Program and Abstracts
Total Page：16
File Type：pdf, Size：1020Kb
Load more
Recommended publications
-
Columbia College Columbia University in the City of New York
Columbia College Columbia University in the City of New York BULLETIN | 2011–2012 JULY 15, 2011 Directory of Services University Information (212) 854-1754 Columbia College On-Line http://www.college.columbia.edu/ ADDRESS INQUIRIES AS FOLLOWS: Financial Aid: Office of Financial Aid and Educational Financing Office of the Dean: Mailing address: Columbia College 100 Hamilton Hall 208 Hamilton Hall Mail Code 2802 Mail Code 2805 1130 Amersterdam Avenue 1130 Amersterdam Avenue New York, NY 10027 New York, NY 10027 Office location: 407 Alfred Lerner Hall telephone (212) 854-2441 telephone (212) 854-3711 Academic Success Programs (HEOP/NOP): Health Services: 403 Alfred Lerner Hall Health Services at Columbia Mail Code 2607 401 John Jay Hall 2920 Broadway Mail Code 3601 New York, NY 10027 519 West 114th Street telephone (212) 854-3514 New York, NY 10027 telephone (212) 854-7210 Admissions: http://www.health.columbia.edu/ Office of Undergraduate Admissions 212 Hamilton Hall Housing on Campus: Mail Code 2807 Residence Halls Assignment Office 1130 Amsterdam Avenue 111 Wallach Hall New York, NY 10027 Mail Code 4202 telephone (212) 854-2522 1116 Amsterdam Avenue http://www.studentaffairs.columbia.edu/admissions/ New York, NY 10027 (First-year, transfer, and visitor applications) telephone (212) 854-2775 http://www.columbia.edu/cu/reshalls/ Dining Services: 103 Wein Hall Housing off Campus: Mail Code 3701 Off-Campus Housing Assistance 411 West 116th Street 419 West 119th Street New York, NY 10027 New York, NY 10027 telephone (212) 854-6536 telephone -
Mccmb ’09 Ttcggtgatatccaggcggcgggcaatcatctt
TCAGAAAATGCGCTCCTGATGCACCCATACCGC TGCTTCCACGCGAGACTTGAGCTTCATTTTCTT CAGCATGTGCTTGACGTGCACTTTTACTGTGCT TTCGGTGATATCCAGGCGGCGGGCAATCATCTT GTTCGGCAAACCCTGGGCAATCAGCTTGAGAAT ATCGCGCTCGCGTGGGGTTAACTGGTTAACATC TCAGAAAATGCGCTCCTGATGCACCCATACCGC TGCTTCCACGCGAGACTTGAGCTTCATTTTCTT CAGCATGTGCTTGACGTGCACTTTTACTGTGCT MCCMB ’09 TTCGGTGATATCCAGGCGGCGGGCAATCATCTT POCEEDINGSR OF THE IN TERNATIONAL MSCOWCNFERENCEOO ONCMPUTATIONALO MLECULARBOLOGYOI July 20-23, 2009 Moscow, Russia Organizers ЕР И И Е Н И Ж Б Н И И О О И И Н Б Ф DepartmentofBioengineeringandBioinformatics О Т Р Е М Т Ь А Л ofM.V.LomonosovMoscowStateUniversity Т У И К К А И Ф 1930 BiologicalDepartment ofM.V.LomonosovMoscowStateUniversity У StateScientificCentreGosNIIGenetika Institutefor Information TrasnsmissionProblems,RAS The ScientificCouncil onBiophysicsRAS, EngelhardtInstituteofMolecular Biology Russian AcademyofSciences Sponsoredby Р И RussianFundofBasicResearch INRIA,France INRIA theFrenchNationalInstituteforResearch inComputerScienceandControl DepartmentofBioengineeringandBioinformatics ofM.V.LomonosovMoscowStateUniversity BiologicalDepartmentofM.V.LomonosovMoscowStateUniversity StateScientificCentreGosNIIGenetika InstituteforInformationTrasnsmissionProblems,Russian A cademyof S ciences TheScientificCouncilonBiophysics , RAS ussian cademyof ciences EngelhardtInstituteofMolecularBiology,Russian AcademyofSciences with financial support of RussianFundofBasicResearch INRIA,France (theFrenchNationalInstituteforResearchinComputerScienceandControl) POCEEDINGSR MCCMB ’09 Moscow, Russia July -
Download Program Guide
2011 C. elegans Meeting Organizing Committee Co-chairs: Oliver Hobert Columbia University Meera Sundaram University of Pennsylvania Organizing Committee: Raffi Aroian University of California, San Diego Ikue Mori Nagoya University Jean-Louis Bessereau INSERM Benjamin Podbilewicz Technion Israel Institute of Keith Blackwell Harvard Medical School Technology Andrew Chisholm University of California, San Diego Valerie Reinke Yale University Barbara Conradt Dartmouth Medical School Janet Richmond University of Illinois, Chicago Marie Anne Felix CNRS-Institut Jacques Monod Ann Rougvie University of Minnesota David Greenstein University of Minnesota Shai Shaham Rockefeller University Alla Grishok Columbia University Ahna Skop University of Wisconsin, Madison Craig Hunter Harvard University Ralf Sommer Max-Planck Institute for Bill Kelly Emory University Developmental Biology, Tuebingen Ed Kipreos University of Georgia Asako Sugimoto RIKEN, Kobe Todd Lamitina University of Pennsylvania Heidi Tissenbaum University of Massachusetts Chris Li City College of New York Medical School Sponsored by The Genetics Society of America 9650 Rockville Pike, Bethesda, MD 20814-3998 telephone: (301) 634-7300 fax: (301) 634-7079 e-mail: [email protected] Web site: http:/www.genetics-gsa.org Front cover design courtesy of Ahna Skop 1 Table of Contents Schedule of All Events.....................................................................................................................4 Maps University of California, Los Angeles, Campus .....................................................................7 -
The Destinies and Destinations Meeting Review of Rnas
View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Cell, Vol. 95, 451±460, November 13, 1998, Copyright 1998 by Cell Press The Destinies and Destinations Meeting Review of RNAs Tulle Hazelrigg GMC. Since Prospero is independently localized to the Department of Biological Sciences GMC, is prospero mRNA localization gratuitous? The Columbia University answer is no. While staufen mutants alone are not defec- New York, New York 10027 tive in GMC differentation, staufen is important for GMC fate, since staufen mutations enhance defects in GMC fate caused by hypomorphic prospero alleles. Thus, this The third biennial FASEB Summer Research Confer- binary cell fate decision appears to be controlled redun- ence, ªIntracellular RNA Sorting, Transport, and Local- dantly by localization of both prospero mRNA and Pros- ization,º was held June 6±11 in Snowmass, Colorado. pero to the GMC daughter cell. Topics included the biological functions of localized Early Embryonic Development RNAs, the nature of nuclear±cytoplasmic RNA transport, Several mRNAs are localized to the animal or vegetal the role of signaling pathways in RNA localization, the poles of the Xenopus oocyte, and some are implicated nature of cis-acting localization elements within RNAs, in axial patterning of the embryo (reviewed in Schnapp the proteins that bind these elements, and the cellular et al., 1997). Mary Lou King (University of Miami Medical mechanisms that achieve cytoplasmic transport and an- School) presented definitive evidence for an essential choring of RNAs to specific domains within cells. role of one vegetally localized mRNA, VegT mRNA, in early embryogenesis. -
One Hundred and First
COneO mm Hundred ENC andEM FirstENT SUNDAY, THE NINTEENTH OF MAY, TWO THOUSAND NINETEEN COMMENCEMENT PROGRAM PROCESSIONAL ... Selected Marches . The Manchester Pipe Band Daniel Pisowloski, Pipe Major Gordon Bell, Drum Sergeant CALL TO ORDER . Marc R. Forster Henry B. Plant Professor of History and College Marshal A CALL TO COMMUNITY . Angela Nzegwu Interim Director of Religious and Spiritual Programs AMERICA THE BEAUTIFUL ��������������������������������������������������������������������������������������������������� George Samuel Grotheer ’19 Constitution Brass Quintet REMARKS BY THE PRESIDENT . Katherine Bergeron President of the College SENIOR CLASS SPEAKER . Issraa Omayma Faiz ’19 PRESENTATION OF OAKES AND LOUISE AMES PRIZE . Jeffrey Cole Dean of the Faculty Professor of Anthropology PRESENTATION OF ANNA LORD STRAUSS MEDAL ���������������������������������������������������������������������� Jefferson A. Singer Dean of the College Faulk Foundation Professor of Psychology CONFERRING OF HONORARY DEGREES . President Bergeron Dean Jeff Cole DeFred G. Folts III ’82 Chair, Connecticut College Board of Trustees COMMENCEMENT ADDRESS . Martin Chalfie and Tulle Inger Hazelrigg CONFERRING OF DEGREES ���������������������������������������������������������������������������������������������������������������� President Bergeron Dean Singer Marina J. Melendez Associate Dean of the College; Dean for Juniors, Seniors and Transfers; Posse Coordinator Marc R. Forster ALUMNI ASSOCIATION WELCOME . Jamie Glanton Costello ’89 President, Board of -
ECWM 2000 Abstracts Platform Sessions WHSCAB Auditorium (10 Min
East Coast Worm Meeting 2000 ECWM 2000 Abstracts Platform Sessions WHSCAB Auditorium (10 min. presentation + 2 min. Q&A) Friday, June 9 7:00-8:48 p.m., Session 1 Andy Singson, Chair Two new cell-death genes and cell-corpse engulfment genes both contribute to cell killing Peter Reddien, Scott Cameron, Michael Huang, Bob Horvitz The cell-corpse engulfment protein CED-1 is a transmembrane receptor that recognizes cell corpses Zheng Zhou, Bob Horvitz Testing Functions of Phagocytosis Receptor Homologs in Cell Corpse Elimination and Gonadal Outgrowth Sambath Chung, Monica Driscoll Components of the cytoskeleton, involved in the biogenesis of membrane channels, interfere with mec-4(d)-induced cell death. Nektarios Tavernarakis, Shiliang Wang, Monica Driscoll Inhibition of touch cell fate in C. elegans Ji Wu, Anne Duggan, Martin Chalfie pag-3 and unc-3 interact to determine neural fates in the ventral cord, and their mammalian counterparts may similarly interact during blood cell development Scott Cameron, Brinda Prasad, Joan B. McDermott, Eric Aamodt, Randall R. Reed, Bob Horvitz Identification of sns-8, a serine/ threonine kinase, and additional genes required for the development of the AWB olfactory neurons. Anne Lanjuin, Piali Sengupta The bHLH transcription factors LIN-32 and HLH-2 specify multiple aspects of ray development in the C. elegans male tail Douglas S. Portman, Scott W. Emmons seu-1 Encodes Novel Nuclear Proteins Required for the Function of Ectopic UNC-5 D.C. Merz, H Zheng, A. Colavita, J.G. Culotti 8:48-9:10 p.m., BREAK 9:10-10:34 p.m., Session 2 Bill Kelly, Chair Molecular and genetic analyses of unc-69, a gene required for axon guidance Suzanne Tharin, Bruce Wightman, Nancy Tsung, Erika Hartwieg, Gian Garriga, Bob Horvitz, Michael Hengartner The C. -
Green Fluorescent Protein ISSN 0306-0012 Guest Editors: Jeremy Sanders and Sophie Jackson TUTORIAL REVIEW HIGHLIGHT Wolf B
Chemical Society Reviews www.rsc.org/chemsocrev Volume 38 | Number 10 | October 2009 | Pages 2813–2968 Themed issue: Green fluorescent protein ISSN 0306-0012 Guest editors: Jeremy Sanders and Sophie Jackson TUTORIAL REVIEW HIGHLIGHT Wolf B. Frommer, Michael W. Davidson Marc Zimmer and Robert E. Campbell GFP: from jelly"sh to the Nobel prize Genetically encoded biosensors based and beyond on engineered !uorescent proteins 0306-0012(2009)38:10;1-Q This article was published as part of the 2009 Green Fluorescent Protein issue Reviewing the latest developments in the science of green fluorescent protein Guest Editors Dr Sophie Jackson and Professor Jeremy Sanders All authors contributed to this issue in honour of the 2008 Nobel Prize winners in Chemistry, Professors Osamu Shimomura, Martin Chalfie and Roger Y. Tsien Please take a look at the issue 10 table of contents to access the other reviews HIGHLIGHT www.rsc.org/csr | Chemical Society Reviews GFP: from jellyfish to the Nobel prize and beyondw Marc Zimmer DOI: 10.1039/b904023d On December 10, 2008 Osamu Shimomura, Martin Chalfie and Roger Tsien were awarded the Nobel Prize in Chemistry for ‘‘the discovery and development of the green fluorescent protein, GFP’’. The path taken by this jellyfish protein to become one of the most useful tools in modern science and medicine is described. Osamu Shimomura painstakingly isolated GFP from hundreds of thousands of jellyfish, characterized the chromophore and elucidated the mechanism of Aequorean bioluminescence. Martin Chalfie expressed the protein in E. coli and C. elegans, and Roger Tsien developed a palette of fluorescent proteins that could be used in a myriad of applications. -
142 POSTERS: Cell Division and Growth Control
142 POSTERS: Cell Division and Growth Control 157A An expression-based approach to identifying factors that mediate cell competition. Claire de la Cova, Laura A. Johnston. Genetics and Development, Columbia University, New York, NY. Cell competition is a process that results in elimination of “losing” cells and survival of “winning” cells within growing organs of both vertebrates and Drosophila melanogaster. In a mosaic Drosophila wing imaginal disc, cells expressing high levels of dMyc compete against and eliminate their neighbors with lower dMyc levels. “Losing” cells die frequently and their competitive elimination requires the pro-apoptotic gene hid. Because little is known about the signal that kills “losing” cells, and no biological markers specific to cell competition exist, we sought to better characterize “winning” and “losing” cells using a gene expression approach. We have generated and isolated competing cell populations from the wing imaginal disc and used gene expression microarrays identify mRNA expression changes in “winning” dMyc cells and wildtype “losing” cells. A large number of significant expression changes occur in dMyc-expressing cells (750 genes at ≥1.5-fold). On the other hand, when growing near dMyc-expressing cells, wildtype “losing” cells display a comparably small number of significant expression changes (58 genes at ≥1.5-fold). We have selected several candidate genes whose expression levels are altered in “losing” cells and used a simple clonal assay of cell competition in the wing imaginal disc to explore their roles in the competitive process. We find that some of our candidate genes contribute to the cell death or to the growth disadvantage of “losing” cells, while others are required for the survival of dMyc- expressing “winning” cells. -
2017-2018 General Studies Academic Policies
The Major ........................................................ 37 TABLE OF Declaring a Major or Concentration ............ 38 Electives ............................................................ 41 CONTENTS Transfer Credit ................................................. 42 Under Construction .................................... 44 General Studies ..................................................................... 4 Majors and Concentrations ..................................... 44 GS Undergraduates ......................................................... 4 Declaring a Major ............................................. 38 Evening Courses ....................................................... 4 African-American Studies .................................. 48 Key to Course Listings ........................................ 4 American Studies .............................................. 49 Newly Approved Courses .............................. 5 Ancient Studies ................................................. 51 Summer Courses ......................................... 11 Anthropology .................................................... 52 History and Philosophy of Science .............. 11 Applied Mathematics ........................................ 55 Colloquia, Interdepartmental Seminars, and Professional School Offerings ...................... 12 Archaeology ...................................................... 60 Degree Fulfillment .................................................. 12 Architecture ..................................................... -
Enhancer Interactions in Developmental Gene Regulation
Enhancer Interactions in Developmental Gene Regulation The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Biette, Kelly Marie. 2019. Enhancer Interactions in Developmental Gene Regulation. Doctoral dissertation, Harvard University, Graduate School of Arts & Sciences. Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:42029813 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Enhancer Interactions in Developmental Gene Regulation A dissertation presented by Kelly Marie Biette to The Division of Medical Sciences in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the subject of Biological and Biomedical Sciences Harvard University Cambridge, Massachusetts May 2019! © 2019 Kelly Marie Biette All rights reserved.! Dissertation Advisor: Dr. Angela DePace Kelly Marie Biette Enhancer Interactions in Developmental Gene Regulation Abstract When and where a gene is expressed during development is a critical determinant of cell identity and transcriptional mis-regulation is a common driver of diverse disease states. The spatial and temporal expression of animal genes is controlled by enhancers, sequences of DNA that are bound by transcription factors (TFs) and direct the pattern, timing, and level of gene expression. Many developmental genes are surrounded by multiple enhancers, each of which directs a subset of the overall gene expression pattern, allowing the gene to be turned on at different stages or in different tissues throughout the lifetime of the organism. -
Profile of Martin Chalfie
PROFILE Profile of Martin Chalfie espite having a bad reputa- tion, cholesterol is an essen- tial component of the plasma membranes of animal cells, Dwhere it is thought to modulate the properties of the lipid bilayer. Choles- terol can also bind directly to proteins in the membrane. In his Inaugural Article published in 2006, Martin Chalfie, the William R. Kenan, Jr., Professor of Bio- logical Sciences at Columbia University (New York), in collaboration with Thomas Benzing (University of Cologne, Germany), identified a new class of cholesterol-binding proteins among the prohibitin (PHB)-domain protein family (1). PHB-domain proteins appear to regulate a variety of membrane func- tions, from cell signaling to mech- anosensation. Studying two members of the family, MEC-2 and Podocin, Chalfie, Benzing, and their colleagues found that cholesterol is crucial for the activity of two different classes of channel proteins to which the PHB-domain proteins bind. They suggest that the binding of choles- terol by the PHB-proteins alters the lo- cal lipid environment of associated membrane proteins and changes their activity. Questioning Research Chalfie, born in 1947 and elected to the National Academy of Sciences in 2004, grew up in Chicago. As a child, all ele- Martin Chalfie ments of science interested him, but he feels his early activities were somewhat Hastings provided Chalfie with one of Chalfie took a series of short-term jobs, mundane. ‘‘Unfortunately, I did not have including a stint selling dresses for his that real indicator of a career in science his fondest memories of Harvard. ‘‘I parents’ dress manufacturing business in that many of my friends have. -
Andrew Martens 04/07/08 the Use of Terminators and Anti
Andrew Martens 04/07/08 The Use of Terminators and Anti-Terminators to Expand the Two-Spatula Burnt-Pancake Problem in Escherichia coli Honors Thesis Davidson College First Reader: Dr. Campbell Second Reader: Dr. Wessner Abstract The emerging field of synthetic biology provides a new experimental approach to biological research by allowing for the design and implementation of novel genetic systems. In 2006, a joint effort by researchers from Davidson College and Missouri Western State University developed a bacterial system that uses the Salmonella Hin/hix DNA recombination mechanism to solve in vivo the two-spatula, burnt-pancake mathematical problem. The problem asks to calculate the least number of flips required to sort a given stack of pancakes with two spatulas, from largest to smallest and with all golden sides facing up, assuming that each pancake is burnt on one side and golden on the other. The system worked as a proof-of-concept for using bacteria to solve mathematical problems in vivo, but was limited to pancake stacks with 3 pancakes. A new system that uses transcription anti-terminators could potentially extend the size of the problem, allowing for many more pancakes per stack. I developed a way to use the naturally occurring E. coli trp operon anti-terminator, downstream of the pLac promoter, to control GFP gene expression in tryptophan-rich and tryptophan-poor conditions. RNA tertiary structure computer simulations were used to predict if the anti-terminator sequence could be modified to accommodate Hin-mediated flipping. The success of using an anti-terminator could enable synthetic biologists to design hundreds of anti-terminators that would allow bacteria to solve burnt-pancake problems that were exponentially more difficult.