bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
Myf6/MRF4 is a Myogenic Niche Regulator Required for the Maintenance of the Muscle Stem Cell Pool
Felicia Lazure1,2, Darren M. Blackburn1,2, Nabila Karam1,2, Korin Sahinyan1,2, Ahmad Sharanek2,
Duy Nguyen2, Aldo H. Corchado1, Christoph Lepper4, Hamed S. Najafabadi1, Theodore J.
Perkins5,6, Arezu Jahani-Asl2,3, Vahab Soleimani1,2,7.
1Department of Human Genetics, McGill University, 3640 rue University, Montréal, QC, H3A 0C7,
Canada.
2Lady Davis Institute for Medical Research, Jewish General Hospital, 3755 Chemin de la Côte-
Sainte-Catherine, Montréal QC, H3T 1E2, Canada.
3Gerald Bronfman Department of Oncology, 5100 de Maisonneuve Blvd. West, Suite 720, Faculty
of Medicine, McGill University, Montréal, QC, H4A 3T2, Canada.
4Department of Physiology & Cell Biology, College of Medicine, The Ohio State University, 1645
Neil Ave. Columbus, OH, 43210, USA
5Sprott Center for Stem Cell Research, Ottawa Hospital Research Institute, 501 Smyth Road,
Ottawa, ON, K1H 8L6, Canada.
6Department of Biochemistry, Microbiology and Immunology, University of Ottawa, Ottawa, ON,
K1H 8M5, Canada
7Corresponding author: Tel: +1 514 340 8222 ext. 26136 Fax: Fax: +1 514 340 7502
1 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
Key words: Myokines, Skeletal Muscles, Muscle Stem Cell, Myogenesis, Myogenic Factors,
Myf6/MRF4, Muscle Stem Cell Pool.
Running Title: Myf6/MRF4 is Required to Maintain Adult Skeletal Muscle Stem Cell Pool
2 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
Abstract
In metazoans, skeletal muscle evolved to contract and produce force. However, recent
experimental evidence suggests that skeletal muscle has also acquired endocrine functions and
produces a vast array of myokines. Using ChIP-Seq and gene expression analyses of myogenic
factors, we show that Myf6/MRF4 transcriptionally regulates a broad spectrum of myokines and
muscle-secreted proteins, including ligands for downstream activation of key signaling pathways
such as EGFR, STAT3 and VEGFR. Homozygous deletion of Myf6 causes a significant reduction in
the ability of muscle to produce key myokines such as EGF, VEGFA and LIF. Consequently,
although Myf6 knockout mice are born with a normal muscle stem cell compartment, they
undergo progressive reduction in their stem cell pool during postnatal life. Mechanistically,
muscle stem cells from the Myf6 knockout animals show defects in activation of EGFR and STAT3
signaling, upregulate the p38 MAP kinase pathway and spontaneously break from quiescence.
Exogenous application of recombinant EGF and LIF rescue the defects in the muscle stem cell
pool of Myf6 knockout animals. Finally, skeletal muscles of mice lacking Myf6 have a significantly
reduced ability to sustain donor-engrafted muscle stem cells. Taken together, our data uncovers
a novel role for Myf6 in regulating the expression of niche factors and myokines to maintain the
skeletal muscle stem cell pool in adult mice.
3 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
Introduction
In adult skeletal muscle, Muscle stem cells (MuSCs) are spatially housed between the sarcolemma
of the muscle fibers and the basal lamina, a layer of extracellular matrix proteins (ECM) that are
closely juxtaposed with the myofibers. The physical enclosure of MuSCs in such an anatomical
space ensures that they remain in close proximity to the myofiber in a mitotically quiescent state,
under normal physiological conditions. Injury or trauma to the myofiber causes disruption of the
MuSC niche during which they re-enter cell cycle, transiently proliferate and undergo myogenic
differentiation to repair the injured muscle 1-3. Induction of MuSC activation triggers a temporally
regulated myogenic differentiation program orchestrated by four myogenic factors, namely
Myf5, MyoD, Myogenin and Myf6 4-6. MyoD and Myf5 transiently amplify MuSCs but also induce
differentiation by upregulating Myogenin in a context dependent manner 7,8. While Myf5, MyoD
and Myogenin are transiently expressed during myogenic commitment and differentiation of
MuSCs, in the fully differentiated myofiber, Myf6/MRF4 is the predominant myogenic factor that
remains expressed under physiological conditions. Previous studies have implicated Myf6
involvement in myofiber maturation and in the maintenance of their differentiated state 9. Aside
from its function in differentiation, Myf6 has also been implicated as a muscle determination
factor in the absence of MyoD and Myf5 10.
While the epigenetic and transcriptional control of muscle formation has been extensively
studied 11,12, less is known about the precise mechanisms by which the muscle stem cell pool is
maintained in adult skeletal muscle. Maintenance of the MuSC pool crucially depends on a
dynamic balance between quiescence and activation 13, a process that is intricately dependent
on the interaction of MuSCs with their niche microenvironment 14-16. Many non-myogenic cells
4 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
have been shown to contribute to the niche milieu of MuSCs, such as endothelial cells under
normal physiological conditions 15, fibroblasts under hypertrophy 17 and macrophages and
neutrophils during muscle injury 18-20. The physical enclosure of MuSCs by the ECM creates an
anatomically defined niche microenvironment where the muscle stem cell resides in a quiescence
state. However, how molecular communication between myofibers and their associated MuSCs
regulates their fate remains unknown.
Beyond its contractile properties, skeletal muscle plays an important role as an endocrine organ.
The secretome of skeletal muscle is composed of proteins and peptides known as myokines,
which are thought to have system-wide effects through autocrine, paracrine, and endocrine
functions 21,22. Exercise-induced myokines such as Interleukin-6 (IL6), Interleukin-15 (IL15), and
brain-derived neurotrophic factor (BDNF) among others, have been studied in the context of their
effect on inflammation, metabolic homeostasis and lipid oxidation, respectively 23-25.
Here, we show that Myf6 plays a key role in the endocrine function of skeletal muscle by
transcriptionally regulating multiple myokines such as EGF, LIF and IL6. Our data shows that
regulation of myokine expression by Myf6 is required to maintain the adult muscle stem cell pool.
In the absence of Myf6, MuSCs break quiescence, upregulate the p38 MAPK signaling pathway
and undergo differentiation. Rescue of MuSC numbers by in vivo exposure to exogenous
myokines in acute muscle injury experiments suggests that defects in the MuSCs compartment
in Myf6 knockout animals are principally due to defective myokine signaling. Collectively, our
data suggest that Myf6 has a novel function as a myogenic niche regulator and plays a critical
role in regulating stem cell pool in adult skeletal muscle.
5 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
Results
Myf6/MRF4 Cistrome and Associated Genetic Networks in Skeletal Muscle
Among the four myogenic regulatory factors (MRFs), Myf6 is the only factor that is primarily
expressed in fully differentiated muscle fibers (Fig. 1A). The remaining three MRFs, namely Myf5,
MyoD and Myogenin are transiently expressed during muscle stem cell activation, commitment
and terminal differentiation. To identify genome-wide Myf6 targets in primary myotubes, we first
used Chromatin Tandem Affinity Purification Sequencing (ChTAP-Seq), an ideal alternative to
traditional ChIP-Seq when a commercial ChIP-grade antibody is not available. Here, we generated
primary myoblast cell lines over-expressing a C-terminal Tandem Affinity Purification tag (Myf6-
CTAP), using a retroviral vector. We validated the expression, subcellular localization and
functionality of the ectopic Myf6-CTAP in muscle and non-muscle cells using
immunofluorescence (IF), Western Blotting (WB) and Luciferase assays (Fig. S1). Next, we
performed ChTAP-Seq on multinucleated primary myotubes formed after five days in
differentiation media as described previously 26. Using MACS2 27 with a p-value threshold of 10-5
and default parameters, we identified 12,885 binding sites for Myf6 in primary myotubes, using
sequencing reads in the affinity-matched empty vector control (EV-ChTAP-Seq) as background
(Fig. 1A). Motif analysis of the peak-covered sequences from the total number of Myf6 peaks
using MEME suite 28 identified the top scoring canonical E-box motif, centrally located and closely
juxtaposed by the MEF2A binding motif located peripheral to the E-box counterparts (Fig. 1B).
Comparative analysis between the densities of the E-box motif distribution in the Myf6 ChIP-Seq
peaks compared to random genomic blocks showed significantly denser clustering of E-boxes
under Myf6 peaks (Fig. 1C). Such patterns of motif distribution in Myf6 peaks mirror those of
6 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
other myogenic factors such as MyoD and Myf5 6. Within Myf6 peaks, highly enriched motifs for
known MRF cooperative heterodimers such as E-protein (E12/E47) and antagonistic interactors
such as TWIST1 and ID4 followed similar distribution patterns as those of E-box motifs (Fig. 1D).
Together, these data suggest that transcriptional control of gene expression by Myf6 follows
similar operational mechanisms as those deployed by other MRFs within their cis-regulatory
domains.
Myf6 Occupies Regulatory Domains of Functionally Distinct Sets of Genes in Differentiated
Muscle Cells
To identify the genetic networks regulated by Myf6 in differentiated muscle cells, we first used
Genomic Regions Enrichment of Annotations Tool (GREAT) 29 and performed Gene Ontology (GO)
analysis using an association rule of single nearest genes (300kb maximum extension). Within
those regions, 12,270 out of 12,885 peaks (95.2%) were associated with a single gene and 610
peaks (4.73%) were not associated with any gene. Computation of GO terms using binomial tests,
implemented in GREAT 29 showed that the majority of the Myf6 ChIP-Seq peaks in the primary
differentiated myotubes were within the regulatory domains of genes involved in regulation of
muscle structure, muscle cell development and differentiation, as well as actin filament
organization, as expected (Fig. 1f, 1g). However, in addition to the expected differentiation genes,
we identified a large set of genes for secreted proteins including many known myokines and
chemokines that are bound and transcriptionally regulated by Myf6 (Fig. 2a, Fig. S2). The latter
genes code for ligands such as EGF, LIF, and IL6 among others, which activate EGFR and STAT3
signaling pathways. Both EGFR and STAT3 play important roles in the regulation of muscle stem
7 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
cell self-renewal and stem cell pool30,31. This data suggests that a novel function of Myf6 in adult
skeletal muscle may be the establishment of a myokine-mediated regulatory network, which
signals back to MuSCs. Therefore, we hypothesize that genetic deletion of Myf6 in skeletal muscle
leads to impairment in EGFR and STAT3 signaling in MuSCs due to diminished expression of
myokines. Other myokines such as Vascular endothelial growth factor (VEGFA) are also
transcriptionally regulated by Myf6 (Fig. 2a, 2b, 2f, S2a-e). VERGFA plays an important role in
maintaining MuSCs quiescence via recruitment of endothelial cells15.
In vivo depletion of Myf6 transcript by RNAi in differentiating primary myotubes shows that Myf6
is required for transcriptional regulation of VEGFA, EGF and LIF (Fig. 2d-g). While some ligands
such as VEGFA are produced by both progenitors as well as differentiated myotubes (Fig. 2b, 2f,
S2b), others such as EGF and LIF are principally produced in differentiated myotubes (Fig. 2b, 2h).
Interestingly, while EGF, LIF, OSM and IL6 are expressed in differentiated myotubes, their
corresponding receptors are expressed in progenitors (Fig. 2i). This observation that
differentiation of muscle stem cells creates a physical niche whereby myokines (ligands) are
produced in myofibers while their respective receptors are expressed in their associated MuSCs
suggests the existence of a myokine-mediated communication network between myofiber and
MuSCs. Below, we delve into the critical role of Myf6 in establishing a myokine signaling network
which is required for activation of EGFR and STAT3 signaling pathways in MuSCs.
Myf6-Regulated Myokines Activate EGFR and STAT3 Signaling Pathways in Muscle Stem Cells
EGFR and STAT3 have recently been shown to play crucial roles in regulating muscle stem cell
self-renewal and expansion. Both EGFR and STAT3 are readily activated in proliferating myoblasts
8 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
(Fig. 2j) as well as in myofiber-associated MuSCs (Fig. 2i, 2m) in response to exogenously applied
ligands, indicating that these pathways are operationally active in muscle cells. To determine the
requirement of Myf6 in the regulation of myokine expression in vivo we first analyzed the whole
muscle transcriptome of Myf6-knockout mice under normal physiological conditions and after
cardiotoxin (CTX) injury by RNA-Seq. For this, we used Myf6CE mice, in which a Cre-ERT2 cassette
is knocked into the first exon of the Myf6 gene, rendering it a null allele (Fig. 3a)32. Mice with
biallelic deletion of Myf6 were born with normal skeletal muscles and were indistinguishable
from their WT littermates (Fig. 2b). Quantitative Real-Time PCR (RT-qPCR) of RNA extracted from
hindlimb muscles showed efficient depletion of Myf6 transcript in homozygous Myf6 knockout
mice (Fig. 3c). RNA-Seq analysis showed that genetic deletion of Myf6 in skeletal muscles led to
deregulation of a vast array of genes involved in myoblast differentiation, muscle development,
muscle contraction, and pre-mRNA splicing (Table S3). However, our data suggests that a novel
function of Myf6 is to regulate the expression of myokines such as VEGFA, EGF, LIF, IL-15 and IL-
6 (Fig. 2a, 2b, 2d-g, 3d, S2a-d). Analysis of Myf6 binding sites by ChIP-Seq showed enrichment of
Myf6 peaks around the transcription start sites (TSS) of latter genes (Fig. 3f). Taken together, this
data suggests that, in addition to regulating muscle differentiation genes, Myf6 transcriptionally
regulates myokines that play key roles in the activation of signaling pathways such as EGFR and
STAT3. Using both siRNA to specifically knockdown Myf6 in myotubes (Fig. 2d-g) and in vivo
genetic deletion of Myf6 in skeletal muscle followed by whole muscle RNA-Seq analysis (Fig. 3d,
S2), we show that the unique function of Myf6 in regulating myokine expression is not
compensated by other myogenic factors such as MyoD and Myogenin. Next, to determine if loss
of Myf6 leads to diminished myokine protein production, we isolated MuSCs from Myf6-KO and
9 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
WT counterparts by Fluorescent Activated Cell Sorting (FACS) using ITGA7+/Lin- as described in
Materials and Methods. We then differentiated fully confluent cultures of primary myoblasts
isolated from Myf6-KO and WT animals for seven days in differentiation media (DMEM
supplemented with 5% horse serum). Next, we collected media (secretome) from myotubes and
performed Enzyme-Linked Immunosorbent Assay (ELISA) followed by comparative analysis of
protein expression by normalizing protein amount to the number of nuclei as described in
Materials and Methods. ELISA analysis of two key myokines, EGF and VEGFA shows that the Myf6-
KO secretome has a significant lower level of these myokines compared to their WT counterparts
(Fig. 3f, 3g). Similarly, to determine the overall contribution of Myf6 to the level of myokines in
serum, we isolated blood serum from Myf6-KO and WT counterpart and by ELISA analysis showed
that serum of Myf6-KO mice has a significant reduction in key myokines such as EGF and VEGFA
(Fig. 3h, 3i). This data suggests that Myf6 is required for the production of multiples myokines.
Loss of Myf6 Leads to Impaired Activation of EGFR and STAT3 Signaling Pathways in the Muscle
Stem Cells
Our data thus far suggests that Myf6 is indispensable for the expression of multiple myokines in
skeletal muscles. These myokines such as EGF and LIF regulate critical signaling pathways such as
EGFR and STAT3. Thus, we hypothesized that loss of Myf6 can lead to impairment in activation
of EGFR and STAT3 signaling pathways in myofiber-associated MuSCs. To determine the role of
Myf6 in transcriptional regulation of myokines, we first analyzed Myf6 binding sites in their
vicinity (Fig. 4a, 4b). Notably, our ChIP-Seq data shows strong enrichment of Myf6 ChIP-Seq reads,
but not the reads from the affinity matched control ChIP-Seq, on the enhancer elements in the
10 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
vicinity of the TSS of EGF, LIF, OSM and VEGFA in primary myotubes (Fig. 4a-b). Next, we
determined the pattern of regulatory histone marks including Histone H3 mono methyl lysine 4
(H3K4me1), a marker for enhancer elements and histone H3 trimethyl lysine 4 histone
(H3K4me3), marking active/poised TSS (Fig. 4a-c). Notably, our analysis of ChIP-Seq data indicates
that Myf6 binding sites overlap with H3K4me1 (Fig. 4a-c). Taken together, the analysis of ChIP-
Seq data (Fig. 4a-c), gene expression data by loss of function of Myf6 (Fig. 2) and analysis of
protein expression by ELISA (Fig. 3f-i) shows that Myf6 is required for the expression of key
myokines. Given that ligands for activation of EGFR and STAT3 are under transcriptional control
of Myf6 in differentiated muscle cells (Fig. 2, Fig. 3, Fig. 4a-c) we hypothesized that genetic
deletion of Myf6 in the skeletal muscle myofiber can lead to defects in phosphorylation and
subsequent activation of EGFR and STAT3. To test this hypothesis, we isolated EDL myofibers
from Myf6-KO and WT animals and cultured them in growth media for 44 hours. To eliminate the
compounding effect of mitogens and growth factors in fiber culture, we switched fibers to pure
DMEM for four hours before fixing and staining. Immunofluorescence of EDL myofibers shows
defects in phosphorylation of EGFR (pEGFR-Y1068) and STAT3 (pSTAT3-Y705) (Fig. 4d-g).
Importantly, treatment of EDL myofibers from Myf6-KO animals with recombinant EGF or LIF
rescues defects in EGFR and STAT3 phosphorylation, respectively (Fig. 4e-g). This data suggests
that Myf6 is required to maintain functional EGFR and STAT3 in the myofiber-associated MuSCs.
Genetic Deletion of Myf6 Leads to Exhaustion of the MuSC Pool in Adult Skeletal Muscle
Genetic deletion of Myf6 led to down-regulation of many myokine genes including EGF, HBEGF,
LIF, VEGFA and Il-15 (Fig. 2, Fig. 3). Therefore, we analyzed how the loss of Myf6 affects muscle
11 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
regeneration and the stem cell pool. Mice with a homozygous deletion of Myf6 were born
without any visible abnormalities and were fertile (Fig. 3). Immunofluorescent analysis of cross
sections of TA muscles showed no significant difference in the number of regenerating fibers (i.e.,
myofibers with centrally located myonuclei), or the number of myofibers per unit area (mm2)
between Myf6-KO and WT mice (Fig. S3). These data suggest that Myf6 is dispensable for muscle
formation and MuSC differentiation during development. Next, we analyzed the effect of genetic
deletion of Myf6 on the MuSC pool postnatally (P7, P21) and during adulthood (three months
and 10 months of age) by first performing immunofluorescent analysis of the TA muscles from
Myf6-KO and WT animals with antibodies against Pax7 as a marker of MuSCs and Laminin to mark
the periphery of myofibers. Our data indicates that loss of Myf6 has no significant effect on the
establishment of MuSC pool during development as the MuSC compartment remains unchanged
at postnatal day 7 (P7) and P21 (Fig. 5a-d). However, by the age of three months we observed a
significant reduction in the number of Pax7+ cells in the Myf6-KO TA muscles compared to their
WT counterparts (Fig. 5e-f). The reduction in the stem cell pool continues during late adulthood
at 10 months of age (Fig. 5g-h). Likewise, analysis of muscle stem cells associated with the
Extensor Digitorum Longus (EDL) muscles stained with anti-Pax7 antibody immediately after
isolation (T=0 hour post isolation) showed a similar significant reduction in the number of MuSCs
in Myf6-KO myofibers (Fig. i-l). Taken together this data suggests that maintenance of the MuSC
pool in adult mice is dependent of Myf6.
Deletion of Myf6 Leads to Spontaneous Break From Quiescence and Entry of MuSCs into
Differentiation
12 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
To determine the mechanism underlying the exhaustion of the muscle stem cell pool in Myf6-KO
adult mice we first examined the quiescent state and the size of the muscle stem cell pool during
three postnatal time points. Immunofluorescence analysis of TA muscle at postnatal day 7 (P7)
and P21 indicates that the size of the stem cell pool is equal between Myf6-KO and WT
counterparts during early postnatal life (Fig. 5a-d, Fig. S4a-d, Fig. 6a). However, by the third week
of postnatal life (P21), muscle stem cells from the Myf6-KO animals spontaneously break
quiescence as shown by increased number of Pax7+ cells that also express KI67, a marker for
proliferating cells (Fig. 6c-f). The spontaneous break of MuSCs from a quiescent state continues
postnatally and by three months of age there is a significant reduction in the MuSC pool of Myf6-
KO animals compared to their WT counterparts (Fig. 5e-f, Fig. 6e-f). Next, isolated MuSCs from
the Myf6-KO and their WT counterpart by FACS using ITGA7+/Lin-, as described in materials
methods, and performed in vitro analysis of MuSCs from the Myf6-KO and WT counterparts for
differentiation potential, senescence and apoptosis. Our data indicates that loss of Myf6 has no
significant effect on the propensity of MuSCs to undergo apoptosis or senescence (Fig. S4e-h),
suggesting that neither apoptosis nor cellular senescence are the cause of MuSC exhaustion in
Myf6-KO muscle. Next, we performed immunofluorescence analysis of myofiber-associated
MuSCs from the EDL myofibers at T0 post fiber isolation. At T0, MuSCs express PAX7 but not
MYOD. However, in Myf6-KO EDL myofibers we observed a significant number of MuSCs that
express both PAX7 and MYOD, suggesting that a significant portion of MuSCs from the Myf6-KO
mice have exited quiescence (Fig. 6k-i). This data is consistent with our earlier analysis showing
that by three weeks of age, MuSCs from Myf6-KO mice break quiescence and express KI67 (Fig.
6c-f). Next, we performed RNA-Seq analysis of freshly sorted MuSCs from Myf6-KO and WT mice.
13 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
To overcome the limitation in the number of MuScs that can be isolated from each animal and,
by proxy, the limited amount of total RNA, we used Switching Mechanisms at 5’ end of RNA
Transcript (SMART technology, Clonetech). Using adjusted p-value of <0.01, we identified 754
genes that are significantly up or down regulated in Myf6-KO compared to their WT counterparts
(Table S4). Analysis of RNA-Seq data shows that the p38 MAPK pathway is significantly
upregulated in MuSCs of the Myf6-KO compared to their WT counterparts (Fig. 6g-h). Up
regulation of p38 MAPK was further validated by immunofluorescence analysis of EDL myofibers
associated MuSCs (Fig. 6n-o). p38 MAPK plays a critical role in MuSCs differentiation. Notably,
our data shows that progenitors derived from MuSCs from Myf6-KO mice readily undergo
myogenic differentiation with a fusion index approaching 100% as compared to their WT
counterpart which exhibit a fusion index of approximately 60%. MuSCs associated with EDL
myofibers from the Myf6-KO mice but not their WT counterparts express MYOD and enter
myogenic differentiation program. Taken together, this data suggest that loss of Myf6 in skeletal
muscle leads to precocious activation of differentiation program by dampening EGFR and STAT3
pathways and concomitant activation of p38 MAPK (Fig. 4, Fig. 6) and expressing MYOD (Fig. 6k-
m).
Myf6 is Required for the Establishment of Functional Niche Microenvironment in Skeletal
Muscle
Loss of Myf6 led to a reduced MuSC pool in adult mice (Fig. 5a-l) through spontaneous MuSC
break from quiescence (Fig. 6a-f). MuSCs from Myf6-KO mice upregulate p38 MAPK pathway,
express MyoD (Fig. 6k-p) and enter into myogenic differentiation (Fig. 6g-j). Therefore, we
14 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
investigated whether defects in the stem cell compartment in Myf6-KO mice are the result of
defective niche microenvironments. Since our earlier analysis established the absolute
requirement for Myf6 to regulate the expression of key myokines (Fig. 3-4), resulting in impaired
activation of EGFR and STAT3 (Fig. 4d-g), we hypothesized that genetic deletion of Myf6 leads to
a defective niche microenvironment which is pro differentiation. To test this hypothesis, we
isolated MuSCs from a luciferase mouse (B6;FVB-Ptprca Tg(CAG-luc,-
GFP)L2G85Chco Thy1a/J) (see Materials and Methods) and transplanted ten thousand cells
into either homozygous Myf6 knockout or WT control. Next, we monitored the engraftment
efficiency by bioluminescence imaging at day 1, 7, 14 and 21. Notably, in the Myf6 knockout
animals there is significantly less retention of donor MuSCs (Fig. 7a-d), suggesting that the main
effect of Myf6 on the MuSC compartment is due to a defective niche microenvironment resulting
from loss of Myf6. To eliminate the possibility that defects in the MuSC compartment in Myf6-
KO animals might be due to a cell intrinsic defect, we performed acute muscle regeneration assay
using CTX injury. Importantly, following CTX-induced injury, the MuSC pool in Myf6-KO mice is
reconstituted back to the level seen in their WT counterparts (Fig. 7e-g), suggesting that exposure
of muscle stem cells to exogenous source of cytokines from infiltrating immune cells during
muscle injury can rescue defects in the MuSC compartment. Similarly, continuous exposure of
culturing EDL myofibers with chick embryo extract expands the number of MuSCs associated with
EDL myofibers (Fig. 7h-i). Furthermore, exposure of myofiber-associated MuSCs to ligands such
as EGF and LIF significantly increases the number of high PAX7 expressing MuSCs (Fig. 7j-k). Lastly,
our data shows that cultured MuSCs from Myf6-KO mice have similar growth characteristics as
those of their WT counterparts (Fig. 7i-m). Taken together, our data indicates that the defect in
15 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
the stem cell compartment of the Myf6-KO animals is not due to cell-intrinsic defects but is
primarily due to an impairment in the niche microenvironment, in which depletion of myokine
expression from the myofiber leads to activation of a signaling cascade that breaks MuSC
quiescence, activates p38 MAP and induces precocious differentiation. This perturbation in the
niche environment leads to a gradual reduction in the number of MuSCs in adult mice.
Discussion
Skeletal muscle has an inherent endocrine function in addition to its primary functions of
producing force and regulating energy metabolism 21,33,34. However, mechanistic insights into
how myokines are regulated and whether or not they function as part of the MuSC niche milieu
remains largely unexplored. Here, we report that Myf6 is critical to maintain the expression of
many myokines with integral functions in the control of various signaling pathways in skeletal
muscle. Our data identifies a novel function for Myf6 as a myogenic regulator of niche factors,
namely myokines (Fig. 1-4).
Consistent with previous work, the differentiation function of Myf6 in myogenesis is dispensable,
likely because of the large overlap in the regulatory function of myogenic factors (Fig. S5) 35. We
found that mice with a homozygous Myf6 deletion showed no visible abnormalities in skeletal
muscle fiber morphology (Fig. S3). The differentiation function of Myf6 is likely compensated
redundantly by other myogenic factors, i.e. MyoD and/or Myogenin during transient
differentiation of muscle stem cells (Fig. S5). Indeed, by comparative ChIP-Seq analysis we found
that Myf6 and MyoD share 50% overlap in their targets during differentiation of muscle cells (Fig.
S5).
16 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
The unanticipated function of Myf6 in regulating MuSC pool via myokine expression is primarily
due to its temporal position in the hierarchy of the muscle differentiation program. While Myf5,
MyoD and Myogenin are transiently expressed during MuSCs differentiation, in mature skeletal
muscle fibers, Myf6 is the only factor with significant expression (Fig. 1a). Consistent with this
notion, comparative analysis of ChIP-Seq and gene expression data in differentiating myotubes
shows that MyoD is fully capable of binding to a very similar set of genes, including many genes
that are targets of Myf6 (Fig. 2a, Fig. S5).
Our ChIP-Seq (Fig. 1), gene expression analysis(Fig. 2) and ELISA experiments (Fig. 3) point to a
role for Myf6 in the production of multiple regulatory myokines such as EGF, VEGFA and LIF. Our
striking observation that loss of Myf6 leads to significant reduction of myokines not only in the
secretome of differentiating myotubes (Fig. 3f-g) but also in serum (Fig. 3h-i) suggests that the
regulatory function of Myf6 may extend beyond skeletal muscle.
The impairment in the ability of MuSCs to activate EGFR and STAT3 followed by subsequent
rescue (Fig. 4d-g), strongly suggests that Myf6 regulates MuSC activity by myokine signaling. A
critical factor that is required for the maintenance of the MuSC pool throughout adult life is the
ability of stem cells to remain quiescent under homeostatic conditions. In Myf6-KO animals,
muscle stem cells break quiescence and spontaneously enter into differentiation program by
upregulating p38 MAPK pathway and express MYOD (Fig. 6). Such spontaneous exit from
quiescence and entry into myogenic differentiation results from abrogation of myokine-
mediated communication between myofibers and their associated stem cells in the Myf6-KO
animals. The inability of donor stem cells to efficiently engraft into the skeletal muscles of Myf6-
KO further supports our conclusion that loss of Myf6 leads to defective communication between
17 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
MuSCs and their niche microenvironment. Our in vivo and in vitro analysis uncover a novel Myf6-
mediated myokine signaling pathway that establishes a direct communication between
myofibers and their associated stem cells. Therefore, we propose that Myf6 is a myogenic niche
regulator which acts upstream of EGFR and STAT3 pathways to maintain muscle stem cell
quiescence and maintain muscle stem cell pool.
Acknowledgements
We thank Christian Young at the Lady Davis Institute for Medical Research – Jewish General
Hospital – core facility for help with the Fluorescence Activated Cell Sorting (FACS). We thank Dr.
Colin Crist at the Lady Davis Institute and McGill University Department of Human Genetics for
sharing reagents. This work was supported by a grant from the Canadian Institute of Health
Research (CIHR) project grant PJT-156087 to VDS, an NSERC discovery grant to VDS, a research
grant from the Richard and Edith Strauss Foundation to VDS and by the Canada Research Chairs
Program (CRC) to VDS.
Authors Contribution
Conceived the idea, VDS; performed experiments, VDS, FL, DB, KS, NK, DN, CL; Analyzed data,
VDS, FL, DN, TJP, HSN, AHC; wrote the manuscript; VDS, FL.
Conflict of Interests
The authors declare no conflict of interest.
18 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
Figure Captions
Figure 1. Genome-Wide Binding Sites of Myf6/MRF4 in Primary Myotubes. (a) Relative
expression of myogenic factors in mouse hindlimb skeletal muscle assayed by quantitative real-
time PCR (RT-qPCR) on isolated whole muscle RNA. (b) A pie chart showing the distribution of
Myf6 ChIP-Seq peaks within various genomic features. (c) Motif analysis using MEME suite 28
identified canonical E-box motif as the most highly enriched sequence among all sequences
under Myf6 peaks, followed by the Mef2a DNA binding motif. (d) Spatial distribution of
transcription factor binding motifs within Myf6 ChIP-Seq peaks using CentriMo available via
MEME suite 28. (e) Normalized distribution of E-box motifs that occur within Myf6 peaks
compared to their occurrences in the genome normalized per kilo base of DNA. (f) Gene Ontology
(GO Molecular Function) analysis of genes associated with Myf6 peaks based on association by
proximity (single gene within 100kb of peaks) analyzed by Genomic Regions Enrichment of
Annotations Tool (GREAT) 29. (g) Gene Ontology (GO Biological Process) analysis of genes
associated with Myf6 peaks based on proximity similar to the analysis in “f”.
Figure 2. Temporally Regulated Occupancy of Myogenic Regulatory Factors (MRFs) to cis-
Regulatory Domains of Myokine Genes. (a) Colormap of Myf5, MyoD and Myf6 peaks within
100kb of the Transcription Start Sites (TSS) of myokines (supplemental table S2) ranging from
zero (black) to six peaks (red) occupancy. The onset of differentiation coincides with increased
binding of MRFs to the regulatory domains of the myokines genes. (b) Gene expression analysis
of myokines (Supplemental table S2) during a five day time course of myogenic differentiation
19 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
going from cycling myoblasts in growth media (Ham’s F10 supplemented with 20% Fetal Bovine
Serum, 1% penicillin/streptomycin, 2.5 ng/ml basic Fibroblast Growth Factor) to terminally
differentiated myocytes (2 days in differentiation media, DMEM supplemented with 5% horse
serum) to post mitotic multinucleated myotubes (5 days in differentiation media). Gene
expression was assayed in biological triplicate by microarray 7,36. Expression of each gene was
averaged across three replicates and normalized to mean zero and standard deviation of one.
Expression values were then truncated at +/- 3 for color display. Blue indicates lower than
average expression, while red indicates higher than average expression. (c) Distribution of Myf6
peaks within 100kb of the TSS of the myokine genes (supplemental table S2), similar to the
analysis shown in “a”. (d) Depletion of Myf6 transcript by siRNAs in differentiated primary
myotubes (5DM). (e-g) Depletion of Myf6 expression by siRNAs leads to a significant reduction in
the gene expression output of Epidermal Growth Factor (EGF) (e), Vascular Endothelial Growth
Factor A (VEGFA) (f) and Leukemia Inhibitory Factor (LIF) (g). (h) Quantitative Real-Time PCR (RT-
qPCR) analysis of a select set of myokines genes involved in the activation of STAT3 and EGFR
signaling pathways. RT-qPCR analysis was performed on the total RNA isolated from primary
myoblasts and multinucleated primary myotubes derived from MuSCs isolated by Fluorescence
Activated Cell Sorting (FACS, see the Extended Material and Methods). Myotubes were obtained
by feeding >90% confluent primary myoblasts with differentiation media (DMEM supplemented
with 5% horse serum) for five days. (i) RT-qPCR analysis of the expression of select receptors for
the ligands in “h” between primary myoblasts and multinucleated myotubes. (j-k) Activation of
STAT3 and EGFR signaling in myoblasts treated with recombinant LIF (j) and EGF (k) respectively.
Myoblasts were treated with 2 ng/ml of each recombinant protein in growth media (Ham’s F10
20 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
supplemented with 20% FBS, 2.5 ng/ml bFGF) for 15 minutes and lysed in RIPA lysis buffer.
Western Blots were performed with antibodies against EGFR, phospho-EGFR (pEGFR-Y1068),
STAT3 and phospho-STAT3 (pSTAT3-Y705). (l) Activation of EGFR in MuSCs on EDL myofibers
treated with EGF compared to untreated control. Myofibers were cultured for 48 hours and were
treated with 40ng/ml of EGF for 10 minutes before fixing and staining with antibodies for PAX7,
EGFR and phospho-EGFR. (m) Activation of STAT3 signaling in MuSCs on EDL myofibers treated
with LIF compared to untreated control. Myofibers were cultured for 48 hours and were treated
with 1000U/ml of recombinant LIF for 10 minutes before fixation and staining with antibodies for
PAX7, STAT3 and p-STAT3.
Figure 3. Genetic Deletion of Myf6 Impairs Myokine Expression in Adult Skeletal Muscles.
(a) Schematic drawing of the Myf6 locus showing insertion of Cre-ERT2 sequence rendering the
Myf6 locus as a null allele 32. (b) Picture of 8 week-old Myf6-KO and WT mice. (c) Relative
expression of Myf6 transcript in the hindlimb skeletal muscles of Myf6-KO and WT mice
measured by Quantitative Real-Time PCR (RT-qPCR). (d) Color map of genes that are up/down
regulated in the whole muscle transcriptome (RNA-Seq) of hindlimb muscles from Myf6-KO and
WT counterparts. Differential expression is Log2 transformed and truncated at +/-3. Color scale
goes from blue (-3=lower than mean), to white (0=mean) and finally to red (+3=higher than
mean). (e) Distribution of Myf6 peaks within 100kb of the TSS of the myokine genes ranging from
zero (black) to six ChIP-Seq peaks (red) occupancy. (e-f)
Expression of VEGFA (e) and EGF (f) proteins in the secretome of Myf6-KO and WT myotubes as
measured by enzyme-linked immunosorbent assay (ELISA). Primary myotubes were derived from
21 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
MuSCs isolated by Fluorescence Activated Cell Sorting (FACS, see the Extended Material and
Methods) from Myf6-KO and WT mice. Myotubes were obtained by feeding >90% confluent
primary myoblasts with differentiation media (DMEM supplemented with 5% horse serum) for
seven days. Media from the last 48 hours of differentiation (days 5 to 7) was collected for ELISA
secretome analysis. Protein readouts were normalized to the total number of nuclei in each plate.
(h-i) Expression of VEGFA (h) and EGF (i) proteins in the blood serum from Myf6-KO and
heterozygous counterparts as measured by Enzyme-Linked Immunosorbent Assay (ELISA).
Figure 4. Myf6 Activates Ligands are Required for Regulation of Key Canonical Signaling
Pathways in MuSCs. (a-c) Snapshots of the UCSC genome browser showing enrichment of Myf6
ChIP-Seq reads compared to control around EGF (a), LIF and OSM (b), and VEGFA (c) loci
superimposed on reads for Histone H3 lysine 4 mono methyl (H3K4me1), Histone H3 lysine4 tri
methyl (H3K4me3) and total H3 in myoblasts (pink) and myotubes (green). (d-e)
Immunofluorescence staining of WT (d) and Myf6-KO (e) EDL myofibers stained with PAX7, EGFR,
phospho-EGFR, STAT3 and phospho-STAT3 antibodies. Live fibers were maintained in culture
media for 44 hours, followed by 4 hours of serum starving in non-supplemented DMEM. For
treated samples, 40ng/ml of recombinant EGF (left) or 1000U/ml of recombinant LIF (right) was
added to the non-supplemented DMEM for 10 minutes before fixation. Activation status of EGFR
and STAT3 signaling pathways was assessed using antibodies against phospho-EGFR (pEGFR-
Y1068) and phospho-STAT3 (pSTAT3-Y705), respectively. (f) Quantification of the percentage of
all pEGFR+/PAX7+ cells (defined as PAX7+ cells showing low or high pEGFR signal) on WT, Myf6-
KO, and Myf6-KO EDL myofibers treated with EGF. (g) Quantification of the percentage of
22 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
EGFRhigh/PAX7+ cells (defined as PAX7+ cells showing high pEGFR signal) on WT, Myf6-KO, and
Myf6-KO EDL myofibers treated with EGF. (h) Quantification of the percentage of all
pSTAT3+/PAX7+ (defined as PAX7+ cells showing low or high pSTAT3 signal) cells on WT, Myf6-KO,
and Myf6-KO EDL myofibers treated with LIF. (i) Quantification of the percentage of
pSTAT3high/PAX7+ cells (defined as PAX7+ cells showing high pSTAT3 signal) on WT, Myf6-KO, and
Myf6-KO EDL myofibers treated with LIF.
Figure 5. Genetic Deletion of Myf6 Leads to Depletion of the Muscle Stem Cell Pool. (a)
Immunofluorescent analysis of TA muscle cross-sections from Myf6-KO and WT mice with PAX7
and Laminin (LAMA1) antibodies at postnatal day 7. (b) Quantification of the number of PAX7+
cells per unit area (mm2) in TA muscle cross-sections from Myf6-KO and WT counterparts at
postnatal day 7. (n=3 animals per group). (c) Immunofluorescent analysis of TA muscle cross-
sections from Myf6-KO and WT mice with PAX7 and Laminin (LAMA1) antibodies at postnatal day
21. (d) Quantification of the number of PAX7+ cells per unit area (mm2) in TA muscle cross-
sections from Myf6-KO and WT counterparts at postnatal day 21. (n=3 animals per group). (e)
Immunofluorescent analysis of TA muscle cross-sections from Myf6-KO and WT mice with PAX7
and Laminin (LAMA1) antibodies at 3 months of age. (f) Quantification of the number of PAX7+
cells per unit area (mm2) in TA muscle cross-sections from Myf6-KO and WT counterparts at 3
months of age. (n=5 animals per group). (g) Immunofluorescent analysis of TA muscle cross-
sections from Myf6-KO and WT mice with PAX7 and Laminin (LAMA1) antibodies at 10 months
of age. (h) Quantification of the number of PAX7+ cells per unit area (mm2) in TA muscle cross-
sections from Myf6-KO and WT counterparts at 10 months of age. (n=3 animals per group). (i)
23 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
Immunofluorescent analysis of myofiber-associated MuSCs isolated from the EDL muscles of 3
month-old Myf6-KO and WT counterparts. Fibers were stained with PAX7 antibody and
counterstained with DAPI at time T=0 hours post fiber isolation. (j) Quantification of the number
of MuSCs per fiber between 3 month-old Myf6-KO and WT counterparts (n=3 animals per group,
p-values are based on two tailed t-test). (k) Immunofluorescent analysis of myofiber-associated
MuSCs isolated from the EDL muscles of 10 month-old Myf6-KO and WT counterparts. Fibers
were stained with PAX7 antibody and counterstained with DAPI at time T=0 hours post fiber
isolation. (l) Quantification of the number of MuSCs per fiber between 10 month-old Myf6-KO
and WT counterparts (n=3 animals per group, p-values are based on two tailed t-test).
Figure 6. MuSCs from Myf6-KO Mice Exhibit Precocious Exit from Quiescence
(a) Immunofluorescent analysis of TA muscle cross-sections from Myf6-KO and WT mice with
PAX7 and KI67 antibodies at postnatal day 7. (b) Quantification of the percentage of KI67+ over
PAX7+ MuSCs between Myf6-KO and WT mice at postnatal day 7 (n=3 animals per group). (c)
Immunofluorescent analysis of TA muscle cross-sections from Myf6-KO and WT mice with PAX7
and KI67 antibodies at postnatal day 21. (d) Quantification of the percentage of KI67+ over PAX7+
MuSCs between Myf6-KO and WT mice at postnatal day 21 (n=3 animals per group). (e)
Immunofluorescent analysis of TA muscle cross-sections from Myf6-KO and WT mice with PAX7
and KI67 antibodies at 3 months of age. (f) Quantification of the percentage of KI67+ over PAX7+
MuSCs between Myf6-KO and WT mice at 3 months of age (n=5 animals per group). (g) Schematic
drawing of the strategy for FACS isolation of Myf6-KO and WT satellite cells for RNA-Seq library
preparation or for culture and differentiation. (h) (Left) Heat Map of up and down-regulated
genes in the p38 MAPK pathway (WP400) in Myf6-KO and WT satellite cells. (Right) Gene set
24 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
enrichment analysis of p38 MAPK pathway genes. In each plot, the blue curve represents the
gene set enrichment score profile 37 across MAPK pathway genes that are ranked by their
differential expression. The grey curve represents the null expectation. P-values are based on
permutation test (10,000 permutations). (i) Immunofluorescent analysis of WT and Myf6-KO
primary myotubes cultured in differentiation media for 7 days and stained with MF20 and DAPI.
(j) Quantification of the fusion index between Myf6-KO and WT 7DM myotubes. Fusion index is
calculated as the percentage of myonuclei out of the total number of nuclei per field of view. (k)
EDL myofibers isolated from WT and Myf6-KO mice fixed at time T=0 and stained with PAX7,
MYOD and DAPI. (l) Quantification of the average percentage of MYOD+/PAX7+ satellite cells per
mouse in Myf6-KO and WT myofibers (n=3). (m) Quantification of the percentage of
MYOD+/PAX7+ satellite cells per fiber in Myf6-KO vs WT myofibers. (n) Staining for phospho-p38
MAPK on EDL myofibers cultured for 48 hours from Myf6-KO and WT mice. (o) Quantification of
the average percentage of phospho-p38+/PAX7+ satellite cells per mouse in Myf6-KO vs WT
myofibers (n=3). (p) Quantification of the percentage of phospho-p38+/PAX7+ satellite cells per
fiber in Myf6-KO vs WT myofibers.
Figure 7. Exposure of MuSCs from Myf6-KO Mice to Exogenous Sources of Cytokines Rescues
their Self-Renewal Defects.
(a) Schematic drawing of MuSC transplantation and in vivo bioluminescence experiments. Briefly,
10 000 MuSCs isolated by FACS from CAG-Luc-eGFP mice were injected into the irradiated
hindlimb of immunocompromised WT or Myf6-KO mice. Bioluminescent imaging was performed
at day 1, 7, 14 and 21 post donor MuSC injections. (b) Representative images of bioluminescent
25 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
signal from hindlimbs of Myf6-KO and WT counterparts at day 1, 7, 14, and 21 post
transplantation. (c) Time course of average bioluminescent signal (total flux in radiance) in Myf6-
KO and WT mice at 1, 7, 14 and 21 days post MuSC transplantation showing engraftment
dynamics of donor MuSCs (mean across 4-5 animals per group ± SEM at each time point). (d)
Bioluminescent signal (radiance) in Myf6-KO and WT mice at each time point normalized to the
bioluminescent signal at day 1 post MuSC transplantation. (n=4-5 animals per group ± SD) (e-f)
Immunostaining of TA cross-sections from WT (e) and Myf6-KO (f) mice stained with laminin
(LAMA1) and PAX7 antibodies. Acute muscle injury was performed by injection of Cardiotoxin
(CTX) into the TA muscle of Myf6-KO and WT mice (n=5 animals per group). (g) Quantification of
the number of PAX7+ cells per unit area of TA muscle cross sections between Myf6-KO and WT
mice (n= 5 animals per group, p-value is based on two tailed t-test). (h) Immunofluorescent
analysis of Myf6-KO and WT EDL myofibers cultured in growth media for 48 hours and stained
with PAX7 and MYOD antibodies. (i) Quantification of the number of PAX7+ MuSCs per fiber in
Myf6-KO and WT mice after 48 hours in culture. (j) Immunofluorescence staining of WT EDL
myofibers cultured in growth media for 48 hours and treated with LIF (1000U/ml) or EGF
(80ng/ml) every 8 hours. Fibers were stained with antibodies against PAX7 and MyoD. (k)
Quantification of the number of PAX7+ and MYOD+ cells on the EDL myofiber treated with
recombinant LIF, EGF or vehicle control. (l) EdU staining of cultured primary myoblasts isolated
by FACS (see materials and methods) from Myf6-KO and WT mice. Staining was analyzed after 6,
12 and 24 hours of EdU incorporation. (m) Quantification of the percentage of EdU+ myoblasts
after 6, 12, and 24 hours of EdU incorporation. (n) Schematic drawing of the mechanism of Myf6
action in maintaining MuSC homeostasis. Briefly, myofibers expressing Myf6 secrete myokines
26 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
that block the activation of the p38 MAPK pathway, which is necessary for maintenance of the
MuSC pool.
Materials and Methods
KEY RESOURCES TABLE
27 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
REAGENT or RESOURCE SOURCE IDENTIFIER APPLICATION Antibodies Pax7 DSHB AB_528428 IF MyoD (G-1) Santa Cruz Sc-377460 IF Laminin Sigma-Aldrich L9393 IF MF20 DSHB AB_2147781 IF EGFR Cell Signaling 4267S WB Phospho-EGFR (Y1068) Cell Signaling 2234S WB STAT3 Cell Signaling 9139S WB STAT3 Cell Signaling 4904S IF Phospho-STAT3 (Y705) Cell Signaling 9131S WB Phospho-STAT3 (Y705) Cell Signaling 9145S IF GAPDH Abcam ab9484 WB Ki67 Abcam AB15580 IF Anti-mouse ITGA7-Alexa647 R&D systems FAB3518R FC Anti-mouse PE-CD45 Invitrogen 12-0451-82 FC Anti-mouse PE-CD11b Invitrogen 12-0112-82 FC ebioscience Anti-mouse PE-CD31 BD Pharmigen 555027 FC Anti-mouse PE-Sca1/Ly6A-E BD Pharmigen 553108 FC Alexa Fluor 568 goat anti- Invitrogen A21124 IF mouse IgG1 Alexa Fluor 488 goat anti- Invitrogen A11008 IF rabbit IgG Alexa Fluor 594 goat anti- Invitrogen A21145 IF mouse IgG2b Alexa Fluor 594 goat anti- Invitrogen A11012 IF rabbit IgG Alexa Fluor 568 donkey anti Invitrogen A10042 IF rabbit IgG Alexa Fluor 488 goat anti Invitrogen A21121 IF mouse IgG1 p38 MAPK Cell Signaling 9212S IF P-p38 MAPK (T180/Y182) Cell Signaling 9216S WB P-p38 MAPK (T180/Y182) Cell Signaling 4511S IF EGFR Bethyl IHC-00005 IF P-EGFR (Y1068) Cell Signaling 3777S IF Anti-mouse Cleaved Caspase 3 Cell Signaling 9664S IF Chemicals, Peptides and Recombinant Proteins Goat Serum Life technologies 50062Z SYBR Green Applied A25742 Biosystems Prolong Gold Antifade Reagent Invitrogen P3695 with DAPI
28 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
Triton-X100 Sigma T9284 Bovine Serum Albumin Sigma A8022 PBS (immuno-staining) Sigma P5368 PBS (cell culture) Wisent 311-425-CL Glycine Bioshop Canada GLN001.1 Paraformaldehyde Electron 15714 Microscopy Sciences Mouse on Mouse (M.O.M) Vector MKB-2213 Blocking Reagent laboratories Collagenase from Clostridium Sigma C0130-1G histolyticum Collagenase D Roche 11088882001 Dispase II Sigma D4693 Fetal Bovine Serum Wisent 080-450 Horse Serum Wisent 065-250 DMEM Invitrogen 11995073 Ham’s F10 Gibco 11550-043 Chicken Embryo Extract Accurate MD-004-D Human bFGF Life Technologies 13256029 TRIzol Life Technologies 15596018 Chloroform Sigma 472476 Isopropanol Sigma I9516 Ethanol Commercial P016EAAN Alcohols Sucrose Sigma S7903 Isopentane Sigma M32631 Penicillin/Streptomycin Gibco 15140122 iScript RT Bio-rad 1708841 Trypsin Gibco 15090-046 siMyf6 Sigma SASI_Mm01_00077345 siControl Sigma SIC001 ANTI-FLAG M2 Affinity Gel Sigma A2220-1ML Ni-NTA Agarose Thermo Fisher R90101 3X FLAG Peptide Sigma F4799-4MG ESGRO recombinant mouse LIF Millipore Sigma ESG1106 protein Recombinant mouse EGF R&D Systems 2028-EG-200 protein Recombinant OSM D-luciferin GoldBiotechnology LUCK-100/115144-35-9 FK-506 monohydrate Sigma F4679 Strausporine Abcam Ab120056
29 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
H202 Hydrogen peroxide Sigma H1009 solution Ampure XP beads Beckman Coulter A63882
Commercial Kits EGF ELISA kit Reddot Biotech RD-EGF-Mu VEGFA ELISA kit Cedarlane CL89125K-96 SMART-Seq v4 Ultra Low Input Takara Bio 634889 RNA kit Nextera XT DNA Library Illumina FC-131-1024 Preparation Kit Nextera XT Index Kit Illumina FC-131-1001 Click-iT Edu Alexa Fluor 555 Invitrogen C10338 Imaging kit Senescence beta-galactosidase Cell Signaling 9860S Staining kit
Deposited Data Data provided in this study GEO: GSE123836
Motif Variation Regulates the 36 GEO: GSE80588 Affinity Landscape and Epigenetic State of the MyoD Cistrome
Time Series of gene expression 7,36 GEO: GSE24811 during the course of myogenic differentiation in mouse skeletal muscle cells
Experimental Models: Cell Lines HEK-293T ATCC CRL-1573 COS-7 ATCC CRL-1651 Phoenix-ECO ATCC CRL-3214 HeLa ATCC CCL-2 C2C12 ATCC CRL-1772 Experimental Models: Organisms/Strains
30 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
C57BL/6J Jackson 000664 Laboratories C57BL/6J Charles River C57BL/6NCrl
Myf6tm1.1(cre/ERT2)Lepr/J (Christoph Lepper laboratory) B6;FVB-Ptprca Tg(CAG-luc,- Jackson 025854 GFP)L2G85Chco Thy1a/J Laboratories Oligonucleotides See table S1 for all primers Software and Algorithms Prism7 Graphpad Adobe Photoshop CS6 Adobe Adobe Illustrator CS6 Adobe BD FACSDIVA Software BD Biosciences
CONTACT FOR REAGENT AND RESOURCE SHARING
Further information and requests for resources and reagents should be directed to and will be
fulfilled by the Lead Contact, Vahab Soleimani ([email protected])
EXPERIMENTAL MODEL AND SUBJECT DETAILS
Animal Procedures
All animal procedures were approved by the McGill University Animal Care Committee (UACC).
Cell Isolation and Culture
Muscle stem cells were isolated from the hindlimb muscles of 8-week-old mice by Fluorescence
Activated Cell Sorting, as described in the Method Details. Sorted cells were cultured on collagen-
coated plates in growth media (Ham’s F10 supplemented with 20% FBS, 1% penicillin
streptomycin and 2.5 ng/ml bFGF) and passaged after reaching 60% confluency.
31 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
METHOD DETAILS
Generation of Myf6-CTAP Retrovirus
Full Open reading Frame (FL-ORF) of the mouse Myf6/MRF4 was sub cloned into pBRIT retroviral
backbone 6. The construct was verified by sequencing and its functionality was confirmed using
multiple functional assays (Fig. S1). Retroviral particles containing Myf6-CTAP were generated by
transfection of Phoenix helper-free retrovirus producer lines, a kind gift from the Nolan lab
(https://web.stanford.edu/group/nolan/_OldWebsite/retroviral_systems/phx.html) with
Polyethylenimine (PEI, Polysciences Cat. 23966-2). Viral supernatant was collected after 48 hours
post transfection.
Generation of Primary Myoblasts Over-Expressing Myf6-CTAP
Muscle stem cells were isolated from 8-week old WT C57BL/6 mice by FACS and were propagated
and maintained in growth media (HAM’s F10 supplemented with 20% FBS, 1%
penicillin/streptomycin and 2.5 ng/ml basic Fibroblast Growth Factor, bFGF) for up to three
passages. The resulting myoblasts were then infected with a retroviral cocktail containing Myf6-
CTAP virus and polybrene (Millipore) for 8 hours. Cells were subsequently washed with 1X PBS
and fed with normal growth media. The selection of transduced cells was carried out by
puromycin selection (2.5 µg/ml) in primary myoblast growth media for up to one week.
Subsequently, stably transduced primary cells were maintained in low puromycin selection media
(HAM’s F10 supplemented with 20% FBS, 2.5 ng/ml bFGF, 1% penicillin/streptomycin, and 1.25
µg/ml puromycin). Differentiated multinucleated myotubes were obtained by placing >90%
32 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
confluent myoblasts in differentiation media (DMEM supplemented with 5% horse serum) for
five days.
Tandem Affinity Chromatin Immunoprecipitation Sequencing (ChTAP-Seq)
ChTAP-Seq was carried out as described previously 26. Briefly, multi nucleated myotubes over
expressing Myf6-CTAP or empty vector- (EV-CTAP) were harvested and 20 mg of chromatin was
used as input for ChIP. ChIP was performed in tandem using anti FLAG antibody conjugated to
agarose beads (Sigma). Chromatin was then eluted from the beads by competition with FLAG
peptide (Sigma) and cleavage by TEV protease (New England Biolabs). The eluted chromatin was
then used for a second purification step using Ni-NTA Agarose with nickel-charged affinity resin
(Thermo Fisher), as described previously 26. Finally, 10 ng of ChIP DNA was used to construct ChIP-
Seq libraries using TruSeq ChIP Library Preparation Kit (Illumina). Reads from the Myf6 ChTAP-
and the EV-ChTAP-Seq were mapped to the mouse mm10/GRCm38 mouse genome assembly.
Peak calling was carried out using MACS2.0 27 with p-value threshold of 10-5 using default
parameters.
Luciferase Assays
Luciferase assays were carried out as described previously 36. Briefly, Cos7 cells were co
transected with retroviral vectors harboring MRFs (MyoD or Myf6) with and without mouse E47
expression vector together with the luciferase vector (pGL4.23 [luc2/minP]) containing a
multimerized E-box motif with three spaced out CAGCTG motifs, as described previously 36. Dual
33 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
luciferase assay was performed using Promega Dual luciferase assay kit. Relative luciferase
expressions were normalized to renilla and plotted relative to the promoter readout.
Immunofluorescent Analysis of the Tibialis Anterior (TA) Muscles
TA muscle sections were fixed in 4% paraformaldehyde (PFA) in PBS for 10 minutes on ice and
washed 3 times for 5 minutes each in PBS. Permeabilization was done in 0.3% Triton-X100 and
0.1M glycine in PBS for 20 minutes on a shaker at room temperature, followed by washing once
in PBT (0.05% Triton-X100 in PBS, v/v).
Muscle cross sections were first blocked in Mouse blocking reagent (M.O.M reagents Vector
Laboratories) for one hour and subsequently in 10% goat serum (Thermo Fisher) supplemented
with 3% Bovine Serum Albumin (BSA) in a humid chamber at room temperature for one hour.
Subsequently, muscle sections were incubated with the primary antibodies (Pax7, concentrated
DSHB 1:100 dilution; Laminin (LAMA1), Sigma 1:750 dilution) in goat serum with BSA blocking
solution overnight in a humid chamber at 4 °C. The next day, slides were washed twice for 10
minutes each time in PBT (0.05% Triton-X100 in PBS, v/v), and once for 10 minutes in PBS. Samples
were then incubated with the secondary antibodies (goat anti-mouse IgG1, Alexa 568 1:1000
dilution; goat anti-rabbit IgG Alexa 488 1:500 dilution) diluted in goat serum in BSA blocking
solution for one hour at room temperature in a humid chamber protected from light. Sections
were washed three times for 10 minutes each time in PBT followed by mounting with ProLong
Gold AntiFade plus DAPI solution (Invitrogen P36935) and coverslips were sealed using clear nail
polish.
34 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
Skeletal Muscle Injury and Regeneration
Injury-induced regeneration experiments were performed via intra-muscular injection of 50 µl
cardiotoxin (CTX, 5 µM, Sigma) into the TA muscle of 3-4-months old Myf6-KO mutant and WT
control animals. Prior to injury, mice were anaesthetized by intra-peritoneal injection of Avertin
(2,2,2-tribromoethanol from TCI America at 15 µl per gram body weight of 20 mg per ml solution),
or by the administration of Isoflurane. The right injured and the left uninjured TA muscles were
harvested via dissection 21 days post CTX injury. Muscles were immediately mounted in
tragacanth (Alfar Aesar) on cork and snap-frozen in liquid nitrogen-chilled isopentane (Sigma).
Isolation and Immunofluorescent Analysis of EDL Myofibers
Briefly, the skin from the hindlimb of the mouse was removed and the TA muscle was dissected
to gain access to the Extensor Digitorum Longus (EDL). Excess tissue was removed around the
knee to reveal the proximal tendon of the EDL muscle. The EDL muscle was dissected by cutting
the distal tendon, gently peeling the muscle off the leg to reach the proximal tendon and severed
that as well. The EDL was placed in a 1.5 ml tube with 1000 U/ml collagenase in Dulbecco’s
Modified Eagle’s Medium (DMEM) for one hour at 37 °C, 5% CO2. The EDL muscle was then
transferred to a 6-well plate containing unsupplemented DMEM that had previously been coated
with 10% horse serum (HS) plus DMEM for 30 minutes. The fibers were released from the EDL
muscle by using a large bore glass pipette with blunted edges at the nozzle, coated with HS, to
gently pipette the muscle up and down.
Isolated fibers were transferred to a single well of a 12-well plate that was coated with 10% HS
plus DMEM for 30 minutes. Excess media was removed and fibers were fixed with 4% PFA in PBS
for 10 minutes at room temperature. After PFA removal, fibers were washed 3X with 0.1% Triton
35 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
X100 in PBS. Fibers were then permeabilized with 0.1% Triton X100, 0.1M glycine in PBS for 15
minutes at room temperature (RT). After removal of permeabilization buffer, fibers were washed
3X with 0.1% Triton X100 in PBS and blocked with a blocking solution composed of 5% HS, 2% BSA,
1% Triton X100 in PBS for at least 1 hour at RT. Subsequently, blocking solution was removed and
fibers were stained with appropriate primary antibodies diluted in the blocking solution
overnight at 4 oC. The next day, the primary antibody solution was removed and fibers were
washed 3X with 0.1% Triton X100 in PBS. Subsequently, the secondary antibodies were diluted in
the blocking solution and added to fibers at RT for at least one hour. Lastly, antibody solution
was removed and fibers were washed 3X with 0.1% Triton X100 in PBS and placed on a glass slide
with mounting solution containing DAPI for microscopic analysis.
Immunofluorescence of cultured fibers was essentially the same as above with the exception
that the fibers were placed in growth media [DMEM/sodium pyruvate (110 mg/L),
supplemented with 10% FBS, 1% penicillin/streptomycin, 1% chick embryo extract, 2.5 ng/ml
bFGF] and incubated at 37 °C and 5% CO2 for 48 hours prior to fixation.
Immunofluorescence Imaging
Imaging was performed using an EVOS FL Imaging System (Thermo Fischer, AMF4300) equipped
with GFP, Texas Red and DAPI filters, and 4x, 10x, 20x, 40x objectives.
Quantitative Real-Time PCR
qPCR analysis was performed using SYBR Green qPCR Master Mix containing buffer, dNTPs and
Thermo stable hot-start DNA polymerase (Thermo Fisher). Gene-specific primers were designed
36 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
using GenScript software. (https://www.genscript.com/tools/real-time-pcr-tagman-primer-
design-tool) crossing exon junctions for specified genes. The reactions were run on a QuantStudio
7 Flex Real-Time PCR System (Applied Biosystems – Thermo Fisher). Relative expression values
were calculated based on the ΔΔCT method using RPS2 or GAPDH as housekeeping genes.
Isolation of Muscle Stem Cells by Fluorescence Activated Cell Sorting
Hindlimb muscles from Myf6-KO and WT mice were minced and digested in FACS digestion
media, composed of HAM’s F10 with 2.4 U/ml Collagenase D, 2.4 U/ml Dispase II and 0.5 mM
CaCl2, for 60 minutes at 37°C in a 5% CO2 Tissue Culture (TC) incubator with intermittent
trituration. The digested muscle slurry was supplemented with 9ml of FBS, filtered through a
40µm cell strainer and cells were pelleted by centrifugation at 500g, Relative Centrifugation Force
(RCF). The cell pellet was resuspended in 500µl of 2% FBS: PBS (v/v) and incubated with
antibodies and live cell stain (Alexa647-conjugated to anti-mouse ITGA7, PE-CD31, PE-CD45, PE-
CD11b, PE-SCA1 and Hoechst 33342) for 15 minutes at room temperature. Cells were washed in
2% FBS:PBS (v/v) solution and sorted for the ITGA7+/Hoechst+/CD31-/CD45-/CD11b-/SCA1-
population as described previously 38 on a FACSAria Fusion system (Beckman-Dickinson).
Isolated cells were sorted directly into lysis buffer for SMART RNA-Seq library preparation or were
cultured in growth media (Ham’s F10 supplemented with 20% FBS, 1% penicillin streptomycin
and 2.5 ng/ml bFGF) and passaged after reaching 60% confluency.
SMART RNA-Seq Library Preparation
37 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
3000 quiescent satellite cells were lysed after FACS by sorting directly into a 0.2ml tube
containing 1 µl SMART-Seq Reaction Buffer (95% SMART-Seq 10x lysis buffer containing 5%
SMART-Seq RNAse Inhibitor, Takara Bioscience, Cat. 634890) in 8µl ddH20. RNA was reverse
transcribed using SMART-Seq Reverse Transcriptase followed by 11 cycles of PCR amplification
(SMART-Seq v4 kit, Takara Bioscience, Cat. 634890). Purification and size selection of DNA was
carried out using Ampure XP beads (Beckman Coulter, Cat. A63880). Total cDNA was quantified
using Quant-iT PicoGreen dsDNA Assay Kit (Thermo Fisher). Sequencing libraries were created
with the Nextera XT kit (Illumina Cat. FC-131-1024 and FC-131-2001), using 150 pg of total
cDNA as input for tagmentation. Illumina sequencing adapters were added by PCR using 12
cycles of amplification (Illumina Cat. FC-131-1024 and FC-131-2001). Final sequencing libraries
were purified and size selected using Ampure XP beads (Beckman Coulter, Cat. A63880).
Satellite Cell Transplantation
Hindlimbs of WT and Myf6-KO mice were irradiated with 18Gy using a MultiRad 225 irradiator
and were administered a subcutaneous injection of immunosuppressant FK506 (2.5mg/kg) the
day before satellite cell transplantation. Luciferase-expressing satellite cells were FACS sorted
from B6;FVB-Ptprca Tg(CAG-luc,-GFP)L2G85Chco Thy1a/J mice into 2%FBS:PBS (v/v) and
10 000 cells were injected into the hindlimb of WT and Myf6-KO mice using a Hamilton syringe.
FK506 injections (2.5mg/kg) were maintained every 48hours throughout throughout the
bioluminescence imaging time-course.
In vivo Bioluminescence Imaging
38 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
Mice were anesthetized and given two 100μl contralateral intraperitoneal injections of D-
luciferin (Gold Biotechnology) diluted to 15mg/ml in PBS. Bioluminescence imaging was
performed 11 minutes after luciferin injections using an IVIS Spectrum machine (Perkin Elmer).
Bioluminescence signal was measured using region of interest (ROI) placed over each hindlimb.
Imaging was performed 1, 7, 14 and 21 days after donor cell transplantation.
Whole muscle RNA-Seq Preparation
Total RNA was isolated from the hindlimb skeletal muscles of 4-months old Myf6-KO and WT
mice using TRIzol reagent (Thermo Fisher). RNA quality and quantity was assessed by the Agilent
Bio analyzer and 1.0 µg of RNA was used to construct RNA-Seq libraries. cDNA libraries were
constructed from total RNA with the TruSeq RNA v2 kit (Illumina). The size distribution of the
libraries was analyzed with the Fragment Analyzer High Sensitivity NGS assay (AATI). DNA
concentration was measured with the Qubit High Sensitivity DNA assay (Thermo Fisher).
RNA-Seq Analysis
Sequencing was performed on Illumina NextSeq 500 High Output Flow Cell. Sequenced reads
were mapped to mouse mm10 genome assembly using HISAT2 39. We used FeatureCounts to
quantify gene expression using GENCODE gene definitions 40. We then normalized expression by
adding one count to every gene (to avoid zeros) and converted gene expression into reads per
million (RPM). Differentially expressed genes were identified using the R package DESeq2 41. P-
values were corrected by independent hypothesis weighting 42.
39 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
GSEA Pathway Analysis
Genes for p38 MAPK (WP400) pathways were used to perform gene set enrichment analysis 43-45
using a weighted Kolmogorov-Smirnov test. In each test, genes in the pathway were weighted by
its Wald-test statistic of differential expression. The null distribution of enrichment scores was
calculated by permuting the gene labels 10 000 times, the enrichment significance (p-value) was
calculated by the comparison of the enrichment score of the original labels with the null
distribution 37
QUANTIFICATION AND STATISTICAL ANALYSIS
Statistical analysis was performed using Prism7 (Graphpad). An unpaired two tailed t-test was used for comparison between experimental and control groups. Error bars are representations of the standard deviation unless otherwise stated. Asterisks (*, **, ***, ****) correspond to p- values of <0.05, <0.01, <0.001 and <0.0001, respectively.
DATA AND SOFTWARE AVAILABILITY
The primary ChIP-Seq and RNA-Seq data reported in this paper is deposited in NCBI and available through Geo Accession number GSE123836.
References 1 Charge, S. B. & Rudnicki, M. A. Cellular and molecular regulation of muscle regeneration. Physiological reviews 84, 209-238 (2004). 2 Lepper, C., Partridge, T. A. & Fan, C. M. An absolute requirement for Pax7-positive satellite cells in acute injury-induced skeletal muscle regeneration. Development (Cambridge, England) 138, 3639-3646, doi:10.1242/dev.067595 (2011). 3 Comai, G. & Tajbakhsh, S. Molecular and cellular regulation of skeletal myogenesis. Curr Top Dev Biol 110, 1-73, doi:10.1016/B978-0-12-405943-6.00001-4 (2014). 4 Berkes, C. A. & Tapscott, S. J. MyoD and the transcriptional control of myogenesis. Seminars in cell & developmental biology 16, 585-595 (2005).
40 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
5 Braun, T., Bober, E., Rudnicki, M. A., Jaenisch, R. & Arnold, H. H. MyoD expression marks the onset of skeletal myogenesis in Myf-5 mutant mice. Development 120, 3083-3092 (1994). 6 Soleimani, V. D. et al. Snail regulates MyoD binding-site occupancy to direct enhancer switching and differentiation-specific transcription in myogenesis. Mol Cell 47, 457-468, doi:10.1016/j.molcel.2012.05.046 (2012). 7 Soleimani, V. D. et al. Snail Regulates MyoD Binding-Site Occupancy to Direct Enhancer Switching and Differentiation-Specific Transcription in Myogenesis. Mol Cell, doi:10.1016/j.molcel.2012.05.046 (2012). 8 Siles, L. et al. ZEB1 imposes a temporary stage-dependent inhibition of muscle gene expression and differentiation via CtBP-mediated transcriptional repression. Mol Cell Biol 33, 1368-1382, doi:10.1128/MCB.01259-12 (2013). 9 Buckingham, M. Muscle differentiation. Which myogenic factors make muscle? Curr Biol 4, 61-63 (1994). 10 Kassar-Duchossoy, L. et al. Mrf4 determines skeletal muscle identity in Myf5:Myod double-mutant mice. Nature 431, 466-471, doi:10.1038/nature02876 (2004). 11 Buckingham, M. & Rigby, P. W. Gene regulatory networks and transcriptional mechanisms that control myogenesis. Dev Cell 28, 225-238, doi:10.1016/j.devcel.2013.12.020 (2014). 12 Bentzinger, C. F., Wang, Y. X. & Rudnicki, M. A. Building muscle: molecular regulation of myogenesis. Cold Spring Harb Perspect Biol 4, doi:10.1101/cshperspect.a008342 (2012). 13 Boonsanay, V. et al. Regulation of Skeletal Muscle Stem Cell Quiescence by Suv4-20h1- Dependent Facultative Heterochromatin Formation. Cell Stem Cell 18, 229-242, doi:10.1016/j.stem.2015.11.002 (2016). 14 Rayagiri, S. S. et al. Basal lamina remodeling at the skeletal muscle stem cell niche mediates stem cell self-renewal. Nat Commun 9, 1075, doi:10.1038/s41467-018-03425- 3 (2018). 15 Verma, M. et al. Muscle Satellite Cell Cross-Talk with a Vascular Niche Maintains Quiescence via VEGF and Notch Signaling. Cell Stem Cell 23, 530-543 e539, doi:10.1016/j.stem.2018.09.007 (2018). 16 Yin, H., Price, F. & Rudnicki, M. A. Satellite cells and the muscle stem cell niche. Physiological reviews 93, 23-67, doi:10.1152/physrev.00043.2011 (2013). 17 Fry, C. S., Kirby, T. J., Kosmac, K., McCarthy, J. J. & Peterson, C. A. Myogenic Progenitor Cells Control Extracellular Matrix Production by Fibroblasts during Skeletal Muscle Hypertrophy. Cell Stem Cell 20, 56-69, doi:10.1016/j.stem.2016.09.010 (2017). 18 Joe, A. W. et al. Muscle injury activates resident fibro/adipogenic progenitors that facilitate myogenesis. Nat Cell Biol 12, 153-163, doi:10.1038/ncb2015 (2010). 19 Wang, X., Zhao, W., Ransohoff, R. M. & Zhou, L. Infiltrating macrophages are broadly activated at the early stage to support acute skeletal muscle injury repair. J Neuroimmunol 317, 55-66, doi:10.1016/j.jneuroim.2018.01.004 (2018). 20 Jin, R. M., Warunek, J. & Wohlfert, E. A. Chronic infection stunts macrophage heterogeneity and disrupts immune-mediated myogenesis. JCI Insight 3, doi:10.1172/jci.insight.121549 (2018).
41 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
21 Pedersen, B. K. & Febbraio, M. A. Muscles, exercise and obesity: skeletal muscle as a secretory organ. Nat Rev Endocrinol 8, 457-465, doi:10.1038/nrendo.2012.49 (2012). 22 Whitham, M. et al. Contraction-induced interleukin-6 gene transcription in skeletal muscle is regulated by c-Jun terminal kinase/activator protein-1. J Biol Chem 287, 10771-10779, doi:10.1074/jbc.M111.310581 (2012). 23 Munoz-Canoves, P., Scheele, C., Pedersen, B. K. & Serrano, A. L. Interleukin-6 myokine signaling in skeletal muscle: a double-edged sword? FEBS J 280, 4131-4148, doi:10.1111/febs.12338 (2013). 24 Quinn, L. S., Anderson, B. G., Conner, J. D. & Wolden-Hanson, T. IL-15 overexpression promotes endurance, oxidative energy metabolism, and muscle PPARdelta, SIRT1, PGC- 1alpha, and PGC-1beta expression in male mice. Endocrinology 154, 232-245, doi:10.1210/en.2012-1773 (2013). 25 Matthews, V. B. et al. Brain-derived neurotrophic factor is produced by skeletal muscle cells in response to contraction and enhances fat oxidation via activation of AMP- activated protein kinase. Diabetologia 52, 1409-1418, doi:10.1007/s00125-009-1364-1 (2009). 26 Soleimani, V. D., Palidwor, G. A., Ramachandran, P., Perkins, T. J. & Rudnicki, M. A. Chromatin tandem affinity purification sequencing. Nature protocols 8, 1525-1534, doi:10.1038/nprot.2013.088 (2013). 27 Zhang, Y. et al. Model-based analysis of ChIP-Seq (MACS). Genome Biol 9, R137, doi:10.1186/gb-2008-9-9-r137 (2008). 28 Bailey, T. L. et al. MEME SUITE: tools for motif discovery and searching. Nucleic Acids Res 37, W202-208, doi:10.1093/nar/gkp335 (2009). 29 McLean, C. Y. et al. GREAT improves functional interpretation of cis-regulatory regions. Nat Biotechnol 28, 495-501, doi:10.1038/nbt.1630 (2010). 30 Wang, Y. X. et al. EGFR-Aurka Signaling Rescues Polarity and Regeneration Defects in Dystrophin-Deficient Muscle Stem Cells by Increasing Asymmetric Divisions. Cell stem cell 24, 419-432 e416, doi:10.1016/j.stem.2019.01.002 (2019). 31 Zhu, H. et al. STAT3 Regulates Self-Renewal of Adult Muscle Satellite Cells during Injury- Induced Muscle Regeneration. Cell Rep 16, 2102-2115, doi:10.1016/j.celrep.2016.07.041 (2016). 32 Southard, S. et al. A series of Cre-ER(T2) drivers for manipulation of the skeletal muscle lineage. Genesis 52, 759-770, doi:10.1002/dvg.22792 (2014). 33 Nadeau, L. & Aguer, C. Interleukin-15 as a myokine: mechanistic insight into its effect on skeletal muscle metabolism. Appl Physiol Nutr Metab, doi:10.1139/apnm-2018-0022 (2018). 34 Pal, M., Febbraio, M. A. & Whitham, M. From cytokine to myokine: the emerging role of interleukin-6 in metabolic regulation. Immunol Cell Biol 92, 331-339, doi:10.1038/icb.2014.16 (2014). 35 Olson, E. N., Arnold, H. H., Rigby, P. W. & Wold, B. J. Know your neighbors: three phenotypes in null mutants of the myogenic bHLH gene MRF4. Cell 85, 1-4 (1996). 36 Soleimani, V. D. et al. Cis-regulatory determinants of MyoD function. Nucleic Acids Res 46, 7221-7235, doi:10.1093/nar/gky388 (2018).
42 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Lazure et al. 2019 manuscript
37 Subramanian, A. et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A 102, 15545- 15550, doi:10.1073/pnas.0506580102 (2005). 38 Pasut, A., Oleynik, P. & Rudnicki, M. A. Isolation of muscle stem cells by fluorescence activated cell sorting cytometry. Methods in molecular biology (Clifton, N.J.) 798, 53-64, doi:10.1007/978-1-61779-343-1_3 (2012). 39 Kim, D., Langmead, B. & Salzberg, S. L. HISAT: a fast spliced aligner with low memory requirements. Nat Methods 12, 357-360, doi:10.1038/nmeth.3317 (2015). 40 Liao, Y., Smyth, G. K. & Shi, W. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 30, 923-930, doi:10.1093/bioinformatics/btt656 (2014). 41 Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome biology 15, 550, doi:10.1186/s13059-014-0550- 8 (2014). 42 Ignatiadis, N., Klaus, B., Zaugg, J. B. & Huber, W. Data-driven hypothesis weighting increases detection power in genome-scale multiple testing. Nature methods 13, 577- 580, doi:10.1038/nmeth.3885 (2016). 43 Tanabe, M. & Kanehisa, M. Using the KEGG database resource. Current protocols in bioinformatics Chapter 1, Unit1.12, doi:10.1002/0471250953.bi0112s38 (2012). 44 Fabregat, A. et al. The Reactome Pathway Knowledgebase. Nucleic Acids Res 46, D649- d655, doi:10.1093/nar/gkx1132 (2018). 45 Slenter, D. N. et al. WikiPathways: a multifaceted pathway database bridging metabolomics to other omics research. Nucleic Acids Res 46, D661-d667, doi:10.1093/nar/gkx1064 (2018).
43 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Figure 1 a b c 30 myogenic factors in mouse skeletal muscles 5’UTR E value 2.2e-2695 E value 2.0e-183 2 2 20 3’UTR Exons 1 1 bits bits 10 Introns TT A Promoters G T CT G 1 2 3 4 5 6 1 5 0 2 3 4 6 C7 C8 0 AT Intergenic
Relative expression Relative RPS2 to normalized 0 E-box Mef2a DBD Total Myf6 peaks: 12,885 CA CTG AATA Myf6 Myf5 MyoD Myog
d 0.016 e 0.014 Myf6 Peaks 0.012 p = 0 0.010 Genome 0.008 Tcf12 MA0521.1 p=6.2e-34 Myog MA0500.1 p=1.6e-30 0 5 10 15 20 0.006 Myod1 MA0499.1 p=2.2e-25 TCF3 MA0522.2 p=1.1e-24 Probability Number of E-boxes 0.004 ID4 MA0824.1 p=7.7e-24 MYF6 MA0667.1 p=5.9e-21 per kilo base (kb) 0.002 TWIST1 MA1123.1 p=1.5e-13 Meis2_DBD_2 p=2.6e-12 0.000 -60 -50 -40 -30 -20 -10 0 10 20 30 40 50 60 Position of Best Site in Sequence
GO Molecular Function f -Log10 (Binomial p value) Cytoskeletal protein binding 0 10 20 30 40 50 60 70 Actin binding Protein complex binding GTPase regulator activity Nucleoside-triphophate activity Phospholipid binding Protein serine/threonine kinase activity Enzyme activator activity Protein kinase binding Small GTPase regulator activity
GO Biological Process g -Log10 (Binomial p value) Muscle structure development 0 10 20 30 40 50 60 70 Cytoskeleton organization Cardiovascular system development Postitive regulation of catalytic activity Actin cytoskeleton organization Muscle organ development Intracellular transport Muscle tissue development bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. F i g u r e 2
a C h I P - Seq b G en e E xp ressi o n c h M y o k in e ex p res s io n in m y o bl as t s Low High Low High Low High an d m y o t ubes 15 *** C o l o rs cal e C o l o rs cal e C o l o rs cal e *** Myoblasts ANG FSTL1 ANGPTL4 SERPINF1 Myotubes APLN VEGFA BDNF VEGFC BRINP3 SERPINE1 10 CCL1 NRG1 ** CCL11 ERFE CCL17 CX3CL1 CCL2 ANG CCL24 IL33 CCL26 DLL1 CNTF BDNF CTSB IGFBP3 5 * CTSH SPARC CX3CL1 THBS1 CXCL10 IL7 CXCL13 SPP1 CXCL9 TNFRSF10B DCN IGF1 Expression Relative DLL1 APLN 0 DPP4 MMP2 EGF CTSH IL6 EPO CCL17 EGF LIF ERFE IL10 OSM FGF2 TNFRSF11B FGF21 ANGPTL4 FGF4 HBEGF FGF6 FGF2 FGF7 FGF21 i FGF9 FGF6 FNDC5 FNDC5 M y o k in e recep t o r ex p res s io n in m y o bl as t s FST FST FSTL1 GDF11 3 an d m y o t ubes GDF11 GH *** GDNF IGF2 GH IL1A GSN MSTN HBEGF NTF3 IFNG PDGFB ** ** IFNG CCL2 IGF1 IL5 2 IGF2 IL13 Myoblasts IGFBP3 MMP10 IL10 CCL26 Myotubes IL13 IL1RN IL15 DPP4 IL16 TNF IL17A CXCL13 1 IL1A CCL1 IL1RN CXCL9 IL22 IL6 IL31 TNFRSF14 IL33 LTA IL5 BRINP3 IL6 MMP7 Expression Relative IL7 INHBA 0 INHBA MMP8 LIF TPO LTA IL17A EGFR LIFR LTF EPO IL6RA IL6ST OSMR METRNL TSHB MMP10 DCN MMP2 CCL11 MMP7 IL22 MMP8 FGF7 MSTN OSM NAMPT LIF NRG1 IL16 j LIF - + k EGF - + NTF3 CNTF OSM TNFRSF8 OSTN CCL24 STAT3 EGFR PDGFA CTSB PDGFB PDGFA SERPINE1 METRNL pSTAT3 (Y705) pEGFR (Y1068) SERPINF1 FGF4 SPARC IFNG SPP1 IFNG TGFB1 GDNF pSTAT3 (S727) Tubulin THBS1 IL15 TNF CXCL10 TNFRSF10B LTF TNFRSF11B IL31 GAPDH TNFRSF14 NAMPT TNFRSF8 FGF9 TPO TGFB1 TSHB EGF VEGFA GSN VEGFC OSTN
Myoblasts Myotubes Myotubes l PAX7 pEGFR DAPI MERGE MyoD peaksMyf5 MBs peaksMyoD MBs peaksMyf6 MTs peaks MTs 2d (DM) 5d (DM)Myf6 ChIP-Seq
e WT d M yf 6 EGF
1. 5 1. 5 p = 0 . 0 0 0 2 p = 0 . 0 0 9 4 PAX7 pEGFR DAPI MERGE 1. 0 1. 0
0. 5 0. 5
0. 0 0. 0 W T + E G F R el at iv e ex p res s io n R el at iv e ex p res s io n
Si- M y f 6 Si- M y f 6 m PAX7 pSTAT3 DAPI MERGE Si- Scram bl ed Si- Scram bl ed
f V E G FA g LIF WT p = 0 . 0 3 8 3 1. 5 1. 5 p = 0 . 0 1 4 8
1. 0 1. 0 PAX7 pSTAT3 DAPI MERGE
0. 5 0. 5
0. 0 0. 0 W T + L I F R el at iv e ex p res s io n R el at iv e ex p res s io n
Si- M y f 6 Si- M y f 6
Si- Scram bl ed Si- Scram bl ed bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
Figure 3
a b c p<0.0001 WT Myf6-KO 150 Myf6/MRF4 locus 100 ATG 5’UTR E1 E2 E3 3’UTR 50 5’ arm 3’ arm CE-pA frt Neo frt in whole muscle 0 Relative Myf6 expression WT
Myf6-KO
Low High d e Low High f VEGFA protein level in h Colorscale VEGFA protein level in serum myotube secretome HBEGF IGFBP3 SPP1 1500 150 TNFRSF10B VEGFC p=0.0009 SERPINE1 p=0.0024
SPARC nuclei) IL7 6 CX3CL1 THBS1 1000 100 ERFE IL33 IGF1 MMP2 CTSH CXCL13 ANG VEGFA 500 50 DLL1 FSTL1 SERPINF1 FGF21 FST
FGF7 Protein level (pg/ml) FGF2 0 0 FNDC5 MSTN NTF3 FGF6 WT PDGFB Protein level (pg/10 HET ANGPTL4 GDF11 IGF2 BDNF Myf6-KO Myf6-KO TNFRSF14 OSTN TGFB1 APLN CXCL9 CTSB LTA METRNL g EGF protein level in i CNTF EGF protein level in serum IL16 FGF4 myotube secretome LTF INHBA MMP8 CCL2 600 p=0.0248 500 p=0.0021 IL15 CCL24 LIF nuclei) DPP4 6 400 IL6 EGF NAMPT 400 GDNF GSN 300 FGF9 CXCL10 PDGFA DCN 200 CCL11 200 TNFRSF8 IL10 CCL17 100 NRG1 IL22 CCL26 MMP10 Protein level (pg/ml) GH 0 0 IL13 TPO IL31 IFNG Protein level (pg/10 WT IFNG HET EPO IL17A TNF OSM Myf6-KO Myf6-KO TSHB CCL1 IL5 IL1A TNFRSF11B BRINP3 IL1RN MMP7
WT WT
Myf6-KO Myf6-KO Myoblasts No Injury CTX Injury Myf6 peaks MyotubesMyotubes 2DM 5DM bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Figure 4
20kb a mm10 Scale 129,770,000 129,760,000 129,750,000 129,740,000 129,730,000 129,720,000 129,710,000 :chr3 _ 30 Myf6 0 _ 30 A nity matched control 0 _ 40 H3K4me1 (MB MT) 0 _ 40 H3K4me3 (MB MT) 0 _ 40 Total H3 0 Egf
b 20kb mm10 Scale 4,310,000 4,300,000 4,290,000 4,280,000 4,270,000 4,260,000 4,250,000 4,240,000 :chr11 _ 30 Myf6 0 _ 30 A nity matched control 0 _ 40 H3K4me1 (MB MT)
0 _ 40 H3K4me3 (MB MT) 0 _ 40 Total H3 0 Lif OSM
c 10kb mm10 Scale 46,045,000 46,040,000 46,035,000 46,030,000 46,025,000 46,020,000 46,015,000 :chr17 _ 30 Myf6 0 _ 30 A nity matched control 0 _ 80 H3K4me1 (MB MT )
0 _ 80 H3K4me3 (MB MT) 0 _ 80 Total H3 0 Vegfa
Cultured EDL EDL muscle myo bers (48h) d f g PAX7 EGFR DAPI MERGE PAX7 STAT3 DAPI MERGE p < 0 . 0 0 0 1 cel l s +
15 0 cel l100 s + p = 0 . 0 3 9 8 p < 0 . 0 0 0 1
/ P A X 7 p < 0 . 0 0 0 1 + / P A X 7 100 h igh
WTPAX7 DAPI PAX7 pSTAT3 DAPI pEGFR MERGE MERGE 5 0 U n t reat ed 5 0
0 0
PAX7 EGFR DAPI PAX7 STAT3 DAPI MERGE WT P ercen t age o f p E GWT FR e MERGE P ercen t age o f t o t al p E G FR M y f 6 - K O M y f 6 - K O M y f 6 - K O M y f 6 - K O h + E G F i + E G F p < 0 . 0 0 0 1 cel l s
+ 110 p = 0 . 0 1 57 100 cel l s + p = 0 . 1 4 1 2 PAX7 pEGFR DAPI MERGE PAX7 pSTAT3 DAPI MERGE / P A X 7
+ 100 p = 0 . 0 0 0 2 / P A X 7 U n t reat ed h igh 9 0 5 0 M y f 6 - K O 80 PAX7 pEGFR DAPI MERGE PAX7 pSTAT3 DAPI MERGE 7 0
60 0 T reat ed WT P ercen t age o f p ST A TWT 3 P ercen t age o f t o t al p ST A T 3
M y f 6 - K O M y f 6+ - K L O I F M y f 6 - K O M y f 6+ - K L O I F bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Figure 5
a P A X 7 DAPI L A M I N I N P A X 7 DAPI L A M I N I N b 2 p=0.2851 cel l s / m m + at P 7 P 7 P 7 N um ber o f P A X 7 WT WT M y f 6- KO M y f 6 - K O c P A X 7 DAPI L A M I N I N P A X 7 DAPI L A M I N I N d 2 p=0.6636 cel l s / m m + at P 2 1 P 2 1 P 2 1 N um ber o f P A X 7 WT WT M y f 6- KO M y f 6 - K O e P A X 7 DAPI L A M I N I N P A X 7 DAPI L A M I N I N f 2 p=0.0178 cel l s / m m + at 3 m o n t h s 3 m o n t h s 3 m o n t h s N um ber o f P A X 7 WT
WT M y f 6- KO M y f 6 - K O g P A X 7 DAPI L A M I N I N P A X 7 DAPI L A M I N I N h 2 p=0.0048 cel l s / m m + at 1 0 m o n t h s 1 0 m o n t h s N um ber o f P A X 7 WT
WT M y f 6- KO M y f 6 - K O
Dissociated EDL Dissociated EDL i Myo bers (0h) j k Myo bers (0h) l 15 p < 0 . 0 0 0 1 WT Myf6-KO WT Myf6-KO 10 p = 0 . 0 4 3 8 P A X 7 P A X 7 P A X 7 P A X 7 cel l s / f iber cel l s / f iber + + 5 DAPI DAPI DAPI DAPI P A X 7 P A X 7 MERGE MERGE MERGE MERGE 0 3 m o n t h s 1 0 m o n t h s WT WT
M y f 6 - K O M y f 6 - K O bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Figure 6
AAA... WT AAA... SM A R T - Seq / N ext era X T b g L y s is AAA... a WT Myf6-KO T l ibrary p rep arat io n & se q uen cin g 0 OR + 7 days Fixa t io n 105 an d st ain in g p=0.6343 M y f 6 - K O M yo bl ast cul t ure D if f eren t iat io n / P A X 7 P A X 7 + 100 FA C S iso l at io n o f P A X 7 + - -
I 6 7 I T G A 7 / Sca1 / C D 3 1 / C D 1 1 b- / C D 4 5- sa t el l it e cel l s 9 5 P 7 K I 6 7 K I 6 7 cel l9 s 0 at P 7
85
P ercen t age o f K p38 MAP Kinase pathway MERGE DAPI MERGE DAPI WT h M y f 6 - K O 1 d Hras c 0.6 Map3k5 p<2.00e-04 + Mapk14 0.5 Tgfb2 0.4 100 P A X 7 p=0.0335 Rac1
P A X 7 0.2
/ P A X 7 Mapkapk2 0
+ 80 Rps6ka5 0.0 Ripk1 I 6 7 60 Grb2 −0.5 P 2 1 P 2 1 Hspb1 −0.2 40 Pla2g4a
−1 −0.4 K I 6 7 K I 6 7 Max 20 Elk1 Enrichment Score cel l s at P 2 1 Mknk1 0 5000 10000 15000 0 Tradd Rank in ordered dataset Cdc42 30 - 20 Map2k4 P ercen t age o f K Map2k6
MERGE DAPI 20 MERGE DAPI Daxx WT Tgfbr1 Mef2d e M y f 6 - K O Map3k1
f Creb1 0 10 Stat1
+ Myc −10 P A X 7 P A X 7 20 p=0.0348 Atf2 Gene value Traf2
15 Map3k7 −20 / P A X 7
+ Ddit3 0 5000 10000 15000 Hmgn1
I 6 7 10 K I 6 7 K I 6 7 Shc1 5 WT 3 m o n t h s 3 m o n t h s 0 Myf6-KO cel l s at 3 m o n t h s - 5 MERGE DAPI MERGE DAPI P ercen t age o f K WT M y f 6 - K O i
Dissociated EDL myo bers (0h) M F2 0 EDL muscle k l m MERGE WT P A X 7 M YO D DAPI DAPI cel l s cel l s + + 80 15 T p = 0 . 0 0 1 8 p = 0 . 0 3 6 1 W WT / P A X 7 / P A X 7 +
+ 60 10 brigh t f iel d 40
5 P A X 7 M YO D DAPI MERGE 20
0 0 M F2 0 WT WT P ercen t age o f M Y O D P ercen t age o f M Y O D
M y f 6 - K O Myf6-KO Myf6-KO DAPI M y f 6 - K O
brigh t f iel d Cultured EDL Immuno uorescence myo bers (48h) EDL muscle n j 150 o p p = 0 . 0 1 50 P A X 7 P - P 3 8 D API MERGE 100 cel l s cel l s + + WT 15 0 p = 0 . 0 0 2 0 100 p = 0 . 0 2 2 9 / P A X 7 / P A X 7 + + 9 0 50 100 P A X 7 P - P 3 8 D API MERGE 80 Fus io n in dex ( % ) O 5 0 K 7 0 0
0 60 y f 6 - WT M P ercen t age o f p - p 3 8 P ercen t age o f p - p 3WT 8 WT M y f 6 - K O M y f 6 - K O M y f 6 - K O e b f a h c GF L2G85 8 G 2 L FP eG uc- L - G A C certified bypeerreview)istheauthor/funder,whohasgrantedbioRxivalicensetodisplaypreprintinperpetuity.Itmadeavailableunder bioRxiv preprint
M y f 6 - K O WT pups born 0 weeks D 2 1 D 1 4 D 7 D 1 Myf6-KO WT EDL muscle T W O K - 6 f y M PAX7P PAX7 A b 1 1 D C ACSiola on f o 7 n io A at l G T Siso I C FA PAX7 g X7 + - Sca1 / 5 4 D C /
myo bers (48h) Cultured EDL + 2 150 N um ber o f P A X 7 100 cel l s / m m MYOD M 50 - 1 3 D C / 0 - s lli e s l ecel it l el t sa Y doi: OD - / LAMININ LAMININ https://doi.org/10.1101/691386 T W 0 0 use 0 o 0 1 m f o s/ l n ecel it l io el ect t j sa in M I . 0 = p Immuno uorescence DAPI 0 2 O K - 6 f y M 8 2 (p/sec/cm Radiance Max=7.94e6 4.82e4 Min= CTX injury CTX 9 weeks week w 1 2.0 4.0 6.0 MERGE 2 /sr) d c cfei IP njeti n io ect j in P I erin ucif l - D DAPI DAPI 2 2
R adian100 ce (200 p / s ec/ 00 3 cm / s400 r) R adian ce ( p / s ec/ cm / s r) 10 10 10 10 10 TA harvest 12 weeks 0 4 5 6 7 8 i 8 2 2 . 0 = p 1 D / 1 2 D 1 D / 4 1 D 1 D / 7 D T W ys e rftme t en m t graf en t s o p s ay D O K - 6 f y M 21 14 7 1 min m 0 1 O K T - 6 W f y M a 6 CC-BY-NC-ND 4.0Internationallicense I L B WT T W ; this versionpostedJuly3,2019. O K - 6 f y M 58 2 0 . 0 = p Myf6-KO Figure 7
T W
O K - 6 f y M 9 3 0 . 0 = p 0 l j sc e cl us M
LIF EGF Control EDL muscle PAX7 M y f 6 - K O WT The copyrightholderforthispreprint(whichwasnot 6 f y M . hours o h 6 k n
m P ercen t age o f nes in k o y M
h igh myo bers (48h) Cultured EDL
P ax 7 / t o t al M uSC100 s 0 15 0 5
+ reat t n edU 0
P ercen t age o f E dU cel l s 100 MYOD 20 40 60 80 0 iscnt uSC M t cen uies Q hours o h 6 T W 6 2 1 0 0 . 0 = p yte t cy o y M 7 x a P / 3 x a P O K - 6 f y M K P A M s n g o y M 8 3 p
hours o h 2 1 i rnta on io at t eren f dif F G E + 6 hours o h 2 1
T W 3 4 4 0 0 . 0 = p s n O K - 6 f y M DAPI
F I L + Immuno uorescence 3
hours o h 4 2 T W
O K - 6 f y M s n hours o h 4 2 MERGE
D o y M / 5 f y M la t as bl o y M
I P A D dU E bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
Supplemental Information
Table S.1 Primer Names and Their Sequences, Used in This Study
Primer Name Primer Sequence (5’ to 3’) EGF-L TGTGAACACATCTGCCAAGA EGF-R TTTCACCTGACAGGATTGGA EGFR-L ATTGGCCTATTCATGCGAAG EGFR-R TATCCTCAAGTGGGCTTGGT IL6-L TCCTTCCTACCCCAATTTCC IL6-R CGCACTAGGTTTGCCGAGTA IL6RA-L GAGATCCTGGAGGGTGACAA IL6RA-R GGCTGATACCACAAGGTTGG IL6ST-L ACCAGATTCCTGTGGACGAC IL6ST-R GCGTGTACTCCGTGTGAGAA LIF-L GGCAACCTCATGAACCAGAT LIF-R TAGGCGCACATAGCTTTTCC LIFR-L TTCAAACAGCACGGAGACTG LIFR-R TGGGAGCCAGTTCTTCTACG MYF5-L TGAGGGAACAGGTGGAGAAC MYF5-R CTGTTCTTTCGGGACCAGAC MYF6-L GCTAAGGAAGGAGGAGCAAA MYF6-R GAAGAAAGGCGCTGAAGACT MYOD-L GGCTACGACACCGCCTACTA MYOD-R GTGGAGATGCGCTCCACTAT MYOG-L ATGGACGTAAGGGAGTGCAGA MYOG-R CAGTGAATGCAACTCCCACAG OSM-L AGCAAGCCTCACTTCCTGAG OSM-R TTGTTCCTTATGCCGAGGAT OSMR-L AGTTCAGCACACCCGAGACT OSMR-R GCCATTGGCCTGTGATTTTA PAX7-L GACTCCATCAAGCCAGGAGA PAX7-R CACGTTTTTGGCCAGGTAAT RPS2-L TCAAGGCTTTCGTCGCTATT RPS2-R CCAATCTTGTTCCCCCAGTA VEGFA-L CAGGCTGCTGTAACGATGAA VEGFA-R GCATTCACATCTGCTGTGCT
L and R refer to left and right primers respectively. Primers were designed using GeneScript program available at https://www.genscript.com/tools/real-time-pcr- tagman-primer-design-tool
bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
Table S.2 List of Myokines Based on Current Literature
Myokine Reference ANG https://www.nature.com/articles/s41598-018-28117-2 ANGPTL4 https://www.sciencedirect.com/science/article/pii/S8756328215000459 http://perspectivesinmedicine.cshlp.org/content/7/11/a029793/T1.expansion.h APLN tml BDNF http://jeb.biologists.org/content/214/2/337.full BRINP3 https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4954587/ https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po CCL1 ne-0062008-t001 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po CCL11 ne-0062008-t001 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po CCL15 ne-0062008-t001 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po CCL17 ne-0062008-t001 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po CCL18 ne-0062008-t001 CCL2 https://www.sciencedirect.com/science/article/pii/S8756328215000459 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po CCL21 ne-0062008-t001 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po CCL23 ne-0062008-t001 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po CCL24 ne-0062008-t001 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po CCL26 ne-0062008-t001 http://perspectivesinmedicine.cshlp.org/content/7/11/a029793/T1.expansion.h CCN1 tml http://perspectivesinmedicine.cshlp.org/content/7/11/a029793/T1.expansion.h CCN1 tml http://perspectivesinmedicine.cshlp.org/content/7/11/a029793/T1.expansion.h CCN2 tml https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po CFD ne-0062008-t001 CHI3L1 https://link.springer.com/article/10.1007/s12272-017-0994-y CNTF https://www.sciencedirect.com/science/article/pii/S8756328215000459 CTRP15 https://www.sciencedirect.com/science/article/pii/S016524781830302X http://perspectivesinmedicine.cshlp.org/content/7/11/a029793.full?cited- by=yes&legid=cshperspectmed;7/11/a029793&related- CTSB urls=yes&legid=cshperspectmed;7/11/a029793 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
https://www.physiology.org/doi/full/10.1152/ajpendo.00326.2011?url_ver=Z39. CTSH 88-2003&rfr_id=ori:rid:crossref.org&rfr_dat=cr_pub%3dpubmed CX3CL1 https://www.sciencedirect.com/science/article/pii/S8756328215000459 CXCL10 https://www.tandfonline.com/doi/abs/10.1080/09168451.2017.1411778 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po CXCL13 ne-0062008-t001 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po CXCL6 ne-0062008-t001 CXCL8 http://jeb.biologists.org/content/214/2/337.full https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po CXCL9 ne-0062008-t001 DCN https://www.sciencedirect.com/science/article/pii/S8756328215000459 https://www.physiology.org/doi/full/10.1152/physiolgenomics.00174.2013?url_ DLL1 ver=Z39.88-2003&rfr_id=ori:rid:crossref.org&rfr_dat=cr_pub%3dpubmed DPP4 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008 EPO https://www.sciencedirect.com/science/article/pii/S016524781830302X FGF2 https://www.sciencedirect.com/science/article/pii/S016524781830302X FGF21 http://jeb.biologists.org/content/214/2/337.full https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po FGF4 ne-0062008-t001 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po FGF6 ne-0062008-t001 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po FGF7 ne-0062008-t001 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po FGF9 ne-0062008-t001 FNDC5 https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4595346/ FST https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4954587/ FSTL1 https://www.sciencedirect.com/science/article/pii/S0889159111000602 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po FURIN ne-0062008-t001 GDF11 https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4595346/ https://www.physiology.org/doi/full/10.1152/physiolgenomics.00174.2013?url_ GDNF ver=Z39.88-2003&rfr_id=ori:rid:crossref.org&rfr_dat=cr_pub%3dpubmed https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po GH ne-0062008-t002 https://www.physiology.org/doi/full/10.1152/ajpendo.00326.2011?url_ver=Z39. GSN 88-2003&rfr_id=ori:rid:crossref.org&rfr_dat=cr_pub%3dpubmed https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po HBEGF ne-0062008-t001 IFNG https://www.physiology.org/doi/pdf/10.1152/ajpcell.00043.2013 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po IFNG ne-0062008-t001 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
https://www.mcponline.org/content/9/11/2482?ijkey=10d91d80b6d5da94f0caf IGF1 0dce13de0ceff16ef1a&keytype2=tf_ipsecsha https://www.mcponline.org/content/9/11/2482?ijkey=10d91d80b6d5da94f0caf IGF2 0dce13de0ceff16ef1a&keytype2=tf_ipsecsha https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po IGFBP3 ne-0062008-t001 http://perspectivesinmedicine.cshlp.org/content/7/11/a029793/T1.expansion.h IL10 tml IL13 https://www.physiology.org/doi/pdf/10.1152/ajpcell.00043.2013 IL15 http://jeb.biologists.org/content/214/2/337.full https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po IL16 ne-0062008-t001 IL17A https://www.physiology.org/doi/pdf/10.1152/ajpcell.00043.2013 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po IL1A ne-0062008-t001 IL1RN https://www.sciencedirect.com/science/article/pii/S016524781830302X https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po IL22 ne-0062008-t001 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po IL28A ne-0062008-t001 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po IL29 ne-0062008-t001 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po IL31 ne-0062008-t001 IL33 https://www.physiology.org/doi/pdf/10.1152/ajpcell.00043.2013 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po IL5 ne-0062008-t001 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po IL51 ne-0062008-t001 IL6 http://jeb.biologists.org/content/214/2/337.full IL7 https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4954587/ https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po IL8 ne-0062008-t001 INHBA https://www.pnas.org/content/114/32/8596 LIF https://www.sciencedirect.com/science/article/pii/S0889159111000602 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po LTA ne-0062008-t001 https://www.physiology.org/doi/full/10.1152/ajpendo.00326.2011?url_ver=Z39. LTF 88-2003&rfr_id=ori:rid:crossref.org&rfr_dat=cr_pub%3dpubmed METRNL https://www.sciencedirect.com/science/article/pii/S8756328215000459 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po MMP10 ne-0062008-t001 MMP2 https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4954587/ bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po MMP7 ne-0062008-t001 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po MMP8 ne-0062008-t001 MSTN https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4595346/ NAMPT https://www.physiology.org/doi/pdf/10.1152/ajpcell.00043.2013 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po NRG1 ne-0062008-t001 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po NTF3 ne-0062008-t001 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po NTF4 ne-0062008-t001 NTRN https://www.sciencedirect.com/science/article/pii/S2212877817308669 OSM https://www.sciencedirect.com/science/article/pii/S8756328215000459 http://perspectivesinmedicine.cshlp.org/content/7/11/a029793.full?cited- by=yes&legid=cshperspectmed;7/11/a029793&related- OSTN urls=yes&legid=cshperspectmed;7/11/a029793 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po PDGFA ne-0062008-t001 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po PDGFB ne-0062008-t001 https://www.physiology.org/doi/full/10.1152/physiolgenomics.00174.2013?url_ PDGFB ver=Z39.88-2003&rfr_id=ori:rid:crossref.org&rfr_dat=cr_pub%3dpubmed https://www.physiology.org/doi/full/10.1152/ajpendo.00326.2011?url_ver=Z39. SERPINE1 88-2003&rfr_id=ori:rid:crossref.org&rfr_dat=cr_pub%3dpubmed SERPINF1 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008 SPARC https://www.sciencedirect.com/science/article/pii/S8756328215000459 SPP1 https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4657151/ https://www.mcponline.org/content/9/11/2482?ijkey=10d91d80b6d5da94f0caf TGFB1 0dce13de0ceff16ef1a&keytype2=tf_ipsecsha https://www.physiology.org/doi/full/10.1152/physiolgenomics.00174.2013?url_ THBS1 ver=Z39.88-2003&rfr_id=ori:rid:crossref.org&rfr_dat=cr_pub%3dpubmed TNF https://www.physiology.org/doi/pdf/10.1152/ajpcell.00043.2013 https://www.physiology.org/doi/full/10.1152/physiolgenomics.00174.2013?url_ TNFRSF10 ver=Z39.88-2003&rfr_id=ori:rid:crossref.org&rfr_dat=cr_pub%3dpubmed https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po TNFRSF10B ne-0062008-t001 TNFRSF11B https://www.nature.com/articles/s41598-018-28117-2 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po TNFRSF14 ne-0062008-t001 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po TNFRSF8 ne-0062008-t001 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po TPO ne-0062008-t001 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po TSHB ne-0062008-t001 VEGFA https://www.sciencedirect.com/science/article/pii/S8756328215000459 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0062008#po VEGFC ne-0062008-t001
bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
Table S.3 Gene Ontology (GO) analysis of genes up/downregulated in Myf6- knockout skeletal muscles (raw p-values <0.001) Category Term Count % PValue List Total Pop Hits Pop Total Fold EnrichmentBonferroni Benjamini FDR UP_KEYWORDS Phosphoprotein 217 47.0715835 3.91E-17 404 7617 22680 1.59932772 1.08E-14 1.08E-14 5.16E-14 UP_KEYWORDS Cytoplasm 138 29.9349241 2.55E-12 404 4404 22680 1.75911188 7.01E-10 3.51E-10 3.36E-09 GOTERM_CC_DIRECT GO:0005737~cytoplasm 188 40.7809111 2.39E-11 373 6631 19662 1.49450606 8.98E-09 8.98E-09 3.31E-08 UP_KEYWORDS Muscle protein 12 2.60303688 1.53E-09 404 52 22680 12.9550647 4.21E-07 1.40E-07 2.02E-06 UP_KEYWORDS Actin-binding 22 4.77223427 5.45E-09 404 252 22680 4.9009901 1.50E-06 3.75E-07 7.19E-06 GOTERM_MF_DIRECT GO:0003779~actin binding 25 5.42299349 1.43E-07 359 338 17446 3.59438612 8.34E-05 8.34E-05 2.10E-04 GOTERM_MF_DIRECT GO:0003676~nucleic acid binding 54 11.7136659 2.54E-07 359 1237 17446 2.12141424 1.49E-04 7.43E-05 3.74E-04 GOTERM_BP_DIRECT GO:0003009~skeletal muscle contraction 8 1.73535792 5.87E-07 364 26 18082 15.284869 0.00107756 0.00107756 1.00E-03 UP_KEYWORDS Alternative splicing 126 27.3318872 1.54E-06 404 4779 22680 1.48011411 4.23E-04 8.45E-05 0.00202697 UP_KEYWORDS RNA-binding 29 6.29067245 3.96E-06 404 601 22680 2.70885158 0.0010874 1.81E-04 0.00521653 GOTERM_CC_DIRECT GO:0030016~myofibril 8 1.73535792 8.93E-06 373 40 19662 10.5426273 0.0033428 0.0016728 0.01233652 UP_KEYWORDS Methylation 38 8.24295011 9.30E-06 404 960 22680 2.22215347 0.0025537 3.65E-04 0.01225927 GOTERM_BP_DIRECT GO:0000381~regulation of alternative mRNA splicing, via spliceosome 8 1.73535792 1.10E-05 364 39 18082 10.1899127 0.01993658 0.01001847 0.01866804 GOTERM_MF_DIRECT GO:0000166~nucleotide binding 68 14.7505423 1.18E-05 359 1936 17446 1.70688782 0.00687515 0.00229699 0.01738111 GOTERM_MF_DIRECT GO:0005515~protein binding 120 26.0303688 1.37E-05 359 4092 17446 1.42510558 0.00796967 0.0019984 0.02015899 GOTERM_BP_DIRECT GO:0055010~ventricular cardiac muscle tissue morphogenesis 7 1.51843818 1.63E-05 364 28 18082 12.418956 0.02945431 0.00991611 0.02771325 UP_KEYWORDS Myosin 8 1.73535792 2.09E-05 404 48 22680 9.35643564 0.00572005 7.17E-04 0.02750121 GOTERM_CC_DIRECT GO:0030018~Z disc 12 2.60303688 2.41E-05 373 124 19662 5.1012713 0.0089794 0.00300214 0.03322884 GOTERM_BP_DIRECT GO:0014883~transition between fast and slow fiber 5 1.0845987 3.05E-05 364 10 18082 24.8379121 0.05444021 0.01389707 0.05188346 GOTERM_MF_DIRECT GO:0003729~mRNA binding 13 2.81995662 3.69E-05 359 142 17446 4.44893876 0.02134192 0.0043053 0.05434096 UP_KEYWORDS Nucleotide-binding 55 11.9305857 5.38E-05 404 1754 22680 1.76033282 0.01468617 0.00164255 0.07091375 GOTERM_BP_DIRECT GO:0006936~muscle contraction 8 1.73535792 5.89E-05 364 50 18082 7.94813187 0.1025587 0.02140902 0.10026812 UP_SEQ_FEATURE chain:60S acidic ribosomal protein P0 4 0.86767896 8.61E-05 375 5 18012 38.4256 0.09676445 0.09676445 0.13883919 UP_KEYWORDS Motor protein 11 2.38611714 9.89E-05 404 128 22680 4.82441213 0.02684374 0.00271736 0.13038334 UP_KEYWORDS mRNA splicing 15 3.2537961 1.09E-04 404 240 22680 3.50866337 0.02947291 0.00271594 0.14333711 GOTERM_BP_DIRECT GO:0008380~RNA splicing 16 3.47071584 1.13E-04 364 241 18082 3.29798003 0.18765227 0.03404478 0.19248916 UP_KEYWORDS Metal-binding 89 19.3058568 1.32E-04 404 3395 22680 1.471675 0.03562781 0.0030186 0.17379302 UP_KEYWORDS mRNA processing 17 3.68763557 1.35E-04 404 307 22680 3.10865288 0.03654312 0.00285956 0.178338 GOTERM_MF_DIRECT GO:0003723~RNA binding 33 7.15835141 1.61E-04 359 780 17446 2.05598886 0.0897139 0.01554398 0.2365552 UP_KEYWORDS Nucleus 111 24.0780911 2.24E-04 404 4534 22680 1.37436836 0.05966408 0.00438451 0.29453006 INTERPRO IPR012677:Nucleotide-binding, alpha-beta plait 16 3.47071584 2.83E-04 386 281 20594 3.03785518 0.18605301 0.18605301 0.42827169 INTERPRO IPR007087:Zinc finger, C2H2 29 6.29067245 2.88E-04 386 731 20594 2.11657677 0.1887746 0.09931948 0.43522438 INTERPRO IPR027401:Myosin-like IQ motif-containing domain 5 1.0845987 2.99E-04 386 18 20594 14.8200921 0.19537309 0.06989599 0.45217646 INTERPRO IPR002928:Myosin tail 5 1.0845987 3.73E-04 386 19 20594 14.0400873 0.23762136 0.06557881 0.56405333 GOTERM_BP_DIRECT GO:0060048~cardiac muscle contraction 7 1.51843818 3.78E-04 364 48 18082 7.24439103 0.50079293 0.09448167 0.64201318 GOTERM_CC_DIRECT GO:0043292~contractile fiber 5 1.0845987 3.90E-04 373 19 19662 13.8718781 0.13614233 0.0359256 0.53777041 UP_KEYWORDS Coiled coil 80 17.3535792 4.22E-04 404 3076 22680 1.46004197 0.1095357 0.00770432 0.55470697 UP_KEYWORDS Acetylation 81 17.5704989 4.26E-04 404 3125 22680 1.45511287 0.11054959 0.00729523 0.56013897 GOTERM_CC_DIRECT GO:0005622~intracellular 50 10.845987 5.47E-04 373 1599 19662 1.64831572 0.18564225 0.04023912 0.75378431 GOTERM_CC_DIRECT GO:0016607~nuclear speck 13 2.81995662 5.56E-04 373 205 19662 3.34278428 0.18838648 0.03419034 0.76612691 GOTERM_BP_DIRECT GO:0030036~actin cytoskeleton organization 11 2.38611714 5.98E-04 364 142 18082 3.84812722 0.66655867 0.12827916 1.01304862 INTERPRO IPR000504:RNA recognition motif domain 14 3.03687636 6.44E-04 386 241 20594 3.09930557 0.37386056 0.08938623 0.97135055 INTERPRO IPR001909:Krueppel-associated box 18 3.90455531 7.04E-04 386 373 20594 2.57464335 0.40054388 0.0817529 1.06122455 INTERPRO IPR008989:Myosin S1 fragment, N-terminal 4 0.86767896 7.06E-04 386 10 20594 21.3409326 0.40137689 0.07068107 1.06409291 GOTERM_CC_DIRECT GO:0048471~perinuclear region of cytoplasm 27 5.85683297 7.49E-04 373 692 19662 2.05672643 0.24483797 0.03932351 1.02936736 INTERPRO IPR001609:Myosin head, motor domain 6 1.30151844 7.59E-04 386 39 20594 8.20805102 0.42436133 0.06670542 1.1448183 KEGG_PATHWAY mmu04260:Cardiac muscle contraction 8 1.73535792 7.75E-04 153 77 7691 5.22264663 0.15156881 0.15156881 0.97624436 GOTERM_BP_DIRECT GO:0006397~mRNA processing 17 3.68763557 8.44E-04 364 322 18082 2.62263668 0.78779785 0.15822811 1.4269152 KEGG_PATHWAY mmu05410:Hypertrophic cardiomyopathy (HCM) 8 1.73535792 9.04E-04 153 79 7691 5.09042773 0.1744741 0.09141544 1.13786903 GOTERM_MF_DIRECT GO:0042803~protein homodimerization activity 31 6.72451193 0.0010639 359 798 17446 1.88781843 0.4629401 0.08497741 1.55411056 UP_KEYWORDS Thick filament 4 0.86767896 0.00108731 404 12 22680 18.7128713 0.25856921 0.01744449 1.42422598 GOTERM_MF_DIRECT GO:0005200~structural constituent of cytoskeleton 8 1.73535792 0.00109447 359 78 17446 4.98421541 0.47245314 0.07682799 1.59843134 GOTERM_CC_DIRECT GO:0031672~A band 5 1.0845987 0.00116434 373 25 19662 10.5426273 0.3539515 0.05314573 1.5968158 GOTERM_BP_DIRECT GO:0007010~cytoskeleton organization 9 1.95227766 0.00117942 364 104 18082 4.2988694 0.88544447 0.19480401 1.98868672 KEGG_PATHWAY mmu05414:Dilated cardiomyopathy 8 1.73535792 0.0012125 153 83 7691 4.84510591 0.22679182 0.08216317 1.52344833 KEGG_PATHWAY mmu03040:Spliceosome 10 2.1691974 0.00122808 153 133 7691 3.77954691 0.22934388 0.06305271 1.5428785 INTERPRO IPR000048:IQ motif, EF-hand binding site 8 1.73535792 0.00130928 386 88 20594 4.85021196 0.61421196 0.10042215 1.96618358 INTERPRO IPR015880:Zinc finger, C2H2-like 26 5.63991323 0.0014012 386 693 20594 2.00167478 0.63918332 0.09691493 2.10286063 GOTERM_BP_DIRECT GO:0048025~negative regulation of mRNA splicing, via spliceosome 5 1.0845987 0.00144733 364 25 18082 9.93516484 0.92999697 0.21474516 2.43519858 UP_KEYWORDS Ubl conjugation 44 9.54446855 0.00146578 404 1505 22680 1.6412618 0.33194613 0.02216111 1.91555745 GOTERM_CC_DIRECT GO:0005811~lipid particle 7 1.51843818 0.00153916 373 66 19662 5.59078723 0.43877221 0.0621647 2.10580383 GOTERM_CC_DIRECT GO:0032982~myosin filament 4 0.86767896 0.0016686 373 13 19662 16.2194267 0.46540591 0.06070412 2.28101338 SMART SM00242:MYSc 6 1.30151844 0.00185053 240 39 10425 6.68269231 0.28484531 0.28484531 2.25773383 UP_KEYWORDS Isopeptide bond 31 6.72451193 0.00187664 404 953 22680 1.8261249 0.4034318 0.02682121 2.44636949 KEGG_PATHWAY mmu04261:Adrenergic signaling in cardiomyocytes 10 2.1691974 0.00193945 153 142 7691 3.53999816 0.33738661 0.07901609 2.42654326 GOTERM_CC_DIRECT GO:0005634~nucleus 141 30.5856833 0.00208998 373 6019 19662 1.23484836 0.54368128 0.06883983 2.84937023 GOTERM_CC_DIRECT GO:0001726~ruffle 8 1.73535792 0.00217823 373 95 19662 4.43900099 0.55856671 0.06587408 2.968012 GOTERM_CC_DIRECT GO:0005856~cytoskeleton 36 7.80911063 0.00228483 373 1113 19662 1.70500712 0.57590255 0.06385416 3.11114101 UP_KEYWORDS Zinc 56 12.1475054 0.00230105 404 2099 22680 1.49774291 0.46927879 0.03117949 2.99189925 UP_KEYWORDS ATP-binding 40 8.67678959 0.00235009 404 1363 22680 1.64750151 0.4764045 0.0303414 3.05475254 INTERPRO IPR004009:Myosin, N-terminal, SH3-like 4 0.86767896 0.00249569 386 15 20594 14.2272884 0.83742799 0.15223225 3.71661928 INTERPRO IPR013087:Zinc finger C2H2-type/integrase DNA-binding domain 24 5.20607375 0.00286197 386 652 20594 1.96388951 0.87552315 0.15939743 4.2511042 GOTERM_CC_DIRECT GO:0016459~myosin complex 6 1.30151844 0.00295803 373 52 19662 6.08228501 0.67073951 0.07628383 4.01053354 UP_KEYWORDS Cytoskeleton 33 7.15835141 0.00307569 404 1073 22680 1.72653705 0.57135133 0.03777344 3.98034461 UP_KEYWORDS Zinc-finger 44 9.54446855 0.00307636 404 1565 22680 1.57833803 0.57143126 0.036169 3.98120318 GOTERM_CC_DIRECT GO:0071004~U2-type prespliceosome 4 0.86767896 0.00313251 373 16 19662 13.1782842 0.6916545 0.07543842 4.24236496 UP_SEQ_FEATURE splice variant 122 26.4642082 0.00349496 375 4691 18012 1.24918013 0.98404975 0.87370571 5.49282696 GOTERM_BP_DIRECT GO:0007009~plasma membrane organization 4 0.86767896 0.00369993 364 16 18082 12.418956 0.99889251 0.43285396 6.11455106 INTERPRO IPR027417:P-loop containing nucleoside triphosphate hydrolase 30 6.50759219 0.00370986 386 909 20594 1.76080302 0.9329344 0.18767325 5.47775081 GOTERM_CC_DIRECT GO:0005654~nucleoplasm 54 11.7136659 0.00386734 373 1935 19662 1.47106428 0.76614722 0.08681471 5.21306806 INTERPRO IPR020422:Dual specificity phosphatase, subgroup, catalytic domain 5 1.0845987 0.00398354 386 35 20594 7.62176166 0.94507679 0.18720211 5.87054358 SMART SM00349:KRAB 18 3.90455531 0.00457345 240 367 10425 2.13044959 0.56381651 0.33955811 5.49474854 GOTERM_CC_DIRECT GO:0030017~sarcomere 5 1.0845987 0.00508735 373 37 19662 7.12339686 0.85230767 0.10640917 6.80455177 GOTERM_CC_DIRECT GO:0031941~filamentous actin 5 1.0845987 0.00508735 373 37 19662 7.12339686 0.85230767 0.10640917 6.80455177 GOTERM_CC_DIRECT GO:0005859~muscle myosin complex 3 0.65075922 0.00509205 373 6 19662 26.3565684 0.85256927 0.10089493 6.81063916 KEGG_PATHWAY mmu00561:Glycerolipid metabolism 6 1.30151844 0.00557149 153 58 7691 5.20013523 0.69408814 0.17914575 6.82547882 UP_SEQ_FEATURE domain:WH2 4 0.86767896 0.00574767 375 18 18012 10.6737778 0.99890099 0.89680284 8.88188014 GOTERM_MF_DIRECT GO:0051015~actin filament binding 9 1.95227766 0.00591813 359 132 17446 3.31337047 0.9687724 0.31965922 8.36359823 UP_SEQ_FEATURE nucleotide phosphate-binding region:ATP 33 7.15835141 0.00604212 375 963 18012 1.64595639 0.99922562 0.83318377 9.3163454 GOTERM_BP_DIRECT GO:0031334~positive regulation of protein complex assembly 4 0.86767896 0.00612347 364 19 18082 10.4580682 0.99998734 0.5799921 9.92708318 INTERPRO IPR000340:Dual specificity phosphatase, catalytic domain 5 1.0845987 0.00646326 386 40 20594 6.66904145 0.99103151 0.26967762 9.3606344 SMART SM00360:RRM 13 2.81995662 0.0065077 240 229 10425 2.46588428 0.69325634 0.32558814 7.73403267 UP_KEYWORDS GTP-binding 14 3.03687636 0.00675553 404 332 22680 2.36729095 0.84496033 0.07473006 8.55000988 GOTERM_MF_DIRECT GO:0046872~metal ion binding 89 19.3058568 0.00686141 359 3355 17446 1.28913649 0.98206271 0.3310777 9.6347966 GOTERM_MF_DIRECT GO:0005524~ATP binding 46 9.97830803 0.00690465 359 1507 17446 1.48335807 0.98251309 0.30777602 9.6926765 GOTERM_BP_DIRECT GO:0006164~purine nucleotide biosynthetic process 4 0.86767896 0.00709821 364 20 18082 9.93516484 0.99999791 0.60709953 11.418968 GOTERM_BP_DIRECT GO:0030049~muscle filament sliding 3 0.65075922 0.0078952 364 7 18082 21.2896389 0.99999952 0.62099569 12.6214925 GOTERM_MF_DIRECT GO:0044822~poly(A) RNA binding 36 7.80911063 0.00795819 359 1113 17446 1.57184152 0.9905918 0.3221626 11.0921776 GOTERM_BP_DIRECT GO:0001932~regulation of protein phosphorylation 6 1.30151844 0.00805299 364 62 18082 4.80733782 0.99999964 0.60458563 12.8577328 SMART SM00195:DSPc 5 1.0845987 0.00807507 240 35 10425 6.20535714 0.76950385 0.3071074 9.51270361 GOTERM_BP_DIRECT GO:0046034~ATP metabolic process 5 1.0845987 0.00826036 364 40 18082 6.20947802 0.99999976 0.59172885 13.1673036 GOTERM_BP_DIRECT GO:0061024~membrane organization 6 1.30151844 0.00860682 364 63 18082 4.73103087 0.99999987 0.58591984 13.6822064 GOTERM_CC_DIRECT GO:0005844~polysome 5 1.0845987 0.00870098 373 43 19662 6.1294345 0.96226418 0.15842601 11.3742355 GOTERM_CC_DIRECT GO:0001725~stress fiber 6 1.30151844 0.00873833 373 67 19662 4.72057941 0.96279364 0.15173634 11.4203645 GOTERM_MF_DIRECT GO:0008138~protein tyrosine/serine/threonine phosphatase activity 5 1.0845987 0.00890393 359 40 17446 6.07451253 0.99460985 0.33087426 12.3312412 UP_SEQ_FEATURE domain:KH 1 4 0.86767896 0.00894752 375 21 18012 9.14895238 0.99997566 0.88053291 13.5003226 UP_SEQ_FEATURE domain:KH 2 4 0.86767896 0.00894752 375 21 18012 9.14895238 0.99997566 0.88053291 13.5003226 UP_SEQ_FEATURE compositionally biased region:Arg/Ser-rich (RS domain) 4 0.86767896 0.00894752 375 21 18012 9.14895238 0.99997566 0.88053291 13.5003226 GOTERM_CC_DIRECT GO:0005861~troponin complex 3 0.65075922 0.00926979 373 8 19662 19.7674263 0.96957175 0.15321122 12.0743053 GOTERM_CC_DIRECT GO:0020005~symbiont-containing vacuole membrane 3 0.65075922 0.00926979 373 8 19662 19.7674263 0.96957175 0.15321122 12.0743053 KEGG_PATHWAY mmu04810:Regulation of actin cytoskeleton 11 2.38611714 0.00943833 153 213 7691 2.59599865 0.86606883 0.2496415 11.3075126 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
Table S.4 List of genes up/downregulated in Myf6-knockout satellite cells (adjusted p-values <0.01)
Gene Myf6- Myf6- log2FoldCh Adjusted p- name gene_ID WT2_rpm WT1_rpm KO2_rpm KO1_rpm ange p-value value Rps3a3 ENSMUSG00000059751 1.178010586 1.151699886 225.7765307 206.3721522 7.587680306 4.41E-197 4.46E-193 Gm9625 ENSMUSG00000097906 2.128019122 1.680859293 140.1985954 146.4091506 6.293315794 5.10E-147 2.46E-143 Gm11942 ENSMUSG00000094344 0.798007171 0.684794527 106.2903569 86.16996332 7.077501437 5.66E-110 1.92E-106 Gm8730 ENSMUSG00000063696 4.90204405 3.268337513 155.2039653 180.8403112 5.420229202 8.15E-103 1.84E-99 Rps13-ps1 ENSMUSG00000066362 0.760006829 0.840429646 66.20179901 68.52476071 6.443490574 5.39E-93 1.34E-89 Gdpd3 ENSMUSG00000030703 0.228002049 0.622540479 85.32738182 87.30539375 7.670895296 1.51E-92 2.27E-89 Rpl29 ENSMUSG00000048758 58.48252552 57.80288345 1.531160196 1.104743119 -5.40902719 3.04E-75 5.45E-72 BC002163 ENSMUSG00000081824 0.418003756 0.249016191 48.85792988 44.34316132 7.204686136 2.60E-63 3.90E-60 Gm10036 ENSMUSG00000058064 2.090018781 2.583542987 54.31442803 56.34189909 4.613083974 3.97E-63 4.61E-60 Gm5869 ENSMUSG00000104802 0.950008537 0.715921551 37.86141575 34.40047325 5.499640703 1.36E-53 1.62E-50 Gm14165 ENSMUSG00000081434 0.684006146 1.02719179 27.1154551 32.22167432 5.157505597 3.38E-41 3.82E-38 Sln ENSMUSG00000042045 5.16804644 3.610734777 83.57350741 50.75680888 3.985350454 1.83E-34 1.81E-31 Cap1 ENSMUSG00000028656 9.538085709 6.816818242 66.31315611 67.35864298 3.083721268 4.27E-32 3.43E-29 Ubc ENSMUSG00000008348 1629.606644 1398.786202 396.2642587 350.4490673 -1.970395003 6.30E-32 4.55E-29 Gm13443 ENSMUSG00000075391 0.304002732 0.280143215 22.60549234 14.63784633 6.046828415 2.61E-29 2.01E-26 Gm47015 ENSMUSG00000112907 0.570005122 0.715921551 18.56879728 17.39970413 4.850597776 1.21E-28 9.15E-26 Paip1 ENSMUSG00000025451 4.674042001 4.855815734 37.08191601 36.73270872 3.004526022 5.72E-28 4.05E-25 Rbp7 ENSMUSG00000028996 9.880088782 12.10841231 60.63394375 59.99368885 2.506538242 4.60E-26 3.18E-23 Pnliprp2 ENSMUSG00000025091 14.55413078 15.75027411 0.278392763 0.429622324 -5.374307559 4.25E-26 3.92E-23 Gm26825 ENSMUSG00000097554 0.684006146 0.996064766 18.03985103 17.86001376 4.4602666 1.41E-25 8.16E-23 Rps15a- ps8 ENSMUSG00000084403 0.038000341 0.062254048 32.26572122 29.95081346 9.297486031 1.65E-25 9.84E-23 Rplp0-ps1 ENSMUSG00000081640 0.304002732 0.280143215 13.41853117 15.03678135 5.662338204 1.73E-25 1.63E-22 Sorl1 ENSMUSG00000049313 11.24810108 9.898393612 64.14169256 52.41392356 2.512844707 3.02E-24 1.37E-21 Rps13-ps2 ENSMUSG00000069972 12.80611508 12.97996898 0.334071315 0.368247706 -5.148642822 4.58E-23 3.32E-20 Zdbf2 ENSMUSG00000027520 22.00219771 23.50090307 87.16477405 82.97848319 1.953756948 1.72E-22 6.61E-20 Tdpx-ps1 ENSMUSG00000082431 0.304002732 0.280143215 11.69249604 13.65585245 5.4956226 9.50E-23 7.59E-20 Pim1 ENSMUSG00000024014 9.082081612 15.62576602 110.6889625 76.01246408 2.966795921 3.97E-22 1.41E-19 Ucp2 ENSMUSG00000033685 33.93430493 32.68337513 127.9214745 108.4796369 1.877379086 8.34E-22 2.87E-19 Mrln ENSMUSG00000019933 25.61223015 22.47371128 90.14357661 110.0753769 2.110618435 2.42E-21 7.56E-19 Msmo1 ENSMUSG00000031604 62.77656411 54.59679999 220.1251576 182.4360513 1.827595236 2.65E-21 8.95E-19 Rplp0 ENSMUSG00000067274 1761.999833 1762.661112 644.7297995 666.9579711 -1.374460429 4.09E-21 1.34E-18 Abhd14b ENSMUSG00000042073 17.97416152 15.81252816 0.445428421 0.920619266 -4.581965526 2.87E-21 2.19E-18 Dctn5 ENSMUSG00000030868 83.98075465 64.4951936 10.71812137 14.5150971 -2.505191184 2.96E-20 9.13E-18 Lama3 ENSMUSG00000024421 13.71812327 15.75027411 66.70290598 56.83289603 2.117824475 8.50E-20 2.98E-17 Arf5 ENSMUSG00000020440 137.0672317 105.5517382 30.7624003 29.7360023 -1.953853072 3.46E-19 8.39E-17 Gm13453 ENSMUSG00000083240 0.190001707 0.280143215 10.35621078 10.52574694 5.510258231 2.35E-19 1.15E-16 Olfm2 ENSMUSG00000032172 65.17058562 78.50235437 6.319515717 11.99873777 -2.915876656 6.34E-19 1.79E-16 Sfrp4 ENSMUSG00000021319 39.52035513 31.22040501 5.62353381 5.677152142 -2.595742337 1.03E-18 3.25E-16 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
Glrx ENSMUSG00000021591 3.686033123 3.08157537 23.55202774 25.53184098 2.912097095 9.53E-19 4.22E-16 Casq2 ENSMUSG00000027861 177.6515964 116.1660533 30.95727523 19.42506652 -2.497917754 9.07E-18 2.05E-15 Gm20305 ENSMUSG00000103979 0.038000341 0.124508096 9.604550319 12.21354893 7.065973103 5.90E-18 3.53E-15 Pdpn ENSMUSG00000028583 64.90458323 75.45190602 222.9647638 187.0698349 1.597200766 1.48E-17 4.01E-15 Nnmt ENSMUSG00000032271 44.80240259 35.60931538 3.452070259 6.106774466 -3.020165984 1.65E-17 4.63E-15 Ryr3 ENSMUSG00000057378 6.270056343 7.937391104 34.27014911 40.13900001 2.440632666 2.06E-17 5.63E-15 Cyp51 ENSMUSG00000001467 19.22817278 22.47371128 73.91327854 68.98507035 1.827736933 2.51E-17 5.67E-15 Tshr ENSMUSG00000020963 15.23813693 11.76601505 56.37453448 82.88642127 2.42057852 3.81E-17 7.94E-15 Grin2a ENSMUSG00000059003 34.99831449 42.14599041 7.488765321 5.247529817 -2.54787988 3.36E-17 8.61E-15 Gm14616 ENSMUSG00000086177 8.284074441 7.377104673 35.07748812 47.41189221 2.450873438 5.27E-17 1.29E-14 Mpzl2 ENSMUSG00000032092 17.74615947 18.27156305 1.141410328 1.90261315 -3.513764691 9.31E-17 2.19E-14 Eno1 ENSMUSG00000063524 318.2148595 339.377942 101.5855192 123.9460405 -1.490754879 4.76E-16 9.69E-14 Gm16399 ENSMUSG00000097790 0.342003073 0.062254048 11.74817459 9.298254589 5.803350441 2.27E-16 1.17E-13 Tsc22d3 ENSMUSG00000031431 169.6335243 103.3105924 32.043007 24.51915979 -2.223711006 1.78E-15 3.10E-13 Anxa3 ENSMUSG00000029484 889.8539962 715.205629 231.4835823 286.2205299 -1.580666555 1.92E-15 3.69E-13 Timp3 ENSMUSG00000020044 309.0947775 285.8083338 121.3792446 112.1928012 -1.298416033 3.41E-15 6.06E-13 Gm13456 ENSMUSG00000082536 62.92856548 53.94313248 155.8164294 156.8121483 1.470474216 3.66E-15 6.38E-13 Cxcl12 ENSMUSG00000061353 341.3190671 301.2784647 88.166988 44.58865979 -2.229432083 5.56E-15 1.01E-12 Eno1b ENSMUSG00000059040 0.684006146 0.840429646 9.938621634 12.82729511 3.950082346 3.04E-15 1.09E-12 Gbp2b ENSMUSG00000040264 0 0 15.89622676 27.37307952 11.79496221 4.99E-15 1.09E-12 Kcnn3 ENSMUSG00000000794 9.652086734 9.867266588 39.05850463 36.05758793 1.995052517 6.48E-15 1.32E-12 Gm15920 ENSMUSG00000080893 47.23442445 46.2858846 117.2033532 124.2529136 1.420168699 1.05E-14 1.78E-12 Btbd9 ENSMUSG00000062202 19.98817961 16.06154435 67.28753078 57.63076606 1.843081213 2.50E-14 5.14E-12 Gm37899 ENSMUSG00000102657 16.87215161 20.23256556 56.73644507 64.01372631 1.754689695 7.58E-14 1.52E-11 Gm47586 ENSMUSG00000113326 24.2822182 27.98319452 113.9183186 74.81565903 1.901024075 9.90E-14 1.60E-11 Gm35082 ENSMUSG00000108866 0.038000341 0 26.25243754 28.78469572 10.69801141 1.22E-13 2.38E-11 Stard4 ENSMUSG00000024378 10.52609459 6.72343717 42.67761055 38.63532187 2.287969687 1.54E-13 2.44E-11 Car3 ENSMUSG00000027559 70.1866307 63.68589098 21.68679623 21.38905428 -1.585053183 1.67E-13 2.44E-11 Palld ENSMUSG00000058056 10.41209356 13.41574732 45.73993094 41.4892416 1.922668165 1.99E-13 3.50E-11 Rfc5 ENSMUSG00000029363 43.77639337 39.96709874 11.69249604 11.04743119 -1.830028306 2.37E-13 3.65E-11 Dbp ENSMUSG00000059824 116.7750493 80.77462712 28.00631194 27.06620643 -1.793456165 3.65E-13 4.79E-11 Col15a1 ENSMUSG00000028339 6.498058392 7.688374913 52.50487507 28.32438609 2.557254086 3.02E-13 5.41E-11 Rab6b ENSMUSG00000032549 18.0501622 20.20143854 1.670356577 0.398935015 -4.157481713 2.39E-13 5.74E-11 Bst2 ENSMUSG00000046718 29.48826498 35.08015598 7.266051111 7.671827218 -2.059770088 3.29E-13 5.74E-11 Fdft1 ENSMUSG00000021273 24.51022025 23.34526795 64.36440677 70.45806117 1.546305494 5.32E-13 7.01E-11 Greb1 ENSMUSG00000036523 25.87823254 30.28659429 5.09458756 6.352272937 -2.242117437 7.09E-13 1.16E-10 Klhl5 ENSMUSG00000054920 12.61611337 9.120218014 42.06514647 42.25642432 2.007441459 7.41E-13 1.16E-10 Tnfaip6 ENSMUSG00000053475 286.9025781 268.0036761 95.93414608 116.5197118 -1.332705398 9.63E-13 1.16E-10 Col3a1 ENSMUSG00000026043 71.51664265 63.25011264 384.4882448 185.3820329 2.125411058 1.03E-12 1.35E-10 Arntl ENSMUSG00000055116 4.218037903 5.13595895 21.07433215 32.55923471 2.573419334 8.67E-13 1.39E-10 Calcr ENSMUSG00000023964 135.319216 124.3213336 282.2902615 276.2471545 1.155976214 1.60E-12 1.83E-10 Adamts5 ENSMUSG00000022894 58.21652313 51.14170033 164.5579621 127.5978303 1.466684675 1.84E-12 2.63E-10 Rian ENSMUSG00000097451 31.31228137 28.23221071 82.93320406 74.44741133 1.452676876 2.52E-12 2.99E-10 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
Tspan4 ENSMUSG00000025511 126.5031368 149.9388743 49.27551903 54.31653671 -1.363304711 2.54E-12 3.13E-10 Arhgdib ENSMUSG00000030220 191.7117227 131.2626599 40.89589686 18.01345031 -2.411198339 3.54E-12 4.31E-10 Trim12a ENSMUSG00000066258 10.52609459 9.773885516 0 0 -10.8315441 1.58E-12 4.94E-10 Asb4 ENSMUSG00000042607 0.228002049 0.529159407 7.822836636 8.531071867 4.466437908 1.78E-12 5.11E-10 Meg3 ENSMUSG00000021268 62.77656411 73.02399816 203.338074 153.1296713 1.442063689 3.85E-12 5.11E-10 Tmem255 a ENSMUSG00000036502 28.84225918 28.88587821 72.02020775 74.29397478 1.393333733 5.10E-12 5.61E-10 Gstm7 ENSMUSG00000004035 7.22006488 5.416102165 25.97404477 30.53387233 2.214198934 4.37E-12 5.91E-10 Cilp ENSMUSG00000042254 0.684006146 0.902683694 9.715907424 9.022068809 3.60841852 3.50E-12 1.03E-09 Idi1 ENSMUSG00000058258 9.462085026 8.559931583 30.20561477 38.66600918 1.987442625 7.49E-12 1.03E-09 Glo1 ENSMUSG00000024026 129.9231675 108.0419001 333.1804586 258.7247011 1.363170397 1.23E-11 1.29E-09 Gm42047 ENSMUSG00000110631 9.728087417 8.342042415 0 0 -10.66396696 4.93E-12 1.37E-09 Il15ra ENSMUSG00000023206 64.06857572 48.3713952 16.28597663 16.50977217 -1.727354484 1.27E-11 1.42E-09 Mfge8 ENSMUSG00000030605 165.1874844 173.5954125 76.27961702 72.2686124 -1.138241962 1.82E-11 1.75E-09 Mri1 ENSMUSG00000004996 49.70444664 49.30520592 17.31602985 15.09815597 -1.560362943 2.29E-11 2.49E-09 Hmgcs1 ENSMUSG00000093930 19.6081762 21.38426545 78.70163406 53.39591744 1.736879502 2.34E-11 2.49E-09 Msc ENSMUSG00000025930 62.13055831 35.92058562 205.1476269 150.4598754 1.9053189 2.23E-11 2.61E-09 Nr4a3 ENSMUSG00000028341 64.06857572 99.82436577 321.4879625 214.504289 1.759744172 2.82E-11 2.61E-09 Cd109 ENSMUSG00000046186 1.482013317 2.490161915 12.69470999 19.30231728 3.061043692 2.61E-11 3.18E-09 Lpl ENSMUSG00000015568 100.0548991 103.7774978 208.3213044 207.2620841 1.079207335 3.35E-11 3.83E-09 Art3 ENSMUSG00000034842 462.388155 338.6931475 150.6940025 96.84914681 -1.647963732 4.61E-11 4.13E-09 Fbxw17 ENSMUSG00000037816 97.01487178 97.20969576 29.50963286 38.29776147 -1.4652137 4.60E-11 4.35E-09 Defb25 ENSMUSG00000074678 27.70224893 29.2594025 68.76301243 70.02843885 1.336432577 5.59E-11 4.61E-09 Shmt1 ENSMUSG00000020534 60.68654533 58.73669417 19.54317195 21.94142584 -1.473615135 4.16E-11 4.97E-09 Clmp ENSMUSG00000032024 17.32815571 14.22504994 2.839606181 2.086737003 -2.629188313 7.25E-11 8.62E-09 Ksr2 ENSMUSG00000061578 12.19810961 16.46619566 0.027839276 0 -9.888311291 3.51E-11 8.70E-09 Ptprz1 ENSMUSG00000068748 31.6162841 32.30985085 76.61368834 72.75960934 1.27549292 1.28E-10 1.15E-08 Dbi ENSMUSG00000026385 196.5757664 221.064124 419.3430187 396.5414053 1.01756674 1.63E-10 1.37E-08 Dctd ENSMUSG00000031562 45.25840669 40.71414731 12.16576374 14.26959863 -1.649694136 1.37E-10 1.48E-08 Enpep ENSMUSG00000028024 35.68232064 27.23614595 7.433086768 3.8052263 -2.438140047 2.14E-10 2.35E-08 Gxylt2 ENSMUSG00000030074 68.32461396 72.33920363 167.1191755 138.6452615 1.170331542 3.09E-10 2.52E-08 Glipr2 ENSMUSG00000028480 50.61645484 45.07193066 103.9518577 129.9300658 1.342019866 3.91E-10 3.53E-08 4-Sep ENSMUSG00000020486 183.3896479 156.070898 68.51245894 42.8701705 -1.560563482 4.60E-10 4.15E-08 Cdon ENSMUSG00000038119 51.11045928 69.50664445 158.1549286 136.313026 1.339049878 5.42E-10 4.55E-08 Gm8210 ENSMUSG00000094497 0 0 5.62353381 6.475022172 9.953532625 3.17E-10 6.13E-08 Pmepa1 ENSMUSG00000038400 59.35653338 87.34242917 209.0172864 170.6521246 1.423319315 7.94E-10 6.97E-08 Ell2 ENSMUSG00000001542 29.26026293 56.12202416 128.673135 177.7715803 1.900210808 7.24E-10 7.06E-08 Nfia ENSMUSG00000028565 71.25064026 85.50593476 188.1378291 155.8301545 1.184381404 1.24E-09 9.49E-08 Gm6916 ENSMUSG00000108608 0.152001366 0.186762144 5.484337428 4.603096331 4.940050258 5.11E-10 1.05E-07 Gadl1 ENSMUSG00000056880 14.85813352 18.11592793 2.811766905 3.436978594 -2.347291396 7.81E-10 1.13E-07 Coro1b ENSMUSG00000024835 185.7076688 148.8805555 71.63045788 69.96706423 -1.19049599 1.45E-09 1.15E-07 Rasgrp2 ENSMUSG00000032946 27.05624313 26.61360547 7.79499736 5.1861552 -1.998217827 1.20E-09 1.18E-07 Ank3 ENSMUSG00000069601 56.01250333 58.30091583 128.5339386 111.5790551 1.121163398 1.45E-09 1.20E-07 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
Lgals3bp ENSMUSG00000033880 27.77824962 32.62112109 8.825050583 5.523715597 -2.023874167 1.32E-09 1.28E-07 Rgs4 ENSMUSG00000038530 260.2643387 209.6716332 91.89745102 105.0733456 -1.203275326 1.45E-09 1.33E-07 Abhd14a ENSMUSG00000042210 110.8089957 113.2089861 45.26666324 51.55467891 -1.157950339 1.86E-09 1.51E-07 Pusl1 ENSMUSG00000051557 39.6723565 28.51235393 9.855103805 6.843269879 -1.981662394 1.64E-09 1.55E-07 Siah2 ENSMUSG00000036432 10.52609459 18.11592793 50.75100067 48.11770031 1.839233347 1.68E-09 1.63E-07 Hmgn2 ENSMUSG00000003038 87.97079051 91.57570442 29.8158649 38.54325995 -1.339999145 2.19E-09 1.63E-07 Gja4 ENSMUSG00000050234 59.43253406 47.4687115 17.06547636 9.298254589 -1.973032812 1.77E-09 1.69E-07 Higd1b ENSMUSG00000020928 114.1150254 91.35781526 34.93829174 16.72458334 -1.946548602 2.56E-09 1.77E-07 Peg3 ENSMUSG00000002265 297.9226771 301.3718458 626.0496451 519.6895758 0.984889705 2.51E-09 2.16E-07 Sncg ENSMUSG00000023064 99.18089124 73.30414137 31.68109641 19.76262691 -1.698693416 3.17E-09 2.16E-07 Homer1 ENSMUSG00000007617 20.0641803 32.02970763 81.68043662 70.18187539 1.595113683 3.81E-09 2.41E-07 C1qtnf2 ENSMUSG00000046491 25.04222503 15.68802006 4.008855785 1.994675077 -2.715609335 2.92E-09 2.61E-07 H2-DMa ENSMUSG00000037649 6.840061465 10.98783945 0.695981907 0.153436544 -4.3350371 1.46E-09 2.64E-07 Ly6k ENSMUSG00000044678 4.446039952 7.90626408 24.16449182 30.31906117 2.193748474 3.27E-09 2.88E-07 Trpc3 ENSMUSG00000027716 40.96436811 38.93990695 9.910782358 3.590415138 -2.519646665 3.33E-09 2.90E-07 H19 ENSMUSG00000000031 4.218037903 3.79749692 34.60422042 14.57647172 2.662693061 2.50E-09 3.11E-07 Clasp2 ENSMUSG00000033392 17.06215332 16.09267138 52.44919652 39.49456652 1.520875906 3.89E-09 3.45E-07 Elovl7 ENSMUSG00000021696 0.722006488 0.529159407 8.323943609 6.106774466 3.582308465 2.10E-09 3.64E-07 Mmp2 ENSMUSG00000031740 36.7463302 46.09912245 106.8471424 87.05989527 1.277391788 6.24E-09 4.23E-07 Gm3496 ENSMUSG00000101251 0.038000341 0.093381072 6.208158612 3.283542049 6.184717287 2.68E-09 4.59E-07 Sox11 ENSMUSG00000063632 1.558014 2.459034891 14.11451308 11.10880581 2.6973931 2.98E-09 5.07E-07 Slco2a1 ENSMUSG00000032548 28.38625508 51.01719223 10.43972861 6.045399848 -2.217149907 6.97E-09 5.74E-07 Adcy7 ENSMUSG00000031659 22.45820181 19.70340615 58.01705178 48.02563839 1.380541133 7.12E-09 5.74E-07 Cog7 ENSMUSG00000034951 87.40078538 60.88445882 27.78359773 21.41974159 -1.543585662 9.74E-09 6.00E-07 Mcm6 ENSMUSG00000026355 29.94426908 21.1975033 7.015497624 5.308904435 -2.00427203 7.56E-09 6.05E-07 Mtch1 ENSMUSG00000024012 29.33626362 34.27085336 71.90885065 69.07713227 1.199658509 9.40E-09 6.05E-07 Vtn ENSMUSG00000017344 507.3805593 421.304269 232.3465999 210.0546292 -1.020256171 8.43E-09 6.42E-07 Kng2 ENSMUSG00000060459 49.28644289 44.63615233 17.53874406 18.13619954 -1.345419279 1.05E-08 7.28E-07 Mif ENSMUSG00000033307 300.4687 327.674181 161.217249 162.5506751 -0.90430573 1.28E-08 8.05E-07 Ifitm1 ENSMUSG00000025491 29.56426566 27.57854321 9.493193213 6.81258257 -1.759682515 1.12E-08 8.81E-07 Ddit4l ENSMUSG00000046818 39.14035172 30.22434024 10.52324644 5.646464833 -2.054113276 1.47E-08 1.14E-06 Col5a1 ENSMUSG00000026837 26.71424005 26.2712082 70.93447598 54.89959558 1.297369096 1.96E-08 1.15E-06 Tmsb10 ENSMUSG00000079523 66.91860133 94.43939063 180.2036354 177.0350849 1.199274429 1.83E-08 1.19E-06 Miip ENSMUSG00000029022 15.99814376 11.73488802 2.728249076 2.393610092 -2.386943523 1.15E-08 1.53E-06 C1qtnf12 ENSMUSG00000023571 50.65445518 42.17711744 17.92849393 16.50977217 -1.3804241 2.24E-08 1.67E-06 Tnik ENSMUSG00000027692 55.32849718 54.56567296 123.2166368 101.8204908 1.083968844 2.41E-08 1.73E-06 Gm4864 ENSMUSG00000112003 0.532004781 0.311270239 4.760516245 7.579765292 3.93556751 1.25E-08 1.89E-06 Gadd45gi p1 ENSMUSG00000033751 17.17615434 14.66082827 3.953177233 3.222167432 -2.099431231 2.46E-08 1.89E-06 Sp100 ENSMUSG00000026222 26.52423835 35.7649505 9.7437467 9.54375306 -1.639048 2.52E-08 1.89E-06 Ubn1 ENSMUSG00000039473 25.8402322 31.4694212 63.80762125 64.10578824 1.210073027 3.57E-08 1.89E-06 Gm7125 ENSMUSG00000069996 0 0 3.507748812 4.603096331 9.377523273 1.26E-08 2.03E-06 Tpi1 ENSMUSG00000023456 177.385594 172.0079343 90.67252286 87.45883029 -0.920972511 3.79E-08 2.08E-06 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
Lyve1 ENSMUSG00000030787 4.712042342 19.04973865 0.946535394 0.460309633 -4.022025202 1.71E-08 2.14E-06 Bche ENSMUSG00000027792 16.72015025 20.57496282 49.69310817 43.14635628 1.36633689 3.04E-08 2.17E-06 Gm8276 ENSMUSG00000102550 0.076000683 0.093381072 4.036695061 3.774538991 5.570284069 1.42E-08 2.25E-06 Arid5b ENSMUSG00000019947 222.796002 234.012966 467.4492881 381.811497 0.944631673 3.36E-08 2.27E-06 Sytl2 ENSMUSG00000030616 120.9930872 102.2834007 207.3190905 233.1314855 1.031670685 4.49E-08 2.39E-06 Noct ENSMUSG00000023087 13.52812156 15.78140114 37.52734443 36.57927218 1.38944078 3.44E-08 2.50E-06 D830026I 12Rik ENSMUSG00000085171 4.978044733 5.540610261 0.306232039 0.368247706 -3.912693467 1.74E-08 2.58E-06 Zswim4 ENSMUSG00000035671 9.31008366 12.13953934 34.32582766 28.47782263 1.599941463 3.94E-08 2.84E-06 Tubg1 ENSMUSG00000035198 43.85239406 38.72201778 14.92185209 16.08014985 -1.362061475 4.73E-08 2.84E-06 Agtr1a ENSMUSG00000049115 42.90238552 38.78427183 9.409675385 2.362922783 -2.751368216 4.25E-08 3.01E-06 Olfm1 ENSMUSG00000026833 9.842088441 16.06154435 41.36916456 38.48188533 1.675609055 4.42E-08 3.12E-06 Slc29a1 ENSMUSG00000023942 114.4950289 106.7345651 55.40015981 50.78749619 -1.008470829 6.20E-08 3.17E-06 Cyp26a1 ENSMUSG00000024987 36.40432713 29.35278357 8.658014925 11.38499159 -1.662149386 4.84E-08 3.27E-06 Tmem246 ENSMUSG00000039611 117.2690538 99.94887386 43.15087824 51.1864312 -1.151494005 6.11E-08 3.27E-06 Nr4a2 ENSMUSG00000026826 21.96419737 40.80752838 86.99773839 96.60364833 1.602781527 6.39E-08 3.62E-06 Zfand5 ENSMUSG00000024750 112.7090128 95.8401067 200.1643965 341.5190605 1.431694414 7.32E-08 3.88E-06 Dhrs3 ENSMUSG00000066026 9.614086392 12.32630148 28.31254398 60.08575077 2.067806189 5.76E-08 3.97E-06 Bhlhe40 ENSMUSG00000030103 609.943481 628.9215187 307.9023957 347.932708 -0.865178446 8.20E-08 4.06E-06 Stk25 ENSMUSG00000026277 74.10066587 81.89519998 33.12873878 36.82477065 -1.104654001 8.82E-08 4.07E-06 Gm18860 ENSMUSG00000110569 0.076000683 0 4.370766377 4.265535933 6.994331213 3.12E-08 4.31E-06 Auts2 ENSMUSG00000029673 13.03411712 14.72308232 43.70766377 32.09892508 1.498767085 6.48E-08 4.37E-06 Aldoa ENSMUSG00000030695 1214.642915 1177.971094 649.3511194 677.084783 -0.79954054 7.45E-08 4.55E-06 Zhx2 ENSMUSG00000071757 30.93227796 24.40358677 9.103443345 8.285573396 -1.619997579 7.61E-08 4.87E-06 Polr2k ENSMUSG00000045996 39.25435274 37.66369896 13.55772755 15.43571636 -1.355750847 8.69E-08 5.40E-06 Ppp2ca ENSMUSG00000020349 62.35856035 85.47480773 150.6661633 342.0407447 1.795802692 1.09E-07 5.49E-06 Cpe ENSMUSG00000037852 72.92265528 86.4708725 35.18884523 22.06417508 -1.428128622 1.16E-07 5.86E-06 Gm38211 ENSMUSG00000104476 5.814052245 9.151345038 33.32361371 22.1255497 1.938108758 9.22E-08 5.97E-06 Thg1l ENSMUSG00000011254 2.166019464 1.400716077 8.574497096 16.14152447 2.850809041 4.68E-08 6.37E-06 Serpini1 ENSMUSG00000027834 506.0885477 391.6402152 183.4329914 223.7718563 -1.089052835 1.33E-07 6.58E-06 Nrep ENSMUSG00000042834 337.8230357 237.7482088 124.9148327 128.365013 -1.13456686 1.45E-07 6.75E-06 Slc39a14 ENSMUSG00000022094 57.95052074 49.61647616 209.0451256 104.4595994 1.588678128 1.32E-07 6.85E-06 Got1 ENSMUSG00000025190 27.47424688 26.58247844 8.76937203 9.574440369 -1.507585486 1.10E-07 6.99E-06 2610507I 01Rik ENSMUSG00000085882 3.002026976 3.548480729 0 0 -9.19886513 5.83E-08 7.53E-06 Nsun5 ENSMUSG00000000916 22.23019976 22.66047343 7.210372558 7.272892203 -1.58064311 1.64E-07 1.03E-05 Abcc9 ENSMUSG00000030249 182.9716442 152.18002 67.89999486 28.78469572 -1.749207379 2.04E-07 1.04E-05 Nsun2 ENSMUSG00000021595 132.203188 113.8003995 45.40585962 59.74819038 -1.173657473 1.86E-07 1.06E-05 Loxl1 ENSMUSG00000032334 25.95423322 27.76530535 58.85223007 53.15041897 1.110776874 2.56E-07 1.08E-05 Steap4 ENSMUSG00000012428 197.0697709 154.79469 67.98351269 26.2683364 -1.857111667 2.28E-07 1.14E-05 Myl9 ENSMUSG00000067818 395.0135496 280.7035019 160.5491063 105.6257171 -1.297728243 2.56E-07 1.14E-05 Gpx3 ENSMUSG00000018339 14289.1164 14483.84002 5845.830431 7995.302141 -1.001863906 2.61E-07 1.15E-05 Chn1 ENSMUSG00000056486 36.1003244 21.1975033 8.268265057 6.689833334 -1.88957578 1.93E-07 1.16E-05 Xrcc6 ENSMUSG00000022471 71.36464128 56.33991333 27.17113365 26.2683364 -1.206684866 2.35E-07 1.16E-05 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
Pebp1 ENSMUSG00000032959 110.2009903 107.7928839 39.78232581 53.97897631 -1.163912065 2.66E-07 1.16E-05 F2r ENSMUSG00000048376 164.6934799 161.269111 300.775541 264.5246025 0.844584701 2.57E-07 1.18E-05 Cpm ENSMUSG00000020183 49.59044562 35.54706134 14.83833426 15.25159251 -1.450365066 2.03E-07 1.20E-05 Ssbp4 ENSMUSG00000070003 19.38017415 21.50877354 6.375194269 6.229523701 -1.646243728 2.08E-07 1.23E-05 Nr1h3 ENSMUSG00000002108 63.72657265 40.93203648 17.12115492 7.395641439 -2.050006307 2.61E-07 1.28E-05 Pkm ENSMUSG00000032294 240.8081639 261.7471443 130.482688 138.399763 -0.85013765 2.68E-07 1.28E-05 Ifi30 ENSMUSG00000031838 26.18223527 22.28694914 8.463139991 6.352272937 -1.660556184 2.68E-07 1.50E-05 Ldhb ENSMUSG00000030246 297.6186744 254.5879288 124.9705112 147.1149587 -0.969406755 3.37E-07 1.50E-05 Fndc3b ENSMUSG00000039286 42.25637972 45.07193066 98.16128818 78.00713916 1.062311906 4.04E-07 1.69E-05 B830012L 14Rik ENSMUSG00000098202 3.648032781 6.567802051 22.21574248 18.04413762 2.027906057 2.98E-07 1.72E-05 Gal ENSMUSG00000024907 661.7759467 533.7039524 1031.584383 1154.333811 0.92171135 4.42E-07 1.84E-05 Hp ENSMUSG00000031722 0 30.00645108 0 0 -24.71302784 2.41E-07 1.90E-05 Il18 ENSMUSG00000039217 31.46428274 21.8511708 59.18630138 72.11517585 1.352055288 4.93E-07 1.90E-05 Akr1c14 ENSMUSG00000033715 392.391526 303.7997536 73.46785012 151.9328662 -1.571687543 4.45E-07 1.93E-05 Apoe ENSMUSG00000002985 3002.786983 2872.526277 4641.05791 5548.725754 0.846889768 4.33E-07 1.97E-05 Ednra ENSMUSG00000031616 31.50228308 24.9638732 8.463139991 3.467665903 -2.197221266 3.65E-07 2.04E-05 Scd1 ENSMUSG00000037071 66.6145986 76.29233567 223.5493886 127.168208 1.342929528 4.57E-07 2.06E-05 Aass ENSMUSG00000029695 1.140010244 3.704115849 15.08888775 16.41771025 2.751536231 3.86E-07 2.07E-05 Bzw2 ENSMUSG00000020547 91.31482055 93.94135824 45.48937745 47.47326683 -0.943084217 5.54E-07 2.08E-05 Pla1a ENSMUSG00000002847 16.18814547 12.4819366 2.811766905 0.859244648 -2.919170923 2.87E-07 2.22E-05 G6pdx ENSMUSG00000031400 28.12025269 32.87013728 12.02656736 9.513065751 -1.4509298 4.26E-07 2.25E-05 Col8a1 ENSMUSG00000068196 11.70410517 11.73488802 31.76461424 27.00483181 1.376467436 4.39E-07 2.28E-05 Mapt ENSMUSG00000018411 9.614086392 10.73882326 25.89052695 26.6365841 1.419318028 4.40E-07 2.31E-05 Cox4i2 ENSMUSG00000009876 39.63435615 33.49267776 13.19581696 6.567084099 -1.841103812 4.43E-07 2.38E-05 Zfp992 ENSMUSG00000070605 0 0.280143215 5.428658876 4.35759786 5.126283556 2.27E-07 2.39E-05 Tmod3 ENSMUSG00000058587 70.60463445 61.78714252 32.043007 27.18895566 -1.110592594 5.81E-07 2.39E-05 Nfkbia ENSMUSG00000021025 2144.815273 1858.781361 1101.405288 1118.491034 -0.8001491 5.55E-07 2.42E-05 Polr3h ENSMUSG00000022476 47.50042684 41.7413391 18.84719005 18.81132034 -1.193886823 5.48E-07 2.44E-05 Cd81 ENSMUSG00000037706 1002.791011 870.4983514 501.9699907 524.1085483 -0.81753767 5.70E-07 2.46E-05 Pnrc2 ENSMUSG00000028675 197.867778 148.6626663 70.23849407 84.54353595 -1.111502295 6.12E-07 2.47E-05 Prmt7 ENSMUSG00000060098 67.37460543 56.62005654 28.08982977 27.34239221 -1.110999131 6.48E-07 2.47E-05 Slc25a39 ENSMUSG00000018677 196.7657681 189.9993541 94.06891457 107.2521445 -0.889857741 5.96E-07 2.53E-05 Trap1 ENSMUSG00000005981 105.0329438 85.19466452 46.40807357 42.07230047 -1.054543678 6.67E-07 2.53E-05 Zfp984 ENSMUSG00000078495 5.16804644 3.455099657 0.250553487 0.245498471 -4.069722484 2.53E-07 2.69E-05 Fhad1 ENSMUSG00000051435 5.43404883 2.957067274 18.45744018 16.29496101 2.101649855 5.32E-07 2.74E-05 Gm15787 ENSMUSG00000086247 3.61003244 1.711986317 10.85731775 20.34568578 2.608728648 5.67E-07 2.91E-05 Srsf2 ENSMUSG00000034120 15.04813522 19.20537377 37.08191601 73.74160322 1.751079036 5.90E-07 3.01E-05 Plk3 ENSMUSG00000028680 17.10015366 15.87478221 36.63648759 37.3464549 1.217330921 7.11E-07 3.03E-05 Ctbp1 ENSMUSG00000037373 23.52221137 19.42326294 46.32455574 49.16106882 1.204318378 6.39E-07 3.04E-05 Ptgds ENSMUSG00000015090 29.60226601 21.75778973 56.29101665 61.52805429 1.249154004 7.36E-07 3.04E-05 Ephx1 ENSMUSG00000038776 828.4074441 870.2182082 315.1962861 463.1328655 -1.071329225 6.66E-07 3.07E-05 Gm49720 ENSMUSG00000116688 2.736024586 2.676924059 0 0 -8.924352018 3.03E-07 3.11E-05 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
Sntb2 ENSMUSG00000041308 33.55430152 32.71450216 72.91106459 60.39262386 1.05829644 8.30E-07 3.20E-05 H2-Bl ENSMUSG00000073406 0.038000341 0.031127024 5.62353381 2.025362386 6.845648521 3.18E-07 3.24E-05 Arih1 ENSMUSG00000025234 25.99223357 31.90519954 68.90220881 55.51334175 1.15388311 9.66E-07 3.25E-05 Ankrd28 ENSMUSG00000014496 41.38237186 35.67156943 80.37199064 72.02311393 1.034088372 8.59E-07 3.27E-05 Gnb4 ENSMUSG00000027669 103.9689343 79.12489485 43.87469943 32.03755046 -1.222287792 1.05E-06 3.51E-05 Maff ENSMUSG00000042622 42.06637801 46.65940888 79.64816945 98.2300757 1.056676161 9.32E-07 3.52E-05 Marcks ENSMUSG00000069662 43.05438689 44.35600911 116.980639 76.90239604 1.197659625 1.01E-06 3.77E-05 Adamtsl1 ENSMUSG00000066113 9.538085709 14.84759042 34.54854187 32.43648548 1.509169193 8.85E-07 4.15E-05 Ssr1 ENSMUSG00000021427 53.88448421 59.45261572 112.4985155 96.84914681 0.935853422 1.14E-06 4.23E-05 Sox6 ENSMUSG00000051910 6.308056684 6.038642644 23.74690267 16.08014985 1.738441507 9.17E-07 4.42E-05 Plekhb1 ENSMUSG00000030701 82.91674509 82.26872427 137.637382 173.4446698 0.966268782 1.36E-06 5.02E-05 Gucy1b1 ENSMUSG00000028005 40.96436811 33.11915347 12.11008518 4.35759786 -2.125216299 1.13E-06 5.20E-05 Lrg1 ENSMUSG00000037095 13.11011781 7.875137056 2.004427893 1.380928899 -2.583456708 5.57E-07 5.21E-05 Sqle ENSMUSG00000022351 15.50413932 24.46584081 51.22426837 48.57800995 1.372159001 1.15E-06 5.23E-05 Gm7785 ENSMUSG00000083064 0.570005122 0.529159407 4.676998416 5.769214068 3.302617415 5.65E-07 5.24E-05 Cops7a ENSMUSG00000030127 98.00288065 108.2597893 49.21984047 54.83822096 -0.934621488 1.48E-06 5.36E-05 Fgg ENSMUSG00000033860 0 16.55957673 0 0 -23.90085841 5.89E-07 5.40E-05 4833420G 17Rik ENSMUSG00000062822 55.36649752 43.04867411 19.68236833 20.89805734 -1.227401036 1.21E-06 5.40E-05 Fbn1 ENSMUSG00000027204 38.22834352 31.84294549 86.27391721 64.41266133 1.153335643 1.53E-06 5.50E-05 Klf5 ENSMUSG00000005148 7.904071026 9.08909099 26.19675898 20.56049695 1.509893347 1.26E-06 5.82E-05 Rac1 ENSMUSG00000001847 28.9562602 30.44222941 54.81553501 69.96706423 1.12415931 1.73E-06 6.13E-05 Eif2b1 ENSMUSG00000029388 68.85661875 76.13670055 37.61086226 30.59524695 -1.037588126 1.64E-06 6.15E-05 BC005537 ENSMUSG00000019132 118.0290606 138.1106052 262.4686968 206.3107776 0.922198161 1.85E-06 6.17E-05 Gm15610 ENSMUSG00000078183 0 0 2.644731247 2.516359328 8.723116209 5.79E-07 6.27E-05 Fgb ENSMUSG00000033831 0 14.50519315 0 0 -23.72667448 7.11E-07 6.36E-05 Dpagt1 ENSMUSG00000032123 15.27613727 19.26762782 3.062320391 5.124780582 -2.022646938 1.02E-06 6.40E-05 Eif3s6-ps2 ENSMUSG00000091697 7.334065904 6.349912883 18.87502932 20.0695 1.561023108 1.42E-06 6.42E-05 Egfr ENSMUSG00000020122 59.4705344 51.11057331 104.1188933 99.54962999 0.931682717 1.86E-06 6.46E-05 Arl6ip1 ENSMUSG00000030654 90.4408127 98.54815779 50.19421514 36.3030864 -1.078043792 1.87E-06 6.46E-05 Ldlr ENSMUSG00000032193 15.96014342 17.40000638 69.34763723 33.29573013 1.667752678 1.60E-06 6.82E-05 Tanc2 ENSMUSG00000053580 99.06689022 108.6644406 206.261198 166.4786506 0.893568748 1.67E-06 6.82E-05 Jund ENSMUSG00000071076 94.77285163 127.1227658 195.4317195 235.7092195 1.012414526 2.17E-06 6.99E-05 Rad23a ENSMUSG00000003813 118.7510671 101.8164953 45.9069666 57.50801683 -1.040606755 2.05E-06 7.01E-05 Myo7a ENSMUSG00000030761 2.128019122 5.509483237 0 0.122749235 -5.933922288 8.16E-07 7.07E-05 Ciart ENSMUSG00000038550 6.612059416 7.314850625 0.668142631 1.135430428 -2.897256364 9.76E-07 7.64E-05 1700019N 19Rik ENSMUSG00000026931 3.648032781 4.202148232 0 0.030687309 -8.012431826 8.34E-07 7.78E-05 Adamts1 ENSMUSG00000022893 127.9471497 133.7216948 225.4146201 206.1880283 0.772823181 2.26E-06 7.98E-05 Pacsin3 ENSMUSG00000027257 42.9783862 33.92845609 15.89622676 9.635814986 -1.543476038 1.93E-06 8.03E-05 Arhgap42 ENSMUSG00000050730 145.6173085 142.1882453 72.02020775 81.07587004 -0.858611393 2.48E-06 8.23E-05 C1qtnf3 ENSMUSG00000058914 56.27850572 24.15457058 109.5475522 132.0168028 1.635686208 2.80E-06 8.23E-05 Il6 ENSMUSG00000025746 102.0309168 74.51809531 42.39921778 29.42912921 -1.250134699 2.68E-06 8.37E-05 Phlda3 ENSMUSG00000041801 35.41631825 40.52738517 16.42517301 16.01877523 -1.175358322 1.97E-06 8.40E-05 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
2610035D 17Rik ENSMUSG00000087259 24.89022366 20.29481961 7.516604597 3.621102447 -1.97367416 2.00E-06 8.45E-05 Nsdhl ENSMUSG00000031349 26.06823425 20.10805746 55.12176705 47.16639374 1.197163658 2.09E-06 8.45E-05 Fah ENSMUSG00000030630 16.30214649 17.71127662 36.07970207 36.85545796 1.152074992 2.37E-06 8.45E-05 Ythdc1 ENSMUSG00000035851 75.12667509 79.52954616 128.0885102 173.5981063 1.017870604 2.60E-06 8.45E-05 Ltf ENSMUSG00000032496 0 12.60644469 0 0 -23.52692849 8.81E-07 8.81E-05 Cgnl1 ENSMUSG00000032232 25.1942264 37.3213017 11.88737097 9.328941898 -1.507551837 2.35E-06 9.54E-05 Atic ENSMUSG00000026192 33.51630118 37.60144492 10.74596065 15.31296713 -1.394662538 2.51E-06 0.000100371 Rcan2 ENSMUSG00000039601 61.9405566 51.91987593 104.2580897 104.0913517 0.922513897 3.36E-06 0.000101814 Mir22hg ENSMUSG00000085148 124.1471156 111.5281268 227.5304051 187.0698349 0.864316335 3.19E-06 0.000107544 H2-D1 ENSMUSG00000073411 735.5726099 688.8099127 436.8260842 404.0904832 -0.709922175 3.65E-06 0.000109677 Fam168b ENSMUSG00000037503 27.28424518 29.13489441 62.41565743 50.35787386 1.049161589 3.93E-06 0.000110534 Myot ENSMUSG00000024471 45.60040977 36.48087205 17.28819057 9.81993884 -1.551444431 2.82E-06 0.000110976 Bid ENSMUSG00000004446 14.63013147 14.90984447 2.199302827 4.204161316 -2.151811769 1.98E-06 0.00011252 Mlh1 ENSMUSG00000032498 14.40212942 8.248661343 2.449856313 1.687801988 -2.404616756 1.99E-06 0.000113545 Sacs ENSMUSG00000048279 9.234082977 8.746693726 20.68458228 28.14026224 1.494682688 3.08E-06 0.000121388 Aurkb ENSMUSG00000020897 2.394021513 2.023256556 0 0 -8.631620398 1.74E-06 0.000123691 Ndufa4l2 ENSMUSG00000040280 119.0550698 106.610057 46.76998416 15.65052753 -1.810798916 4.36E-06 0.000128046 Trp53 ENSMUSG00000059552 124.755121 127.0916387 61.24640783 71.2559312 -0.874072781 4.34E-06 0.000134558 Plagl1 ENSMUSG00000019817 7.942071367 5.478356213 33.65768503 16.41771025 1.94556729 3.63E-06 0.000139394 Jmjd1c ENSMUSG00000037876 142.0832768 183.338171 275.7201923 298.955763 0.873619659 4.35E-06 0.000141432 Bgn ENSMUSG00000031375 70.45263309 68.41719861 115.3659609 120.815935 0.817765681 4.87E-06 0.000141432 Tnnt1 ENSMUSG00000064179 25.30822742 27.9520675 51.08507198 52.50598548 1.01147643 3.75E-06 0.000142761 Rnf217 ENSMUSG00000063760 14.40212942 14.6919553 32.57195325 30.84074542 1.17507793 3.83E-06 0.000146101 Chmp1a ENSMUSG00000000743 54.91049343 55.71737285 27.25465148 27.12758104 -0.973160475 4.42E-06 0.000146101 Sowahc ENSMUSG00000098188 42.21837937 38.16173135 81.98666866 69.23056882 0.961601219 4.78E-06 0.000146101 Pts ENSMUSG00000032067 31.80628581 37.41468277 14.83833426 14.45372248 -1.188997026 3.90E-06 0.000146583 Ldha ENSMUSG00000063229 418.2317582 462.0495433 247.8530768 263.880169 -0.73024369 4.86E-06 0.000155576 Rrp9 ENSMUSG00000041506 37.16433396 40.55851219 12.4441565 17.61451529 -1.31687229 4.23E-06 0.000155846 Snx1 ENSMUSG00000032382 225.8740297 181.2837874 95.15464634 111.7324916 -0.925337504 5.81E-06 0.000183859 Gas1 ENSMUSG00000052957 66.38659655 42.5195147 210.8825179 97.67770414 1.545923158 6.67E-06 0.000188069 Ruvbl2 ENSMUSG00000003868 104.8809425 96.55602825 56.73644507 45.53996637 -0.928374371 6.38E-06 0.000190713 Ppp2r1b ENSMUSG00000032058 40.7743664 40.86978243 19.12558281 18.50444725 -1.066318458 5.11E-06 0.000198494 Dag1 ENSMUSG00000039952 295.3766543 298.2280163 610.1255791 441.4676255 0.873871786 6.44E-06 0.000202391 Atp5b ENSMUSG00000025393 1637.320713 1534.780169 915.5502792 977.9124719 -0.692918432 5.87E-06 0.000205554 Socs2 ENSMUSG00000020027 112.7850135 98.1746335 39.39257594 55.88158946 -1.093707581 6.57E-06 0.000205554 Trank1 ENSMUSG00000062296 26.41023732 18.05367388 4.593480587 7.457016056 -1.831269524 3.90E-06 0.000205953 Galnt17 ENSMUSG00000034040 8.056072392 11.79714207 34.29798838 22.61654664 1.568279966 5.72E-06 0.000209807 Sec16b ENSMUSG00000026589 1.406012634 1.711986317 7.822836636 7.733201836 2.368793416 2.86E-06 0.000213043 Map4k4 ENSMUSG00000026074 21.6221943 24.68372998 62.41565743 42.04161316 1.222495813 5.88E-06 0.000223429 Frem1 ENSMUSG00000059049 26.41023732 18.86297651 49.05280482 50.72612157 1.190956012 5.95E-06 0.000223429 Iqgap2 ENSMUSG00000021676 53.88448421 59.17247251 22.41061741 28.63125918 -1.094073718 6.26E-06 0.000236432 Timp2 ENSMUSG00000017466 109.6309851 125.8154308 189.1957216 200.6643127 0.77992441 7.85E-06 0.000238648 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
Acad8 ENSMUSG00000031969 44.38439884 43.26656327 21.07433215 20.4070604 -1.028247257 6.89E-06 0.000242659 Pcdh7 ENSMUSG00000029108 16.98615264 19.20537377 43.40143173 34.52322248 1.156369002 6.87E-06 0.000244411 Foxs1 ENSMUSG00000074676 9.614086392 13.07335005 2.895284734 2.516359328 -2.015995272 3.98E-06 0.000246323 Gm27252 ENSMUSG00000098708 16.18814547 10.42755302 3.619105917 2.73117049 -2.018719157 5.22E-06 0.000271122 Tmem45a ENSMUSG00000022754 14.36412908 14.25617696 28.39606181 39.80143961 1.306418519 7.78E-06 0.000271122 Thbs2 ENSMUSG00000023885 89.37680314 84.75888618 196.2668978 135.4230941 0.977926669 9.04E-06 0.000271802 Orai3 ENSMUSG00000043964 21.12818986 23.43864902 9.103443345 7.180830276 -1.401990317 7.81E-06 0.000273872 Pcsk4 ENSMUSG00000020131 14.97213454 12.97996898 4.426444929 3.927975536 -1.691906691 7.61E-06 0.000278593 Pnrc1 ENSMUSG00000040128 121.9810961 84.72775916 176.835083 294.5981652 1.242892255 1.17E-05 0.000310362 Nostrin ENSMUSG00000034738 8.968080587 9.244726109 2.004427893 0.736495413 -2.683459972 6.29E-06 0.00031886 Arnt2 ENSMUSG00000015709 1.02600922 3.455099657 0 0 -8.647384849 3.90E-06 0.000326455 Gm15446 ENSMUSG00000090015 1.634014683 1.462970125 5.679212362 12.33629817 2.597483815 6.47E-06 0.000326455 Gm3571 ENSMUSG00000090610 3.914035172 3.112702394 13.47420972 11.01674389 1.852173855 6.73E-06 0.00034122 Gm43151 ENSMUSG00000106750 4.066036537 5.883007524 21.57543912 12.91935704 1.841403376 9.47E-06 0.000342451 Zfp948 ENSMUSG00000067931 41.38237186 39.09554207 67.53808427 91.54024237 1.03647659 1.19E-05 0.000349173 Asf1b ENSMUSG00000005470 11.8181062 6.972453362 1.364124538 1.933300459 -2.460228623 4.65E-06 0.000350012 Elavl1 ENSMUSG00000040028 44.91640362 29.75743488 68.7908517 116.5503991 1.365110768 1.44E-05 0.000350012 Erbin ENSMUSG00000021709 45.41040806 52.69805153 86.6358278 84.42078671 0.85361626 1.32E-05 0.000361492 Iqsec3 ENSMUSG00000040797 26.71424005 20.97961413 51.80889317 46.24577447 1.089884078 1.04E-05 0.000365821 Lamc1 ENSMUSG00000026478 75.84868158 82.01970808 158.2106071 121.4603685 0.874694686 1.36E-05 0.000369379 Hrct1 ENSMUSG00000071001 37.96234113 28.26333774 13.64124538 7.119455659 -1.627408409 1.12E-05 0.000377223 Sema6a ENSMUSG00000019647 102.714923 115.8859101 174.6357801 179.7048808 0.748885581 1.32E-05 0.000379687 Noc2l ENSMUSG00000095567 36.67032952 29.66405381 14.97753064 10.95536927 -1.306233093 1.10E-05 0.000386421 Esam ENSMUSG00000001946 40.05235991 36.57425313 18.40176162 12.30561086 -1.270677782 1.20E-05 0.000400477 Parp9 ENSMUSG00000022906 35.07431518 33.86620204 16.6757265 13.99341285 -1.118312259 1.42E-05 0.000414633 Plbd2 ENSMUSG00000029598 111.3790009 92.82078538 53.34005336 54.37791132 -0.872055531 1.55E-05 0.000414692 Osr2 ENSMUSG00000022330 29.37426396 37.78820706 59.047105 85.52552983 1.161023343 1.49E-05 0.000422746 Gm10801 ENSMUSG00000075015 0.646005805 1.587478221 10.74596065 5.615777524 2.915324578 5.97E-06 0.000422892 Tsc22d2 ENSMUSG00000027806 45.41040806 54.84581618 118.3169242 81.44411775 1.043875419 1.52E-05 0.000426426 Hspa12a ENSMUSG00000025092 65.58858938 67.51451492 36.49729121 25.83871407 -1.045201249 1.61E-05 0.000426566 B230311B 06Rik ENSMUSG00000109284 2.888025952 2.334526795 0.055678553 0 -6.458369744 5.31E-06 0.000429888 Insig1 ENSMUSG00000045294 14.59213112 13.29123922 27.83927629 35.35177982 1.233275008 1.26E-05 0.000429888 Gm6594 ENSMUSG00000073371 0 0 1.893070787 1.841238532 8.256432312 7.93E-06 0.000448228 Frmd6 ENSMUSG00000048285 118.5990657 113.115605 248.6604158 173.9970413 0.915539003 1.63E-05 0.000450763 Rpl30 ENSMUSG00000058600 170.2035294 177.5485445 96.68580654 104.4289121 -0.73796577 1.64E-05 0.000450763 Gm43136 ENSMUSG00000105541 0.760006829 0.186762144 4.315087824 6.628458717 3.598721693 7.52E-06 0.000452945 Tpm2 ENSMUSG00000028464 139.7652559 165.128862 89.78166602 66.4073364 -0.915037839 1.85E-05 0.000453252 Medag ENSMUSG00000029659 154.7373905 174.9650016 375.6353549 246.2349664 0.964154097 1.67E-05 0.000459466 Mettl22 ENSMUSG00000039345 61.10454909 64.09054229 28.22902615 33.84810169 -0.959391209 1.68E-05 0.000459466 Gm6249 ENSMUSG00000110101 7.448066928 6.194277764 1.336285262 0.889931957 -2.565248482 7.28E-06 0.00049911 Heca ENSMUSG00000039879 18.73416835 17.46226043 61.80319335 32.43648548 1.426988915 1.54E-05 0.000515511 Olfml2b ENSMUSG00000038463 36.70832986 41.55457696 101.0287336 63.46135475 1.119973719 2.03E-05 0.000517706 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
Gm6166 ENSMUSG00000074280 0.304002732 0.373524287 7.293890387 2.117424312 3.837005774 8.79E-06 0.000519672 Rtp4 ENSMUSG00000033355 24.92822401 34.67550467 8.76937203 12.52042202 -1.430580952 1.66E-05 0.000523728 Pes1 ENSMUSG00000020430 36.06232406 33.27478859 16.09110169 15.58915291 -1.079146498 1.65E-05 0.000549379 Tril ENSMUSG00000043496 1.330011951 1.431843101 10.60676426 5.278217126 2.570379947 8.60E-06 0.000556746 Gm11814 ENSMUSG00000084215 0.26600239 0.217889168 3.786141575 2.853919725 3.83238826 8.13E-06 0.000567429 Ccdc115 ENSMUSG00000042111 25.72623118 24.43471379 7.377408216 10.77124541 -1.413574022 1.72E-05 0.000567429 Wwtr1 ENSMUSG00000027803 78.20470275 90.1127343 166.6180686 128.6718861 0.860939578 2.27E-05 0.000568944 Trp53inp2 ENSMUSG00000038375 12.57811303 16.59070376 35.74563075 29.58256575 1.21363822 1.82E-05 0.000572941 Cab39 ENSMUSG00000036707 27.8542503 27.51628916 49.3033583 52.69010934 0.933101659 1.90E-05 0.000589724 Fosl2 ENSMUSG00000029135 133.4191989 183.4315521 336.9944394 251.1756231 0.943075204 2.29E-05 0.000601685 Fgfr4 ENSMUSG00000005320 131.8231846 152.8959416 260.0188405 212.1413662 0.780207049 2.58E-05 0.000604619 Arl4d ENSMUSG00000034936 291.9566235 280.4544857 179.758207 133.5204809 -0.820709221 2.53E-05 0.000625785 Arhgef2 ENSMUSG00000028059 65.81659143 69.19537421 154.9534118 102.6490482 0.98052717 2.75E-05 0.000642238 Ifi27l2a ENSMUSG00000079017 10.98209869 21.50877354 4.537802035 3.958662845 -1.881936353 2.00E-05 0.000646436 Cyp4b1 ENSMUSG00000028713 28.57625679 42.76853089 15.70135183 10.95536927 -1.36949864 2.20E-05 0.000662799 Csrp2 ENSMUSG00000020186 23.56021171 15.09660661 48.46818001 40.59930964 1.253160332 2.50E-05 0.000666039 Nop56 ENSMUSG00000027405 230.9660755 232.9546471 115.2546038 143.0335467 -0.791925702 2.72E-05 0.000666039 Pdlim1 ENSMUSG00000055044 57.07651289 59.07909143 30.06641839 17.49176606 -1.24035711 2.18E-05 0.000695242 Alpk1 ENSMUSG00000028028 5.472049172 4.295529303 17.70577972 12.33629817 1.670215334 2.38E-05 0.00069743 Dclk3 ENSMUSG00000032500 31.16028001 31.15815096 14.5599415 13.87066361 -1.08114956 2.49E-05 0.000751905 Mest ENSMUSG00000051855 8.170073416 4.544545495 17.00979781 23.47579129 1.724250174 2.66E-05 0.000773628 Slc7a7 ENSMUSG00000000958 16.83415127 18.92523055 5.818408744 6.966019114 -1.431477311 2.49E-05 0.000782836 Lix1 ENSMUSG00000047786 31.27428103 22.72272747 54.81553501 54.16310016 1.063576963 2.55E-05 0.000804561 Tead1 ENSMUSG00000055320 20.0641803 20.35707366 43.01168186 36.08827524 1.018764278 2.68E-05 0.000833861 C1s1 ENSMUSG00000038521 72.69465323 52.60467045 31.82029279 21.17424312 -1.19435616 3.33E-05 0.00084742 Celf2 ENSMUSG00000002107 118.6750664 106.672311 197.7423795 168.99501 0.752311891 3.42E-05 0.000862707 Tsc22d1 ENSMUSG00000022010 204.2898357 198.5904127 121.6019588 77.27064374 -0.97067091 3.42E-05 0.000866332 Mtap ENSMUSG00000062937 66.34859621 53.38284605 26.97625872 31.17830582 -0.990467503 3.71E-05 0.000882131 Srm ENSMUSG00000006442 186.619677 163.1367325 79.53681235 104.2141009 -0.875964373 3.94E-05 0.000883692 Matn2 ENSMUSG00000022324 26.14423493 25.46190558 51.36346475 44.15903747 0.938592078 3.44E-05 0.000887839 Il34 ENSMUSG00000031750 11.05809937 11.54812588 3.424230983 1.810551224 -2.061421332 1.75E-05 0.000894501 Gm3924 ENSMUSG00000116287 9.272083319 7.096961458 1.837392235 1.718489297 -2.152356182 1.78E-05 0.000910924 Gm48302 ENSMUSG00000113041 2.052018439 6.16315074 17.2603513 17.36901682 2.127718335 3.01E-05 0.000918937 Gm15666 ENSMUSG00000084399 1.634014683 1.680859293 7.683640255 7.119455659 2.209689084 1.28E-05 0.000926362 Lrmda ENSMUSG00000063458 0.760006829 0.560286431 3.619105917 6.628458717 3.014924007 1.71E-05 0.000926362 Zfp612 ENSMUSG00000044676 11.93210722 14.0382878 28.47957964 26.69795872 1.138195116 3.20E-05 0.00093509 Serpine2 ENSMUSG00000026249 74.06266553 70.50270922 41.98162864 35.01421942 -0.858902252 4.25E-05 0.00093509 Ednrb ENSMUSG00000022122 33.28829913 25.52415963 11.2749069 3.989350154 -1.902004306 3.32E-05 0.00096774 Manf ENSMUSG00000032575 66.31059587 69.13312017 113.7791222 104.1527263 0.737035923 4.18E-05 0.000968158 St6galnac 5 ENSMUSG00000039037 0 0.404651311 4.593480587 4.603096331 4.526696679 1.36E-05 0.000969205 Ccni ENSMUSG00000063015 43.66239235 48.18463306 83.01672188 73.15854435 0.816590114 4.22E-05 0.000971989 G530011 O06Rik ENSMUSG00000072844 0.152001366 0.249016191 3.424230983 2.639108563 3.957920711 1.53E-05 0.000976602 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
Tuft1 ENSMUSG00000005968 1.482013317 1.836494412 8.184747228 6.751207952 2.219107227 1.69E-05 0.000986359 Crem ENSMUSG00000063889 109.5549845 115.792529 168.8452107 252.0655551 0.956035457 3.62E-05 0.000986359 Rabif ENSMUSG00000042229 45.56240942 44.6050253 21.79815333 23.38372936 -0.94520217 3.56E-05 0.000997244 Ifitm3 ENSMUSG00000025492 1551.705944 1647.459996 977.604026 1042.601319 -0.611019544 4.47E-05 0.001016859 Clcn5 ENSMUSG00000004317 35.07431518 40.68302029 97.96641325 59.90162692 1.10753577 4.48E-05 0.001021629 Exosc4 ENSMUSG00000034259 49.40044391 43.92023078 18.93070787 24.18159939 -1.061731026 3.45E-05 0.001024305 Htatip2 ENSMUSG00000039745 30.13427079 27.01825678 11.44194255 13.25691743 -1.158622605 3.66E-05 0.001029147 Fras1 ENSMUSG00000034687 6.878061806 9.898393612 0.890856841 1.963987768 -2.50008511 2.53E-05 0.001044406 Epha4 ENSMUSG00000026235 2.85002561 8.279788367 26.19675898 17.86001376 2.035129346 3.69E-05 0.001044406 Tmem182 ENSMUSG00000079588 14.82013317 15.06547959 4.955391179 1.871925841 -2.083251063 3.67E-05 0.001073462 Mtfr1l ENSMUSG00000046671 163.8574724 143.3088182 81.48556169 92.03123931 -0.772373075 5.08E-05 0.00107498 Lgals1 ENSMUSG00000068220 767.0748929 737.3680701 1091.800737 1107.995974 0.599382532 4.73E-05 0.001109681 Igfbp5 ENSMUSG00000026185 219.9459764 234.1997281 466.530592 321.0199381 0.842984825 4.98E-05 0.001109681 Rock2 ENSMUSG00000020580 122.4751006 139.7914645 209.8246254 197.9024549 0.688038472 4.99E-05 0.001109681 Nap1l5 ENSMUSG00000055430 121.0690879 109.255854 175.1368871 189.86238 0.715750234 5.33E-05 0.001116559 Rora ENSMUSG00000032238 103.0949264 113.146732 183.6278664 159.3898823 0.716308213 4.79E-05 0.001118679 Ntn1 ENSMUSG00000020902 10.37409322 11.92165017 35.88482713 21.11286851 1.402002828 3.96E-05 0.001139726 Bmp1 ENSMUSG00000022098 30.70427591 34.51986955 92.23152233 51.61605353 1.188584618 5.15E-05 0.001139726 Ppp4r2 ENSMUSG00000052144 35.34031757 36.20072884 63.75194269 58.70482188 0.826276166 5.17E-05 0.001139726 Hs6st2 ENSMUSG00000062184 54.22648728 53.88087844 102.5598938 82.18061316 0.822763731 5.26E-05 0.001153152 Slc4a8 ENSMUSG00000023032 25.53622947 15.37674983 5.901926573 1.319554282 -2.460988892 4.38E-05 0.001154623 Hexim1 ENSMUSG00000048878 28.46225576 33.6794399 64.78199592 51.15574389 0.949823108 5.40E-05 0.001180117 Jpt2 ENSMUSG00000024165 27.62624825 30.34884834 6.430872822 12.61248395 -1.55047107 4.18E-05 0.001181604 Prkg1 ENSMUSG00000052920 6.802061123 6.038642644 1.336285262 0.981993884 -2.419132923 2.13E-05 0.001182402 Mmp11 ENSMUSG00000000901 13.90812498 13.69589053 5.122426837 3.436978594 -1.639726698 4.17E-05 0.001182402 Neo1 ENSMUSG00000032340 11.21010073 17.80465769 35.85698786 31.42380429 1.264651607 4.45E-05 0.001182402 Pan3 ENSMUSG00000029647 16.79615093 18.52057924 37.4438266 32.1602997 1.029260055 4.48E-05 0.001186068 Plxna2 ENSMUSG00000026640 37.05033293 25.7420488 66.06260263 58.7968838 1.041046562 5.29E-05 0.001211297 Ntn5 ENSMUSG00000070564 32.94629606 33.24366157 16.84276215 14.08547477 -1.047317658 5.27E-05 0.001235326 Retsat ENSMUSG00000056666 24.81422298 28.57460797 11.91521025 11.56911545 -1.133257675 4.45E-05 0.001246255 Vav3 ENSMUSG00000033721 19.38017415 13.22898517 37.02623746 34.70734634 1.187621436 4.74E-05 0.001246255 Mybpc1 ENSMUSG00000020061 45.71441079 34.86226681 77.78293794 69.59881653 0.920825716 6.59E-05 0.001246274 Pik3r1 ENSMUSG00000041417 172.4455496 175.3073988 102.0587869 108.1113892 -0.67468627 6.19E-05 0.001319088 Pgls ENSMUSG00000031807 73.64466177 73.8644278 41.25780746 41.58130352 -0.781029205 5.98E-05 0.001350193 Junb ENSMUSG00000052837 1478.821289 1548.818457 943.9741803 993.225439 -0.592229591 6.06E-05 0.001356453 Olfr558 ENSMUSG00000070423 24.51022025 15.75027411 6.82062269 2.301548166 -2.098468498 5.10E-05 0.001358094 Cd248 ENSMUSG00000056481 2.85002561 4.98032383 0.278392763 0 -4.751035766 2.45E-05 0.001379044 Tnfrsf21 ENSMUSG00000023915 33.02229674 31.53167525 16.17461952 10.92468196 -1.203363767 5.35E-05 0.001414196 Rtn4 ENSMUSG00000020458 51.45246235 67.17211766 120.0151201 93.47354283 0.898275865 7.25E-05 0.001439531 Rgs18 ENSMUSG00000026357 0.798007171 2.521288939 0 0 -8.214691571 3.18E-05 0.001440648 Bmp5 ENSMUSG00000032179 15.27613727 12.04615826 4.704837692 2.577733945 -1.859784751 3.78E-05 0.001449079 Ptp4a3 ENSMUSG00000059895 25.61223015 27.57854321 12.77822782 10.46437233 -1.143901794 5.62E-05 0.001458849 Timp4 ENSMUSG00000030317 7.980071709 17.18211721 56.01262389 26.08421254 1.754347683 5.80E-05 0.001483585 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
Ndrg2 ENSMUSG00000004558 464.0221697 404.0287707 227.7809586 273.7921698 -0.739314982 6.72E-05 0.001485065 Spout1 ENSMUSG00000039660 31.6162841 29.13489441 12.41631722 14.79128288 -1.106894488 5.84E-05 0.001506584 Pcdh18 ENSMUSG00000037892 32.68029367 35.32917217 60.66178303 55.57471637 0.82417554 7.98E-05 0.001561706 Ckm ENSMUSG00000030399 104.6529404 79.59180021 46.0183237 18.13619954 -1.478550084 7.29E-05 0.001600902 Hsd17b7 ENSMUSG00000026675 14.66813181 11.26798267 38.02845141 24.36572325 1.314205191 6.25E-05 0.001616937 Tec ENSMUSG00000029217 17.5941581 15.37674983 4.732676969 6.567084099 -1.492499951 6.26E-05 0.001619071 Suclg2 ENSMUSG00000061838 95.64685948 76.13670055 43.40143173 47.59601606 -0.865729553 8.39E-05 0.001626898 Gm13340 ENSMUSG00000083563 11.32410176 17.33775233 4.426444929 4.388285169 -1.648516418 4.41E-05 0.001629424 Clmn ENSMUSG00000021097 72.16264845 101.1939548 170.8496386 139.5351934 0.891606714 6.75E-05 0.001642182 Gm43359 ENSMUSG00000105434 5.472049172 5.883007524 19.82156472 12.36698548 1.551393732 6.79E-05 0.001667457 Met ENSMUSG00000009376 26.79024074 28.20108369 50.38909008 46.6753968 0.87067082 6.62E-05 0.001675305 Fry ENSMUSG00000056602 37.92434079 48.30914115 91.42418332 68.00307646 0.936598065 9.42E-05 0.001693724 Adamts9 ENSMUSG00000030022 8.132073075 8.279788367 17.70577972 20.34568578 1.265518674 6.71E-05 0.001711615 Srebf2 ENSMUSG00000022463 39.59635581 43.88910375 96.24037812 63.58410399 0.985568863 8.43E-05 0.001712917 Cyp20a1 ENSMUSG00000049439 84.47475909 81.17927843 45.99048442 48.60869726 -0.756737707 9.09E-05 0.00173357 Thbs4 ENSMUSG00000021702 6.346057026 18.39607115 58.60167658 29.45981652 1.881406218 6.68E-05 0.001744221 Il2rg ENSMUSG00000031304 7.22006488 6.16315074 1.447642367 0.644433486 -2.628241931 2.82E-05 0.00175093 Dnph1 ENSMUSG00000040658 28.80425884 25.6175407 11.60897821 12.64317126 -1.114664448 6.68E-05 0.001754646 Meiob ENSMUSG00000024155 3.040027318 1.836494412 0 0.030687309 -7.324237595 2.68E-05 0.001792287 Ears2 ENSMUSG00000030871 9.424084685 10.30304492 2.950963286 2.639108563 -1.768088207 4.93E-05 0.001802085 1190007I 07Rik ENSMUSG00000063320 11.59010415 11.26798267 2.394177761 3.713164374 -1.851234017 3.56E-05 0.00181383 Maf1 ENSMUSG00000022553 236.590126 205.438358 122.4371371 136.804023 -0.718392091 8.65E-05 0.001814849 Atp2b4 ENSMUSG00000026463 49.24844255 38.0994773 88.38970221 71.2559312 0.918926141 9.15E-05 0.001814849 Agtr1b ENSMUSG00000054988 1.672015025 1.276207981 0 0 -8.048671437 4.19E-05 0.001884542 Gucy1a1 ENSMUSG00000033910 61.59855352 61.00896692 27.36600859 8.040074925 -1.748615087 7.77E-05 0.001910043 Wdr83os ENSMUSG00000059355 61.10454909 69.00861207 36.38593411 35.72002753 -0.799915123 0.000102687 0.001913384 Atp6ap1 ENSMUSG00000019087 163.1734663 153.1138307 94.84841431 96.87983411 -0.670976845 9.31E-05 0.0019465 Aspn ENSMUSG00000021388 215.9559406 132.7567571 92.17584378 45.50927906 -1.297111465 9.94E-05 0.00207441 Bcar3 ENSMUSG00000028121 91.23881987 66.17605289 39.47609377 40.96755735 -0.918360291 0.000119684 0.002077723 Filip1l ENSMUSG00000043336 180.2736199 151.2462093 242.1738644 346.6745283 0.882025981 0.000102724 0.00213566 Cpne2 ENSMUSG00000034361 12.84411542 12.10841231 4.203730719 4.08141208 -1.539560196 6.09E-05 0.002178103 Igf1 ENSMUSG00000020053 9.994089807 5.696245381 17.90065465 27.80270184 1.596125688 9.00E-05 0.002206995 Hspd1 ENSMUSG00000025980 189.5077029 172.2258234 98.80159154 113.2054824 -0.718954717 9.54E-05 0.002207906 Cfap54 ENSMUSG00000020014 11.55210381 9.524869325 2.92312401 0.889931957 -2.420822019 6.40E-05 0.002274805 Zranb1 ENSMUSG00000030967 78.39470445 90.26836942 150.3320919 122.8719847 0.746243509 0.000125744 0.002300402 Chka ENSMUSG00000024843 19.64617654 32.96351835 55.06608849 55.23715597 1.121070705 9.71E-05 0.002300863 Rnd3 ENSMUSG00000017144 395.8495571 345.0119333 142.6206124 227.914643 -0.945444929 0.000116098 0.002379719 Gypc ENSMUSG00000090523 67.94461055 59.35923465 35.04964884 18.04413762 -1.215489896 0.000139668 0.002380834 Top1 ENSMUSG00000070544 150.4813522 177.1438932 250.8040401 248.2296415 0.659097589 0.000106409 0.002434116 Tmem229 a ENSMUSG00000048022 7.714069319 5.727372404 20.15563603 14.91403211 1.432967777 9.73E-05 0.002442686 Atf4 ENSMUSG00000042406 279.4165108 286.3686202 422.795089 397.5540865 0.586971525 0.000107466 0.002448486 Il33 ENSMUSG00000024810 9.576086051 16.901974 4.203730719 2.976668961 -1.830914199 7.15E-05 0.002500823 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
Cxcl5 ENSMUSG00000029371 0 0 0.612464078 2.577733945 8.038213641 6.13E-05 0.00252238 Ptprd ENSMUSG00000028399 44.9924043 42.86191196 75.91770643 67.7882653 0.760375657 0.000141443 0.002541399 Sat1 ENSMUSG00000025283 565.2930797 579.95871 791.4984641 1058.129097 0.745325939 0.000112707 0.002547554 Xist ENSMUSG00000086503 81.28273041 92.9764205 186.7458653 123.9153532 0.882957679 0.000144319 0.002582817 Ift81 ENSMUSG00000029469 36.78433054 38.8776529 57.59946264 92.12330124 1.039679027 0.000145865 0.002605333 Cadm1 ENSMUSG00000032076 27.20824449 45.72559816 61.58047914 105.5643425 1.254031858 0.000147356 0.002626791 Ubn2 ENSMUSG00000038538 34.50431006 38.41074754 59.77092619 61.896302 0.790500753 0.000140135 0.002651299 Zfp429 ENSMUSG00000078994 1.976017756 2.2100187 0 0.030687309 -7.10099336 6.22E-05 0.002655798 Ripk1 ENSMUSG00000021408 74.44266894 105.5828652 145.905647 165.9262791 0.846443786 0.000143337 0.002683432 Nudt4 ENSMUSG00000020029 37.46833669 44.16924697 99.63676983 61.03705735 1.025193874 0.00015157 0.002683432 Plac8 ENSMUSG00000029322 0.26600239 3.423972633 0 0 -8.363892346 6.60E-05 0.00274713 Fpgs ENSMUSG00000009566 18.39216527 17.08873614 7.850675913 5.677152142 -1.34159807 0.000124638 0.002792066 Tuba1b ENSMUSG00000023004 83.52475055 103.0927033 56.09614172 46.76745872 -0.808343646 0.000149789 0.002792066 Slfn2 ENSMUSG00000072620 2.58402322 4.918069782 0.278392763 0 -4.689767429 4.52E-05 0.002800641 Smpdl3b ENSMUSG00000028885 15.69414103 13.94490672 5.038909008 5.646464833 -1.420396034 8.37E-05 0.002800641 Gm28875 ENSMUSG00000100975 10.07009049 11.76601505 24.888313 21.4504289 1.135909287 0.000116813 0.002801894 Col5a2 ENSMUSG00000026042 40.16636093 38.97103397 74.85981393 60.1778127 0.820657423 0.000144536 0.002837055 Fxyd2 ENSMUSG00000059412 13.94612532 19.32988187 6.514390651 3.682477065 -1.656687518 8.62E-05 0.002863002 Luc7l2 ENSMUSG00000029823 58.93852962 74.30020614 131.095152 99.30413152 0.840329173 0.000165076 0.002869238 Pkp4 ENSMUSG00000026991 8.208073758 6.661183123 24.33152747 14.8833448 1.446967421 0.000119643 0.002876011 Mapk8 ENSMUSG00000021936 17.32815571 20.97961413 35.91266641 36.14964985 0.96325561 0.00012155 0.002887645 Gm48609 ENSMUSG00000113934 0 0 1.364124538 1.411616208 7.828891613 7.10E-05 0.002925115 Sfrp5 ENSMUSG00000018822 20.93818815 36.48087205 11.63681749 4.603096331 -1.773695555 0.000122546 0.002925115 Wwc2 ENSMUSG00000031563 15.3901383 18.67621436 35.88482713 30.53387233 1.013740343 0.000129042 0.002925115 Ints6 ENSMUSG00000035161 42.37038074 55.49948368 103.2558757 75.27596867 0.917271745 0.000159807 0.002925115 Map7d1 ENSMUSG00000028849 22.07819839 27.36065404 57.51594481 40.38449848 1.03506881 0.000124061 0.00294831 Pgam2 ENSMUSG00000020475 56.65850913 48.65153841 29.14772227 26.2683364 -0.876140524 0.000125047 0.002966129 Mep1b ENSMUSG00000024313 0 0 1.085731775 1.718489297 7.846526448 7.25E-05 0.002970639 Mrpl12 ENSMUSG00000039640 58.40652484 55.0014513 29.14772227 32.62060933 -0.82477318 0.000164109 0.002970639 Rps3a1 ENSMUSG00000028081 911.0201864 839.962741 539.2467817 581.4631285 -0.59227293 0.000174219 0.002970639 Trabd2b ENSMUSG00000070867 29.33626362 38.34849349 2.227142103 0.27618578 -4.714452064 0.000133228 0.002979288 Cp ENSMUSG00000003617 201.1738077 162.2963028 264.6401604 353.6405475 0.818927825 0.000167501 0.003006622 A930005H 10Rik ENSMUSG00000054426 5.206046782 6.412166931 13.52988827 16.01877523 1.398977052 0.000130536 0.003032814 Med8 ENSMUSG00000006392 41.34437152 38.13060432 18.29040452 21.32767967 -0.952394426 0.000130841 0.003032814 Sub1 ENSMUSG00000022205 291.0446153 298.6326677 422.7394104 423.4541751 0.572543119 0.000142548 0.003032814 Abca6 ENSMUSG00000044749 47.0064224 37.63257194 13.94747742 21.88005123 -1.187021798 0.000136268 0.003147038 Pdgfrb ENSMUSG00000024620 74.97467372 70.87623351 37.47166588 13.41035398 -1.475165257 0.00016872 0.003188861 Htra1 ENSMUSG00000006205 47.4624265 43.76459566 15.39511979 24.58053441 -1.136366391 0.000146735 0.003195203 Gsto1 ENSMUSG00000025068 118.3710637 139.168924 73.57920722 78.1605757 -0.710716441 0.000152773 0.003223395 Chd2 ENSMUSG00000078671 37.46833669 38.28623944 65.14390651 58.76619649 0.760588378 0.000193136 0.003226893 Neat1 ENSMUSG00000092274 85.88077172 128.9281331 231.4000645 166.6013999 0.940488044 0.000154933 0.003251665 Gls ENSMUSG00000026103 60.80054635 78.68911651 118.9572276 109.7991912 0.765391996 0.000184545 0.003251665 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
Nipal2 ENSMUSG00000038879 1.216010927 2.645797035 0.055678553 0.030687309 -5.420420388 8.23E-05 0.003265801 Mirg ENSMUSG00000097391 2.394021513 1.74311334 9.96646091 6.413647555 2.034908324 0.000102876 0.003265801 Ptgfr ENSMUSG00000028036 4.826043367 4.388910375 15.7291911 10.43368502 1.554282337 0.000142859 0.003265801 Hspb6 ENSMUSG00000036854 40.35636264 66.30056099 23.66338484 24.76465826 -1.085263083 0.000171313 0.003265801 Dmac2 ENSMUSG00000057229 27.32224552 20.51270877 10.71812137 9.390316515 -1.200615682 0.0001444 0.003268041 Gm5900 ENSMUSG00000094685 0.722006488 0.560286431 4.064534338 4.326910551 2.764826617 7.35E-05 0.003276945 Rhobtb3 ENSMUSG00000021589 13.87012464 12.54419065 26.5308303 25.74665215 1.036045979 0.000148695 0.003353023 Slc38a2 ENSMUSG00000022462 435.3699122 420.028061 595.9832267 642.4388113 0.585575202 0.000162218 0.003354479 H2-Q6 ENSMUSG00000073409 23.14220796 15.09660661 7.600122426 4.173474007 -1.653144544 0.000107601 0.003361388 Uckl1 ENSMUSG00000089917 36.70832986 36.16960182 18.70799366 18.74994572 -0.908918229 0.000152148 0.003446098 Dnajc15 ENSMUSG00000022013 37.43033635 34.83113979 58.96358717 60.36193655 0.774978833 0.000187861 0.003448275 Kcnj8 ENSMUSG00000030247 539.5668485 426.2845928 119.708888 43.88285169 -2.519054692 0.000212197 0.003456094 Lyzl4 ENSMUSG00000032530 0.912008195 1.805367388 0 0 -7.927629786 8.93E-05 0.003493421 Hspa9 ENSMUSG00000024359 302.3687171 290.2283712 198.0486115 180.5334381 -0.596003818 0.000195472 0.003568677 C1qbp ENSMUSG00000018446 222.682001 192.3650079 112.3871584 132.4464251 -0.709654845 0.000220648 0.003574453 Cdkn1a ENSMUSG00000023067 117.5350562 188.505257 262.4408575 276.8302133 0.871397926 0.000221822 0.003587051 Flnc ENSMUSG00000068699 50.04644972 73.36639542 149.329878 93.44285552 1.025631488 0.000223903 0.003614257 Blnk ENSMUSG00000061132 143.5652901 105.8007544 190.4763283 243.6265451 0.851539348 0.000200221 0.003629374 Lama2 ENSMUSG00000019899 100.0168988 91.73133954 154.3409477 137.7860168 0.657555022 0.000230996 0.003715495 Cd14 ENSMUSG00000051439 15.46613898 36.85439634 9.660228871 4.725845567 -1.81188684 0.000173948 0.00371933 Hopx ENSMUSG00000059325 24.96622435 23.37639498 11.44194255 5.799901377 -1.440232372 0.000175883 0.0037451 Fam198b ENSMUSG00000027955 3.87603483 6.256531811 12.61119216 16.23358639 1.562229262 0.000169522 0.003758207 Gm47585 ENSMUSG00000114104 3.078027659 3.050448346 9.548871766 9.513065751 1.688552224 8.98E-05 0.003876552 Ndn ENSMUSG00000033585 33.97230528 28.23221071 15.75703038 13.80928899 -1.023093635 0.000183023 0.003876552 Aatf ENSMUSG00000018697 107.2369636 119.683407 45.29450252 69.01575766 -0.934348463 0.000194453 0.003900921 Gipc1 ENSMUSG00000019433 37.16433396 35.17353705 15.53431617 19.54781575 -0.991537213 0.000189169 0.003902409 Idh3a ENSMUSG00000032279 191.8637241 159.2147274 87.49884537 109.8298785 -0.77911763 0.000222163 0.003936821 Ifrd2 ENSMUSG00000010048 17.82216015 17.36887936 5.150266113 7.825263763 -1.386081017 0.000196303 0.003959244 Dcun1d3 ENSMUSG00000048787 11.24810108 10.11628278 27.22681221 19.63987768 1.182467737 0.00018116 0.003967169 Actg1 ENSMUSG00000062825 439.8159522 398.0835091 240.3643115 278.4566407 -0.639608002 0.000252957 0.003990758 Zdhhc2 ENSMUSG00000039470 2.128019122 3.08157537 9.326157556 8.346948014 1.811794348 0.000132032 0.003994535 Rbpms2 ENSMUSG00000032387 9.576086051 7.875137056 2.644731247 1.595740061 -1.99206386 9.59E-05 0.004078632 Selenbp1 ENSMUSG00000068874 24.32021854 25.92881094 8.936407688 12.48973471 -1.176338518 0.000196008 0.00408683 Acta1 ENSMUSG00000031972 780.6790152 730.6757599 467.1708954 206.6176506 -1.120636249 0.000235667 0.004125539 Cspg5 ENSMUSG00000032482 0.076000683 0.031127024 2.199302827 1.503678135 5.191989624 0.000118661 0.004235571 Zfp275 ENSMUSG00000031365 20.44418371 22.59821938 38.13980851 38.02157569 0.874773979 0.000208921 0.004235571 Pde8b ENSMUSG00000021684 8.816079221 6.941326338 2.199302827 1.565052753 -2.015991123 9.55E-05 0.00427168 Isg15 ENSMUSG00000035692 3.230029025 2.676924059 12.4441565 7.610452601 1.812033488 0.000144161 0.00427168 Impa2 ENSMUSG00000024525 18.92417005 19.82791425 6.152480059 1.012681193 -2.392626834 0.000198625 0.00427168 Ints4 ENSMUSG00000025133 45.82841181 48.27801413 26.86490162 24.82603288 -0.813350669 0.000238228 0.00427168 Epdr1 ENSMUSG00000002808 128.1371514 115.9481642 73.41217157 74.84634634 -0.668236298 0.000246126 0.00427168 Atp5a1 ENSMUSG00000025428 753.9267748 794.2682698 525.9952861 503.7014879 -0.537087476 0.000260346 0.00427168 Hmbs ENSMUSG00000032126 68.74261772 45.04080364 24.60992024 29.0608815 -1.033498755 0.000260696 0.00427168 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
Cdh15 ENSMUSG00000031962 62.85256479 72.5570928 137.8044176 95.68302907 0.835232826 0.000276688 0.00427168 Gm32219 ENSMUSG00000113302 35.11231552 29.81968893 57.43242698 52.41392356 0.808831476 0.000301371 0.00434358 Fam110a ENSMUSG00000027459 7.676068977 12.13953934 1.72603513 0.122749235 -3.376016867 9.76E-05 0.00435187 Ncoa1 ENSMUSG00000020647 51.41446201 70.81397946 114.9205325 94.60897326 0.828734238 0.00028785 0.004410631 Ifi47 ENSMUSG00000078920 17.02415298 12.04615826 5.62353381 3.559727829 -1.614590122 0.000151277 0.004414466 Mcl1 ENSMUSG00000038612 260.6443422 309.433745 522.0699482 386.1077202 0.721700029 0.000278117 0.004495478 Atad3a ENSMUSG00000029036 56.8105105 57.67837536 32.043007 33.32641744 -0.756895356 0.000281208 0.004537794 Abhd11 ENSMUSG00000040532 101.8789155 96.18250397 62.2207825 57.4159549 -0.676728493 0.000266472 0.004562386 Syt17 ENSMUSG00000058420 3.040027318 2.676924059 9.855103805 8.193511469 1.709255452 0.000155333 0.00457441 Cct6a ENSMUSG00000029447 316.8848475 328.4834836 200.721182 215.5476575 -0.580557686 0.000271543 0.00460229 Sirt1 ENSMUSG00000020063 16.34014683 20.04580342 35.99618424 32.1602997 0.956332195 0.000223203 0.00463757 Sgta ENSMUSG00000004937 98.64888646 84.50986999 40.53398627 55.82021484 -0.873827803 0.000289835 0.004659655 Ccrl2 ENSMUSG00000043953 62.13055831 50.08338152 16.09110169 30.22699924 -1.222061293 0.000239317 0.00468304 Ctnnbl1 ENSMUSG00000027649 61.78855523 54.65905403 29.28691865 34.12428747 -0.825038005 0.000292262 0.00468304 Mesd ENSMUSG00000038503 99.598895 87.34242917 49.83230455 57.35458028 -0.750730367 0.000277442 0.004694972 Gm9825 ENSMUSG00000096403 0.494004439 0.311270239 16.17461952 0.429622324 4.404725098 9.69E-05 0.004751391 Zfp36l2 ENSMUSG00000045817 45.63841011 51.98212998 104.0353755 70.02843885 0.883285734 0.000299402 0.004751391 Aspscr1 ENSMUSG00000025142 19.98817961 22.53596533 9.604550319 9.574440369 -1.097127186 0.000242609 0.004779666 Gm31105 ENSMUSG00000109587 2.014018098 2.801432154 0.167035658 0.153436544 -3.85686304 0.000121184 0.004904485 Cys1 ENSMUSG00000062563 39.78635752 39.22005016 20.40618952 21.57317814 -0.860688253 0.00025157 0.004935906 Smarca5 ENSMUSG00000031715 45.52440908 58.86120227 92.09232595 80.9224335 0.780264426 0.000311631 0.004935906 Eif3d ENSMUSG00000016554 83.56275089 84.72775916 53.86899961 42.01092585 -0.761937197 0.000314195 0.004968349 Eif3b ENSMUSG00000056076 115.5970388 102.4390358 63.47354993 67.4200176 -0.684944261 0.000335704 0.004983652 Spta1 ENSMUSG00000026532 1.748015708 2.085510604 0.083517829 0 -5.440388776 0.000147394 0.004984102 Dlc1 ENSMUSG00000031523 56.96251187 58.08302667 32.96170312 17.36901682 -1.145573252 0.000259407 0.004984102 Slc5a5 ENSMUSG00000000792 2.394021513 2.801432154 0.22271421 0.184123853 -3.622291527 0.000120203 0.005013288 Tmem266 ENSMUSG00000032313 0.912008195 1.587478221 0 0 -7.807499205 0.000147256 0.005201445 Fbxo33 ENSMUSG00000035329 13.03411712 15.75027411 32.12652483 25.19428059 1.043701373 0.000265895 0.005201445 Aff3 ENSMUSG00000037138 10.18409151 13.38462029 4.12021289 3.621102447 -1.554683625 0.00015422 0.005205206 Gm47469 ENSMUSG00000113047 0.912008195 1.711986317 5.734890915 6.659146026 2.289085385 0.000145306 0.005234536 Stard10 ENSMUSG00000030688 8.01807205 7.626120865 16.56436939 18.38169802 1.211631608 0.000188489 0.005268975 Myo1g ENSMUSG00000020437 0.798007171 1.711986317 0 0 -7.812824419 0.00015859 0.00530192 Rrp1b ENSMUSG00000058392 53.96048489 46.9395521 29.48179359 21.48111621 -0.936661872 0.000265623 0.005323097 Gm37728 ENSMUSG00000103220 8.170073416 9.649377421 19.12558281 18.6578838 1.135458147 0.000287437 0.005339888 Myh13 ENSMUSG00000060180 0 0 3.006641839 0.245498471 8.044683899 0.000153801 0.005366312 Pdgfa ENSMUSG00000025856 21.35619191 27.60967023 51.69753606 39.95487615 0.954556648 0.000266497 0.005366312 Slc1a5 ENSMUSG00000001918 41.95237698 51.07944628 26.64218741 19.24094266 -0.969706007 0.000266863 0.005366312 Tuba8 ENSMUSG00000030137 3.838034489 3.828623944 0.417589144 0.613746177 -2.843051103 0.00013791 0.005393908 Carmn ENSMUSG00000097324 15.88414273 15.15886066 6.876301243 3.958662845 -1.470178808 0.000293434 0.005393908 Aco2 ENSMUSG00000022477 50.65445518 56.12202416 25.05534866 31.51586621 -0.863267465 0.000324299 0.005393908 Ier3 ENSMUSG00000003541 347.5891234 428.7747547 232.6806712 248.9047623 -0.635991381 0.000333422 0.005393908 Arl13b ENSMUSG00000022911 49.05844084 58.17640774 88.83513063 80.73830965 0.71234168 0.000375076 0.005399959 Lgr4 ENSMUSG00000050199 8.77807888 10.80107731 24.19233109 18.44307263 1.172372468 0.000275803 0.005430762 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
Pax7 ENSMUSG00000028736 187.6076858 254.0587694 426.3028378 309.9111323 0.787593707 0.000378175 0.005430762 Susd5 ENSMUSG00000086596 0 0.249016191 3.953177233 1.994675077 4.586244464 0.000137001 0.005542108 Tnks2 ENSMUSG00000024811 39.90035854 40.15386088 66.50803105 60.39262386 0.715360212 0.000390997 0.005593592 Nfil3 ENSMUSG00000056749 83.7527526 51.39071652 100.0265197 209.041948 1.247888702 0.00035137 0.005604315 Cct3 ENSMUSG00000001416 363.9672706 318.9586143 188.7502932 226.8405872 -0.66452521 0.000371273 0.005604315 Atp2a2 ENSMUSG00000029467 44.68840157 62.84546133 101.7525548 83.6842913 0.837340445 0.000394106 0.005611472 Ttc28 ENSMUSG00000033209 17.78415981 19.45438996 41.31348601 30.0735627 0.988198443 0.000291676 0.005736571 Qk ENSMUSG00000062078 106.3249554 113.0533509 182.5142953 150.1836896 0.650938315 0.000359081 0.005736571 Egr2 ENSMUSG00000037868 27.70224893 22.87836259 45.35018107 43.54529129 0.864252424 0.000296918 0.005755323 Prmt5 ENSMUSG00000023110 45.14440567 35.98283967 15.617834 22.15623701 -1.050182271 0.000352511 0.005755323 Zbtb20 ENSMUSG00000022708 712.1263992 669.9780632 1182.334064 904.4470544 0.643308764 0.000361574 0.005755323 Gm31718 ENSMUSG00000110697 0.912008195 1.525224173 0 0 -7.771252385 0.000171182 0.00580853 Cd24a ENSMUSG00000047139 32.14828888 33.99071014 17.03763709 7.886638381 -1.361164345 0.000301796 0.005871186 Igtp ENSMUSG00000078853 27.55024757 26.83149463 11.72033532 14.1775367 -1.018009742 0.000317604 0.005871186 Rasa1 ENSMUSG00000021549 37.24033464 38.7531448 74.664939 55.35990521 0.82417391 0.00037077 0.005871186 7-Mar ENSMUSG00000026977 68.1726126 65.64689348 99.91516259 102.9866086 0.651946946 0.00033322 0.005887941 Wbp2 ENSMUSG00000034341 85.95677241 78.15995711 51.61401823 44.86484557 -0.716419724 0.000378067 0.005952805 Rhbdd2 ENSMUSG00000039917 13.64212259 16.09267138 6.430872822 5.1861552 -1.305131932 0.000321721 0.005978039 Dst ENSMUSG00000026131 58.74852791 88.74314525 171.7404954 110.0446896 0.983836005 0.00033954 0.005978039 Selenok ENSMUSG00000042682 465.7321851 431.762949 614.858256 661.986627 0.560128512 0.000406806 0.005998983 Clock ENSMUSG00000029238 32.68029367 37.25904765 69.12492302 51.89223931 0.840725103 0.000386602 0.006049792 Deptor ENSMUSG00000022419 112.4430104 102.1588926 68.31758401 39.89350154 -0.94081025 0.000473185 0.006160927 Rnf187 ENSMUSG00000020496 19.72217722 21.07299521 31.59757858 56.12708793 1.16029362 0.000338053 0.006170458 Fam240a ENSMUSG00000096393 0 0 0.863017565 1.595740061 7.657870414 0.000185814 0.006189331 Clptm1l ENSMUSG00000021610 19.49417517 20.69947092 32.043007 46.18439985 1.014795701 0.000344807 0.006190016 Vmn1r181 ENSMUSG00000097425 0.190001707 0.342397263 2.282820655 3.559727829 3.50149528 0.000127481 0.006190072 Lrrn1 ENSMUSG00000034648 12.9201161 5.322721093 20.51754662 34.95284481 1.657269704 0.000327971 0.006190072 Ttc9 ENSMUSG00000042734 16.30214649 21.63328164 32.96170312 39.67869037 0.990443982 0.000346472 0.006190072 Ddx56 ENSMUSG00000004393 53.01047635 51.57747866 25.50077708 31.20899312 -0.830551335 0.000390236 0.006190072 Ppan ENSMUSG00000004100 40.28036196 40.27836898 21.74247478 22.00280046 -0.829517978 0.000326111 0.006200025 Popdc3 ENSMUSG00000019848 16.68214991 8.871201822 32.54411398 27.89476377 1.290739791 0.000342085 0.00624104 BC006965 ENSMUSG00000041674 0.342003073 4.762434662 0 0.061374618 -6.348919704 0.000168969 0.006259942 Nip7 ENSMUSG00000031917 109.4789838 106.5166759 44.4871635 68.03376377 -0.88658079 0.00040804 0.006269704 Adprhl2 ENSMUSG00000042558 25.68823083 24.52809486 12.97310275 11.13949312 -1.007986075 0.000349698 0.006277275 Npy4r ENSMUSG00000048337 2.31802083 1.213953934 0.055678553 0 -5.90336256 0.000195766 0.006290004 Mfap2 ENSMUSG00000060572 35.75832132 18.67621436 8.54665782 11.32361697 -1.403575361 0.000339033 0.006324981 1810026B 05Rik ENSMUSG00000101970 24.20621752 24.65260296 42.70544982 39.95487615 0.809529254 0.000355125 0.006346022 Svep1 ENSMUSG00000028369 9.386084343 11.61037993 28.89716878 18.47375994 1.222415563 0.000352764 0.006353264 Ap1s1 ENSMUSG00000004849 24.16821718 22.06905997 9.548871766 11.50774083 -1.082755065 0.000342585 0.006422267 Inpp4b ENSMUSG00000037940 30.66627557 26.36458928 14.30938801 6.628458717 -1.399656791 0.000356812 0.006422267 Dio3os ENSMUSG00000113581 3.116028001 2.894813226 0.250553487 0.368247706 -3.229955433 0.000168782 0.006430862 Arhgap10 ENSMUSG00000037148 12.50211234 16.03041733 6.096801507 4.050724771 -1.441329952 0.00034673 0.006437403 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
1500011B 03Rik ENSMUSG00000072694 8.398075465 8.404296463 17.2603513 18.19757416 1.129188586 0.000351783 0.006521517 Mtmr7 ENSMUSG00000039431 6.46005805 6.567802051 1.558999472 1.62642737 -1.980632179 0.000198897 0.006559173 Immp2l ENSMUSG00000056899 32.56629264 38.16173135 17.31602985 19.08750612 -0.905797453 0.000379874 0.006617486 Aff4 ENSMUSG00000049470 63.68857231 64.65082872 95.12680707 97.5242676 0.637608739 0.000442137 0.006662966 Gm47798 ENSMUSG00000114253 0 0 1.280606709 1.074055811 7.590078916 0.000219256 0.006702082 Fabp7 ENSMUSG00000019874 1.330011951 0.684794527 4.704837692 6.014712539 2.468680277 0.000178638 0.006726206 Tmem100 ENSMUSG00000069763 13.56612191 15.06547959 5.957605125 5.585090215 -1.259340686 0.000378595 0.006726206 Robo1 ENSMUSG00000022883 7.714069319 11.14347457 22.99524221 18.87269496 1.200971259 0.000368418 0.00673168 Gpr137b ENSMUSG00000021306 6.840061465 6.72343717 14.05883452 16.54045948 1.226250277 0.00040112 0.006795299 Cacna1d ENSMUSG00000015968 8.77807888 6.816818242 23.88609905 14.5150971 1.347809867 0.000405824 0.006855265 Myo1b ENSMUSG00000018417 86.10877377 81.58392974 51.05723271 24.64190903 -1.101519595 0.000551547 0.006855265 Nts ENSMUSG00000019890 0.646005805 1.805367388 0 0 -7.777849661 0.000215902 0.00685544 Map2 ENSMUSG00000015222 42.44638142 59.48374274 112.7212297 74.99978289 0.930708023 0.000488379 0.006865886 Gm9824 ENSMUSG00000095478 19.38017415 20.01467639 7.739318807 9.54375306 -1.136177336 0.000393597 0.006919136 Rgs2 ENSMUSG00000026360 53.77048318 43.45332542 77.50454518 79.35738075 0.740957877 0.000527742 0.006956427 Shmt2 ENSMUSG00000025403 38.15234284 34.30198038 20.57322518 16.35633563 -0.922687719 0.000408896 0.006988453 Naalad2 ENSMUSG00000043943 16.37814717 15.59463899 6.959819071 2.976668961 -1.6394033 0.000417717 0.006994306 Tmsb4x ENSMUSG00000049775 2030.434245 2312.239846 3319.889376 2858.799007 0.559594784 0.000485106 0.007113722 Dcdc2b ENSMUSG00000078552 1.178010586 1.120572862 0 0 -7.688775394 0.000226858 0.007130337 Azin1 ENSMUSG00000037458 76.68468909 83.91845654 119.7924059 117.133458 0.612442209 0.000517288 0.007165224 Gm48027 ENSMUSG00000113775 1.254011269 1.120572862 5.178105389 5.370279053 2.203769054 0.000203539 0.007194018 Galnt16 ENSMUSG00000021130 13.26211917 13.32236625 26.89274089 23.53716591 0.974210352 0.000398743 0.007209514 Gnb1 ENSMUSG00000029064 42.29438006 57.02470785 84.85411412 79.14256959 0.7753984 0.00049629 0.007274591 Grina ENSMUSG00000022564 117.0790521 123.0451256 71.04583308 78.37538686 -0.632166447 0.000537383 0.007400791 Cdk17 ENSMUSG00000020015 13.07211747 13.22898517 28.7579724 22.52448471 1.013103443 0.00041368 0.007436721 Fam3a ENSMUSG00000031399 19.6081762 18.76959543 8.212586504 9.052756118 -1.100714536 0.000430374 0.007436721 1190002N 15Rik ENSMUSG00000045414 18.62016732 18.30269008 41.0907718 28.87675765 0.971064284 0.000502977 0.007516032 Aldh3a1 ENSMUSG00000019102 71.51664265 72.65047387 36.274577 45.47859175 -0.765494525 0.000548458 0.007545281 Arhgap15 ENSMUSG00000049744 13.41412054 9.400361229 3.312873878 3.958662845 -1.598643463 0.000255071 0.007565204 Creb3l1 ENSMUSG00000027230 0.988008878 2.147764652 7.627961702 6.352272937 2.203877482 0.000208266 0.007584868 Mfap3l ENSMUSG00000031647 2.812025269 1.961002508 7.711479531 8.193511469 1.789553222 0.000306259 0.007646318 Kcne4 ENSMUSG00000047330 193.4217381 151.3707174 109.7424271 64.87297096 -0.935391604 0.000477133 0.007736269 Prmt3 ENSMUSG00000030505 66.1585945 51.32846247 28.25686543 34.09360016 -0.862513905 0.000569985 0.007749567 Tmc5 ENSMUSG00000030650 0.570005122 1.836494412 0 0 -7.750746288 0.000265401 0.007768384 Rasl12 ENSMUSG00000041696 21.12818986 25.11950832 10.07781802 3.375603976 -1.735598028 0.000317657 0.007768384 Sfxn1 ENSMUSG00000021474 68.59061636 63.77927205 37.55518371 40.4765604 -0.710900857 0.000580202 0.007855049 Fbln2 ENSMUSG00000064080 8.588077172 12.82433386 30.7624003 19.17956805 1.27057967 0.000471193 0.00792133 Pvr ENSMUSG00000040511 42.90238552 63.0633505 101.8639119 82.3033624 0.848697021 0.000589153 0.00795376 Dnaja1 ENSMUSG00000028410 253.9182817 245.3743297 340.279474 369.2297004 0.558740209 0.000500208 0.008030558 Sdhd ENSMUSG00000000171 273.982462 229.3439124 152.6149126 163.0723594 -0.6220628 0.000632218 0.008040968 St3gal1 ENSMUSG00000013846 3.800034147 6.132023716 14.83833426 12.0907997 1.488731547 0.000332417 0.008054188 Gm44639 ENSMUSG00000108521 2.31802083 4.855815734 12.75038854 10.74055811 1.761012887 0.000277952 0.008093754 bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
Gm21769 ENSMUSG00000110458 0.836007512 1.805367388 4.342927101 9.850626148 2.480589803 0.000236578 0.008104469 Rps13 ENSMUSG00000090862 272.7664511 302.6169267 182.0410276 193.9744794 -0.561403274 0.000641018 0.008107341 Rbpj-ps3 ENSMUSG00000079575 2.85002561 3.019321322 7.071176177 13.10348089 1.836731356 0.000237431 0.008111009 Serpine1 ENSMUSG00000037411 74.93667338 76.0744465 45.68425238 46.39921102 -0.662151662 0.000572288 0.008119848 Snhg20 ENSMUSG00000086859 41.4203722 40.74527433 23.2457957 22.70860857 -0.787190278 0.000569997 0.008280594 Dhodh ENSMUSG00000031730 19.22817278 19.73453318 9.715907424 5.707839451 -1.288417838 0.000518039 0.008289124 Mycbp2 ENSMUSG00000033004 59.73653679 65.98929075 94.18027167 93.13598243 0.626785759 0.000703436 0.008289124 2010111I 01Rik ENSMUSG00000021458 272.0064442 207.5549956 350.1624171 394.9763525 0.686692723 0.000591905 0.008295144 Ulk1 ENSMUSG00000029512 16.22614581 28.20108369 64.19737111 36.6406468 1.231748205 0.000486999 0.008452044 Ddost ENSMUSG00000028757 212.0039051 203.6952446 122.9660834 140.6706239 -0.604861396 0.000602561 0.008478527 Antxr2 ENSMUSG00000029338 74.4046686 61.04009394 142.7319695 93.74972861 0.851343353 0.000619595 0.008647268 Asb11 ENSMUSG00000031382 2.280020488 3.641861801 0.306232039 0.030687309 -4.077349777 0.000214616 0.008742556 Rtcb ENSMUSG00000001783 126.4651364 111.6837619 66.20179901 77.05583258 -0.681410819 0.000625781 0.008768912 Tinagl1 ENSMUSG00000028776 45.25840669 41.33668779 23.07876004 8.745883029 -1.399563944 0.000548783 0.008863928 Ephb1 ENSMUSG00000032537 2.926026293 2.427907867 9.660228871 7.487703365 1.729751684 0.000246396 0.008887937 Pdxk ENSMUSG00000032788 17.74615947 15.59463899 4.203730719 7.610452601 -1.442791077 0.000526208 0.008993384 Lsm6 ENSMUSG00000031683 167.3155035 142.8730399 224.0226563 230.5230643 0.6021224 0.000662186 0.009153312 Ltbp1 ENSMUSG00000001870 72.73265358 59.4214887 132.1530445 92.000552 0.810044286 0.000698456 0.009153312 Sparcl1 ENSMUSG00000029309 175.9035807 217.9202946 131.095152 81.90442738 -0.837751154 0.000704356 0.009210667 Stk32b ENSMUSG00000029123 0.304002732 0.840429646 5.512176705 2.976668961 2.930963385 0.000304998 0.009223379 Idh3g ENSMUSG00000002010 354.9611897 300.6247972 203.8948595 215.1487225 -0.594798746 0.000706984 0.009223379 2310061I 04Rik ENSMUSG00000050705 18.84816937 13.38462029 3.396391707 6.904644497 -1.59196928 0.000566711 0.009247866 Cln5 ENSMUSG00000022125 41.38237186 35.04902895 17.14899419 21.60386545 -0.927737315 0.00058009 0.009247866 Cul1 ENSMUSG00000029686 409.4916797 334.8022695 185.2703837 248.4444526 -0.72662461 0.000712234 0.009247866 Gas5 ENSMUSG00000053332 770.5709244 632.7501426 484.570443 380.8601904 -0.648976476 0.000753807 0.009247866 Ppl ENSMUSG00000039457 15.99814376 30.90913477 67.76079848 40.04693808 1.250506436 0.000553944 0.009300913 Tox3 ENSMUSG00000043668 0 0 1.642517301 0.675120795 7.562561979 0.000316702 0.009310566 Musk ENSMUSG00000057280 24.70022196 19.01861163 36.99839818 42.50192279 0.914489058 0.00058813 0.009320225 Cygb ENSMUSG00000020810 22.19219942 24.65260296 9.632389595 2.086737003 -1.955727388 0.000605174 0.009396646 Lbp ENSMUSG00000016024 32.11028854 35.111283 18.12336886 17.82932646 -0.851324706 0.000563266 0.00940658 Asb10 ENSMUSG00000038204 2.58402322 1.338462029 0.111357105 0 -5.069253557 0.000341254 0.009466432 Tmem222 ENSMUSG00000028857 77.55869694 55.37497558 37.52734443 34.86078288 -0.827501527 0.000831162 0.009466432 Fbxo9 ENSMUSG00000001366 48.1084323 47.68660067 28.6466153 26.05352523 -0.757675596 0.000568111 0.00954299 Nedd4l ENSMUSG00000024589 76.4186867 68.85297695 129.5918311 100.1326889 0.710178862 0.000629937 0.009613023 Hnrnph3 ENSMUSG00000020069 75.69668021 90.01935323 119.2634596 133.4591063 0.661706693 0.000632384 0.009624623 Nfib ENSMUSG00000008575 223.3660072 229.8730718 396.9880798 291.4373724 0.652126545 0.000752542 0.009624623 Ppox ENSMUSG00000062729 39.8623582 29.97532405 16.56436939 18.19757416 -0.955634394 0.000611852 0.009710731 Adsl ENSMUSG00000022407 88.4267946 67.42113385 30.73456102 47.53464145 -0.940522998 0.000876329 0.009892627 Ruvbl1 ENSMUSG00000030079 88.73079733 93.81685015 56.8199629 57.66145337 -0.621509192 0.000774184 0.009901005 Lamp1 ENSMUSG00000031447 53.31447908 55.99751606 72.77186821 150.3064389 1.086056355 0.000659098 0.009977991
bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
Supplemental Figure Captions
Figure S1. Functional Validation Myf6-CTAP Construct Used for ChIP-Seq Analysis. (a)
Western Blot analysis of myoblasts infected with a retrovirus containing Myf6-CTAP. (b)
Immunofluorescent analysis of myoblasts infected with a retrovirus containing Myf6-
CTAP showing nuclear localization of the recombinant MYF6 protein using an antibody
against FLAG (Monoclonal ANTI-FLAG M2 antibody, Sigma). (c) Transfection of Hela cells
with Myf6-CTAP construct shows exclusive nuclear localization of the ectopically
expressed MYF6-CTAP in Hela cells. (d) Dual luciferase assays showing the
transcriptional activity of MYF6-CTAP on a synthetic regulatory sequence containing a
trimeric canonical E-box motif (CAGCTG) spread over a 72bp stretch of a synthetic DNA.
The synthetic sequence was sub cloned into the pGL4.23[luc2/minP] luciferase vector
(Promega). Dual luciferase assays with Renilla/luciferase constructs were performed in
Cos7 cells and a vector containing the full-length mouse MyoD (Soleimani et al., 2012a)
was used as a positive control. Relative transcriptional activity of the MyoD and the
Myf6 constructs were measured with and without co-transfection of Cos7 cells with the
transcription factor E2-alpha (E47), a heterodimer of the myogenic regulatory factors
(MRFs).
Figure S2. Myf6 Regulates the Expression of Various Cytokine Genes (a) Colormap of
Myf5, MyoD and Myf6 peaks within 100kb of the Transcription Start Sites (TSS) of
cytokines ranging from zero (black) to six peaks (red) occupancy. Black indicates no
binding (i.e., zero peaks), red indicates up to six ChIP-Seq peaks. The onset of bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
differentiation coincides with increased binding of MRFs to the regulatory domains of
the cytokines genes. (b) Gene expression analysis of cytokines during a five day time
course of myogenic differentiation going from cycling myoblasts in growth media (Ham’s
F10 supplemented with 20% Fetal Bovine Serum, 1% penicillin/streptomycin, 2.5 ng/ml
basic Fibroblast Growth Factor) to terminally differentiated myocytes (2 days in
differentiation media, DMEM supplemented with 5% horse serum) to the post mitotic
multinucleated myotubes (5 days in differentiation media). Gene expression was
assayed in biological triplicate by microarray (Soleimani et al., 2018; Soleimani et al.,
2012a). Expression of each gene was averaged across three replicates and normalized to
mean zero and standard deviation of one. Expression values were then truncated at +/-3
for color display. Blue indicates lower than average expression, while red indicates
higher than average expression. (c) Distribution of Myf6 peaks within 100kb of the TSS
of the cytokines genes, similar to the analysis shown in “a”. (d) Color map of genes that
are up/down regulated in the whole muscle transcriptome (RNA-Seq) of hindlimb
muscles from Myf6-KO and WT counterparts. Differential expression is Log2 transformed
and truncated at +/-3. Color scale goes from blue (-3=lower than mean), to white
(0=mean) and finally to red (+3=higher than mean).
Figure S3. Myf6 is Dispensable for Muscle Development and Regeneration in Adult
Mice. (a-b) Immunofluorescent analysis of TA muscles from WT and Myf6-KO
counterparts stained with Laminin (LAMA1) and counterstained with DAPI. (c)
Quantification of the number of regenerating fibers (depicted by the presence of
centrally located myonuclei) between the WT and the Myf6-KO mice. (d) Quantification bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
of the number of myofibers per unit area (mm2) of the TA muscles between WT and
Myf6-KO counterparts. (e) Immunofluorescent analysis of TA muscle from WT and
Myf6-KO animals three weeks after CTX injury (see extended Materials and Methods)
stained with Laminin and counterstained with DAPI. (f) Quantification of the number of
regenerating myofibers (centrally located myonuclei) between WT and Myf6-KO
counterparts. (g) Quantification of the number of myofibers per unit area (mm2)
between WT and Myf6-KO counterparts. (n=4 animals per group were used. p values are
based on two tailed t-test. Error bars represent standard deviation).
Figure S4. Myf6-Knockout Mice Show a Reduced MuSC Pool.
(a) Representative FACS plots for the isolation of MuSCs from Myf6-KO and WT mice at
P21. The yellow population corresponds to the ITGA7+/CD31-/SCA1-/CD45-/CD11b-
population of MuSCs. (b) Quantification of the percentage of total FACS sorting events
corresponding to the MuSC population (number of ITGA+/ ITGA7+/CD31-/SCA1-/CD45-
/CD11b- events over the total number of FACS events) at P21. (c) Representative FACS
plots for the isolation of MuSCs from Myf6-KO and WT mice at 3 months. The yellow
population corresponds to the ITGA7+/CD31-/SCA1-/CD45-/CD11b- population of
MuSCs. (d) Quantification of the percentage of total FACS sorting events corresponding
to the MuSC population (number of ITGA+/ ITGA7+/CD31-/SCA1-/CD45-/CD11b- events
over the total number of FACS events) at 3 months. (e) Representative photos of SA-β-
galactosidase staining in Myf6-KO, WT and WT H2O2-treated cultured primary
myoblasts. As a positive control, primary myoblasts from WT mice were cultured and
treated with 20μM H2O2 for 15 minutes, and left in fresh media for 48 hours before bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
fixation (f) Quantification of the percentage of SA-β-Gal+ cells in Myf6-KO, WT and WT
H2O2-treated myoblasts. (g) Representative photos of staining for cleaved caspase 3 in
Myf6-KO, WT, and WT strausporine-treated cultured primary myoblasts. Primary
myoblasts from WT mice were cultured and treated with 3μM strausporine for 3 hours
and then fixed. (h) Quantification of the percentage of cleaved caspase3+ cells in Myf6-
KO, WT and WT strausporine-treated myoblasts.
Figure S5. Myf6 and MyoD Share a Vast Core Myogenic Genetic Network. (a)
Enrichment of Myf6 ChIP-Seq signal on the myosin heavy chain gene cluster and location
of Myf6 peaks. (b) Venn diagram showing genome-wide binding sites for MyoD and
Myf6 and their overlap in differentiated muscle cells. The overlap is defined as any
peaks that has any overlap between the two datasets (c) Gene Ontology (GO analysis)
using Genomic Regions Enrichment of Annotations Tool (GREAT) (McLean et al., 2010) of
genes associated with MyoD ChIP-Seq peaks in primary myotubes (Soleimani et al.,
2012a). (d) Similar analysis as in “c” for genes associated with MyoD/Myf6 common
peaks. The association rule is based on single nearest gene within 300kb of the peaks.
Within that window the number of peaks associated with more than one gene is
minimal for ChIP-Seq datasets. bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
Figure S1
a b WT (control) Myf6-HF
FLAG
GAPDH FLAG DAPI c
FLAG LAMININ MERGE
d ) 2 512
128
32
8
2
0.5 Relative luciferase activity (log Renilla + + + + + Promoter + + + + + MyoD-HF - + + - - E47-HF - - +- + Myf6-HF - -- + + bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
Figure S2
a Low High b Low High c Low High d Low High e Low High
CX3CL1 CCL1 CXCL12 SPP1 CCL11 CSF1 CSF1 CCL12 VEGFA VEGFA CCL17 IL18 IL7 CCL19 CX3CL1 CXCL12 CCL2 CCL5 CCL5 CCL20 IL7 IL18 CCL22 SPP1 CXCL13 CCL24 CCL17 CXCL1 CCL3 IL10 CXCL16 CCL4 TNFRSF11B CCL7 CCL5 IFNA2 CCL11 CCL7 CCL12 PF4 CX3CL1 IL1A CCL2 CXCL1 GPI1 PPBP CXCL10 MSTN THPO CXCL11 CTF1 CCL24 CXCL12 HC BMP2 CXCL13 TGFB2 LIF CXCL16 FGF21 TNFSF13B CXCL3 CCL2 EGF CXCL5 IL24 TNFSF10 CXCL9 IL5 IL15 PF4 IL13 IL16 PPBP TNFSF10 CNTF XCL1 IL21 GPI1 IL10 CSF2 MSTN IL11 CXCL11 TGFB2 IL12A CXCL16 IL12A IL12B ADIPOQ CXCL9 IL13 IL1RN ADIPOQ IL15 TNF BMP7 IL16 CD40LG BMP6 IL17A IL9 LTA IL17F CXCL13 CCL3 IL18 CCL1 IL2 IL1A CXCL9 BMP4 IL1B IL6 CCL22 IL1RN IL2 LTB IL2 XCL1 CTF1 IL21 LTA CXCL11 IL22 CXCL5 CCL12 IL23A PF4 TNF IL24 CSF3 FGF21 IL27 CCL3 NODAL IL3 IL23A CCL19 IL4 CCL4 IL27 IL5 LTB XCL1 IL6 CCL7 IL6 IL7 BMP6 MIF IL9 MIF CXCL10 IFNA2 IL12B IL11 IFNG FASL IL1B BMP2 THPO TNFSF11 BMP4 CXCL1 CCL17 BMP6 BMP2 CSF2 BMP7 IL27 TNFRSF11B CNTF TNFSF11 IL1RN CSF1 IL17A IL23A CSF2 CCL20 IL10 CSF3 CCL19 IFNA2 GPI1 IL12A CD40LG LIF BMP7 HC MSTN NODAL IL5 NODAL PPBP IL17F OSM CCL11 IL4 THPO IL22 CCL1 VEGFA OSM CCL4 CD40LG CD70 OSM CD70 LIF IL22 FASL CCL22 CXCL3 LTA CXCL3 IL3 LTB IL16 IL13 TNF CNTF IL9 TNFRSF11B BMP4 IL17A TNFSF10 CCL24 FASL TNFSF11 IL4 IFNG TNFSF13B IL3 CCL20 ADIPOQ IFNG IL12B CTF1 TNFSF13B CXCL5 HC IL17F IL1A MIF IL15 CD70 SPP1 CXCL10 IL24 TGFB2 IL1B IL21 EGF IL11 CSF3 FGF21 EGF WT WT Myf6-KO Myf6-KO Myf5 MBsMyoD MTsMyf6 MTs Myoblasts MyoD MBs Myoblasts Myotubes Myotubes Myf6 peaks 2d (DM) 5d (DM)Myf6 ChIP-Seq MyotubesMyotubes 2DM 5DM No Injury CTX Injury peaks 5d (DM) bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Figure S3
a b DAPI LAMININ DAPI LAMININ
WT Myf6-KO
c d
20 2 800 p=0.4375 p=0.4543
700 15 2 600 10 500
5 400
Number of centrally located located centrally Number of nuclei/mm 0 300
WT WT
Myf6-KO Myf6-KO
CTX e T A m uscl e h arve st ed 0 w eeks 8 w eeks 1 1 w eeks P up s bo rn f DAPI LAMININ g DAPI LAMININ
WT Myf6-KO
h 800 p=0.5839 i 2 1200 p=0.5152
600 1000 2 y located ll ylocated
400 800
200 600
0 400 Number of centra Number of nuclei/mm WT WT Myf6-KO Myf6-KO bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
Figure S4
p = 0 . 1 4 7 2 a b c 0 . 5 WT WT 0 . 4 2 50 2 50 + - - ITGA / Sca1 / C D 3 1 / 2 50 2 50 ITGA + / Sca1 - / C D 3 1 - / at P 2 1 ( x 1 , 0 0 0 ) - - ( x 1 , 0 0 0 ) ( x 1 , 0 0 0 ) - - ( x 1 , 0 0 0 ) C D 4 5 / C D 1 1 b C D 4 5 / C D 1 1 b 2 0 0 2 0 0 2 0 0 2 0 0 0 . 3
1 50 1 50 1 50 1 50 0 . 2 SSC - A SSC - A 1 0 0 1 0 0 SSC - A SSC - A 1 0 0 1 0 0 0 . 1
50 50 50 50 o f s o rt in g ev en t s 0 . 0 P ercen t age o f M uSC s / t o t al n um ber 2 3 4 5 WT 50 1 0 0 1 50 2 0 0 2 50 1 0 1 0 1 0 1 0 2 3 4 5 ( x 1 , 0 0 0 ) 50 1 0 0 1 50 2 0 0 2 50 1 0 1 0 1 0 1 0 FSC - A ( x 1 , 0 0 0 ) ( 6 4 0 n m - 6 7 0 / 3 0 ) A F6 4 7 FSC - A ( 6 4 0 n m - 6 7 0 / 3 0 ) A F6 4 7 M y f 6 - K O P 2 1 M yf 6 - K O M yf 6 - K O 3 m o n t h s d 0 . 2 0 p = 0 . 0 50 1 2 50 2 50 ITGA + / Sca1 - / C D 3 1 - / 2 50 2 50 ITGA + / Sca1 - / C D 3 1 - /
( x 1 , 0 0 0 ) ( x 1 , 0 0 0 ) - -
( x 1 , 0 0 0 ) - - ( x 1 , 0 0 0 ) C D 4 5 / C D 1 1 b C D 4 5 / C D 1 1 b 2 0 0 2 0 0 2 0 0 2 0 0 0 . 1 5
1 50 1 50 1 50 1 50 0 . 1 0 at 3 m o n t h s o f age SSC - A SSC - A SSC - A SSC1 - 0 A 0 1 0 0 1 0 0 1 0 0
50 50 50 50 0 . 0 5
2 3 4 5 50 1 0 0 1 50 2 0 0 2 50 1 0 1 0 1 0 1 0 2 3 4 5 0 . 0 0 ( x 1 , 0 0 0 ) 50 1 0 0 1 50 2 0 0 2 50 1 0 1 0 1 0 1 0 FSC - A ( x 1 , 0 0 0 ) ( 6 4 0 n m - 6 7 0 / 3 0 ) A F6 4 7 FSC - A ( 6 4 0 n m - 6 7 0 / 3 0 ) A F6 4 7 P ercen t age o f M uSC s / t o t al n um ber
o f s o rt in g ev en t s WT
M y f 6 - K O
100 e f W T + H 2 O 2 WT M y f 6 - K O + 80
60
40 m y o bl as t s p = 0 . 9 4 4 5 20
Percentage of SA-β-gal 0 0 2 2 g W T + St raus p o rin e WT M y f 6 - K O h WT W T + H M y f 6 - K O DAPI PAX7 DAPI PAX7 DAPI PAX7PAX7 120
100
80 p = 0 . 3 3 6 3 m y o bl as t s Cleaved MERGE Cleaved MERGE Cleaved MERGE + Caspase3 Caspase3 Caspase3 60
40 C as p as e3
P ercen t age o20 f cl eav ed
0
WT WT M y f 6 - K O + s t raus p o rin e bioRxiv preprint doi: https://doi.org/10.1101/691386; this version posted July 3, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Figure S5
a mm10 100 kb Scale 67,450,000 67,400,000 67,350,000 67,300,000 67,250,000 67,200,000 67,150,000 67,100,000 67,050,000 67,000,000 :chr11 _ 100 Myf6 ChIP-Seq depth
0 _ 100 Control ChIP-Seq depth
0 Location of Myf6 peaks
Myh8 Myh4 AK035006 Myh2 Mir6923 Myh3 Sco1 Tmem220 Myh13 Myh8 Myh4 Myh2 Myh3 Sco1 Tmem220 Myh8 Myh4 Myh1 Myh2 2310065F04Rik Myh3 AK018523 Tmem220 Myh8 Myh1 2310065F04Rik Adprm Myh8 Adprm Myh8 Myh8 Myh13 Myh8 Myh4 Myh2 Myh3 Myh8 Myh1
b Myf6 MyoD
6,356 6,529 7,230
c GO Biological process (MyoD targets) -log 10 (Binomial p value) Muscle structure development0 10 20 30 40 50 60 70 80 90 100 110 Cytoskeleton organization Muscle organ development
Striated muscle tissue development Muscle tissue development Actin cytoskeleton organization Skeletal muscle organ development Skeletal muscle tissue development
GO Biological process (MyoD/Myf6 common targets) d -log 10 (Binomial p value) 0 5 10 15 20 25 30 35 40 45 50 Muscle structure development Cytoskeleton organization Muscle organ development Muscle tissue development Striated muscle tissue development Actin cytoskeleton organization Skeletal muscle tissue development Heart development