DOCSLIB.ORG

ECWM 2000 Abstracts Platform Sessions WHSCAB Auditorium (10 Min

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
ECWM 2000 Abstracts Platform Sessions WHSCAB Auditorium (10 Min East Coast Worm Meeting 2000 ECWM 2000 Abstracts Platform Sessions WHSCAB Auditorium (10 min. presentation + 2 min. Q&A) Friday, June 9 7:00-8:48 p.m., Session 1 Andy Singson, Chair Two new cell-death genes and cell-corpse engulfment genes both contribute to cell killing Peter Reddien, Scott Cameron, Michael Huang, Bob Horvitz The cell-corpse engulfment protein CED-1 is a transmembrane receptor that recognizes cell corpses Zheng Zhou, Bob Horvitz Testing Functions of Phagocytosis Receptor Homologs in Cell Corpse Elimination and Gonadal Outgrowth Sambath Chung, Monica Driscoll Components of the cytoskeleton, involved in the biogenesis of membrane channels, interfere with mec-4(d)-induced cell death. Nektarios Tavernarakis, Shiliang Wang, Monica Driscoll Inhibition of touch cell fate in C. elegans Ji Wu, Anne Duggan, Martin Chalfie pag-3 and unc-3 interact to determine neural fates in the ventral cord, and their mammalian counterparts may similarly interact during blood cell development Scott Cameron, Brinda Prasad, Joan B. McDermott, Eric Aamodt, Randall R. Reed, Bob Horvitz Identification of sns-8, a serine/ threonine kinase, and additional genes required for the development of the AWB olfactory neurons. Anne Lanjuin, Piali Sengupta The bHLH transcription factors LIN-32 and HLH-2 specify multiple aspects of ray development in the C. elegans male tail Douglas S. Portman, Scott W. Emmons seu-1 Encodes Novel Nuclear Proteins Required for the Function of Ectopic UNC-5 D.C. Merz, H Zheng, A. Colavita, J.G. Culotti 8:48-9:10 p.m., BREAK 9:10-10:34 p.m., Session 2 Bill Kelly, Chair Molecular and genetic analyses of unc-69, a gene required for axon guidance Suzanne Tharin, Bruce Wightman, Nancy Tsung, Erika Hartwieg, Gian Garriga, Bob Horvitz, Michael Hengartner The C. elegans ORFeome project Jerome Reboul, Philippe Vaglio, Cindy Jackson, Troy Moore, Jean Thierry-Mieg, Danielle Thierry-Mieg, Jim Hartley, Gary Temple, Mike Brasch, Nia Tzellas, Marc Vidal Assigning function to ovary expressed genes using RNAi. F. Piano, A. Schetter, D. Morton, K. Kemphues, V. Reinke, S. Kim, M. Mangone, L. Stein A comprehensive reverse genetic screen of Chromosome I Andrew Fraser, Ravi Kamath, Peder Zipperlen, Julie Ahringer EGO-1: A link between development and RNAi Eleanor Maine, Karin Schneider, Valarie Vought Role of mut-7 and rde genes in the initiation of transgene silencing in the germline Alla Grishok, Tae Ho Shin, Hiroaki Tabara, Craig Mello Mechanisms of response to environmental dsRNA Lisa Timmons, Hiroaki Tabara, Craig Mello, Andrew Fire 10:34 p.m.-midnight Workshop: Gene Knockouts Michael Koelle, organizer Saturday, June 10 8:30-10:06 a.m., Session 3 Jill Schumacher, Chair 1 East Coast Worm Meeting 2000 Parent of Origin Effects in C. elegans: Worm Imprinting or an Insight Into Hybrid Dysgenesis? William G. Kelly Towards the Molecular Genetics of Sex Drive in C. elegans Jonathan Lipton, Scott W. Emmons Haldane’s Rule in Caenorhabditis is implemented by sexual transformation. Scott Everet, Baird, Wei-Chih, Yen Germ-Soma Distinction in C. elegans Yingdee Unhavaithaya, Tae Ho Shin, Craig C. Mello. The germline protein PIE-1 has two functions, each important for germ cell fate T. Tenenhaus, K. Subramaniam, G. Seydoux CGH-1, an essential and conserved germline RNA helicase RE Navarro, EY Shim, Y Kohara, Y Shi, TK Blackwell The Locations and Predicted Roles of MES-2, MES-3, MES-4, and MES-6 in Control of Gene Expression in the Germline Lei Xu, Youyi Fong, and Susan Strome Histone deacetylase HDA-1 is involved in gonadogenesis and germline maturation in Caenorhabditis elegans P. Dufourcq, M. Victor, D. Calvo, J. Hodgkin, Y. Shi 10:06-10:40 a.m. BREAK 10:40 a.m.-12:16 p.m., Session 4 Chris Rongo, Chair glp-1 Proximal Proliferation (Pro) Mutants Te-Wen Lo, E. Jane Albert Hubbard Chromosome segregation is not required for polarized segregation of organelles during C. elegans sperm meiosis Don Fox, Penny Sadler, Michelle Reed, Lori Blanchfield, Allen Dvarkas, Diane Shakes Genes required for sperm-oocyte interactions at fertilization Andrew Singson, Sonia Zannoni, Pavan Kadandale, Brian Geldziler, Steven L’Hernault Several novel complementation groups regulate cell survival of vulva precursor cells in Pristionchus pacificus Jagan Srinivasan, Ralf J. Sommer Synthetic Vulvaless/Lethal mutations define new regulators of Ras signaling Meera Sundaram, Ranjana Kishore, Robyn M. Howard, Alissa Goldman, Gaurang Patel The Caenorhabditis elegans COG-4 protein mediates vulval cell morphogenesis Wendy Hanna-Rose, Min Han Expression of the small regulatory RNA let-7 across phylogeny Brenda Reinhart, Amy Pasquinelli, Ashok Srinivasan, Mark Fishman, Frank Slack, Mitzi Kuroda, Gary Ruvkun The C. elegans let-7 RNA controls temporal patterning by regulating the timing of expression of the lin-41RBCC regulatory gene. Frank J. Slack, Betsy R. Maller 12:16-1:45 p.m., lunch, Dobbs University Center ("The DUC") 1:45-5:30 p.m., Poster Session Dobbs University Center (Winship Ballroom, Faculty & Trustees Dining Rooms) 5:30-6:54 p.m., Session 5 Frank Slack, Chair G protein regulators RGS-1 and RGS-2 allow C. elegans to rapidly alter egg-laying behavior when re-fed after starvation Meng-Qiu Dong, Dan Chase, Georgia Patikoglou, Michael Koelle daf-5 cloning identifies a Sno oncogene homolog as a TGF-beta signaling output Li Sun, Garth Patterson Cloning and Characterization of lon-1, a gene downstream of TGFb signaling involved in body size regulation Lisa L. Maduzia, Pradnya Shetgiri, Srikant Krishna, Cathy Savage-Dunn, Huang Wang, Richard W. 2 East Coast Worm Meeting 2000 Padgett sma-9 and TGFb Signaling Yuval Hiltzik, Rafal Tokarz, Robyn Lints, Scott Emmons, Cathy Savage-Dunn Toward steroid endocrinology: cholesterol accumulation in C. elegans John Lenard, William G. Wadsworth rme-1, a new endocytosis gene implicated in recycling B Grant, Y Zhang, M Paupard, DH Hall, D Hirsh rme-8 is an essential gene required for endocytosis Yinhua Zhang, David Hirsh 7:00-8:30 p.m., "wet bar" & banquet, Cox Hall Ballroom (3 rd floor) 8:30-11:30 p.m., band, dancing etc. Sunday, June 11 8:30-9:42 a.m., Session 6 Jane Hubbard, Chair Postembryonic Muscle Patterning Steve Kostas, Andy Fire LAD-1, a homologue of vertebrate L1CAMs, is a general receptor for UNC-44 at sites of cell-cell contact throughout development, and participates in a novel ankyrin-independent signaling pathway Lihsia Chen, Bryan Ong, Vann Bennett MUP-4 is a novel matrix receptor with essential functions in epithelial cell adhesion, morphogenesis and maintenance of muscle position. L. Hong, T. Elbl, C. Franzini-Armstrong, J. Ward, K. Rybicka, E. Bucher The unc-78 gene encodes a homolog of actin-interacting protein 1 (AIP1) and is involved in actin filament assembly in body wall muscle Shoichiro Ono, Henry F. Epstein, Guy M. Benian PDZ containing Protein Kinases are Implicated in Contractile Functions. M Land, C.S. Rubin A calcium-binding protein of SR (sarcoplasmic reticulum), calsequestrin, is not essential for body-wall muscle function in C. elegans Jeong Hoon Cho, Young Soo Oh, Tomoyo Hamada, Hiroaki Kagawa, Joohong Ahnn 9:42-10:10 a.m., BREAK 10:10-11:58 a.m., Session 7 Scott Clark, Chair The extracellular domain of the C. elegans amyloid precursor-related protein is essential for viability Angela Hornsten, Chris Li Analysis of C. elegans nlp genes reveals new neuropeptide families Arif, Nathoo, Rachael Moeller, Anne C. Hart Elongation factor-2 kinase affects Caenorhabditis elegans life span by regulating protein turnover Nektarios Tavernarakis, Bradley S. Nefsky, Charmaine E. Mendola, Karen S. Pavur, Zeynep Altun-Gultekin, William G. Wadsworth, Monica Driscoll, Alexey G. Ryazanov A wee-1 kinase homolog is required for meiosis during spermatogenesis in C. elegans Todd Lamitina, Steve L’Hernault Absence of CUL-4 leads to endoreplication Weiwei Zhong, Edward Kipreos Regulation of progression through G1 phase in C. elegans Mike Boxem, Sander van den Heuvel Regulation of microtubule dynamics during mitosis: identifying AIR kinase substrates in C. elegans. John D. Bishop, Jill M. Schumacher Cytoplasmic dynein light-intermediate chain is required for distinct aspects of cell division in C. elegans John H. Yoder, Min Han The survivin-like C. elegans protein BIR-1 acts with the aurora-like kinase AIR-2 to mediate chromosome behavior and spindle midzone formation Liz Speliotes, Anthony Uren, David Vaux, Bob Horvitz Negative regulation of MEC-3 by zinc finger protein SEM-4 Anne Toker, Martin Chalfie 3 East Coast Worm Meeting 2000 Posters Genetic and molecular analysis of intron requirements for gene activity Rosa Alcazar, Andrew Fire CRB-1 may function in synaptic transmission and dauer formation Mark Alkema, Bob Horvitz In vivo Studies of Troponin T Functions. T. Allen, J. Ward, L. Hong, A. Burkeen, E.A. Bucher Genetic analysis of neuroendocrine controls of fat metabolism in C. elegans Kaveh Ashrafi, Gary Ruvkun Functional Characterization of Calcineurin, a serine/threonine protein phosphatase, in C. elegans Jaya Bandyopadhyay, Jiyeon Lee, Byung-Jae Park, Joohong Ahnn A Genetic Screen for Components of the Goalpha Signaling Pathway in C. elegans I. Amy Bany, Michael Koelle SQV-7, a protein involved in vulval invagination and embryonic development, transports UDP-glucuronic acid, UDP-N-acetylgalactosamine and UDP-galactose Patricia Berninsone, Ho-Yon Hwang, Bob Horvitz, Carlos Hirschberg The ClC family of Chloride Channels in C. elegans Laura Bianchi, Carol L. Beck, David M. Miller III, Alfred L. George Jr Protein interaction mapping of DNA repair and DNA damage checkpoint proteins in C. elegans Simon Boulton, Nick Dyson, Marc Vidal dig-1 encodes an adhesion molecule involved in sensory map formation. Christopher Burket, Stacy Hubbard, Elizabeth F. Ryder The C. elegans lissencephaly (LIS1)-like gene lis-1 is required for embryonic development Ned Buttner, Bob Horvitz The ER stress response in C.
Load more

Recommended publications
  • Mccmb ’09 Ttcggtgatatccaggcggcgggcaatcatctt
    TCAGAAAATGCGCTCCTGATGCACCCATACCGC TGCTTCCACGCGAGACTTGAGCTTCATTTTCTT CAGCATGTGCTTGACGTGCACTTTTACTGTGCT TTCGGTGATATCCAGGCGGCGGGCAATCATCTT GTTCGGCAAACCCTGGGCAATCAGCTTGAGAAT ATCGCGCTCGCGTGGGGTTAACTGGTTAACATC TCAGAAAATGCGCTCCTGATGCACCCATACCGC TGCTTCCACGCGAGACTTGAGCTTCATTTTCTT CAGCATGTGCTTGACGTGCACTTTTACTGTGCT MCCMB ’09 TTCGGTGATATCCAGGCGGCGGGCAATCATCTT POCEEDINGSR OF THE IN TERNATIONAL MSCOWCNFERENCEOO ONCMPUTATIONALO MLECULARBOLOGYOI July 20-23, 2009 Moscow, Russia Organizers ЕР И И Е Н И Ж Б Н И И О О И И Н Б Ф DepartmentofBioengineeringandBioinformatics О Т Р Е М Т Ь А Л ofM.V.LomonosovMoscowStateUniversity Т У И К К А И Ф 1930 BiologicalDepartment ofM.V.LomonosovMoscowStateUniversity У StateScientificCentreGosNIIGenetika Institutefor Information TrasnsmissionProblems,RAS The ScientificCouncil onBiophysicsRAS, EngelhardtInstituteofMolecular Biology Russian AcademyofSciences Sponsoredby Р И RussianFundofBasicResearch INRIA,France INRIA theFrenchNationalInstituteforResearch inComputerScienceandControl DepartmentofBioengineeringandBioinformatics ofM.V.LomonosovMoscowStateUniversity BiologicalDepartmentofM.V.LomonosovMoscowStateUniversity StateScientificCentreGosNIIGenetika InstituteforInformationTrasnsmissionProblems,Russian A cademyof S ciences TheScientificCouncilonBiophysics , RAS ussian cademyof ciences EngelhardtInstituteofMolecularBiology,Russian AcademyofSciences with financial support of RussianFundofBasicResearch INRIA,France (theFrenchNationalInstituteforResearchinComputerScienceandControl) POCEEDINGSR MCCMB ’09 Moscow, Russia July
    [Show full text]
  • Download Program Guide
    2011 C. elegans Meeting Organizing Committee Co-chairs: Oliver Hobert Columbia University Meera Sundaram University of Pennsylvania Organizing Committee: Raffi Aroian University of California, San Diego Ikue Mori Nagoya University Jean-Louis Bessereau INSERM Benjamin Podbilewicz Technion Israel Institute of Keith Blackwell Harvard Medical School Technology Andrew Chisholm University of California, San Diego Valerie Reinke Yale University Barbara Conradt Dartmouth Medical School Janet Richmond University of Illinois, Chicago Marie Anne Felix CNRS-Institut Jacques Monod Ann Rougvie University of Minnesota David Greenstein University of Minnesota Shai Shaham Rockefeller University Alla Grishok Columbia University Ahna Skop University of Wisconsin, Madison Craig Hunter Harvard University Ralf Sommer Max-Planck Institute for Bill Kelly Emory University Developmental Biology, Tuebingen Ed Kipreos University of Georgia Asako Sugimoto RIKEN, Kobe Todd Lamitina University of Pennsylvania Heidi Tissenbaum University of Massachusetts Chris Li City College of New York Medical School Sponsored by The Genetics Society of America 9650 Rockville Pike, Bethesda, MD 20814-3998 telephone: (301) 634-7300 fax: (301) 634-7079 e-mail: [email protected] Web site: http:/www.genetics-gsa.org Front cover design courtesy of Ahna Skop 1 Table of Contents Schedule of All Events.....................................................................................................................4 Maps University of California, Los Angeles, Campus .....................................................................7
    [Show full text]
  • Enhancer Interactions in Developmental Gene Regulation
    Enhancer Interactions in Developmental Gene Regulation The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Biette, Kelly Marie. 2019. Enhancer Interactions in Developmental Gene Regulation. Doctoral dissertation, Harvard University, Graduate School of Arts & Sciences. Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:42029813 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Enhancer Interactions in Developmental Gene Regulation A dissertation presented by Kelly Marie Biette to The Division of Medical Sciences in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the subject of Biological and Biomedical Sciences Harvard University Cambridge, Massachusetts May 2019! © 2019 Kelly Marie Biette All rights reserved.! Dissertation Advisor: Dr. Angela DePace Kelly Marie Biette Enhancer Interactions in Developmental Gene Regulation Abstract When and where a gene is expressed during development is a critical determinant of cell identity and transcriptional mis-regulation is a common driver of diverse disease states. The spatial and temporal expression of animal genes is controlled by enhancers, sequences of DNA that are bound by transcription factors (TFs) and direct the pattern, timing, and level of gene expression. Many developmental genes are surrounded by multiple enhancers, each of which directs a subset of the overall gene expression pattern, allowing the gene to be turned on at different stages or in different tissues throughout the lifetime of the organism.
    [Show full text]
  • Andrew Martens 04/07/08 the Use of Terminators and Anti
    Andrew Martens 04/07/08 The Use of Terminators and Anti-Terminators to Expand the Two-Spatula Burnt-Pancake Problem in Escherichia coli Honors Thesis Davidson College First Reader: Dr. Campbell Second Reader: Dr. Wessner Abstract The emerging field of synthetic biology provides a new experimental approach to biological research by allowing for the design and implementation of novel genetic systems. In 2006, a joint effort by researchers from Davidson College and Missouri Western State University developed a bacterial system that uses the Salmonella Hin/hix DNA recombination mechanism to solve in vivo the two-spatula, burnt-pancake mathematical problem. The problem asks to calculate the least number of flips required to sort a given stack of pancakes with two spatulas, from largest to smallest and with all golden sides facing up, assuming that each pancake is burnt on one side and golden on the other. The system worked as a proof-of-concept for using bacteria to solve mathematical problems in vivo, but was limited to pancake stacks with 3 pancakes. A new system that uses transcription anti-terminators could potentially extend the size of the problem, allowing for many more pancakes per stack. I developed a way to use the naturally occurring E. coli trp operon anti-terminator, downstream of the pLac promoter, to control GFP gene expression in tryptophan-rich and tryptophan-poor conditions. RNA tertiary structure computer simulations were used to predict if the anti-terminator sequence could be modified to accommodate Hin-mediated flipping. The success of using an anti-terminator could enable synthetic biologists to design hundreds of anti-terminators that would allow bacteria to solve burnt-pancake problems that were exponentially more difficult.
    [Show full text]
  • Targeting of Painting of Fourth to Rox1 and Rox2 Proximal Sites Suggests Evolutionary Links Between Dosage Compensation and the Regulation of The
    G3: Genes|Genomes|Genetics Early Online, published on June 3, 2013 as doi:10.1534/g3.113.006866 Targeting of Painting of fourth to roX1 and roX2 proximal sites suggests evolutionary links between dosage compensation and the regulation of the 4th chromosome in Drosophila melanogaster Lina E Lundberg, Maria Kim, Anna-Mia Johansson, Marie-Line Faucillion, Rafael Josupeit1 and Jan Larsson Department of Molecular Biology, Umeå University, SE-90187 Umeå, Sweden 1Present address: Division of Tumor Virology, German Cancer Research Center (DKFZ), 69120 Heidelberg, Germany 1 © The Author(s) 2013. Published by the Genetics Society of America. Running title: POF, roX and heterochromatin Key words: Painting of fourth, dosage compensation, heterochromatin, epigenetics, Drosophila melanogaster Corresponding author: Jan Larsson, Department of Molecular Biology, Umeå University, SE-90187 Umeå, Sweden, Tel:+46 (0)90 7856785; Fax:+46 (0)90 778007; Email: [email protected] Data deposition footnote: The microarray data reported in this paper have been deposited at http://www.ncbi.nlm.nih.gov/geo/ (Accession: GSE45402). 2 Abstract In Drosophila melanogaster, two chromosome-specific targeting and regulatory systems have been described. The male-specific lethal (MSL) complex supports dosage compensation by stimulating gene expression from the male X-chromosome and the protein Painting of fourth (POF) specifically targets and stimulates expression from the heterochromatic 4th chromosome. The targeting sites of both systems are well characterized, but the principles underlying the targeting mechanisms have remained elusive. Here we present an original observation, namely that POF specifically targets two loci on the X-chromosome, PoX1 and PoX2 (POF-on-X). PoX1 and PoX2 are located close to the roX1 and roX2 genes, which encode ncRNAs important for the correct targeting and spreading of the MSL-complex.
    [Show full text]
  • MCELROY-DISSERTATION-2016.Pdf (6.703Mb)
    Balancing transcriptional activity in Drosophila through protein- protein interactions on chromatin The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation McElroy, Kyle A. 2016. Balancing transcriptional activity in Drosophila through protein-protein interactions on chromatin. Doctoral dissertation, Harvard University, Graduate School of Arts & Sciences. Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:33493492 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Balancing transcriptional activity in Drosophila through protein-protein interactions on chromatin A dissertation presented by Kyle McElroy to The Department of Molecular and Cellular Biology in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the subject of Biology Harvard University Cambridge, Massachusetts April 2016 ©2016 Kyle Andrew McElroy All rights reserved. ii Dissertation Advisor: Professor Mitzi I Kuroda Kyle McElroy Balancing transcriptional activity in Drosophila through protein-protein interactions on chromatin Abstract Chromatin plays a vital role in the implementation of gene expression programs. Several disparate groups of regulatory proteins alter chromatin state through post-translational modification of histone proteins, nucleosome remodeling, and higher order chromatin structure in order to affect gene expression. Several of these key groups, such as the Male-Specific Lethal complex and Polycomb Group have been well characterized in Drosophila. Yet aspects of their biology at the molecular level, such as the means by which they are faithfully targeted to regulated loci throughout the genome and the molecular mechanisms they employ to alter transcriptional state, still remain unexplained.
    [Show full text]
  • Transcription Termination in Vitro at the Tryptophan Operon Attenuator Is
    Proc. Natl. Acad. Sci. USA Vol. 80, pp. 2206-2210, April 1983 Biochemistry Transcription termination in vitro at the tryptophan operon attenuator is controlled by secondary structures in the leader transcript (alternative RNA secondary structure/transcription regulation) IWONA STROYNOWSKI*, MITzI KURODA, AND CHARLES YANOFSKY Department of Biological Sciences, Stanford University, Stanford, California 94305 Contributed by Charles Yanofsky, January 20, 1983 ABSTRACT The role of alternative RNA secondary struc- don, secondary structure 1:2 would form and prevent 2:3 tures in regulating transcription termination at the attenuator of formation, thereby facilitating 3:4 formation. In accord with the the tryptophan (trp) operon of Serratia marcescens was examined latter expectation, tip leader mutants of S. marcescens and E. in vitro by transcribing mutant DNA templates having deletions coli that are defective in translation initiation show increased of different segments of the trp leader region. Deletions that re- transcription termination at their respective attenuators in vivo moved sequences corresponding to successive segments of pos- (12, 15). tulated RNA secondary structures either increased or decreased Secondary structure 1:2 (Fig. la) is the alternative 1:2 struc- transcription termination at the attenuator. The results obtained ture we considered previously (14). We favored a theoretically are consistent with the hypothesis that transcription termination less stable 1:2 structure at the time but the key deletion mu- results from RNA polymerase recognition of a particular RNA tant, no. 432, that led us to select this less stable alternative, secondary structure, the terminator. This structure forms only in has been found to have a much larger deletion than previously the absence of an alternative, preceding, RNA secondary struc- supposed.
    [Show full text]
  • Program and Abstracts
    1 48th ANNUAL DROSOPHILA RESEARCH CONFERENCE March 7-11, 2007 Philadelphia Marriott Downtown Philadelphia, Pennsylvania Program and Abstracts • 2007 Meeting Organizers Steve DiNardo, University of Pennsylvania School of Medicine Liz Gavis, Princeton University Tom Jongens, University of Pennsylvania School of Medicine Jessica Treisman, NYU Medical Center • 2007 Drosophila Board of Directors Officers and Regional Representatives President Trudy MacKay North Carolina State University President-Elect Utpal Banerjee University of California at Los Angeles Past-President Mark Krasnow Stanford University Medical School Past-President & Elections Chair Lynn Cooley Yale University School of Medicine Past-President Ruth Lehman New York University School of Medicine Treasurer Michael Bender University of Georgia Canada Howard Lipshitz University of Toronto Great Lakes Amanda Simcox Ohio State University Northwest Barb Taylor Oregon State University College of Science Southeast Rebecca Kellum University of Kentucky California Ken Burtis University of California, Davis Heartland Susan Abmayr Stowers Institute for Medical Research New England Mitzi Kuroda Harvard University Medical School Mid-Atlantic Claude Desplan New York University Midwest Pam Geyer University of Iowa • International Representatives Australia/Oceana Robert Saint Australian National University Asia Yasushi Hiromi National Institute of Genetics Europe David Ish-Horowicz Cancer Research UK • Sponsored by The Genetics Society of America 9650 Rockville Pike, Bethesda, MD 20814-3998
    [Show full text]