Pitx2 Defines Alternate Pathways Acting Through Myod During Limb

RESEARCH ARTICLE 3847

Development 137, 3847-3856 (2010) doi:10.1242/dev.053421 © 2010. Published by The Company of Biologists Ltd Pitx2 defines alternate pathways acting through MyoD during limb and somitic myogenesis Aurore L’Honoré, Jean-François Ouimette, Marisol Lavertu-Jolin and Jacques Drouin*

SUMMARY The MyoD gene is part of the core regulatory network that governs skeletal myogenesis and acts as an essential determinant of the myogenic cell fate. Although generic regulatory networks converging on this gene have been described, the specific mechanisms leading to MyoD expression in muscles of different ontology remain misunderstood. We now show that the homeobox gene Pitx2 is required for initial activation of the MyoD gene in limb muscle precursors through direct binding of Pitx2 to the MyoD core enhancer. Whereas Myf5 and Mrf4 are dispensable for limb muscle progenitor fate, inactivation of Myf5 and Mrf4 in Pitx2 mutants results in a drastic decrease of limb MyoD expression. Thus, Pitx2 and Myf5 define parallel genetic pathways for limb myogenesis. We show a similar dependence on Pitx2 and Myf5(Mrf4) in myotome, where MyoD expression is initially activated by Myf5 and Mrf4. In their absence, MyoD expression is eventually rescued by a Pax3-dependent mechanism. We now provide evidence that Pitx2 contributes to the rescue of MyoD expression and that it acts downstream of Pax3. We thus propose that myogenic differentiation of somite-derived muscle cells relies on two parallel genetic pathways, with the Pitx2 pathway being of primary importance for limb myogenesis but the Myf5 and Mrf4 pathway predominating in myotome. Muscle- specific wiring of regulatory networks composed of similar transcription factors thus underlies development of distinct skeletal muscles.

KEY WORDS: Muscle, Differentiation, Regulatory networks, Mouse, Myod1

INTRODUCTION 1998; Noden, 1983; Ordahl and Williams, 1998). Finally, extra- Much that we have learned about muscle development has ocular and branchiomeric muscles do not derive from somites, but emphasized a general regulatory network driving myogenesis. The rather from cranial mesoderm (Noden and Francis-West, 2006). program for skeletal muscle development depends on a genetic In spite of these developmental differences, all skeletal muscles network that is centred on a group of basic helix-loop-helix muscle rely on the regulatory network involving MRFs. Thus, Myf5 is regulatory factors (MRF) that control determination of myogenic expressed at the onset of myogenesis in the mouse embryo (Ott et progenitors and differentiation of myoblasts. The implication of al., 1991) when, together with Mrf4, it determines the myogenic this core genetic network in all skeletal muscles, together with the cell fate (Kassar-Duchossoy et al., 2004). MyoD is subsequently shared properties of MRFs, has led to a relatively simple view of expressed and can direct cells into the myogenic program in the muscle development. By contrast, different skeletal muscles clearly absence of Myf5 and Mrf4 (Braun et al., 1992). Myf5, Mrf4 and achieve different functions through intrinsic differences that are MyoD thus constitute the core regulatory network for myogenic probably built into their developmental program. The molecular determination. In their absence, precursor myoblast cells are mechanisms that underlie the unique identity of different muscles lacking and skeletal muscles do not form (Kassar-Duchossoy et al., remain elusive. We already have indications that two groups of 2004; Rudnicki et al., 1993). By contrast, myogenin functions as body skeletal muscles have distinct mechanisms of formation an essential differentiation factor, as inactivation of its gene although they both derive from somites. Indeed, most muscles of prevents formation of functional muscle fibres in vivo without the trunk develop by growth, expansion and reorganization of the affecting myoblast determination (Hasty et al., 1993; Nabeshima et myotome (Cossu et al., 1996; Denetclaw et al., 1997; Tajbakhsh et al., 1993). Although this core network has been implicated in all al., 1996b), giving rise to back, intercostal and ventral body skeletal myogenesis, various studies on hierarchical interactions muscles (Christ et al., 1983; Christ and Brand-Saberi, 2002). By between MRFs and with upstream transcription factors such as contrast, several muscle groups including limb, diaphragm, Pax3 suggested that ‘wiring’ of the myogenesis network is different intrinsic tongue and pharynx muscles do not go through a in trunk, limbs or head muscles (Bajard et al., 2006; Kablar et al., myotomal intermediate. Instead, myogenic progenitor cells of the 1999; Kassar-Duchossoy et al., 2004; Sambasivan et al., 2009). In hypaxial dermomyotome undergo an epithelial-to-mesenchymal particular, different transcription factors were shown to modulate transition and migrate as single cells to their respective destinations the core network in these muscles (Dastjerdi et al., 2007; Grifone (Bladt et al., 1995; Christ and Ordahl, 1995; Mackenzie et al., et al., 2005; Grifone et al., 2007; Mankoo et al., 1999). The Pitx2 gene has previously been shown to be expressed during embryonic myogenesis (Diehl et al., 2006; Dong et al., 2006; L’Honoré et al., 2007; Shih et al., 2007b) of different skeletal Laboratoire de génétique moléculaire, Institut de recherches cliniques de Montréal muscle types, including extraocular, branchiomeric, trunk and limb (IRCM), 110 Avenue des Pins Ouest, Montréal QC H2W 1R7, Canada. muscles. Whereas Pitx2 was suggested to regulate MRF transcription in extraocular and branchiomeric muscles (Diehl et *Author for correspondence ([email protected]) al., 2006; Dong et al., 2006), it was also implicated in proliferation

Accepted 18 September 2010 and survival of muscle progenitor cells in branchiomeric muscles DEVELOPMENT 3848 RESEARCH ARTICLE Development 137 (22)

(Dong et al., 2006; Shih et al., 2007a). During body muscle auspices of the NICHD and maintained by the University of Iowa, development, Pitx2 is expressed in muscle progenitor cells and Department of Biological Sciences, Iowa City, IA52242, USA); early differentiating cells and its expression decreases at terminal monoclonal anti-MyoD, 1:100 (Pharmingen, Mississauga, ON, Canada); differentiation (L’Honoré et al., 2007; Shih et al., 2007b). However, and polyclonal anti-Ki67, 1:100 (LabVision/Neomarkers, Fremont, CA, the precise role of Pitx2 in those muscles is unknown. USA). Secondary antibodies were coupled to biotin (anti-rabbit BA1000, or anti-mouse BA2000, Vector Labs, Burlington, ON, Canada) and used at Pitx2 belongs to the Pitx gene family that includes three dilution of 1:150, or coupled to a fluorochrome, Alexa 488 or 555 members in vertebrates. This family encodes paired-related (Molecular Probes/Invitrogen, Carlsbad, CA, USA) and used at dilution of homeodomain transcription factors that play major roles in early 1:250. Strepatvidin was coupled to peroxidase HRP (NEL750, NEN Life patterning and organogenesis. PITX2 mutations have been Science, Bridgewater, NJ, USA) and used at 1:1000 or coupled to a associated with human Axenfeld-Rieger syndrome type I, an fluorochrome, Alexa 488 or 555 (Molecular Probes/Invitrogen, Carlsbad, autosomal dominant disorder that includes dental hypoplasia, CA, USA) and used at 1:500. For immunohistochemistry, reactions were anterior segment eye defects, craniofacial dysmorphologies and performed using diaminobenzidine (DAB, Sigma-Aldrich, St Louis, MO, heart defects as cardinal features (Gage et al., 1999; Kioussi et al., USA) as peroxidase substrate (L’Honoré et al., 2007) and slides were 2002; Kitamura et al., 1999; Lin et al., 1999; Lu et al., 1999; counterstained with Methyl Green. For immunofluorescence, slides were Semina et al., 1996). Pitx2 is an essential effector for left-right mounted using Mowiol. asymmetry, and it is essential for pituitary and craniofacial Plasmids and transfection assays development (Gage et al., 1999; Lin et al., 1999). The mouse Pitx2 The MyoD CE and CE-mut luciferase reporter plasmids were constructed gene produces three spliced isoforms (a, b and c) from two in pXP2 driven by the mouse MyoD proximal promoter (–285/+15 bp). different promoters. Ablation of all three Pitx2 isoforms in the The intact MyoD 258 bp CE was cloned upstream of this promoter and the mouse embryo causes lethality at mid-gestation (E10.5-E13.5) with CE-mut plasmids included mutations in either or both PRE as indicated axial malformations, open body wall, heart malformations, in Fig. 4A. The following oligonucleotides were used for site directed laterality defects and arrest of multiple organ development. mutagenesis of the PitxRE sites: PRE1fwd, CAGCAGCTGGT - CACAAAGCCAGTGAATTCCCCAGAGTGCTC; PRE1rev, GAGC- In this report, we defined the role of Pitx2 in both limb and ACTCTGGGGAATTCACTGGCTTTGTGACCAGCTGCTG; PRE2fwd, myotome muscle development. We show that Pitx2 is crucial for GTGAATTCCCCAGAGTGCTCGACTTCAAACCCGTGACTCACAA - the onset of MyoD gene expression in limb muscle progenitors and CAC; and PRE2rev, GTGTTGTGAGTCACGGGTTTGAAGTCGA - that it acts on the MyoD core enhancer. This action is later GCACTCTGGGGAATTCAC. The reporter plasmids were sequenced to compensated by a Myf5-dependent mechanism. By contrast, ascertain the expected sequences. initiation of MyoD expression in myotome is not dependent on CV-1 cells were cultured in Dulbecco’s modified Eagle’s medium Pitx2 but we show that Pitx2 acts in a Pax3-dependent genetic (DMEM) with 10% foetal bovine serum and penicillin/streptavidin pathway parallel to Myf5 and Mrf4 such that Pitx2 rescues MyoD- antibiotics and maintained in a humidified incubator (37°C, 5% CO2). For mediated myogenesis in their absence. We propose that the joint transfection, 40,000 cells were plated in 12-well-plates. Cells were actions of Myf5, Mrf4 and Pitx2 are crucial for control of MyoD transfected by the calcium phosphate co-precipitation method using a total of 1.5 g of DNA (100 ng of CE-wt or CE-mut reporter plasmid, 0-50 ng expression in muscles with different contributions of each gene  of RSV-Pitx2 or empty RSV-expression vector, 50 ng of CMV-b- depending on muscle ontology. galactosidase as internal control and 1.3 g of carrier DNA). Cells were harvested 24 hours later using transfection lysis buffer [0.1 M Tris (pH MATERIALS AND METHODS 8.0), 0.5% NP-40, 1 mM DTT]. Luciferase activity was assayed by Animal handling and genotyping injection of 100 l of luciferine [0.5 mM in 100 mM Tris (pH 8.0)] to 100 All animal procedures were approved and conducted in accordance with l of lysates using the Glomax luminometer (Promega, Madison, WI, IRCM Animal Ethics Review Committee regulations. Pitx2–/–, nlacZnlacZ USA). b-Gal activity was determined using the b-gal reporter gene Myf5 and Splotch mice have been described previously (Gage et Galacto-Star (TROPIX) assay system. al., 1999; Tajbakhsh et al., 1996a; Underhill et al., 1995). Genotyping was carried out by PCR using DNA isolated from umbilical cord/amniotic Chromatin immunoprecipitation membrane of embryos or adult tail sections. Chromatin immunoprecipitations were performed as described previously (Coulon et al., 2007) on either E12 hindlimbs, carefully dissected hindlimb Whole-mount in situ hybridization and X-Gal staining, histology muscles at E15 or E12 myotomes. Similar results were obtained using a and immunohistochemistry Pitx2-specific antibody (L’Honoré et al., 2007) as well as an antibody that Mouse embryos were collected after natural overnight matings. Noon of recognizes equally well the three Pitx factors. For ChIP analyses of the the day on which a vaginal plug was detected was considered to be E0.5. MyoD locus, the following primers were used in qPCR: CEfwd, Embryos were staged more precisely by counting the number of somites CCAGTTAATCTCCCAGAGTGCTCA; CErev, TGAGCTAGAGAA - posterior to the forelimb bud and scoring that first somite as 13 ACCGGAGAAAC; DRRfwd, AGGTGCTAGTTGGATCCGGTTT; (Lewandoski et al., 2000). For X-Gal staining, embryos dissected in PBS DRRrev, CATTTCAGCTCCCTTGGCTAGTCT; PRfwd, ACTCCT- were fixed for 30-45 minutes (depending on stage) with 4% ATGCTTTGCCTGGTCT; and PRrev, ATACGCGGTAGCA CTT - paraformaldehyde (PFA) in PBS, at 4°C. Embryos were then rinsed three GGCTAT. Enrichments were calculated relative to Q-PCR analyses of a times in PBS and stained with X-gal (1mg/mL) for 2-12 hours at 30°C. control sequence within the POMC gene promoter that is not expressed in Embryos were rinsed in PBS and post-fixed overnight in 4% PFA. Whole- muscles or limbs: POMCfwd, TCGGAGTGGAATTACCTATGTGCG; and mount in situ hybridization was performed as described in the protocols POMCrev, TGGTTTCACAAGATATCACACTTTCCC. The b-actin and from Dr Janet Rossant’s laboratory (http://www.sickkids.ca/rossant/custom/ GAPDH loci were also used as negative control and yielded similar results. protocols.asp) using digoxigenin-labelled riboprobes for MyoD and myogenin (plasmids kindly provided by S. Tajbakhsh). Fluorescent co-immunohistochemistry and peroxidase immunohistochemistry were carried out as described previously (Lanctôt RESULTS et al., 1999). The following primary antibodies were used: polyclonal anti- Having previously shown (L’Honoré et al., 2007) that Pitx2 is Pitx2, 1:200 (L’Honoré et al., 2007); goat anti-b-galactosidase, 1:400 expressed before MyoD in Pax3-positive myogenic progenitors (Sigma); monoclonal anti-Pax3, 1:50; monoclonal anti-myogenin, 1:50 that have entered limb buds (Fig. 1A-C), we wanted to assess Pitx2

(from the Developmental Studies Hybridoma Bank developed under the expression in relation to the first expressed myogenic bHLH factor DEVELOPMENT Pitx2 in limb and somite myogenesis RESEARCH ARTICLE 3849

Fig. 2. MyoD and myogenin, but not Myf5, expression are Fig. 1. Limb expression of Pitx2 precedes Myf5 and MyoD. deficient in limbs of Pitx2 mutant embryos. (A,B)b-Galactosidase +/– nLacZ/+ (A-I)Expression of Pitx2 (green) (A,C,D,F,G,I), Pax3 (red) (B,C), b- staining of E11.0 hindlimb buds from Pitx2 ;Myf5 (A) and galactosidase (Myf5, red) (E,F) and MyoD (red) (H,I) revealed by co- Pitx2–/–;Myf5nLacZ/+ (B) embryos. (C-J)Whole-mount in situ hybridization immunofluorescence on transverse sections of forelimbs from E11.0 at hindlimb (C,D) or forelimb level (E-J) of Pitx2+/–;Myf5nLacZ/+ (C,E,G,I) –/– nLacZ/+ Myf5nLacZ/+ embryos. Arrowheads indicate Pitx2-positive cells that do and Pitx2 ;Myf5 (D,F,H,J) embryos at E11.5 (C-F), E12.5 (G,H) or not express Myf5 (b-galactosidase). This population represents 13±1% E11.25 (I,J), hybridized with MyoD (C-H) or myogenin (I,J) probes. (n6) of the total number of cells expressing Pitx2. (J)Quantitation of Complementary data are presented in Fig. S1 in the supplementary Pitx2-positive cells expressing the indicated myogenic markers. material. Green bars in E,F,I,J indicate width of myotomes. (K)Schematic illustration of Pitx2, Myf5, MyoD and Pax3 expression in forelimb (filled boxes) and hindlimb (clear boxes) during mouse embryonic development.

Myf5. Using Myf5nlacZ heterozygous mice that carry a lacZ expression (Fig. 2C) is markedly decreased in Pitx2–/– embryos insertion into the Myf5 locus (Tajbakhsh and Buckingham, 1994), (Fig. 2D). A similar decrease was observed in FL buds at E10.5 we did co-labelling by immunofluorescence for Pitx2 and b- (data not shown) and decreased MyoD transcripts are still observed galactosidase (Myf5) in E11.0 forelimb buds. Whereas all Myf5- in E11.5 FL and E12.5 HL (Fig. 2F, compare with 2E; see Fig. expressing cells co-express Pitx2 (Fig. 1D-F), some Pitx2-positive S1C,D in the supplementary material). However, MyoD expression Myf5-negative cells (13±1%, n6) are also observed (Fig. 1F, is largely recovered in E12.5 FL buds (Fig. 2G,H). As myogenin arrowheads). As the expression of MyoD is more restricted at this expression is dependent on MyoD during limb myogenesis developmental stage (Fig. 1G-J) (L’Honoré et al., 2007), these data (Sassoon et al., 1989; Wright et al., 1989), we assessed its show that Pitx2 expression precedes activation of the limb expression by in situ hybridization in Pitx2–/– embryos. We myogenic program (Fig. 1K). observed decreased myogenin transcripts, in agreement with their purported dependence on MyoD (Fig. 2J, compare with 2I). As MyoD expression is decreased in Pitx2–/– limb buds shown for MyoD in E12.5 FL (Fig. 2G,H), similar patterns of In order to assess a putative role of Pitx2 in the myogenic program, MyoD and myogenin were observed in E13.0 FL and HL (see Fig. we crossed the Myf5nlacZ indicator allele into the Pitx2-null S1E,F in the supplementary material and data not shown), background. Expression of b-galactosidase (Myf5) in Pitx2+/– suggesting full recovery of their expression. embryos is identical to Pitx2+/+ embryos (data not shown), and thus heterozygote embryos were used throughout as control. Mice Delayed myogenic differentiation in Pitx2–/– limb heterozygous for Myf5nlacZ did not show significant differences in buds b-galactosidase (Myf5) expression in E11.0 Pitx2–/– forelimb (FL) The decreased MyoD expression in Pitx2 mutant limb buds may be and hindlimb (HL) buds compared with Pitx2+/– embryos (Fig. due to altered progenitor number or delayed myogenic 2A,B; Fig. S1A,B in the supplementary material). The early differentiation. In order to assess these possibilities, we analyzed expression of Myf5 in limb progenitors thus appears to be largely myogenic precursors and their proliferation status by co-labelling

independent of Pitx2. By contrast, the onset of hindlimb bud MyoD for Pax3 and Ki67. The number of Pax3-positive cells is unaltered DEVELOPMENT 3850 RESEARCH ARTICLE Development 137 (22)

recovery of the number of MyoD-expressing cells (Fig. 3M-O). These results clearly indicate that the absence of Pitx2 causes a delay in MyoD expression that is fully recovered by E13.5.

Pitx2 acts directly on the MyoD core enhancer We considered the possibility that Pitx2 may act directly on the MyoD gene. Appropriate spatiotemporal expression of MyoD is reproduced by a 24 kb fragment of 5Ј regulatory sequences that contains two enhancers called core enhancer (CE) (Faerman et al., 1995; Goldhamer et al., 1992; Goldhamer et al., 1995) and distal regulatory region (DRR) (Asakura et al., 1995; Tapscott et al., 1992). Although DRR activity is restricted to differentiated cells and maintains MyoD expression at foetal stages and postnatally (Asakura et al., 1995; Chen et al., 2002; Hughes et al., 1993; L’Honoré et al., 2003), genetic studies have ascribed initiation of MyoD expression to the CE (Chen and Goldhamer, 2004; Kablar et al., 1999). The highly conserved 258 bp CE element is located about 20 kb upstream of the MyoD gene and it recapitulates the skeletal muscle pattern of MyoD expression during embryonic development (Faerman et al., 1995; Goldhamer et al., 1992; Goldhamer et al., 1995). Interestingly, targeted deletion of the MyoD CE leads to a delay of MyoD expression in limbs (Chen and Goldhamer, 2004) that is similar to that observed in Pitx2–/– embryos (Figs 2 and 3), suggesting that the MyoD CE may be a direct target of Pitx2. To assess this hypothesis, we analyzed the CE sequence (Goldhamer et al., 1995) and this revealed two well conserved putative Pitx binding sites (Fig. 4A). The sites (TAATCT and TAAGCT) are conserved Fig. 3. Limb MyoD deficiency is transient in Pitx2–/– embryos. between mouse and human (see Fig. S3A in the supplementary (A-F)Co-staining by immunofluorescence for MyoD (red) (A,C,D,F) or b- material) and correspond to sequences previously shown to bind and galactosidase (Myf5, green) (B,C,E,F) on transverse sections of hindlimb be activated in response to Pitx1 and Pitx2 (Tremblay et al., 2000); +/– nLacZ/+ –/– nLacZ/+ buds from E11.5 Pitx2 ;Myf5 (A-C) and Pitx2 ;Myf5 (D-F) furthermore, the sites are in opposite orientation relative to each embryos. (G-N) Immunohistochemical analyses of Pax3 (G,H), MyoD  other, as often observed in pituitary Pitx target genes (Tremblay et (I,J,M,N) or Pitx2 (K,L) on transverse sections of hindlimb buds from Pitx2+/– (G,I,K,M) and Pitx2–/– (H,J,L,N) embryos at E11.5 (G-L) and al., 1998). We used gel retardation assays to verify that Pitx2 binds E13.5 (M,N). (O)Quantification of the number (±s.d.) of Pax3- or these two sites (PRE1 and PRE2) in vitro (see Fig. S3B in the MyoD-positive cells in entire hindlimb buds from Pitx2+/– and Pitx2–/– supplementary material). Similar binding was observed at each site embryos at E11.5 and E13.5. Fig. S2 in the supplementary material and a probe containing both sites showed cooperative binding. The provides cell number and proliferation controls for these experiments. in vivo occupancy of the CE was ascertained directly by chromatin immunoprecipitation (ChIP) using HL buds from E12 and E15 embryos and anti-Pitx2 antibody. Significant recruitment of Pitx factors was observed both in E12 and E15 buds at the CE but not at the DRR (Fig. 4B). Interestingly, recruitment was also observed at in Pitx2 mutant limb buds and their proliferation status is also about –600 bp in the promoter region (PR), in agreement with the unaffected (see Fig. S2D-F, compare with S2A-C in the presence of a putative Pitx binding site at –615 bp. This site was supplementary material). Also consistent with the unaltered Myf5 tested by gel retardation and shown to bind Pitx2 (see Fig. S3B in expression pattern (Fig. 2A,B), the number of Myf5 and Pax3 the supplementary material). The CE may thus be a direct target of double positive cells was similar in Pitx2-deficient limb buds (see Pitx factor action and this possibility was tested directly in co- Fig. S2M-O, compare with S2G-I in the supplementary material). transfection experiments in CV1 cells. The reporters containing the However, co-labelling of myogenic precursors with Myf5 and CE inserted upstream of the proximal MyoD promoter exhibited MyoD revealed almost no double positive cells in Pitx2–/– embryos dose-dependent activation in response to increasing amounts of (Fig. 3D-F) compared with their control siblings (Fig. 3A-C). Pitx2 and mutagenesis of the two putative Pitx-binding sites in CE These data are thus consistent with a delay of MyoD activation. In prevented this activation (Fig. 4C). Linker-scanning mutagenesis of order to quantify this delay, immuno-peroxidase labelling was the CE provided an in-depth functional analysis of this element performed on both E11.5 and E13.5 HL buds. The number of Pax3- (Kucharczuk et al., 1999) but, surprisingly, it did not identify any positive cells was similar for both Pitx2–/– and Pitx2+/– HL buds at essential sequence for MyoD limb expression. In particular, mutants E11.5 (Fig. 3G,H,O), indicating that the number of progenitors that LS-8 and LS-9 that respectively encompass the PRE1 and PRE2 did migrated into the mutant limb buds is not dependent on Pitx2. This not affect limb activity. To assess the hypothesis that PRE1 and is consistent with the onset of Pitx2 expression after migration of PRE2 may have redundant activities, we performed co-transfection limb bud progenitors (L’Honoré et al., 2007). As expected, the experiments for Pitx2 activation of a wild-type or mutant CE number of MyoD expressing cells was considerably decreased in reporter (Fig. 4D). Whereas mutagenesis of either site had a E11.5 Pitx2–/– HL buds (Fig. 3I,J,O). However, quantitation of marginal effect, their combined mutation abrogated activation,

MyoD-positive cells in E13.5 HL buds revealed a complete which highlights their redundancy. These experiments support the DEVELOPMENT Pitx2 in limb and somite myogenesis RESEARCH ARTICLE 3851

Fig. 5. Myf5 compensates functionally for MyoD expression in Pitx2–/– limbs. (A-H)Dorsal views of forelimb (A-D) and hindlimb (E-H) buds from Pitx2+/–;Myf5nLacZ/+ (A,E), Pitx2+/–;Myf5nLacZ/LacZ (B,F), –/– nLacZ/+ –/– nLacZ/LacZ Fig. 4. Pitx2 directly regulates MyoD expression through binding Pitx2 ;Myf5 (C,G) and Pitx2 ;Myf5 (D,H) embryos at of the core enhancer. (A)Schematic representation of MyoD gene E12.5 stained by whole-mount in situ hybridization for MyoD regulatory regions comprising a minimal promoter called proximal transcripts. (I-L)Co-staining by immunofluorescence for b-galactosidase regulatory region (PRR) (Tapscott et al., 1992) and two enhancers: the (Myf5, green) or MyoD (red) on transverse sections of forelimb buds +/– nLacZ/+ +/– nLacZ/nLacZ core enhancer (CE) (Goldhamer et al., 1992) and the distal regulatory from E11.5 Pitx2 ;Myf5 (I), Pitx2 ;Myf5 (J) –/– nLacZ/+ –/– nLacZ/nLacZ region (DRR) (Tapscott et al., 1992). The 258 bp CE contains two Pitx2 ;Myf5 (K) and Pitx2 ;Myf5 (L) embryos. putative consensus Pitx-binding sites (PRE1 and PRE2). A third putative (M)Quantification of the percentage of Myf5 (b-galactosidase)-positive Pitx binding site (PRE3) is present at –615 bp in the promoter region cells co-expressing MyoD in forelimb buds from embryos analyzed in I- (PR) close to the PRR. The consensus PitxRE was obtained from the L. See also Fig. S3 in the supplementary material for controls of b- Genomatix database. Sequences of the three PRE are shown together galactosidase (Myf5) expression. with mutations used in transactivation assays (in red). (B)Chromatin immunoprecipitation (ChIP) analysis for the presence of Pitx2 at the indicated MyoD regulatory sequences were performed on chromatin Myf5 cooperates with Pitx2 for limb MyoD isolated from hindlimb buds of wild-type E12 or E15 embryos. The expression histogram shows enrichments (±s.e.m., n3) obtained at CE, DRR and The delay in MyoD expression observed in Pitx2–/– limb buds thus PR relative to the promoter used as reference. (C) Activation of POMC  appears to be due to the failure to activate the MyoD core enhancer. CE by Pitx2. CV1 cells that do not express Pitx transcription factors were This delay is not compensated for by the related Pitx3 as the double transfected with a luciferase reporter construct containing MyoD CE –/– –/– fused to PRR sequences (CE-luc). Dose response is shown for co- Pitx2 ;Pitx3 embryos show similar myogenin expression –/– transfection of increasing amounts of Pitx2 expression plasmid as patterns as the Pitx2 embryos (see Fig. S4 in the supplementary indicated. The double PRE1/2 mutations prevented Pitx2 activation. material). As Myf5 is activated independently of Pitx2 during early (D)Effect of single or joint PRE site mutation on reporter activation by myogenesis, we then tested the possibility that Myf5 may Pitx2. Results are the average of three independent experiments, each contribute to MyoD recovery in Pitx2–/– limbs. As previously performed in duplicate (±s.e.m.). reported (Tajbakhsh et al., 1997), MyoD expression is not affected in limb buds of Myf5nlacZ/nlacZ mutant embryos indicating that Myf5 and Mrf4 (which is inactivated in cis in this mutant) are dispensable model that Pitx2 is directly recruited to the MyoD CE to activate for non-myotomal MyoD expression (Fig. 5B,F, compare with MyoD expression in early development, notwithstanding a possible 5A,E). However, inactivation of Myf5(Mrf4) in the Pitx2–/– action through other Pitx sites. The model is further supported by background resulted in almost complete loss of MyoD expression equivalent delays of limb MyoD expression observed in Pitx2–/– at E12.5 compared with Pitx2–/–;Myf5nlacZ/+ embryos (Fig. 5D,H, (Fig. 2) and mice deleted of the MyoD CE (Chen and Goldhamer, compare with 5C,G). As for the Pitx2 knockout (Fig. 2A-D), the

2004). double Pitx2 and Myf5(Mrf4) loss-of-function did not appear to DEVELOPMENT 3852 RESEARCH ARTICLE Development 137 (22)

Pitx2–/–;Myf5nlacZ/lacZ embryos that are deficient in Pitx2, Myf5 and Mrf4 showed an almost complete loss of MyoD myotome expression (Fig. 6D) compared with Myf5 (Fig. 6B) and Pitx2 (Fig. 6C) mutants (also see Fig. S6A-D in the supplementary material). The remaining weak expression of MyoD in these double mutants was ascertained by immunohistofluorescence on E11.5 transverse thoracic sections. Staining for MyoD and myogenin revealed a small patch of positive cells in the most epaxial part of the myotome in Pitx2–/–;Myf5nlacZ/lacZ embryos (Fig. 6G, compare with 6E; see Fig. S6G,H in the supplementary material). However, the loss of Pitx2 did not affect the appearance of myotome cells as revealed by b-galactosidase staining (Fig. 6F,H; see Fig. S6E-H in the supplementary material). Pitx2–/– embryos are characterized by severe trunk distortion (see Fig. S6C,D in the supplementary material). It is noteworthy that this distortion had no effect on MyoD expression in myotome of Pitx2 mutants, clearly not supporting the idea of non cell-autonomous effects in the myotome of Pitx2–/–;Myf5nlacZ/lacZ embryos. In view of the many apparent targets of Pitx2 recruitment/action at the MyoD locus revealed by ChIP in limb buds (Fig. 4B), we also ascertained the presence of Pitx2 at the same sites in E12 myotome. The experiments clearly Pitx2 Fig. 6. is sufficient for hypaxial myotome expression of indicated recruitment of Pitx2 at the CE, DRR and –600 bp regions MyoD in absence of Myf5 and Mrf4. (A-D)Dorsal views of interlimb of the MyoD gene (Fig. 6I). These data thus suggest multiple myotomes from Pitx2+/–;Myf5nLacZ/+ (A), Pitx2+/–;Myf5nLacZ/LacZ (B), Pitx2–/–;Myf5nLacZ/+ (C) and Pitx2–/–;Myf5nLacZ/LacZ (D) embryos at E12.5 targets for Pitx2 action on the MyoD gene and, in particular, stained by whole-mount in situ hybridization for MyoD transcripts. The support the involvement of the DRR for myotome MyoD black arrows indicate hypaxial myotome. See also Fig. S4A,B in the expression (Chen et al., 2002). supplementary material. (E-H)Staining by immunofluorescence for As Pax3 was involved in recovery of MyoD expression in MyoD (red, E,G) or b-galactosidase (Myf5, green, F,H) on transverse myotome of Myf5/Mrf4 mutants (Kassar-Duchossoy et al., 2004; sections of thoracic somites from E11.5 Pitx2+/+;Myf5nLacZ/LacZ (E,F) and Tajbakhsh et al., 1997), we investigated a putative role of Pax3 in Pitx2–/–;Myf5nLacZ/LacZ (G,H) embryos. The white arrow indicates hypaxial myotome expression of Pitx2. We first excluded the possibility that myotome and the asterisk indicates non-specific staining of red blood Pax3 might act directly on PREs using gel retardation (see Fig. cells. See also Fig. S6G,H in the supplementary material for myogenin S3B in the supplementary material). The Pax3 mutant Splotch expression. (I)Chromatin immunoprecipitation (ChIP) analysis for the mouse exhibits disorganized dermomyotome and it has slightly presence of Pitx2 at the indicated MyoD regulatory sequences were performed on chromatin isolated from dissected myotome of wild-type delayed myogenic differentiation. Analysis of these mutants at E12 embryos. The histogram shows enrichments (±s.e.m., n3) obtained E11.5, when myogenesis resumes (as evidenced by myogenin at CE, DRR and PR relative to the POMC promoter used as reference. expression, Fig. 7B,D), revealed a complete deficit of Pitx2 expression (Fig. 7A,C); this deficit is restricted to the myotome and is not observed in neighbouring mesenchyme, indicating that Pitx2 affect the number of limb muscle progenitors as assessed by b- is downstream of Pax3 during myotome myogenesis. If myotome galactosidase (Myf5) staining (Fig. 5I-L; see Fig. S5 in the expression of Pitx2 is downstream of Pax3, inactivation of both supplementary material). The Pitx2 and Myf5(Mrf4) double mutant genes should have no greater effect than either mutation: this was is therefore specifically deficient in MyoD activation but not in indeed observed in myotome (Fig. 7E-G). These results indicate formation or migration of precursors to the limb buds. In order to that Pitx2 is a likely intermediate downstream of Pax3 for MyoD quantify the Myf5 compensation of Pitx2, we counted the ratios of recovery in Myf5(Mrf4) mutant myotomes. Interestingly, we MyoD-positive cells relative to Myf5-positive cells (Fig. 5I-M). observed a similar relationship between Pax3 and Pitx2 at shoulder Whereas absence of Myf5 and Pitx2 resulted in complete loss of girdle level. MyoD expression in a muscle opposite the forelimb is MyoD expression (L), the presence of one active Myf5 allele truncated in Pax3Sp/Sp embryos (Fig. 7H,I). This truncation is also prevented this loss in about 60% of cells (K). These results clearly observed in Pitx2–/– embryos (Fig. 7K,M) and the absence of both suggest that Myf5 is acting in parallel to Pitx2 for control of MyoD Pax3 and Pitx2 did not aggravate this truncation (Fig. 7H-J). As expression during early limb bud myogenesis. previously described, this truncation is not observed in Myf5nlacZ/nlacZ mutants (Fig. 7K,L) (Tajbakhsh et al., 1997), but we Pitx2 in myotome expression of MyoD now provide evidence that MyoD expression in this muscle is also We have previously shown Pitx2 expression in myogenic cells of dependent on both Pitx2 and Myf5/Mrf4 pathways, as the double the myotome (L’Honoré et al., 2007). Myotome expression of mutant is almost completely devoid of MyoD (Fig. 7K-N). These MyoD (Fig. 2F and data not shown) and of myogenin (Fig. 2J) is data are consistent with Pax3 regulation of Pitx2 expression in both not delayed in Pitx2–/– embryos, in contrast to limb muscle cells. myotome and shoulder girdle, and with a primary role of the We wanted to test the hypothesis that Pitx2 and Myf5/Mrf4 may Pax3/Pitx2 pathway in the shoulder girdle. also cooperate for MyoD expression in myotome. In Myf5nlacZ/lacZ mutant embryos where both Myf5 and Mrf4 are absent, MyoD DISCUSSION expression in myotome is delayed by ~2 days. Recovery of MyoD Many studies have supported the idea that one core regulatory expression, which is dependent on Pax3, appears by E11.5 and is MRF is sufficient to initiate myogenesis in skeletal muscles of

complete by E12.5 (Tajbakhsh et al., 1997). Investigation of E12.5 various origins. Whereas Myf5 and Mrf4 are primarily involved in DEVELOPMENT Pitx2 in limb and somite myogenesis RESEARCH ARTICLE 3853

an upstream regulator for MRF expression in extra ocular muscles (Diehl et al., 2006) and Pitx2 was also shown to cooperate with Tbx1 for activation of the muscle fate in the pharyngeal arch (Dong et al., 2006; Shih et al., 2007a). The present work identifies a crucial role for Pitx2 in control of somite-derived myogenesis, placing this gene either downstream of Pax3 in myotome and in a parallel pathway to Myf5 and Mrf4 in limbs where Pitx2 directly controls onset of MyoD expression. Taken collectively, these data support models that include Pitx2-dependent pathways in all skeletal muscles (Fig. 8A). The present work documented a delay of limb bud MyoD expression in Pitx2–/– embryos. This delay is similar to the 1- to 2- day delay of MyoD activation in limb buds of MyoD CE-deleted mice. Accordingly, we show Pitx2 binding to the MyoD CE in embryonic limb buds by ChIP and binding site-dependent transcriptional activation by Pitx2. Thus, the MyoD core enhancer is the likely target for Pitx2 control of MyoD expression during limb myogenesis. CE-deleted mutant embryos are characterized by delayed MyoD expression not only in limbs but also in muscle precursors of the first branchial arch (Chen and Goldhamer, 2004). During branchiomeric development, Pitx2 is expressed both in surface ectoderm and in the mesodermal core of the first arch, and interestingly conditional inactivation of Pitx2 in pharyngeal Fig. 7. Cooperation between Pax3/Pitx2 and Myf5/Mrf4 mesoderm results in severe reduction of MyoD and myogenin pathways for MyoD expression in myotome and shoulder girdle expression (Dong et al., 2006). The CE may thus also constitute a muscle. (A-D)Immunohistochemical analyses of Pitx2 and myogenin cis target for Pitx2-dependent MyoD expression during expression on transverse sections of thoracic somites from E11.5 branchiomeric myogenesis. In both Pitx2–/– and CEloxP/loxP mutants, Pax3Sp/+ and Pax3Sp/Sp embryos. The black arrows indicate unaffected Pitx2 expression in mesenchyme, whereas dotted lines indicate the functional consequence of delayed MyoD expression was a myotomes. (E-N)Whole-mount in situ hybridization for MyoD delay in muscle differentiation as revealed by myogenin performed on E12.0 (E-J) and E12.5 (K-N) embryos of the indicated expression. This defect is reminiscent (somewhat less pronounced) genotypes. (E-G)Bracket indicates width of myotomes. (H-N)Forelimb of delayed limb and branchial arch differentiation observed in buds are outlined with black dotted lines, whereas white dotted lines MyoD–/– embryos (Kablar et al., 1997). Collectively, these data indicate shoulder girdle muscle; furthermore, the extent of this shoulder suggest similar regulatory networks for Pitx2-dependent MyoD muscle is indicated by a white bar. Second branchial arch muscles activation in MyoD-dependent lineages of the head and limb. affected by Pitx2 mutation (Shih et al., 2007a) are outlined with green This similarity contrasts with Myf5/Mrf4 regulation of MyoD. line. Asterisk indicates first branchial arch that is absent in Pitx2 mutant Indeed, while MyoD expression is delayed in myotome of (Dong et al., 2006). White arrows in K-N indicate presence (K-M) or Myf5nlacZ/nlacZ mutant embryos, it is unaffected in limb buds and absence (N) of shoulder muscle. OV, otic vesicle; FL, forelimb bud. branchial arch-derived myogenic cells (Kablar et al., 1997; Tajbakhsh et al., 1997). Consistent with this, CE activity is not initial determination of the myogenic program, it appears that affected in Myf5nlacZ/nlacZ limb buds nor in branchial arch, MyoD is the point of convergence for regulatory pathways that suggesting that Myf5 is dispensable for both CE activity and early drive myogenic differentiation. Recent work has identified Pitx2 as MyoD expression in these lineages (Chen and Goldhamer, 2004).

Fig. 8. MyoD gene regulation. (A)Gene networks controlling MyoD expression in limb, myotome, extra-ocular and pharyngeal arch muscles. Pitx2 has a crucial role in initiation of MyoD expression in limb buds, but not in myotome, where Myf5 and Mrf4 play a predominant role. Nonetheless, Pitx2, Myf5 and Mrf4 are jointly contributing to MyoD expression in both limb and myotome, as revealed by their compound mutants. Pax3 is required for Pitx2 expression in myotome. In head (extra-ocular and 1st pharyngeal arch) muscles that do not express Pax3, Pitx2 acts upstream of Myf5 and Mrf4 (rather than in parallel), and in association with Tbx1 in arches (Sambasivan et al., 2009). (B)Differential recruitment of Pitx2 to different regions of the MyoD gene depending on muscle ontology, in support of functional redundancy models (Frankel et al., 2010). DEVELOPMENT 3854 RESEARCH ARTICLE Development 137 (22)

The present work nonetheless supports a role of Myf5(Mrf4) in reported to assume nonmuscle fates in trunk and limbs, being first limb MyoD expression and positioned these two genes in a parallel integrated in cartilage primordia, but then to undergo apoptosis. pathway relative to Pitx2 (Fig. 8A). This death occurs several days after their birth (E13.5) (Kablar et MyoD regulation has been studied extensively in myotomal al., 1999; Kablar et al., 2003) and may be linked to their failure to lineages and supported models in which Myf5, Mrf4, as well as commit. It is, thus, tempting to speculate that a similar mechanism Pax3, operate upstream of MyoD (Tajbakhsh and Cossu, 1997). occurs in Pitx2;Myf5(Mrf4) mutants: analysis of those mutants at In Myf5nlacZ/nlacZ mutant embryos, MyoD expression is delayed E12.5 revealed a slight increase of apoptosis in myotome and limb by ~2 days in myotome (Kablar et al., 1997; Tajbakhsh et al., compared to control. Unfortunately, the early lethality (E13) of 1997) and this delay appeared to be due to developmental arrest Pitx2;Myf5(Mrf4) mutants did not allow us to perform analyses at of myogenic progenitors along the dermomyotome (Tajbakhsh et later stages. al., 1996b). Using allelic series of Myf5 mutants that As reported for Pax3;Myf5;Mrf4 mice (Kassar-Duchossoy et al., differentially affect Mrf4 expression together with Mrf4 mutants, 2004; Tajbakhsh et al., 1997), we note an incomplete penetrance it has been shown that Myf5nlacZ/nlacZ and Myf5;Mrf4 mutants and residual MyoD and myogenin expression in Pitx2;Myf5(Mrf4) exhibit the same delayed MyoD expression, supporting the embryos, leading to sporadic myogenesis in the myotome conclusion that both Mrf4 and Myf5 act upstream of MyoD in (particularly in the most epaxial part) and in the limb (dorsal mass). myotomes (Kassar-Duchossoy et al., 2004). This dependence on This could be due to compensation by another factor. Likely Myf5 and Mrf4 was transient and the recovery of MyoD candidates include: Pax7, which is expressed in precursors from expression operates through a Pax3-dependent mechanism, E11.5 (Kassar-Duchossoy et al., 2005; Relaix et al., 2005); Tbx1, although this may be mediated through a secondary factor which is initially expressed in dorsal masses of the limbs (Dastjerdi (Tajbakhsh et al., 1997). We complemented this model by et al., 2007) and reminiscent of residual MyoD expression observed positioning Pitx2 under control of Pax3 (Fig. 8A). As the double in Pitx2;Myf5(Mrf4) mutants; and, finally, Pitx3, which is mutant for Pitx2 and Myf5(Mrf4) is deficient in myotome expressed after Pitx2 during embryonic myogenesis (L’Honoré et expression of MyoD, Pitx2 is a likely intermediate for Pax3 al., 2007). Pitx3 does not compensate for loss of Pitx2 towards control of MyoD. Thus, Pitx2 defines a complementary pathway myogenin or MyoD expression in limbs (see Fig. S4 in the for activation of the myogenic pathway through MyoD. supplementary material), but we cannot exclude the possibility that Regulation of MyoD expression is complex: although it can be it could exert its action in absence of both Pitx2 and Myf5. These recapitulated by the complementary activities of the CE and DRR, seemingly Pitx2-independent myogenic cells may represent a various transgenic studies have concluded that both enhancers are subpopulation that is regulated by yet another alternate myogenic dispensable either for Myf5 regulation or Pax3-dependant pathway. expression of MyoD in myotomal lineages (Chen et al., 2002; Chen The present work delineated differential requirements for Pitx2 and Goldhamer, 2004; Kucharczuk et al., 1999). With the exception in migratory versus non-migratory somite-derived myogenic cells. of E-boxes, the two enhancers lack cis-motifs known to regulate These body myogenic cells share a crucial dependence on Pax3 for muscle genes during development. Taken together, these their fate, in contrast to extra-ocular and branchial arch muscles observations suggest a functional redundancy in cis-regulatory (Sambasivan et al., 2009), which do not express Pax3. It is mechanisms controlling MyoD expression. Such redundancy of noteworthy that Pitx2 is complementary to Myf5 and Mrf4 in Pax3- transcriptional control mechanisms appears to be a frequent feature dependent body muscles, whereas it is genetically upstream of the of developmental regulatory pathways, as elegantly shown recently MRF core regulatory network in Pax3-independent head muscles. in Drosophila larvae (Frankel et al., 2010) and the action of Pitx2 Thus, all skeletal muscles include Pitx2 in their genetic program. on the MyoD gene is consistent with this model (Fig. 8B). Whereas Different muscles have evolved the striking ability to co-opt the CE appears to be the predominant site of action for MyoD selected elements of a core regulatory network together with a expression in limb buds, ChIP analyses also revealed Pitx2 complementary genetic pathway in order to direct similar, yet recruitment in the –600 bp PR region, but not at the DRR. This distinct, muscle cell fates at different anatomical locations. Pitx proximal site, which is close to documented sites for Pax3 and transcription factors have been shown to interact physically and FoxO3 (Hu et al., 2008), may thus also contribute to expression. functionally with factors of multiple structural families, including Furthermore, similar ChIP analyses in myotome revealed Pitx2 at POU-homeo factors (Szeto et al., 1996), bHLH factors (Poulin et the three MyoD regulatory regions (CE, DRR and PR). Pitx2 al., 2000), Smads (Nudi et al., 2005), Tbox (Lamolet et al., 2001), recruitment to the DRR was unexpected as no consensus Pitx- Egr and nuclear receptors (Tremblay and Drouin, 1999), and LEF1 binding site is present in this enhancer. Pitx2 may be indirectly (Vadlamudi et al., 2005). In view of these multiple interactions, the recruited to the DRR through its interaction with another implication of Pitx2 in the myogenic program provides numerous transcription factor. Serum response factor (SRF) is a likely alternative mechanisms to modulate unique muscle identities in candidate as the DRR contains a SRF-binding CArG element limb, trunk, pharyngeal or ocular muscles. previously shown to be required for MyoD expression in skeletal myoblasts (L’Honoré et al., 2003) and Pitx2 has been shown to Acknowledgements interact with SRF and increase its association with DNA (Shang et We are grateful to Phil Gage and Sally Camper, who provided the Pitx2 mutant al., 2008). mice; to Sharaghim Tajbakhsh and Margaret Buckingham (Institut Pasteur, Paris), who provided the Myf5nLacZ mice; and to Alan Underhill (University of In Pitx2;Myf5(Mrf4) mutants, progenitor cells are still present at Alberta, Edmonton, Canada) for the Splotch mice. The help of Philippe Daubas E11.5-E12.5 in both myotome and limb, as revealed by b- for gel retardation is greatly appreciated. We thank Catherine Couture for galactosidase staining but most of these cells do not express MyoD plasmid constructions, Annie Vallée of the IRCM Histology Core for her or myogenin. This situation is reminiscent but somewhat less precious help in tissue and section preparations, and Julie D’Amours and pronounced than in Myf5;Mrf4;MyoD triple mutants, where in Isabelle Brisson for animal husbandry. The secretarial assistance of Lise Laroche was highly appreciated. This work was supported by a postdoctoral Fellowship absence of all myogenic bHLH, somitic progenitors cells fail to from Fondation de la recherche médicale to A.L. and by grants to J.D. from the

commit to the muscle lineage. Those progenitors have been Canadian Institutes of Health Research (MT-15081). DEVELOPMENT Pitx2 in limb and somite myogenesis RESEARCH ARTICLE 3855

Competing interests statement Hu, P., Geles, K. G., Paik, J. H., DePinho, R. A. and Tjian, R. (2008). The authors declare no competing financial interests. Codependent activators direct myoblast-specific MyoD transcription. Dev. Cell 15, 534-546. Supplementary material Hughes, S. M., Taylor, J. M., Tapscott, S. J., Gurley, C. M., Carter, W. J. and Supplementary material for this article is available at Peterson, C. A. (1993). Selective accumulation of MyoD and myogenin mRNAs http://dev.biologists.org/lookup/suppl/doi:10.1242/dev.053421/-/DC1 in fast and slow adult skeletal muscle is controlled by innervation and hormones. Development 118, 1137-1147. References Kablar, B., Krastel, K., Ying, C., Asakura, A., Tapscott, S. J. and Rudnicki, M. Asakura, A., Lyons, G. E. and Tapscott, S. J. (1995). The regulation of MyoD A. (1997). MyoD and Myf-5 differentially regulate the development of limb gene expression: conserved elements mediate expression in embryonic axial versus trunk skeletal muscle. Development 124, 4729-4738. muscle. Dev. Biol. 171, 386-398. Kablar, B., Krastel, K., Ying, C., Tapscott, S. J., Goldhamer, D. J. and Bajard, L., Relaix, F., Lagha, M., Rocancourt, D., Daubas, P. and Buckingham, Rudnicki, M. A. (1999). Myogenic determination occurs independently in M. E. (2006). A novel genetic hierarchy functions during hypaxial myogenesis: somites and limb buds. Dev. Biol. 206, 219-231. Pax3 directly activates Myf5 in muscle progenitor cells in the limb. Genes Dev. Kablar, B., Krastel, K., Tajbakhsh, S. and Rudnicki, M. A. (2003). Myf5 and 20, 2450-2464. MyoD activation define independent myogenic compartments during embryonic Bladt, F., Riethmacher, D., Isenmann, S., Aguzzi, A. and Birchmeier, C. (1995). development. Dev. Biol. 258, 307-318. Essential role for the c-met receptor in the migration of myogenic precursor cells Kassar-Duchossoy, L., Gayraud-Morel, B., Gomes, D., Rocancourt, D., into the limb bud. Nature 376, 768-771. Buckingham, M., Shinin, V. and Tajbakhsh, S. (2004). Mrf4 determines Braun, T., Rudnicki, M. A., Arnold, H. H. and Jaenisch, R. (1992). Targeted skeletal muscle identity in Myf5:Myod double-mutant mice. Nature 431, 466- inactivation of the muscle regulatory gene Myf-5 results in abnormal rib 471. development and perinatal death. Cell 71, 369-382. Kassar-Duchossoy, L., Giacone, E., Gayraud-Morel, B., Jory, A., Gomes, D. Chen, J. C. and Goldhamer, D. J. (2004). The core enhancer is essential for and Tajbakhsh, S. (2005). Pax3/Pax7 mark a novel population of primitive proper timing of MyoD activation in limb buds and branchial arches. Dev. Biol. myogenic cells during development. Genes Dev. 19, 1426-1431. 265, 502-512. Kioussi, C., Briata, P., Baek, S. H., Rose, D. W., Hamblet, N. S., Herman, T., Chen, J. C., Ramachandran, R. and Goldhamer, D. J. (2002). Essential and Ohgi, K. A., Lin, C., Gleiberman, A., Wang, J. et al. (2002). Identification of a redundant functions of the MyoD distal regulatory region revealed by targeted Wnt/Dvl/b-cateninrPitx2 pathway mediating cell-type-specific proliferation mutagenesis. Dev. Biol. 245, 213-223. during development. Cell 111, 673-685. Christ, B. and Ordahl, C. P. (1995). Early stages of chick somite development. Kitamura, K., Miura, H., Miyagawa-Tomita, S., Yanazawa, M., Katoh-Fukui, Anat. Embryol. (Berl.) 191, 381-396. Y., Suzuki, R., Ohuchi, H., Suehiro, A., Motegi, Y., Nakahara, Y. et al. Christ, B. and Brand-Saberi, B. (2002). Limb muscle development. Int. J. Dev. (1999). Mouse Pitx2 deficiency leads to anomalies of the ventral body wall, Biol. 46, 905-914. heart, extra- and periocular mesoderm and right pulmonary isomerism. Christ, B., Jacob, M. and Jacob, H. J. (1983). On the origin and development of Development 126, 5749-5758. the ventrolateral abdominal muscles in the avian embryo. An experimental and Kucharczuk, K. L., Love, C. M., Dougherty, N. M. and Goldhamer, D. J. ultrastructural study. Anat. Embryol. (Berl.) 166, 87-101. (1999). Fine-scale transgenic mapping of the MyoD core enhancer: MyoD is Cossu, G., Kelly, R., Tajbakhsh, S., Di Donna, S., Vivarelli, E. and regulated by distinct but overlapping mechanisms in myotomal and non- Buckingham, M. (1996). Activation of different myogenic pathways: myf-5 is myotomal muscle lineages. Development 126, 1957-1965. induced by the neural tube and MyoD by the dorsal ectoderm in mouse paraxial L’Honoré, A., Lamb, N. J., Vandromme, M., Turowski, P., Carnac, G. and mesoderm. Development 122, 429-437. Fernandez, A. (2003). MyoD distal regulatory region contains an SRF binding Coulon, V., L’Honoré, A., Ouimette, J. F., Dumontier, É., van den Munckhof, CArG element required for MyoD expression in skeletal myoblasts and during P. and Drouin, J. (2007). A muscle-specific promoter directs Pitx3 gene muscle regeneration. Mol. Biol. Cell 14, 2151-2162. expression in early muscle cells. J. Biol. Chem. 282, 33192-33200. L’Honoré, A., Coulon, V., Marcil, A., Lebel, M., Lafrance-Vanasse, J., Gage, P. Dastjerdi, A., Robson, L., Walker, R., Hadley, J., Zhang, Z., Rodriguez- J., Camper, S. A. and Drouin, J. (2007). Sequential expression and Niedenfuhr, M., Ataliotis, P., Baldini, A., Scambler, P. and Francis-West, P. redundancy of Pitx2 and Pitx3 genes during muscle development. Dev. Biol. (2007). Tbx1 regulation of myogenic differentiation in the limb and cranial 307, 421-433. mesoderm. Dev. Dyn. 236, 353-363. Lamolet, B., Pulichino, A. M., Lamonerie, T., Gauthier, Y., Brue, T., Enjalbert, Denetclaw, W. F., Jr, Christ, B. and Ordahl, C. P. (1997). Location and growth of A. and Drouin, J. (2001). A pituitary cell-restricted T-box factor, Tpit, activates epaxial myotome precursor cells. Development 124, 1601-1610. POMC transcription in cooperation with Pitx homeoproteins. Cell 104, 849- Diehl, A. G., Zareparsi, S., Qian, M., Khanna, R., Angeles, R. and Gage, P. J. 859. (2006). Extraocular muscle morphogenesis and gene expression are regulated by Lanctôt, C., Gauthier, Y. and Drouin, J. (1999). Pituitary homeobox 1 (Ptx1) is Pitx2 gene dose. Invest. Ophthalmol. Vis. Sci. 47, 1785-1793. differentially expressed during pituitary development. Endocrinology 140, 1416- Dong, F., Sun, X., Liu, W., Ai, D., Klysik, E., Lu, M. F., Hadley, J., Antoni, L., 1422. Chen, L., Baldini, A. et al. (2006). Pitx2 promotes development of splanchnic Lewandoski, M., Sun, X. and Martin, G. R. (2000). Fgf8 signalling from the AER mesoderm-derived branchiomeric muscle. Development 133, 4891-4899. is essential for normal limb development. Nat. Genet. 26, 460-463. Faerman, A., Goldhamer, D. J., Puzis, R., Emerson, C. P., Jr and Shani, M. Lin, C. R., Kioussi, C., O’Connell, S., Briata, P., Szeto, D., Liu, R., Izpisua (1995). The distal human myoD enhancer sequences direct unique muscle- Belmonte, J. C. and Rosenfeld, M. G. (1999). Pitx2 regulates lung asymmetry, specific patterns of lacZ expression during mouse development. Dev. Biol. 171, cardiac positioning and pituitary and tooth morphegenesis. Nature 401, 279- 27-38. 282. Frankel, N., Davis, G. K., Vargas, D., Wang, S., Payre, F. and Stern, D. L. Lu, M. F., Pressman, C., Dyer, R., Johnson, R. L. and Martin, J. F. (1999). (2010). Phenotypic robustness conferred by apparently redundant transcriptional Function of Rieger syndrome gene in left-right asymmetry and craniofacial enhancers. Nature 466, 490-493. development. Nature 401, 276-278. Gage, P. J., Suh, H. Y. and Camper, S. A. (1999). Dosage requirement of Pitx2 for Mackenzie, S., Walsh, F. S. and Graham, A. (1998). Migration of hypoglossal development of multiple organs. Development 126, 4643-4651. myoblast precursors. Dev. Dyn. 213, 349-358. Goldhamer, D. J., Faerman, A., Shani, M. and Emerson, C. P., Jr (1992). Mankoo, B. S., Collins, N. S., Ashby, P., Grigorieva, E., Pevny, L. H., Candia, Regulatory elements that control the lineage-specific expression of myoD. A., Wright, C. V., Rigby, P. W. and Pachnis, V. (1999). Mox2 is a component Science 256, 538-542. of the genetic hierarchy controlling limb muscle development. Nature 400, 69- Goldhamer, D. J., Brunk, B. P., Faerman, A., King, A., Shani, M. and Emerson, 73. C. P., Jr (1995). Embryonic activation of the myoD gene is regulated by a highly Nabeshima, Y., Hanaoka, K., Hayasaka, M., Esumi, E., Li, S. and Nonaka, I. conserved distal control element. Development 121, 637-649. (1993). Myogenin gene disruption results in perinatal lethality because of severe Grifone, R., Demignon, J., Houbron, C., Souil, E., Niro, C., Seller, M. J., muscle defect. Nature 364, 532-535. Hamard, G. and Maire, P. (2005). Six1 and Six4 homeoproteins are required for Noden, D. M. (1983). The role of the neural crest in patterning of avian cranial Pax3 and Mrf expression during myogenesis in the mouse embryo. Development skeletal, connective, and muscle tissues. Dev. Biol. 96, 144-165. 132, 2235-2249. Noden, D. M. and Francis-West, P. (2006). The differentiation and Grifone, R., Demignon, J., Giordani, J., Niro, C., Souil, E., Bertin, F., Laclef, C., morphogenesis of craniofacial muscles. Dev. Dyn. 235, 1194-1218. Xu, P. X. and Maire, P. (2007). Eya1 and Eya2 proteins are required for hypaxial Nudi, M., Ouimette, J. F. and Drouin, J. (2005). Bone morphogenic protein somitic myogenesis in the mouse embryo. Dev. Biol. 302, 602-616. (Smad)-mediated repression of proopiomelanocortin transcription by Hasty, P., Bradley, A., Hsi Morris, J., Edmondson, D. G., Venuti, J. M., Olson, interference with Pitx/Tpit activity. Mol. Endocrinol. 19, 1329-1342. E. N. and Klein, W. H. (1993). Muscle deficiency and neonatal death in mice Ordahl, C. P. and Williams, B. A. (1998). Knowing chops from chuck: roasting

with a targeted mutation in the myogenin gene. Nature 364, 501-506. myoD redundancy. BioEssays 20, 357-362. DEVELOPMENT 3856 RESEARCH ARTICLE Development 137 (22)

Ott, M. O., Bober, E., Lyons, G., Arnold, H. and Buckingham, M. (1991). Early Tajbakhsh, S. and Buckingham, M. E. (1994). Mouse limb muscle is determined expression of the myogenic regulatory gene, myf-5, in precursor cells of skeletal in the absence of the earliest myogenic factor myf-5. Proc. Natl. Acad. Sci. USA muscle in the mouse embryo. Development 111, 1097-1107. 91, 747-751. Poulin, G., Lebel, M., Chamberland, M., Paradis, F. W. and Drouin, J. (2000). Tajbakhsh, S. and Cossu, G. (1997). Establishing myogenic identity during Specific protein:protein interaction between basic Helix-Loop-Helix transcription somitogenesis. Curr. Genetics Dev. 7, 634-641. factors and homeoproteins of the Pitx family. Mol. Cell. Biol. 20, 4826-4837. Tajbakhsh, S., Bober, E., Babinet, C., Pournin, S., Arnold, H. and Relaix, F., Rocancourt, D., Mansouri, A. and Buckingham, M. (2005). A Buckingham, M. (1996a). Gene targeting the myf-5 locus with nlacZ reveals Pax3/Pax7-dependent population of skeletal muscle progenitor cells. Nature expression of this myogenic factor in mature skeletal muscle fibres as well as 435, 948-953. early embryonic muscle. Dev. Dyn. 206, 291-300. Rudnicki, M. A., Schnegelsberg, P. N., Stead, R. H., Braun, T., Arnold, H. H. Tajbakhsh, S., Rocancourt, D. and Buckingham, M. (1996b). Muscle progenitor and Jaenisch, R. (1993). MyoD or Myf-5 is required for the formation of cells failing to respond to positional cues adopt non-myogenic fates in myf-5 skeletal muscle. Cell 75, 1351-1359. null mice. Nature 384, 266-270. Sambasivan, R., Gayraud-Morel, B., Dumas, G., Cimper, C., Paisant, S., Kelly, Tajbakhsh, S., Rocancourt, D., Cossu, G. and Buckingham, M. (1997). R. G. and Tajbakhsh, S. (2009). Distinct regulatory cascades govern extraocular Redefining the genetic hierarchies controlling skeletal myogenesis: Pax-3 and and pharyngeal arch muscle progenitor cell fates. Dev. Cell 16, 810-821. Myf-5 act upstream of MyoD. Cell 89, 127-138. Sassoon, D., Lyons, G. E., Wright, W. E., Lin, V., Lassar, A., Weintraub, H. and Tapscott, S. J., Lassar, A. B. and Weintraub, H. (1992). A novel myoblast Buckingham, M. (1989). Expression of two myogenic regulatory factors enhancer element mediates MyoD transcription. Mol. Cell. Biol. 12, 4994-5003. myogenin and MyoD1 during mouse embryogenesis. Nature 341, 303-307. Tremblay, J. J. and Drouin, J. (1999). Egr-1 is a downstream effector of GnRH Semina, E. V., Reiter, R., Leysens, N. J., Alward, W. L., Small, K. W., Datson, and synergizes by direct interaction with Ptx1 and SF-1 to enhance luteinizing N. A., Siegel-Bartelt, J., Bierke-Nelson, D., Bitoun, P., Zabel, B. U. et al. hormone b gene transcription. Mol. Cell. Biol. 19, 2567-2576. (1996). Cloning and characterization of a novel bicoid-related homeobox Tremblay, J. J., Lanctôt, C. and Drouin, J. (1998). The pan-pituitary activator of transcription factor gene, RIEG, involved in Rieger syndrome. Nat. Genet. 14, transcription, Ptx-1 (pituitary homeobox1), acts in synergy with SF-1 and Pit1 392-399. and is an upstream regulator of the Lim-homeodomain gene Lim3/Lhx3. Mol. Shang, Y., Yoshida, T., Amendt, B. A., Martin, J. F. and Owens, G. K. (2008). Endocrinol. 12, 428-441. Pitx2 is functionally important in the early stages of vascular smooth muscle cell Tremblay, J. J., Goodyer, C. G. and Drouin, J. (2000). Transcriptional properties differentiation. J. Cell Biol. 181, 461-473. of Ptx1 and Ptx2 isoforms. Neuroendocrinol. 71, 277-286. Shih, H. P., Gross, M. K. and Kioussi, C. (2007a). Cranial muscle defects of Pitx2 Underhill, D. A., Vogan, K. J. and Gros, P. (1995). Analysis of the mouse mutants result from specification defects in the first branchial arch. Proc. Natl. Splotch-delayed mutation indicates that the Pax-3 paired domain can influence Acad. Sci. USA 104, 5907-5912. homeodomain DNA-binding activity. Proc. Natl. Acad. Sci. USA 92, 3692-3696. Shih, H. P., Gross, M. K. and Kioussi, C. (2007b). Expression pattern of the Vadlamudi, U., Espinoza, H. M., Ganga, M., Martin, D. M., Liu, X., homeodomain transcription factor Pitx2 during muscle development. Gene Expr. Engelhardt, J. F. and Amendt, B. A. (2005). PITX2, beta-catenin and LEF-1 Patterns 7, 441-451. interact to synergistically regulate the LEF-1 promoter. J. Cell Sci. 118, 1129- Szeto, D. P., Ryan, A. K., O’Connell, S. M. and Rosenfeld, M. G. (1996). P-OTX: 1137. a PIT-1-interacting homeodomain factor expressed during anterior pituitary Wright, W. E., Sassoon, D. A. and Lin, V. K. (1989). Myogenin, a factor gland development. Proc. Natl. Acad. Sci. USA 93, 7706-7710. regulating myogenesis, has a domain homologous to MyoD. Cell 56, 607-617. DEVELOPMENT