 0 0 0 113 virg_592_VA1 1 0 0 0 0 0 1 114 virg_592_VA1 1 0 0 0 0 0 0

164

Locus (Allele size below) A8GO9 Taxon, Sample, 10 10 10 10 11 11 11 12 12 12 13 13 13 13 14 14 # Region 0 3 6 9 2 5 8 1 4 7 0 3 6 9 2 5 11 5 virg_592_VA1 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 11 6 virg_593_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 11 7 virg_593_VA2 0 0 0 0 0 1 0 1 0 0 1 1 1 1 1 0 11 8 virg_593_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 11 9 virg_593_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 12 0 virg_593_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 12 1 virg_593_VA2 0 0 0 0 0 1 0 1 0 0 1 1 0 0 0 1 12 2 virg_593_VA2 0 0 0 0 0 1 0 1 1 0 0 0 1 0 1 0 12 3 virg_593_VA2 0 0 0 0 0 0 0 1 0 0 0 1 0 0 1 0 12 4 virg_593_VA2 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 12 5 virg_593_VA2 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 12 6 virg_593_VA2 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 12 7 virg_596_VA3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 12 8 virg_596_VA3 0 0 0 0 0 1 0 1 0 0 0 0 0 0 1 0 12 9 virg_596_VA3 0 0 0 0 0 1 0 1 0 0 0 0 0 0 1 0 13 0 virg_596_VA3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 13 1 virg_596_VA3 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 13 2 virg_596_VA3 0 0 0 0 0 1 0 1 0 0 1 0 0 0 1 0 13 3 virg_596_VA3 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0

165

Locus (Allele size below) 1 Taxon, Sample, 4 15 15 15 16 16 16 17 17 17 18 19 19 20 23 23 # Region 8 1 4 7 3 6 9 2 5 8 7 3 6 8 2 8 11 5 virg_592_VA1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 11 6 virg_593_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 11 7 virg_593_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 11 8 virg_593_VA2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 11 9 virg_593_VA2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 12 0 virg_593_VA2 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 12 1 virg_593_VA2 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 12 2 virg_593_VA2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 12 3 virg_593_VA2 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 12 4 virg_593_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 12 5 virg_593_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 12 6 virg_593_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 12 7 virg_596_VA3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 12 8 virg_596_VA3 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 12 9 virg_596_VA3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 13 0 virg_596_VA3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 13 1 virg_596_VA3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 13 2 virg_596_VA3 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 13 3 virg_596_VA3 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0

166

Locus (Allele size below) 2 Taxon, Sample, 4 25 25 26 26 26 28 28 29 30 31 35 36 41 42 42 # Region 4 6 9 2 5 8 6 9 8 7 0 8 4 5 1 4 11 5 virg_592_VA1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 11 6 virg_593_VA2 0 0 0 0 0 0 0 1 0 1 0 0 0 0 1 0 11 7 virg_593_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 11 8 virg_593_VA2 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 11 9 virg_593_VA2 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 12 0 virg_593_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 12 1 virg_593_VA2 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 12 2 virg_593_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 12 3 virg_593_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 12 4 virg_593_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 12 5 virg_593_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 12 6 virg_593_VA2 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 12 7 virg_596_VA3 0 0 0 0 0 0 0 1 0 1 0 0 0 0 1 0 12 8 virg_596_VA3 0 0 0 0 0 0 0 1 0 1 0 0 0 0 1 0 12 9 virg_596_VA3 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 13 0 virg_596_VA3 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 13 1 virg_596_VA3 0 0 0 1 0 0 0 1 0 1 0 0 0 0 1 0 13 2 virg_596_VA3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 13 3 virg_596_VA3 0 0 0 1 0 0 0 1 0 1 0 0 0 0 1 0

167

Locus (Allele size below) AQLMG 4 Taxon, Sample, 3 44 45 49 53 53 56 58 59 10 10 10 11 11 11 11 # Region 6 2 1 9 5 8 2 6 2 1 4 7 0 3 6 9 11 5 virg_592_VA1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 11 6 virg_593_VA2 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 11 7 virg_593_VA2 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 11 8 virg_593_VA2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 11 9 virg_593_VA2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 12 0 virg_593_VA2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 12 1 virg_593_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 12 2 virg_593_VA2 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 12 3 virg_593_VA2 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 12 4 virg_593_VA2 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 12 5 virg_593_VA2 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 12 6 virg_593_VA2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 12 7 virg_596_VA3 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 12 8 virg_596_VA3 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 12 9 virg_596_VA3 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 13 0 virg_596_VA3 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 13 1 virg_596_VA3 0 1 0 0 0 0 0 0 0 1 0 1 0 0 0 0 13 2 virg_596_VA3 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 13 3 virg_596_VA3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

168

Locus (Allele size below) 1 Taxon, Sample, 2 12 13 13 14 14 14 14 15 15 15 16 16 16 17 17 # Region 5 8 4 7 0 3 6 9 2 5 8 1 4 7 0 3 11 5 virg_592_VA1 0 0 0 0 0 0 0 0 0 0 0 1 1 0 1 0 11 6 virg_593_VA2 0 1 1 0 0 0 1 1 0 0 0 0 0 0 1 0 11 7 virg_593_VA2 0 1 1 0 0 0 1 1 0 0 0 0 0 1 1 0 11 8 virg_593_VA2 0 1 0 0 0 0 1 1 0 0 0 0 1 1 0 0 11 9 virg_593_VA2 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 12 0 virg_593_VA2 0 1 0 1 0 0 1 1 0 0 0 0 0 0 1 0 12 1 virg_593_VA2 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 12 2 virg_593_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 12 3 virg_593_VA2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 12 4 virg_593_VA2 1 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 12 5 virg_593_VA2 0 1 0 0 0 0 0 0 0 0 0 0 1 1 0 0 12 6 virg_593_VA2 1 1 0 0 0 0 1 1 0 0 0 0 0 0 0 0 12 7 virg_596_VA3 0 1 0 0 0 0 0 1 1 0 0 0 0 0 1 0 12 8 virg_596_VA3 0 1 0 0 1 0 0 1 1 0 0 0 0 1 1 0 12 9 virg_596_VA3 0 1 0 0 0 1 0 0 0 0 0 0 0 1 1 0 13 0 virg_596_VA3 0 0 0 0 0 0 0 0 1 1 0 0 0 0 0 1 13 1 virg_596_VA3 0 1 0 0 0 1 1 0 0 0 0 0 0 0 1 1 13 2 virg_596_VA3 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 1 13 3 virg_596_VA3 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 1

169

Locus (Allele size below) CIHYO 1 Taxon, Sample, 7 18 18 22 23 23 25 25 10 10 10 11 11 11 12 12 # Region 6 2 8 4 6 9 1 4 2 5 8 1 4 7 0 3 11 5 virg_592_VA1 0 0 0 1 0 1 0 0 0 1 0 0 0 0 0 0 11 6 virg_593_VA2 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 11 7 virg_593_VA2 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 11 8 virg_593_VA2 0 0 0 1 0 0 0 0 0 0 0 1 0 0 1 1 11 9 virg_593_VA2 0 0 0 1 0 0 0 0 0 0 0 1 0 1 0 0 12 0 virg_593_VA2 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 12 1 virg_593_VA2 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 12 2 virg_593_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 12 3 virg_593_VA2 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 12 4 virg_593_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 12 5 virg_593_VA2 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 12 6 virg_593_VA2 0 0 0 1 0 0 0 0 0 0 0 1 0 1 1 1 12 7 virg_596_VA3 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 12 8 virg_596_VA3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 12 9 virg_596_VA3 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 13 0 virg_596_VA3 1 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 13 1 virg_596_VA3 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 13 2 virg_596_VA3 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 13 3 virg_596_VA3 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

170

Locus (Allele size below) 1 Taxon, Sample, 2 12 13 13 13 14 14 14 15 15 15 15 16 16 16 17 # Region 6 9 2 5 8 1 4 7 0 3 6 9 2 5 8 7 11 5 virg_592_VA1 1 0 1 1 1 1 0 0 0 0 0 0 0 0 0 0 11 6 virg_593_VA2 0 0 1 1 0 0 1 0 1 0 1 0 0 0 1 0 11 7 virg_593_VA2 0 0 1 1 0 0 1 0 1 0 1 0 0 0 1 0 11 8 virg_593_VA2 0 0 1 1 0 1 1 0 0 0 0 0 0 1 0 0 11 9 virg_593_VA2 0 0 1 1 0 1 0 1 0 1 0 0 0 1 0 0 12 0 virg_593_VA2 0 0 1 1 0 0 0 0 0 0 0 0 0 0 1 0 12 1 virg_593_VA2 0 0 1 1 0 1 0 1 0 1 0 0 0 1 0 0 12 2 virg_593_VA2 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 12 3 virg_593_VA2 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 12 4 virg_593_VA2 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 12 5 virg_593_VA2 0 0 1 1 0 1 0 1 0 0 0 0 0 1 0 0 12 6 virg_593_VA2 0 0 1 1 0 0 1 0 1 0 0 0 0 0 0 0 12 7 virg_596_VA3 1 0 1 1 1 0 0 0 1 0 0 0 0 0 0 0 12 8 virg_596_VA3 0 0 1 1 0 0 0 0 0 1 0 1 0 1 0 1 12 9 virg_596_VA3 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 13 0 virg_596_VA3 0 0 1 1 0 0 1 0 0 0 0 0 0 0 1 0 13 1 virg_596_VA3 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 13 2 virg_596_VA3 0 0 1 1 0 0 0 0 0 0 0 0 1 0 0 0 13 3 virg_596_VA3 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0

171

Locus (Allele size below) CJSU2 1 Taxon, Sample, 8 19 23 27 # Region 0 8 1 3 51 54 57 60 63 66 72 75 78 81 84 87 11 5 virg_592_VA1 0 0 0 0 0 0 1 1 0 0 1 0 1 0 0 1 11 6 virg_593_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 11 7 virg_593_VA2 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 11 8 virg_593_VA2 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 11 9 virg_593_VA2 0 0 0 0 0 1 1 0 0 0 0 0 1 0 1 1 12 0 virg_593_VA2 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 1 12 1 virg_593_VA2 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 1 12 2 virg_593_VA2 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 1 12 3 virg_593_VA2 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 1 12 4 virg_593_VA2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 12 5 virg_593_VA2 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 1 12 6 virg_593_VA2 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 12 7 virg_596_VA3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 12 8 virg_596_VA3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 12 9 virg_596_VA3 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 1 13 0 virg_596_VA3 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 13 1 virg_596_VA3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 13 2 virg_596_VA3 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 1 13 3 virg_596_VA3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

172

Locus (Allele size below)

# Taxon, Sample, Region 90 93 96 99 102 105 114 115 virg_592_VA1 1 0 0 1 0 0 0 116 virg_593_VA2 1 0 0 0 0 0 1 117 virg_593_VA2 1 0 0 0 0 0 0 118 virg_593_VA2 1 0 0 0 0 0 0 119 virg_593_VA2 1 1 0 0 1 0 0 120 virg_593_VA2 1 1 0 0 0 0 1 121 virg_593_VA2 1 1 0 1 0 0 0 122 virg_593_VA2 1 0 0 1 0 0 0 123 virg_593_VA2 1 1 0 1 0 0 1 124 virg_593_VA2 1 0 0 0 0 0 0 125 virg_593_VA2 1 1 0 1 0 0 1 126 virg_593_VA2 1 0 0 0 0 0 0 127 virg_596_VA3 1 0 0 0 0 0 1 128 virg_596_VA3 1 0 0 0 0 0 1 129 virg_596_VA3 1 1 0 1 0 0 1 130 virg_596_VA3 1 0 0 0 0 0 0 131 virg_596_VA3 1 0 0 0 0 0 1 132 virg_596_VA3 1 1 0 1 0 0 1 133 virg_596_VA3 1 0 0 0 0 0 1

173

Locus (Allele size below) A8GO9 Taxon, Sample, 10 10 10 10 11 11 11 12 12 12 13 13 13 13 14 14 # Region 0 3 6 9 2 5 8 1 4 7 0 3 6 9 2 5 13 4 virg_596_VA3 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 13 5 virg_596_VA3 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 13 6 virg_596_VA3 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 13 7 virg_596_VA3 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 13 8 virg_597_VA4 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 13 9 virg_597_VA4 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 14 0 virg_597_VA4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 14 1 virg_597_VA4 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 14 2 virg_597_VA4 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 14 3 virg_606_VA5 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 14 4 virg_606_VA5 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 14 5 virg_606_VA5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 14 6 virg_606_VA5 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 14 7 virg_606_VA5 0 0 0 0 0 0 0 1 0 0 1 0 0 0 1 0 14 8 virg_606_VA5 0 0 0 0 0 0 0 1 0 0 0 1 0 0 1 0 14 9 virg_606_VA5 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 15 0 virg_606_VA5 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 15 1 virg_606_VA5 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 15 2 virg_606_VA5 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0

174

Locus (Allele size below) 1 Taxon, Sample, 4 15 15 15 16 16 16 17 17 17 18 19 19 20 23 23 # Region 8 1 4 7 3 6 9 2 5 8 7 3 6 8 2 8 13 4 virg_596_VA3 0 1 0 0 0 0 0 0 1 1 0 0 0 0 0 0 13 5 virg_596_VA3 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 13 6 virg_596_VA3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 13 7 virg_596_VA3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 13 8 virg_597_VA4 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 13 9 virg_597_VA4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 14 0 virg_597_VA4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 14 1 virg_597_VA4 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 14 2 virg_597_VA4 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 14 3 virg_606_VA5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 14 4 virg_606_VA5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 14 5 virg_606_VA5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 14 6 virg_606_VA5 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 14 7 virg_606_VA5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 14 8 virg_606_VA5 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 14 9 virg_606_VA5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 15 0 virg_606_VA5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 15 1 virg_606_VA5 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 15 2 virg_606_VA5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

175

Locus (Allele size below) 2 Taxon, Sample, 4 25 25 26 26 26 28 28 29 30 31 35 36 41 42 42 # Region 4 6 9 2 5 8 6 9 8 7 0 8 4 5 1 4 13 4 virg_596_VA3 0 0 0 0 0 0 0 1 0 1 0 0 0 0 1 0 13 5 virg_596_VA3 0 0 0 0 0 0 0 1 0 1 0 0 0 0 1 0 13 6 virg_596_VA3 0 0 0 1 0 0 0 1 0 1 0 0 0 0 1 0 13 7 virg_596_VA3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 13 8 virg_597_VA4 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 13 9 virg_597_VA4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 14 0 virg_597_VA4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 14 1 virg_597_VA4 0 0 0 0 0 0 0 1 0 1 0 0 0 0 1 0 14 2 virg_597_VA4 0 0 0 0 0 0 0 1 0 1 0 0 0 0 1 0 14 3 virg_606_VA5 1 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 14 4 virg_606_VA5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 14 5 virg_606_VA5 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 14 6 virg_606_VA5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 14 7 virg_606_VA5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 14 8 virg_606_VA5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 14 9 virg_606_VA5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 15 0 virg_606_VA5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 15 1 virg_606_VA5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 15 2 virg_606_VA5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

176

Locus (Allele size below) AQLMG 4 Taxon, Sample, 3 44 45 49 53 53 56 58 59 10 10 10 11 11 11 11 # Region 6 2 1 9 5 8 2 6 2 1 4 7 0 3 6 9 13 4 virg_596_VA3 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 13 5 virg_596_VA3 0 1 0 0 0 0 0 0 0 1 0 1 0 0 0 0 13 6 virg_596_VA3 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 13 7 virg_596_VA3 0 1 0 0 0 0 0 0 0 1 0 1 0 0 0 0 13 8 virg_597_VA4 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 13 9 virg_597_VA4 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 14 0 virg_597_VA4 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 14 1 virg_597_VA4 0 1 0 0 0 0 0 0 0 1 0 1 0 0 0 0 14 2 virg_597_VA4 0 1 0 0 0 0 0 0 0 1 0 1 0 0 0 0 14 3 virg_606_VA5 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 14 4 virg_606_VA5 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 14 5 virg_606_VA5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 14 6 virg_606_VA5 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 14 7 virg_606_VA5 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 14 8 virg_606_VA5 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 14 9 virg_606_VA5 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 15 0 virg_606_VA5 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 15 1 virg_606_VA5 1 0 0 0 0 0 0 0 0 0 1 1 0 0 0 1 15 2 virg_606_VA5 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0

177

Locus (Allele size below) 1 Taxon, Sample, 2 12 13 13 14 14 14 14 15 15 15 16 16 16 17 17 # Region 5 8 4 7 0 3 6 9 2 5 8 1 4 7 0 3 13 4 virg_596_VA3 0 1 0 0 1 0 0 0 1 1 0 0 0 1 1 1 13 5 virg_596_VA3 0 1 0 1 0 1 1 0 0 0 0 0 0 1 1 0 13 6 virg_596_VA3 0 1 0 1 0 0 0 1 1 0 0 0 0 1 1 1 13 7 virg_596_VA3 0 1 0 0 1 0 0 0 0 1 0 0 0 1 1 1 13 8 virg_597_VA4 0 1 0 0 0 1 1 0 0 0 0 0 0 0 0 1 13 9 virg_597_VA4 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 14 0 virg_597_VA4 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 14 1 virg_597_VA4 0 1 0 0 0 1 1 0 0 0 0 0 0 0 1 1 14 2 virg_597_VA4 0 1 0 0 0 1 1 0 0 0 0 0 0 0 1 1 14 3 virg_606_VA5 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 1 14 4 virg_606_VA5 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 14 5 virg_606_VA5 0 0 0 0 0 0 0 1 1 0 0 0 0 0 0 1 14 6 virg_606_VA5 0 1 0 0 0 0 0 0 0 0 1 0 0 1 1 1 14 7 virg_606_VA5 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 14 8 virg_606_VA5 0 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 14 9 virg_606_VA5 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 15 0 virg_606_VA5 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 15 1 virg_606_VA5 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 1 15 2 virg_606_VA5 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0

178

Locus (Allele size below) CIHYO 1 Taxon, Sample, 7 18 18 22 23 23 25 25 10 10 10 11 11 11 12 12 # Region 6 2 8 4 6 9 1 4 2 5 8 1 4 7 0 3 13 4 virg_596_VA3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 13 5 virg_596_VA3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 13 6 virg_596_VA3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 13 7 virg_596_VA3 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 13 8 virg_597_VA4 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 13 9 virg_597_VA4 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 14 0 virg_597_VA4 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 14 1 virg_597_VA4 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 14 2 virg_597_VA4 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 14 3 virg_606_VA5 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 14 4 virg_606_VA5 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 14 5 virg_606_VA5 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 14 6 virg_606_VA5 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 14 7 virg_606_VA5 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 14 8 virg_606_VA5 1 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 14 9 virg_606_VA5 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 15 0 virg_606_VA5 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 15 1 virg_606_VA5 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 15 2 virg_606_VA5 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

179

Locus (Allele size below) 1 Taxon, Sample, 2 12 13 13 13 14 14 14 15 15 15 15 16 16 16 17 # Region 6 9 2 5 8 1 4 7 0 3 6 9 2 5 8 7 13 4 virg_596_VA3 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 13 5 virg_596_VA3 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 13 6 virg_596_VA3 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 13 7 virg_596_VA3 0 0 1 1 0 0 0 0 0 0 0 0 1 0 1 0 13 8 virg_597_VA4 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 13 9 virg_597_VA4 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 1 14 0 virg_597_VA4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 14 1 virg_597_VA4 0 0 1 1 0 0 0 0 0 1 0 1 0 1 0 1 14 2 virg_597_VA4 0 0 1 1 0 0 0 0 0 1 0 1 0 1 0 1 14 3 virg_606_VA5 1 0 1 1 1 0 0 0 1 0 0 0 0 0 0 0 14 4 virg_606_VA5 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 14 5 virg_606_VA5 1 0 1 1 1 0 0 0 1 0 0 0 0 0 0 0 14 6 virg_606_VA5 0 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0 14 7 virg_606_VA5 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 14 8 virg_606_VA5 1 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0 14 9 virg_606_VA5 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 15 0 virg_606_VA5 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0 15 1 virg_606_VA5 1 0 1 1 0 0 0 0 1 0 0 0 0 0 0 0 15 2 virg_606_VA5 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 0

180

Locus (Allele size below) CJSU2 1 Taxon, Sample, 8 19 23 27 # Region 0 8 1 3 51 54 57 60 63 66 72 75 78 81 84 87 13 4 virg_596_VA3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 13 5 virg_596_VA3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 13 6 virg_596_VA3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 13 7 virg_596_VA3 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 1 13 8 virg_597_VA4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 13 9 virg_597_VA4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 14 0 virg_597_VA4 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 14 1 virg_597_VA4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 14 2 virg_597_VA4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 14 3 virg_606_VA5 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 1 14 4 virg_606_VA5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 14 5 virg_606_VA5 0 0 0 0 0 1 1 0 0 0 0 0 1 0 0 1 14 6 virg_606_VA5 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 1 14 7 virg_606_VA5 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 1 14 8 virg_606_VA5 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 1 14 9 virg_606_VA5 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 1 15 0 virg_606_VA5 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 1 15 1 virg_606_VA5 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 1 15 2 virg_606_VA5 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 1

181

Locus (Allele size below)

# Taxon, Sample, Region 90 93 96 99 102 105 114 134 virg_596_VA3 1 0 0 0 0 0 1 135 virg_596_VA3 1 0 0 0 0 0 1 136 virg_596_VA3 1 0 0 0 0 0 1 137 virg_596_VA3 1 1 0 1 0 0 0 138 virg_597_VA4 1 0 0 0 0 0 0 139 virg_597_VA4 1 0 0 0 0 0 0 140 virg_597_VA4 1 1 0 0 0 0 1 141 virg_597_VA4 0 0 0 0 0 0 0 142 virg_597_VA4 0 1 0 0 0 0 0 143 virg_606_VA5 1 1 0 1 0 0 0 144 virg_606_VA5 1 0 0 0 0 0 0 145 virg_606_VA5 1 0 0 1 0 0 0 146 virg_606_VA5 1 1 0 1 0 0 0 147 virg_606_VA5 1 0 0 1 0 0 0 148 virg_606_VA5 1 0 0 1 0 0 0 149 virg_606_VA5 1 1 0 1 0 0 0 150 virg_606_VA5 1 1 0 1 0 0 0 151 virg_606_VA5 1 0 0 1 0 0 0 152 virg_606_VA5 1 0 0 1 0 0 1

! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !

Thesis and Dissertation Services ! !