DOCSLIB.ORG

Mccmb ’09 Ttcggtgatatccaggcggcgggcaatcatctt

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mccmb ’09 Ttcggtgatatccaggcggcgggcaatcatctt TCAGAAAATGCGCTCCTGATGCACCCATACCGC TGCTTCCACGCGAGACTTGAGCTTCATTTTCTT CAGCATGTGCTTGACGTGCACTTTTACTGTGCT TTCGGTGATATCCAGGCGGCGGGCAATCATCTT GTTCGGCAAACCCTGGGCAATCAGCTTGAGAAT ATCGCGCTCGCGTGGGGTTAACTGGTTAACATC TCAGAAAATGCGCTCCTGATGCACCCATACCGC TGCTTCCACGCGAGACTTGAGCTTCATTTTCTT CAGCATGTGCTTGACGTGCACTTTTACTGTGCT MCCMB ’09 TTCGGTGATATCCAGGCGGCGGGCAATCATCTT POCEEDINGSR OF THE IN TERNATIONAL MSCOWCNFERENCEOO ONCMPUTATIONALO MLECULARBOLOGYOI July 20-23, 2009 Moscow, Russia Organizers ЕР И И Е Н И Ж Б Н И И О О И И Н Б Ф DepartmentofBioengineeringandBioinformatics О Т Р Е М Т Ь А Л ofM.V.LomonosovMoscowStateUniversity Т У И К К А И Ф 1930 BiologicalDepartment ofM.V.LomonosovMoscowStateUniversity У StateScientificCentreGosNIIGenetika Institutefor Information TrasnsmissionProblems,RAS The ScientificCouncil onBiophysicsRAS, EngelhardtInstituteofMolecular Biology Russian AcademyofSciences Sponsoredby Р И RussianFundofBasicResearch INRIA,France INRIA theFrenchNationalInstituteforResearch inComputerScienceandControl DepartmentofBioengineeringandBioinformatics ofM.V.LomonosovMoscowStateUniversity BiologicalDepartmentofM.V.LomonosovMoscowStateUniversity StateScientificCentreGosNIIGenetika InstituteforInformationTrasnsmissionProblems,Russian A cademyof S ciences TheScientificCouncilonBiophysics , RAS ussian cademyof ciences EngelhardtInstituteofMolecularBiology,Russian AcademyofSciences with financial support of RussianFundofBasicResearch INRIA,France (theFrenchNationalInstituteforResearchinComputerScienceandControl) POCEEDINGSR MCCMB ’09 Moscow, Russia July 20-23, 2009 4-TH MOSCOW CONFERENCE ON COMPUTATIONAL MOLECULAR BIOLOGY July 20–23, 2009 NEW METHOD TO IMPROVE ERROR PROBABILITY ESTIMATION APPLIED TO ILLUMINA SEQUENCING IRINA ABNIZOVA 1, TOM SKELLY 1, YUMI YAN 1, TONY COX 1 The new short read sequencing technique introduced new technological and computational challenges. It requires reconsideration of well-known error estimation algorithms, taking into account different sequencing platforms. 1 Wellcome Trust Sanger Institute, Hinxton, United Kingdom, [email protected] 1 4-TH MOSCOW CONFERENCE ON COMPUTATIONAL MOLECULAR BIOLOGY July 20–23, 2009 DETECTION OF GENES THAT UNDERWENT POSITIVE SELECTION IN DEEP-SEA ARCHAEBACTERIA OF PYROCOCCUS GENUS K.V. GUNBIN 1, D.A. AFONNIKOV 2, N.A.KOLCHANOV 2 Pressure is an environmental parameter of crucial importance for organisms. Archaeal species of the Pyrococcus genus live under both normal (~0,1MPa) and high pressures (>10MPa). To date, the genomes of three Pyrococcus species have been completely sequenced: P. furiosus bacteria live under normal pressure, whereas P. horikoshii and P. аbyssi are piezophilic (live in deep sea environment under high pressure at 14MPa and 20MPa, respectively). In this work we analyze the rate of nucleotide substitution in search for genes underwent positive selection in deep-sea species of Pyrococcus genus. A phylogenetic analysis was performed to determine the evolutionary relatedness of the piezophilic species of the Pyrococcus genus and T. kodekaraensis as outgroup. The analysis of phylogenetic tree demonstrates that piezophilic species have a common origin and the ancestor of piezophilic species emerged from archaebacteria phylogenetically close to the extant species of Pyrococcus genus inhabiting in normal pressure environments. Events of positive selection (PS) for adaptation of life under high pressure were searched for the set of 508 homologous genes which protein sequences are close homologs (amino acid sequence identity greater than 40%) and have no paralogs in genomes. We reconstructed genes and proteins of the most recent ancestor of piezophilic species of the Pyrococcus genus and the common ancestor of P. furiosus, P. horikoshii and P. аbyssi species. Reconstructed ancestral sequence of genes and proteins were compared with extant sequences using nonsynonymous to synonymous substitution rate ratio, radical to conservative amino acid replacement rate ratio, also amino acid dissimilarity measures. We use ArCOG functional classification of analyzed genes and demonstrated that positive selection events occurred in genes and proteins of ‘Coenzyme transport and metabolism’ and ‘Energy production and conversion’ functional groups (Table 1). The results suggest 1 Institute of Cytology and genetics SB RAS, [email protected] 2 Institute of Cytology and genetics SB RAS, Novosibirsk State University [email protected]; [email protected] 2 4-TH MOSCOW CONFERENCE ON COMPUTATIONAL MOLECULAR BIOLOGY July 20–23, 2009 that genes of these functional classes may be important for adaptation of piezophilic Pyrococcus species to deep-sea environment. Table 1. ArCOG group enrichment in the full set of analyzed genes and in genes with identified positive selection events. Last column represents the probablilty of difference in number of genes in full and PS sets observed by chance according to Monte Carlo shuffling test with 105 replicas. ArCOG groups with statistical significant difference (p<0.05) shown in bold. ArCOG group Number Number ppp-p---valuevalue of observing in full in PS by random chance dataset group Amino acid transport and metabolism 34 8 0.18225 Carbohydrate transport and metabolism 22 2 0.90471 Cell cycle control; cell division; chromosome partitioning 8 0 * Cell motility 7 2 0.32479 Cell wall/membrane/envelope biogenesis 13 1 0.90748 Coenzyme transport and metabolism 15 6 0.02416 Defense mechanisms 3 0 * Energy production and conversion 33 11 0.01072 Inorganic ion transport and metabolism 16 0 * Intracellular trafficking; secretion; and vesicular transport 6 0 * Lipid transport and metabolism 5 0 * Nucleotide transport and metabolism 24 5 0.36181 Posttranslational modification; protein turnover; chaperones 18 4 0.34395 Replication; recombination and repair 24 4 0.58199 Secondary metabolites biosynthesis; transport and catabolism 5 1 0.59636 Signal transduction mechanisms 3 1 0.42142 Transcription 28 4 0.70909 Translation; ribosomal structure and biogenesis 76 14 0.36997 Function unknown 87 6 0.99903 General function prediction only 75 14 0.34782 Not annotated 6 1 0.66633 Total 508 84 The work was supported by SB RAS integration proJect №109, Scientific School НШ-2447.2008.4, RAS program “Origin and evolution of Biosphere” and CRDF REC-008 grant. 3 4-TH MOSCOW CONFERENCE ON COMPUTATIONAL MOLECULAR BIOLOGY July 20–23, 2009 MATHEMATICAL MODELING OF THE MOLECULAR GENETIC SYSTEMS REGULATING A PLANT DEVELOPMENT ILYA AKBERDIN 1, FEDOR KAZANTSEV 1, STANISLAV FADEEV 2, IRINA GAINOVA 2, VITALY LIKHOSHVAI 1 Keywords: auxin metabolism, gene network, automatic generation, mathematical model, plant development Indole-3-acetic acid (IAA) is physiologically active in the form of the free acid, but can also be found in conJugated forms in plant tissues. IAA can be degraded and redundant pathways lead to its synthesis. Auxin participates in regulation of cell differentiation in development of embryo, leaves, vascular tissue, fruit, primary and lateral root and in controlling apical dominance and tropisms. The regulation of the IAA metabolism (synthesis, conJugation and degradations) is enough complex and may explain in some aspects how this simple substance is able to influence such diverse processes. Mathematical modeling of IAA metabolic gene network can help reveal the main factors governing this complex process. To reach this aim, we first reconstructed a gene network of auxin biosynthesis, conJugation degradation by annotating experimental data from 107 published papers into GeneNet computer system. This gene network after reduction was input into converter to generate the mathematical model of auxin metabolism. We have reconstructed the gene network and develop the mathematical model of auxin metabolism in arabidopsis shoots. The model allows to reproduce some phenomenological and molecular-genetic aspects of the auxin role in the plant development. The obtained results confirm adequacy of the developed model. In silico experiments testify to qualitatively rapid processes of the molecular genetic regulation of the systems homeostasis. The cumulative experimental data allowed starting construction of spatial distributed hierarchical model that describe both molecular genetic processes and processes on the level of cell- cell interactions simultaneously. So earlier we’ve developed the cellular automaton model that imitates morphodynamics of embryo development by means of regulation of signals produced by different embryonic cells is a first 1 The Institute of Cytology and Genetics SB RAS, Russian Federation, [email protected] 2 The Institute of Mathematics SB RAS, Russian Federation 4 4-TH MOSCOW CONFERENCE ON COMPUTATIONAL MOLECULAR BIOLOGY July 20–23, 2009 step in modelling the process of development in general and in modelling the gene network for morphogenesis in particular [1]. The next step in mathematical modeling application to studying of the plant development rules is integration of the spatial distributed hierarchical model with model of the intracellular auxin metabolism. Akberdin I.R., Ozonov E.A., Mironova V.V., Gorpinchenko D.N., Omelyanchuk N.A., Likhoshvai V.A., Kolchanov N.A. (2007). “A cellular automaton to model the development of shoot meristems of Arabidopsis thaliana”, Journal of Bioinformatics and Computational Biology Vol. 5, pp. 641-650. 5 4-TH MOSCOW CONFERENCE ON COMPUTATIONAL MOLECULAR BIOLOGY July 20–23, 2009 WATER-MEDIATED HYDROGEN BONDS ARE ESSENTIAL FOR LOOP STABILIZATION IN PROTEIN STRUCTURES EVGENIY AKSIANOV 1, SERGEI SPIRIN 1,2,
Load more

Recommended publications
  • Download Program Guide
    2011 C. elegans Meeting Organizing Committee Co-chairs: Oliver Hobert Columbia University Meera Sundaram University of Pennsylvania Organizing Committee: Raffi Aroian University of California, San Diego Ikue Mori Nagoya University Jean-Louis Bessereau INSERM Benjamin Podbilewicz Technion Israel Institute of Keith Blackwell Harvard Medical School Technology Andrew Chisholm University of California, San Diego Valerie Reinke Yale University Barbara Conradt Dartmouth Medical School Janet Richmond University of Illinois, Chicago Marie Anne Felix CNRS-Institut Jacques Monod Ann Rougvie University of Minnesota David Greenstein University of Minnesota Shai Shaham Rockefeller University Alla Grishok Columbia University Ahna Skop University of Wisconsin, Madison Craig Hunter Harvard University Ralf Sommer Max-Planck Institute for Bill Kelly Emory University Developmental Biology, Tuebingen Ed Kipreos University of Georgia Asako Sugimoto RIKEN, Kobe Todd Lamitina University of Pennsylvania Heidi Tissenbaum University of Massachusetts Chris Li City College of New York Medical School Sponsored by The Genetics Society of America 9650 Rockville Pike, Bethesda, MD 20814-3998 telephone: (301) 634-7300 fax: (301) 634-7079 e-mail: [email protected] Web site: http:/www.genetics-gsa.org Front cover design courtesy of Ahna Skop 1 Table of Contents Schedule of All Events.....................................................................................................................4 Maps University of California, Los Angeles, Campus .....................................................................7
    [Show full text]
  • ECWM 2000 Abstracts Platform Sessions WHSCAB Auditorium (10 Min
    East Coast Worm Meeting 2000 ECWM 2000 Abstracts Platform Sessions WHSCAB Auditorium (10 min. presentation + 2 min. Q&A) Friday, June 9 7:00-8:48 p.m., Session 1 Andy Singson, Chair Two new cell-death genes and cell-corpse engulfment genes both contribute to cell killing Peter Reddien, Scott Cameron, Michael Huang, Bob Horvitz The cell-corpse engulfment protein CED-1 is a transmembrane receptor that recognizes cell corpses Zheng Zhou, Bob Horvitz Testing Functions of Phagocytosis Receptor Homologs in Cell Corpse Elimination and Gonadal Outgrowth Sambath Chung, Monica Driscoll Components of the cytoskeleton, involved in the biogenesis of membrane channels, interfere with mec-4(d)-induced cell death. Nektarios Tavernarakis, Shiliang Wang, Monica Driscoll Inhibition of touch cell fate in C. elegans Ji Wu, Anne Duggan, Martin Chalfie pag-3 and unc-3 interact to determine neural fates in the ventral cord, and their mammalian counterparts may similarly interact during blood cell development Scott Cameron, Brinda Prasad, Joan B. McDermott, Eric Aamodt, Randall R. Reed, Bob Horvitz Identification of sns-8, a serine/ threonine kinase, and additional genes required for the development of the AWB olfactory neurons. Anne Lanjuin, Piali Sengupta The bHLH transcription factors LIN-32 and HLH-2 specify multiple aspects of ray development in the C. elegans male tail Douglas S. Portman, Scott W. Emmons seu-1 Encodes Novel Nuclear Proteins Required for the Function of Ectopic UNC-5 D.C. Merz, H Zheng, A. Colavita, J.G. Culotti 8:48-9:10 p.m., BREAK 9:10-10:34 p.m., Session 2 Bill Kelly, Chair Molecular and genetic analyses of unc-69, a gene required for axon guidance Suzanne Tharin, Bruce Wightman, Nancy Tsung, Erika Hartwieg, Gian Garriga, Bob Horvitz, Michael Hengartner The C.
    [Show full text]
  • Enhancer Interactions in Developmental Gene Regulation
    Enhancer Interactions in Developmental Gene Regulation The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Biette, Kelly Marie. 2019. Enhancer Interactions in Developmental Gene Regulation. Doctoral dissertation, Harvard University, Graduate School of Arts & Sciences. Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:42029813 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Enhancer Interactions in Developmental Gene Regulation A dissertation presented by Kelly Marie Biette to The Division of Medical Sciences in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the subject of Biological and Biomedical Sciences Harvard University Cambridge, Massachusetts May 2019! © 2019 Kelly Marie Biette All rights reserved.! Dissertation Advisor: Dr. Angela DePace Kelly Marie Biette Enhancer Interactions in Developmental Gene Regulation Abstract When and where a gene is expressed during development is a critical determinant of cell identity and transcriptional mis-regulation is a common driver of diverse disease states. The spatial and temporal expression of animal genes is controlled by enhancers, sequences of DNA that are bound by transcription factors (TFs) and direct the pattern, timing, and level of gene expression. Many developmental genes are surrounded by multiple enhancers, each of which directs a subset of the overall gene expression pattern, allowing the gene to be turned on at different stages or in different tissues throughout the lifetime of the organism.
    [Show full text]
  • Andrew Martens 04/07/08 the Use of Terminators and Anti
    Andrew Martens 04/07/08 The Use of Terminators and Anti-Terminators to Expand the Two-Spatula Burnt-Pancake Problem in Escherichia coli Honors Thesis Davidson College First Reader: Dr. Campbell Second Reader: Dr. Wessner Abstract The emerging field of synthetic biology provides a new experimental approach to biological research by allowing for the design and implementation of novel genetic systems. In 2006, a joint effort by researchers from Davidson College and Missouri Western State University developed a bacterial system that uses the Salmonella Hin/hix DNA recombination mechanism to solve in vivo the two-spatula, burnt-pancake mathematical problem. The problem asks to calculate the least number of flips required to sort a given stack of pancakes with two spatulas, from largest to smallest and with all golden sides facing up, assuming that each pancake is burnt on one side and golden on the other. The system worked as a proof-of-concept for using bacteria to solve mathematical problems in vivo, but was limited to pancake stacks with 3 pancakes. A new system that uses transcription anti-terminators could potentially extend the size of the problem, allowing for many more pancakes per stack. I developed a way to use the naturally occurring E. coli trp operon anti-terminator, downstream of the pLac promoter, to control GFP gene expression in tryptophan-rich and tryptophan-poor conditions. RNA tertiary structure computer simulations were used to predict if the anti-terminator sequence could be modified to accommodate Hin-mediated flipping. The success of using an anti-terminator could enable synthetic biologists to design hundreds of anti-terminators that would allow bacteria to solve burnt-pancake problems that were exponentially more difficult.
    [Show full text]
  • Targeting of Painting of Fourth to Rox1 and Rox2 Proximal Sites Suggests Evolutionary Links Between Dosage Compensation and the Regulation of The
    G3: Genes|Genomes|Genetics Early Online, published on June 3, 2013 as doi:10.1534/g3.113.006866 Targeting of Painting of fourth to roX1 and roX2 proximal sites suggests evolutionary links between dosage compensation and the regulation of the 4th chromosome in Drosophila melanogaster Lina E Lundberg, Maria Kim, Anna-Mia Johansson, Marie-Line Faucillion, Rafael Josupeit1 and Jan Larsson Department of Molecular Biology, Umeå University, SE-90187 Umeå, Sweden 1Present address: Division of Tumor Virology, German Cancer Research Center (DKFZ), 69120 Heidelberg, Germany 1 © The Author(s) 2013. Published by the Genetics Society of America. Running title: POF, roX and heterochromatin Key words: Painting of fourth, dosage compensation, heterochromatin, epigenetics, Drosophila melanogaster Corresponding author: Jan Larsson, Department of Molecular Biology, Umeå University, SE-90187 Umeå, Sweden, Tel:+46 (0)90 7856785; Fax:+46 (0)90 778007; Email: [email protected] Data deposition footnote: The microarray data reported in this paper have been deposited at http://www.ncbi.nlm.nih.gov/geo/ (Accession: GSE45402). 2 Abstract In Drosophila melanogaster, two chromosome-specific targeting and regulatory systems have been described. The male-specific lethal (MSL) complex supports dosage compensation by stimulating gene expression from the male X-chromosome and the protein Painting of fourth (POF) specifically targets and stimulates expression from the heterochromatic 4th chromosome. The targeting sites of both systems are well characterized, but the principles underlying the targeting mechanisms have remained elusive. Here we present an original observation, namely that POF specifically targets two loci on the X-chromosome, PoX1 and PoX2 (POF-on-X). PoX1 and PoX2 are located close to the roX1 and roX2 genes, which encode ncRNAs important for the correct targeting and spreading of the MSL-complex.
    [Show full text]
  • MCELROY-DISSERTATION-2016.Pdf (6.703Mb)
    Balancing transcriptional activity in Drosophila through protein- protein interactions on chromatin The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation McElroy, Kyle A. 2016. Balancing transcriptional activity in Drosophila through protein-protein interactions on chromatin. Doctoral dissertation, Harvard University, Graduate School of Arts & Sciences. Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:33493492 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Balancing transcriptional activity in Drosophila through protein-protein interactions on chromatin A dissertation presented by Kyle McElroy to The Department of Molecular and Cellular Biology in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the subject of Biology Harvard University Cambridge, Massachusetts April 2016 ©2016 Kyle Andrew McElroy All rights reserved. ii Dissertation Advisor: Professor Mitzi I Kuroda Kyle McElroy Balancing transcriptional activity in Drosophila through protein-protein interactions on chromatin Abstract Chromatin plays a vital role in the implementation of gene expression programs. Several disparate groups of regulatory proteins alter chromatin state through post-translational modification of histone proteins, nucleosome remodeling, and higher order chromatin structure in order to affect gene expression. Several of these key groups, such as the Male-Specific Lethal complex and Polycomb Group have been well characterized in Drosophila. Yet aspects of their biology at the molecular level, such as the means by which they are faithfully targeted to regulated loci throughout the genome and the molecular mechanisms they employ to alter transcriptional state, still remain unexplained.
    [Show full text]
  • Transcription Termination in Vitro at the Tryptophan Operon Attenuator Is
    Proc. Natl. Acad. Sci. USA Vol. 80, pp. 2206-2210, April 1983 Biochemistry Transcription termination in vitro at the tryptophan operon attenuator is controlled by secondary structures in the leader transcript (alternative RNA secondary structure/transcription regulation) IWONA STROYNOWSKI*, MITzI KURODA, AND CHARLES YANOFSKY Department of Biological Sciences, Stanford University, Stanford, California 94305 Contributed by Charles Yanofsky, January 20, 1983 ABSTRACT The role of alternative RNA secondary struc- don, secondary structure 1:2 would form and prevent 2:3 tures in regulating transcription termination at the attenuator of formation, thereby facilitating 3:4 formation. In accord with the the tryptophan (trp) operon of Serratia marcescens was examined latter expectation, tip leader mutants of S. marcescens and E. in vitro by transcribing mutant DNA templates having deletions coli that are defective in translation initiation show increased of different segments of the trp leader region. Deletions that re- transcription termination at their respective attenuators in vivo moved sequences corresponding to successive segments of pos- (12, 15). tulated RNA secondary structures either increased or decreased Secondary structure 1:2 (Fig. la) is the alternative 1:2 struc- transcription termination at the attenuator. The results obtained ture we considered previously (14). We favored a theoretically are consistent with the hypothesis that transcription termination less stable 1:2 structure at the time but the key deletion mu- results from RNA polymerase recognition of a particular RNA tant, no. 432, that led us to select this less stable alternative, secondary structure, the terminator. This structure forms only in has been found to have a much larger deletion than previously the absence of an alternative, preceding, RNA secondary struc- supposed.
    [Show full text]
  • Program and Abstracts
    1 48th ANNUAL DROSOPHILA RESEARCH CONFERENCE March 7-11, 2007 Philadelphia Marriott Downtown Philadelphia, Pennsylvania Program and Abstracts • 2007 Meeting Organizers Steve DiNardo, University of Pennsylvania School of Medicine Liz Gavis, Princeton University Tom Jongens, University of Pennsylvania School of Medicine Jessica Treisman, NYU Medical Center • 2007 Drosophila Board of Directors Officers and Regional Representatives President Trudy MacKay North Carolina State University President-Elect Utpal Banerjee University of California at Los Angeles Past-President Mark Krasnow Stanford University Medical School Past-President & Elections Chair Lynn Cooley Yale University School of Medicine Past-President Ruth Lehman New York University School of Medicine Treasurer Michael Bender University of Georgia Canada Howard Lipshitz University of Toronto Great Lakes Amanda Simcox Ohio State University Northwest Barb Taylor Oregon State University College of Science Southeast Rebecca Kellum University of Kentucky California Ken Burtis University of California, Davis Heartland Susan Abmayr Stowers Institute for Medical Research New England Mitzi Kuroda Harvard University Medical School Mid-Atlantic Claude Desplan New York University Midwest Pam Geyer University of Iowa • International Representatives Australia/Oceana Robert Saint Australian National University Asia Yasushi Hiromi National Institute of Genetics Europe David Ish-Horowicz Cancer Research UK • Sponsored by The Genetics Society of America 9650 Rockville Pike, Bethesda, MD 20814-3998
    [Show full text]