DOCSLIB.ORG

Transgenic Banana Expressing Pflp Gene Confers Enhanced Resistance

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Transgenic Banana Expressing Pflp Gene Confers Enhanced Resistance Transgenic Res (2012) 21:855–865 DOI 10.1007/s11248-011-9574-y ORIGINAL PAPER Transgenic banana expressing Pflp gene confers enhanced resistance to Xanthomonas wilt disease B. Namukwaya • L. Tripathi • J. N. Tripathi • G. Arinaitwe • S. B. Mukasa • W. K. Tushemereirwe Received: 30 June 2011 / Accepted: 11 November 2011 / Published online: 19 November 2011 Ó Springer Science+Business Media B.V. 2011 Abstract Banana Xanthomonas wilt (BXW), caused transgenic lines were characterized by molecular by Xanthomonas campestris pv. musacearum, is one analysis. After challenge with X. campestris pv. of the most important diseases of banana (Musa sp.) musacearum transgenic lines showed high resistance. and currently considered as the biggest threat to About 67% of transgenic lines evaluated were com- banana production in Great Lakes region of East and pletely resistant to BXW. These transgenic lines did Central Africa. The pathogen is highly contagious and not show any disease symptoms after artificial inoc- its spread has endangered the livelihood of millions of ulation of in vitro plants under laboratory conditions as farmers who rely on banana for food and income. The well as potted plants in the screen-house, whereas non- development of disease resistant banana cultivars transgenic control plants showed severe symptoms remains a high priority since farmers are reluctant to resulting in complete wilting. This study confirms that employ labor-intensive disease control measures and expression of the Pflp gene in banana results in there is no host plant resistance among banana enhanced resistance to BXW. This transgenic tech- cultivars. In this study, we demonstrate that BXW nology can provide a timely solution to the BXW can be efficiently controlled using transgenic technol- pandemic. ogy. Transgenic bananas expressing the plant ferre- doxin-like protein (Pflp) gene under the regulation of Keywords Transgenic banana Á Pflp Á the constitutive CaMV35S promoter were generated Disease resistance Á Banana Xanthomonas wilt using embryogenic cell suspensions of banana. These B. Namukwaya Á L. Tripathi (&) Á J. N. Tripathi Introduction International Institute of Tropical Agriculture, P.O. Box 7878, Kampala, Uganda Banana (Musa sp.) is one of the most important world e-mail: [email protected] food crops grown in more than 120 tropical and B. Namukwaya Á G. Arinaitwe Á W. K. Tushemereirwe subtropical countries of the world (Jones 2000). National Agricultural Research Organization, Annual banana production in the world is estimated P.O. Box 7065, Kampala, Uganda at 1.3 9 1011 kg, of which less than 15% enters the international commercial market, indicating that the B. Namukwaya Á S. B. Mukasa Department of Crop Science, Makerere University, crop is far more important for local or domestic P.O. Box 7062, Kampala, Uganda consumption than for export (FAO 2008). Nearly a 123 856 Transgenic Res (2012) 21:855–865 third of the bananas produced globally are grown in 2009). BXW has similarities to other bacterial wilts of sub-Saharan Africa where the crop provides more than banana caused by Ralstonia solanacearum, including 25% of food energy requirements for over 100 million Moko, blood, and bugtok diseases (Thwaites et al. people (Robinson 1996). East Africa is the largest 2000). Once these pathogens have become estab- banana producing and consuming region in Africa. lished, disease control is very difficult (Eden-Green Uganda is the world’s second largest producer after 2004). There are currently no commercial chemicals, India with a total of about 1 9 1010 kg (FAO 2008). biocontrol agents or resistant cultivars available to Food security studies reveal that in Burundi, Rwanda control X. campestris pv. musacearum (Tripathi et al. and Uganda, bananas constitute more than 30% of the 2009). Although BXW can be managed by following daily per capita caloric intake, rising to 60% in some phytosanitary practices including cutting and burying regions (Abele et al. 2007). Despite the importance of infected plants, restricting the movement of banana bananas, the crop is threatened by various constraints materials from BXW affected areas, decapitating male such as biotic and abiotic factors (Ortiz et al. 2002). buds and use of ‘‘clean’’ tools, but the adoption of such Banana Xanthomonas wilt (BXW), caused by the practices has been inconsistent as they are labour bacterium X. campestris pv. musacearum (Xcm), is intensive and also farmers belief that de-budding considered as the biggest threat to banana production affects the fruit quality (Tripathi et al. 2009). The lack in East and Central Africa (Tripathi et al. 2009). It of natural resistance against X. campestris pv. musa- endangers the livelihood of millions of farmers, who cearum, labor intensive and unsustainable cultural rely on banana for staple food and cash. The disease practices, and the difficulties of conventional breeding was first reported about 40 years ago in Ethiopia on with this highly sterile crop favor a transgenic Ensete, which is closely related to banana (Yirgou and approach. Bradbury 1968), and then on banana (Yirgou and The aim of this study was to determine whether the Bradbury 1974). Outside Ethiopia, BXW was first expression of sweet pepper (Capsicum annuum) plant identified in Uganda in 2001 (Tushemereirwe et al. ferredoxin-like protein (Pflp) gene in transgenic 2004), and subsequently in the Democratic Republic banana provides resistance to BXW. PFLP is a of Congo (Ndungo et al. 2006), Rwanda (Reeder et al. member of protein Ferredoxin-I (Fd-I), an important 2007), Kenya, Tanzania and Burundi (Carter et al. member of photosynthesis proteins. Fd-I is involved in 2009). several important metabolic pathways such as photo- The disease is very destructive, infecting all synthesis, nitrate reduction and lipid synthesis (Curdt banana varieties, including dessert, cooking, roasting et al. 2000; Geigenberger et al. 2005; Meyer 2001). and beer types (Ssekiwoko et al. 2006). The impacts The Pflp gene is widely distributed in all green tissues of BXW are both extreme and rapid, unlike those of of plants and shows little diversity in different plant other diseases which cause gradually increasing species. losses over years. The economic impact of BXW is The Pflp has shown resistance against various due to absolute yield loss and death of the mother bacterial pathogens like Erwinia, Pseudomonas, Rals- plant that would otherwise contribute to the ratoon tonia, and Xanthomonas spp. in transgenic tobacco, plant production cycles (Tripathi et al. 2009). tomato, orchids, calla lily and rice (Huang et al. 2004, Overall economic losses were estimated at $2 billion 2007, Liau et al. 2003; Tang et al. 2001, Yip et al. over a decade, arising from price increases and 2007). The PFLP-mediated resistance raised by over- significant reductions in production (Abele and expression of the Pflp gene in transgenic plants is due Pillay 2007). to intensified production of active oxygen species The affected banana plants develop symptoms (AOS) and activation of the hypersensitive response characterized by a progressive yellowing and wilting (HR) when plants were challenged with bacterial of the leaves, and uneven and premature ripening of pathogens or elicitors of defense responses (Dayakar the fruits with sections showing unique yellowish et al. 2003; Haung et al. 2004). In this study, the sweet blotches and dark brown scars in the pulp (Tripathi pepper Pflp gene was transformed into banana plants et al. 2009). Eventually, infected plants wither and rot. in order to assess the effect of its over-expression on The disease spreads through insect vectors, infected resistance against the bacterial pathogen X. campestris suckers and contaminated farming tools (Tripathi et al. pv. musacearum. 123 Transgenic Res (2012) 21:855–865 857 Materials and methods medium (MS salts and vitamins, 10 mg/l ascorbic acid, 100 mg/l myo-inositol, 5 mg/l BAP, 30 g/l Agrobacterium and plasmid sucrose, 3 g/l gelrite, pH 5.8) for multiplication. The individual shoots were transferred to rooting medium The pBI-PFLP vector containing the Pflp gene regu- [MS salts and vitamins, 10 mg/l ascorbic acid, lated by the CaMV35S promoter and the nptII gene as 100 mg/l myo-inositol, 1 mg/l indole-3-butyric acid selection marker was acquired from Academia Sinica, (IBA), 30 g/l sucrose, 3 g/l gelrite, pH 5.8]. Rooted Taiwan. A schematic representation of the pBI-PFLP plantlets were then transferred to pots in the contain- vector is shown in Fig. 2a. The vector was transformed ment facility. The plants were further used for into Agrobacterium tumefaciens super virulent strain molecular analysis and for the evaluation of resistance EHA 105 through electroporation. The Agrobacterium against X. campestris pv. musacearum. strain EHA105 harbouring pBI-PFLP was maintained on YEB (0.1% yeast extract, 0.5% beef extract, 0.5% PCR analysis peptone, 0.5% sucrose and 0.04% MgSO4) medium supplemented with kanamycin (50 mg/l). The bacte- Genomic DNA was isolated from 12 randomly rial culture was grown in liquid YEB medium selected putative transformed plantlets using DNeasy supplemented with kanamycin (50 mg/l) with shaking plant mini kit (Qiagen, GmbH, Germany). The (150 rpm) at 28°C until the optical density at 600 nm presence of Pflp and npt II gene in the plant genome (OD600 nm) reached 0.8. The bacterial cells were of the randomly selected putatively transgenic lines harvested by centrifugation at 5,0009g for 10 min at was confirmed by PCR analysis using specific prim- 4°C and re-suspended in 25 ml of TMA1 medium [MS ers. The primer sequences were Pflp gene: forward Macro, MS Micro, MS vitamins, 1 mg/l biotin, 50-CAAGAAAACCAGCTGTGACAAGCCTTAA 100 mg/l malt extract, 100 mg/l glutamine, 230 mg/l AC-30 and reverse 50-CGAGTTCTGCCTCTTTGTG proline, 40 mg/l ascorbic acid, 5 g/l polyvinylpyrrol- AGTCTCAATAG-30; nptII gene: forward 50 CCT idone 10 (PVP 10), 200 mg/l cysteine,1 mg/l indole- TATCCGCAACTTCTTTACCTA 30 and reverse 50 acetic acid (IAA), 1 mg/l naphthaleneacetic acid ACACCCAGCCGGCCACAGTCG 30.
Load more

Recommended publications
  • Molecular Basis of Disease Resistance in Banana Progenitor Musa Balbisiana Against Received: 25 September 2018 Accepted: 23 April 2019 Xanthomonas Campestris Pv
    www.nature.com/scientificreports OPEN Molecular Basis of Disease Resistance in Banana Progenitor Musa balbisiana against Received: 25 September 2018 Accepted: 23 April 2019 Xanthomonas campestris pv. Published: xx xx xxxx musacearum Leena Tripathi 1, Jaindra Nath Tripathi1, Trushar Shah1, Kariuki Samwel Muiruri1 & Manpreet Katari2 Banana Xanthomonas wilt disease, caused by Xanthomonas campestris pv. musacearum (Xcm), is a major threat to banana production in east Africa. All cultivated varieties of banana are susceptible to Xcm and only the progenitor species Musa balbisiana was found to be resistant. The molecular basis of susceptibility and resistance of banana genotypes to Xcm is currently unknown. Transcriptome analysis of disease resistant genotype Musa balbisiana and highly susceptible banana cultivar Pisang Awak challenged with Xcm was performed to understand the disease response. The number of diferentially expressed genes (DEGs) was higher in Musa balbisiana in comparison to Pisang Awak. Genes associated with response to biotic stress were up-regulated in Musa balbisiana. The DEGs were further mapped to the biotic stress pathways. Our results suggested activation of both PAMP-triggered basal defense and disease resistance (R) protein-mediated defense in Musa balbisiana as early response to Xcm infection. This study reports the frst comparative transcriptome profle of the susceptible and resistant genotype of banana during early infection with Xcm and provide insights on the defense mechanism in Musa balbisiana, which can be used for genetic improvement of commonly cultivated banana varieties. Banana Xanthomonas wilt (BXW), caused by the bacterium Xanthomonas campestris pv. musacearum (Xcm), is one of the most devastating disease endangering the livelihood of millions of farmers in east Africa, which is the largest banana-producing and -consuming region in Africa1.
    [Show full text]
  • Impact of Banana Xanthomonas Wilt on Farmers' Livelihoods in Kagera
    Vol. 9(7), pp. 279-286, July 2015 DOI: 10.5897/AJPS2015.1292 Article Number: 19632ED54360 ISSN 1996-0824 African Journal of Plant Science Copyright © 2015 Author(s) retain the copyright of this article http://www.academicjournals.org/AJPS Full Length Research Paper Adverse impact of Banana Xanthomonas Wilt on farmers’ livelihoods in Eastern and Central Africa Jackson Nkuba1*, William Tinzaara2, Gertrude Night3, Nicholas Niko4, Wellington Jogo2, Innocent Ndyetabula1, Leornard Mukandala1, Privat Ndayihazamaso4, Celestin Niyongere4, Svetlana Gaidashova3, Ivan Rwomushana5, Fina Opio5 and Eldad Karamura2 1Maruku-Agricultural Research and Development Institute, P.O. Box 127, Bukoba, Tanzania. 2Bioversity International, P.O. Box 24384, Kampala, Uganda. 3Rwanda Agriculture Board (RAB), Rwanda. 4Institut des Sciences Agronomiques du Burundi (ISABU), Burundi. 5Association for Strengthening Agricultural Research in Eastern and Central Africa, P.O. 765, Entebbe, Uganda. Received 9 March, 2015; Accepted 5 May, 2015 Banana is a key crop in the livelihoods of many people in the Great Lakes region of East and Central Africa. For more than a decade now, the crop has been threatened by Banana Xanthomonas Wilt (BXW) which has spread throughout the region but at different rates. The disease attacks all banana cultivars and can cause up to 100% yield losses at farm level if effective control measures are not put in place. However, limited information on impact of BXW at regional level is available to guide interventions. Thus, this study assessed the impact of BXW on farmers’ livelihoods in Kagera basin of Tanzania, Burundi and Rwanda. A total of 436 households (Tanzania 120, Burundi 208 and Rwanda 108) mostly from major banana-producing and BXW-affected districts were sampled and interviewed in a household survey.
    [Show full text]
  • Banana Xanthomonas Wilt: a Review of the Disease, Management Strategies and Future Research Directions
    African Journal of Biotechnology Vol. 6 (8), pp. 953-962, 16 April 2007 Available online at http://www.academicjournals.org/AJB ISSN 1684–5315 © 2007 Academic Journals Review Banana Xanthomonas wilt: a review of the disease, management strategies and future research directions Moses Biruma2, Michael Pillay1,2*, Leena Tripathi2, Guy Blomme3, Steffen Abele2, Maina Mwangi2, Ranajit Bandyopadhyay4, Perez Muchunguzi2, Sadik Kassim2, Moses Nyine2 Laban Turyagyenda2 and Simon Eden-Green5 1Vaal University of Technology, Private Bag X021, Vanderbijlpark 1900, South Africa. 2International Institute of Tropical Agriculture (IITA), P. O. Box 7878, Kampala, Uganda 3International Network for the Improvement of Banana and Plantain (INIBAP) P. O. Box 24384 Kampala, Uganda 4International Institute of Tropical Agriculture, Ibadan, Nigeria 5EG Consulting, 470 Lunsford Lane, Larkfield, Kent ME20 6JA, United Kingdom. Accepted 1 March, 2007 Banana production in Eastern Africa is threatened by the presence of a new devastating bacterial disease caused by Xanthomonas vasicola pv. musacearum (formerly Xanthomonas campestris pv. musacearum). The disease has been identified in Uganda, Eastern Democratic Republic of Congo, Rwanda and Tanzania. Disease symptoms include wilting and yellowing of leaves, excretion of a yel- lowish bacterial ooze, premature ripening of the bunch, rotting of fruit and internal yellow discoloration of the vascular bundles. Plants are infected either by insects through the inflorescence or by soil-borne bacterial inoculum through the lower parts of the plant. Short- and long-distance transmission of the disease mainly occurs via contaminated tools and insects, though other organisms such as birds may also be involved. Although no banana cultivar with resistance to the disease has been identified as yet, it appears that certain cultivars have mechanisms to ‘escape’ the disease.
    [Show full text]
  • Diagnostic and Management Guide Xanthomonas Wilt of Bananas
    Xanthomonas Wilt of Bananas in East and Central Africa Diagnostic and Management Guide E. B. Karamura, F. L. Turyagyenda, W. Tinzaara, G. Blomme, F. Ssekiwoko, S. Eden–Green, A. Molina & R. Markham Bioversity International Rome, Italy Bioversity Kampala, Uganda Bioversity International is an independent international scientific organization that seeks to improve the well-being of present and future generations of people by enhancing conservation and the deployment of agricultural biodiversity on farms and in forests. It is one of 15 centres supported by the Consultative Group on International Agricultural Research (CGIAR), an association of public and private members who support efforts to mobilize cutting-edge science to reduce hunger and poverty, improve human nutrition and health, and protect the environment. Bioversity has its headquarters in Maccarese, near Rome, Italy, with offices in more than 20 other countries worldwide. The Institute operates through four Programmemes: Diversity for Livelihoods, Understanding and Managing Biodiversity, Global Partnerships, and Commodities for Livelihoods. The international status of Bioversity is conferred under an Establishment Agreement which, by January 2008, had been signed by the Governments of Algeria, Australia, Belgium, Benin, Bolivia, Brazil, Burkina Faso, Cameroon, Chile, China, Congo, Costa Rica, COte d’lvoire, Cyprus, Czech Republic, Denmark, Ecuador, Egypt, Ethiopia, Ghana, Greece, Guinea, Hungary, India, Indonesia, Iran, Israel, Italy, Jordan, Kenya, Malaysia, Mali, Mauritania,
    [Show full text]
  • An Analysis of the Risk from Xanthomonas Campestris Pv
    An analysis of the risk from Xanthomonas campestris pv. musacearum to banana cultivation in Eastern, Central and Southern Africa by JJ Smith, DR Jones, E Karamura, G Blomme and FL Turyagyenda Bioversity International is an independent international scientifi c organization that seeks to improve the well-being of present and future generations of people by enhancing conservation and the deployment of agricultural biodiversity on farms and in forests. It is one of 15 centres supported by the Consultative Group on International Agricultural Research (CGIAR), an association of public and private members who support efforts to mobilize cutting-edge science to reduce hunger and poverty, improve human nutrition and health, and protect the environment. Bioversity has its head- quarters in Maccarese, near Rome, Italy, with offi ces in more than 20 other countries worldwide. The Institute operates through four programmes: Diversity for Livelihoods, Understanding and Managing Biodiversity, Global Partnerships, and Commodities for Livelihoods. The international status of Bioversity is conferred under an Establishment Agreement which, by January 2008, had been signed by the Governments of Algeria, Australia, Belgium, Benin, Bolivia, Brazil, Burkina Faso, Cameroon, Chile, China, Congo, Costa Rica, Côte d’Ivoire, Cyprus, Czech Re- public, Denmark, Ecuador, Egypt, Ethiopia, Ghana, Greece, Guinea, Hungary, India, Indonesia, Iran, Israel, Italy, Jordan, Kenya, Malaysia, Mali, Mauritania, Mauritius, Morocco, Norway, Oman, Pakistan, Panama, Peru, Poland, Portugal, Romania, Russia, Senegal, Slovakia, Sudan, Switzerland, Syria, Tunisia, Turkey, Uganda and Ukraine. Financial support for Bioversity’s research is provided by more than 150 donors, including govern- ments, private foundations and international organizations. For details of donors and research ac- tivities please see Bioversity’s Annual Reports, which are available in printed form on request from [email protected] or from Bioversity’s Web site (www.bioversityinternational.org).
    [Show full text]
  • Transgenic and Genome-Edited Fruits
    Lobato-Gómez et al. Horticulture Research (2021) 8:166 Horticulture Research https://doi.org/10.1038/s41438-021-00601-3 www.nature.com/hortres REVIEW ARTICLE Open Access Transgenic and genome-edited fruits: background, constraints, benefits, and commercial opportunities Maria Lobato-Gómez 1, Seanna Hewitt2, Teresa Capell1,PaulChristou1,3,AmitDhingra 2 and ✉ Patricia Sarai Girón-Calva 1 Abstract Breeding has been used successfully for many years in the fruit industry, giving rise to most of today’s commercial fruit cultivars. More recently, new molecular breeding techniques have addressed some of the constraints of conventional breeding. However, the development and commercial introduction of such novel fruits has been slow and limited with only five genetically engineered fruits currently produced as commercial varieties—virus-resistant papaya and squash were commercialized 25 years ago, whereas insect-resistant eggplant, non-browning apple, and pink-fleshed pineapple have been approved for commercialization within the last 6 years and production continues to increase every year. Advances in molecular genetics, particularly the new wave of genome editing technologies, provide opportunities to develop new fruit cultivars more rapidly. Our review, emphasizes the socioeconomic impact of current commercial fruit cultivars developed by genetic engineering and the potential impact of genome editing on the development of improved cultivars at an accelerated rate. 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; Introduction original variety the transgenic events should be derived The conventional breeding of fruit crops can take more from mature tissue (such as leaves) rather than embryo- than two decades due to the long juvenile period of woody genic explants3. species1. Genetic engineering allows improved varieties to The first genetically engineered fruit product (Flavr be developed more quickly, and the vegetative propaga- Savr™ tomato) was deregulated in 1992 and introduced tion of fruit trees allows the engineered cultivars to into the market in 19944.
    [Show full text]
  • THE STATUS of BANANA XANTHOMONAS WILT (Xanthomonas Campestris Pv Musacearum) in WESTERN KENYA 1 J.N
    THE STATUS OF BANANA XANTHOMONAS WILT (Xanthomonas campestris pv musacearum) IN WESTERN KENYA 1 J.N. Mbaka, 2 M. Mwangi, 2 V.G. Nakato, 3J.Auma and 4B. Odero 1Kenya Agricultural research Institute (KARI) National Horticultural Research Centre, Thika P.O. Box 220-01000, Thika, Kenya Tel. +254 67 24332 E-Mail [email protected] 2 International Institute for Tropical Agriculture (IITA) P.O Box 7878 Kampala, Uganda Tel +256 41 223445, 221009 Fax: +256 41 223494, 220217 Email: [email protected]:[email protected] 3 Rural Energy and Food Security Organisation (REFSO) P.O.Box 342, Busia, Kenya 4Catholic Relief Services (CRS) P.O. Box 49675-00100, GPO, Nairobi, Kenya Email: [email protected] Tel: 0733 401401 Mode of presentation in the KARI Conference 2008: ORAL Author for correspondence Jesca Njeri Mbaka National Horticultural Research Centre P.O. Box 220-0100, Thika, Kenya Email: [email protected] Tel: + 254 722 88 24 22 Mbaka et al Status of banana Xanthomonas wilt2 in Kenya- ABSTRACT Banana Xanthomonas Wilt (BXW), caused by the bacterium Xanthomonas campesris pv musacearum was reported in a single farm in Mukono district of Uganda in 2001. By early 2006 it was confirmed in 33 districts of Uganda, parts of Democratic Republic of Congo, Rwanda and Tanzania. Disease spread between plants is mainly by insect pollinators and contaminated farm tools. The main mode of long distance spread is banana trade (fruits, leaves and planting material). Insect transmitted infections lead to wilting and rotting of the banana male bud, pre-mature ripening and rotting of fingers that become unpalatable.
    [Show full text]
  • Fact Sheet Banana Xanthomonas Wilt
    Fact sheet Banana Xanthomonas wilt What is banana Xanthomonas wilt? Banana Xanthomonas wilt (caused by Xanthomonas vasicola pv. musacearum) is a devastating bacterial disease of banana in East and Central Africa. It has caused significant reductions in banana and enset production in Ethiopia since its discovery in 1968 and is now causing massive losses in other parts of Africa. The recent rapid spread is thought to be due to the suitability of environmental conditions and an abundance of vectors, as well as the relative increase in banana production. Banana Xanthomonas wilt is so severe that it can kill whole plants within a month of the first appearance of symptoms. The bacteria block the water conducting tissues of the plant, resulting in severe wilting, crop loss and eventually death of the entire plant mat. Whole plantations are commonly affected, causing complete loss of the crop. The bacterium survives well on infected plant material and moves easily in soil water, making this pest very difficult to manage. What do the symptoms look like? Symptoms include general wilting of the plant prior to flowering, fruit rotting and premature ripening and eventual death of the entire plant. What can it be confused with? Banana Xanthomonas wilt symptoms are similar to those of other bacterial wilts (blood disease, Moko and bugtok) and Panama disease. What should I look for? • Infected stems produce a thick yellow ooze 5–15 minutes after being cut. • Pockets of cream-yellow coloured bacterial Anthony Young ooze within leaf bases of the stem. Banana plant exhibiting yellowing and collapse of leaves typical of banana Xanthomonas wilt • Yellow and brown streaking in vascular tissues, especially the stem.
    [Show full text]
  • Banana Xanthomonas Wilt Xanthomonas Campestris Pv
    Banana xanthomonas wilt Xanthomonas campestris pv. musacearum Photo: Eric Boa, CABI, CC BY 4.0 Photo: Eric Boa, CABI, CC BY 4.0 BXW produces a distinctive premature ripening of BXW can be confused with Fusarium wilt, caused by fruit, which eventually rots. a fungus. The bacterial wilt affects younger leaves, though, and leaves collapse inwards. SUMMARY: Banana xanthomonas wilt (BXW) is named after the bacterium that infects the plant and eventually kills it. The disease has surged through Uganda since it was first found in 2001 and is now widespread in the region. All banana types are susceptible, though research has produced some promising results for future resistant varieties. The main management option for now is sanitation: planting healthy material, using clean cutting tools and removal of male buds to limit infection by bacteria-carrying insects as they collect nectar. BXW does not occur in West Africa and the other major bacterial wilt on banana worldwide, caused by Ralstonia solanacearum (Moko disease), is absent from all of Africa. KEY SIGNS The most distinctive feature of BXW is the premature ripening of fruit: individual bananas start to go yellow while others in the bunch remain green. When cut open, the bananas have dark stains, including those that are green. The bananas quickly blacken and eventually the whole bunch decays. The first signs of infection, however, are when the purple leaves (bracts) of the male flower bud shrivel, go black and die. Also look out for young leaves in the crown that go yellow, fold in the centre and then collapse.
    [Show full text]
  • Banana Xanthomonas Wilt Continues to Spread in Tanzania Despite an Intensive Symptomatic Plant Removal Campaign: an Impending Socio-Economic and Ecological Disaster
    Food Sec. DOI 10.1007/s12571-016-0609-3 ORIGINAL PAPER Banana xanthomonas wilt continues to spread in Tanzania despite an intensive symptomatic plant removal campaign: an impending socio-economic and ecological disaster Mpoki M. Shimwela1,2 & Randy C. Ploetz3 & Fen D. Beed4 & Jeffrey B. Jones2 & Jason K. Blackburn5 & Shabani I. Mkulila1 & Ariena H. C. van Bruggen2 Received: 7 April 2016 /Accepted: 29 July 2016 # Springer Science+Business Media Dordrecht and International Society for Plant Pathology 2016 Abstract Banana Xanthomonas wilt (BXW), caused by the campaign. However, pathogen transmission continued due to recently introduced pathogen Xanthomonas campestris pv. inconsistent sterilization of field tools and exposure of Xcm to musacearum (Xcm), is a limiting factor for banana production rain. Fields of poor farmers are at greatest risk because they in Kagera, Tanzania. A region-wide eradication campaign was borrow tools and are unable to impose some recommended initiated in 2013. The objectives were to gain insight into the management practices. After the appearance of BXW in indi- spatial and seasonal occurrences of BXW and into field man- vidual farms, the number of banana bunches consumed per agement practices. In 2015, 135 smallholder farmers were family per month decreased significantly from 13.1 to 6.4 with interviewed about BXW and management practices, and their a corresponding increase in areas planted to cassava and farms were assessed for incidence of the disease. BXW inci- maize. Based on these findings, we suggest refining the dence per ward in 2014, obtained from extension offices, and BXW management recommendations, in particular limiting space-time cluster analysis was performed with SaTScan.
    [Show full text]
  • Improving Banana for Resistance Against Xanthomonaswilt in Sub
    Project Progress Report 2012 Improving Banana for Resistance against Xanthomonas Wilt in Sub-Saharan Africa Message from the The Banana Xanthomonas Wilt provide a cost-effective method (BXW) pathogen, the cause of to develop varieties resistant to Project Coordinator this phenomenon, costs banana BXW. farmers millions of dollars in damages every year across The novel green pepper proteins East and Central Africa. The that give crops enhanced pathogen infects all varieties, resistance against deadly including East African Highland pathogens can also provide Banana and the exotic types. The effective control against other rapid spread of the disease has BXW-like bacterial diseases in endangered the livelihoods of other parts of the world. The millions of farmers who rely on mechanism of this resistance is banana for staple food and cash. such that it rapidly kills plant cells at the region of attempted There are presently no invasion by the pathogen and commercial chemicals, bio- forms a physical barrier to control agents or resistant prevent further infection. In varieties that could control the addition, it also activates the ananas are among the spread of BXW. Even if a source defences of surrounding and most important food of resistance is identified soon, even distant uninfected parts crops after maize, rice, developing a truly resistant of banana plants leading to a wheat, and cassava. banana through conventional systemic acquired resistance. BAnnual production in the world breeding would be quite difficult is estimated at 130 million and would take years, given the The transgenic approach brings tonnes, nearly one-third of it sterile nature and long gestation in more options of defence being grown in Sub-Saharan period of the crop.
    [Show full text]
  • Local and Regional Spread of Banana Xanthomonas Wilt (BXW) in Space and Time in Kagera, Tanzania
    Plant Pathology (2017) 66, 1003–1014 Doi: 10.1111/ppa.12637 Local and regional spread of banana xanthomonas wilt (BXW) in space and time in Kagera, Tanzania M. M. Shimwelaab*, J. K. Blackburnc, J. B. Jonesd, J. Nkubaa, H. A. Narouei-Khandanb, R. C. Ploetze, F. Beedf and A. H. C. van Bruggenb aARI-Maruku, PO Box 127, Bukoba, Tanzania; bUniversity of Florida, Plant Pathology Department and Emerging Pathogens Institute, University of Florida, Gainesville FL23611; cSpatial Epidemiology and Ecology Research Laboratory, Department of Geography, University of Florida, and Emerging Pathogens Institute, University of Florida, Gainesville FL23611; dPlant Pathology Department, University of Florida, Gainesville FL23611; ePlant Pathology Department, University of Florida, TREC – Homestead FL33031, USA; and fResearch & Development Building, AVRDC – The World Vegetable Centre, Kasetsart University Bangkhen, Bangkok 10900, Thailand Banana is an important crop in the Kagera region of Tanzania. Banana xanthomonas wilt (BXW) was first reported in Kagera in 2006, and is now an important limiting factor in banana production, because all cultivars are susceptible and infected plants can fail to produce fruit. BXW is caused by Xanthomonas campestris pv. musacearum (Xcm), which is spread by farm tools, infected planting materials, and pollinating insects. Practices that address Xcm dissemi- nation, such as mat removal, debudding and tool sterilization, have not prevented the spread of BXW in the region. Disease surveys were conducted in Kagera from 2007 to 2011 to assess BXW presence, monitor its intensity and evalu- ate its socioeconomic impacts. Spatiotemporal clusters of BXW were analysed with ARCGIS and SAS. The relationship between BXW clusters and environmental variables was examined using bivariate correlations in SPSS; two modelling approaches, MaxEnt (maximum entropy) and logistic regression, were used to predict the potential distribution of BXW in Tanzania.
    [Show full text]