GENETIC MODIFICATION OF THERMOTOGA TO DEGRADE CELLULOSE
Hui Xu
A Dissertation
Submitted to the Graduate College of Bowling Green State University in partial fulfillment of the requirements for the degree of
DOCTOR OF PHILOSOPHY
August 2015
Committee:
Zhaohui Xu, Advisor
R. Marshall Wilson Graduate Faculty Representative
George Bullerjahn
Robert McKay
Scott Rogers
©2015
Hui Xu
All Rights Reserved iii
ABSTRACT
Zhaohui Xu, Advisor
Thermotoga spp. can effectively utilize a variety of carbohydrates to generate hydrogen gas, making them great candidates for biofuel production. However, their ability to degrade cellulose, the most common and renewable organic material on Earth, is rather limited due to a lack of exo-glucanases. To address this deficiency, firstly technical preparations were done: the methylase M.TneDI was overexpressed in E. coli and could be used for in vitro methylation, which could enhance transformation efficiency of Thermotoga; a natural transformation protocol was optimized in T. sp. strain RQ2, which provided the convenience of genetic engineering of
Thermotoga. Then cellulase genes Csac_1076 (celA) and Csac_1078 (celB) from
Caldicellulosiruptor saccharolyticus DSM 8903 were cloned into T. sp. strain RQ2 for heterologous overexpression. Thermotoga-E. coli shuttle vectors pHX02, pHX04 and pHX07
carrying celA or celB were successfully constructed and naturally transformed into T. sp strain
RQ2. Recombinant cellulases were successfully expressed and secreted outside hosts, and the resulting T. sp. strain RQ2 transformants demonstrated enhanced abilities of cellulose
degradation (endo- and/or exo-glucanase activities). Even though the T. sp. strain RQ2
transformants are not stable as indicated by loss of enhanced cellulase activities after three
consecutive transfers, this is still the first time heterologous genes larger than 1 kb (up to 5.3 kb)
have been expressed in Thermotoga, and definitely a milestone of genetic engineering of
Thermotoga to utilize cellulose.
iv
Dedicated to my wife, Yuanyuan, my son, Felix, my daughter, Fiona and my family.
v
ACKNOWLEDGMENTS
I would like to deeply thank my advisor, Dr. Zhaohui Xu, for her mentoring, help,
patience, encouragement, support and guidance. I am extremely grateful to the committee
members, Dr. George Bullerjahn, Dr. Robert Michael McKay, Dr. Scott O. Rogers, and Dr. R.
Marshall Wilson, for their suggestions and help in the completion of this dissertation.
I would like to thank Dr. Paul Morris and Dr. Carol Heckman, for their helpful discussions. I would like to extend my thanks to my lab members: Dr. Dongmei Han, Rutika
Puranik, Jacob Newmister, Jyotshana Gautam, Joseph Awora Owino and Huimin Zhang for their help and discussions in the lab.
I would like to thank Chris Hess, Susan Schooner, Steve Queen, Sheila Kratzer, and Dee
Dee Wentland, for all their help.
I would like to thank my wife, Yuanyuan, my son, Felix, my daughter, Fiona and my family, for their understanding, support, and patience.
vi
TABLE OF CONTENTS
Page
GENERAL INTRODUCTION ...... 1
What is Thermotoga? ...... 1
Thermotoga with O2 ...... 2
Thermotoga with H2 ...... 3
Evolution and horizontal (or lateral) gene transfer of Thermotoga ...... 5
Thermotoga with genetic tools ...... 6
Genomics, transcriptomics, and proteomics of Thermotoga ...... 8
Cellulose and cellulases ...... 9
Thermotoga with carbohydrate-active enzymes ...... 12
Goals of this study ...... 14
CHAPTER I. OVEREXPRESSION OF A LETHAL METHYLASE M.TNEDI IN E. COLI
BL21(DE3) ...... 15
Introduction ...... 15
Materials and Methods ...... 16
Strains and cultivation conditions ...... 16
Plasmid and chromosome DNA extract ...... 20
Preparation and assay of M.TneDI ...... 21
Results and Discussion ...... 21 vii
Confirmation of the McrBC background in BL21(DE3) ...... 21
Screening for BL21(DE3) transformants expressing functional M.TneDI ...... 23
Expression of M.TneDI in BL21(DE3)/pDH21#3...... 26
Comparison of the M.TneDI activities in BL21(DE3)/pDH21#3 and XL1-Blue
MRF’/pJC340 ...... 26
Stability of E. coli BL21(DE3)/pDH21#3 expressing M.TneDI ...... 29
Exploration of restriction-modification (R-M) system TneDI in Thermotoga
strains ...... 31
Conclusion ...... 36
CHAPTER II. OPTIMIZATION OF NATURAL TRANSFORMATION OF THERMOTOGA
STRAINS ...... 37
Introduction ...... 37
Materials and methods ...... 39
Strains and cultivation conditions ...... 39
Natural transformation in Thermotoga sp. strain RQ2 ...... 40
Results and Discussion ...... 41
Optimization of culturing Caldicellulosiruptor saccharolyticus DSM 8903 .. 41
DNA stability in transformation environment ...... 42
Confirmation of natural transformation in Thermotoga sp. strain RQ2 ...... 43
Optimization of natural transformation ...... 47
Application of methylase M.TneDI in natural transformation ...... 47 viii
Conclusion ...... 49
CHAPTER III. EXPRESSION OF HETEROLOGOUS CELLULASES IN THERMOTOGA SP.
STRAIN RQ2...... 50
Introduction ...... 50
Materials and methods ...... 52
Strains and cultivation conditions ...... 52
Construction of vectors ...... 55
Detection of endoglucanase activity with CMC plates ...... 62
Detection of endoglucanase activities with zymogram ...... 62
Detection of exoglucanase activity ...... 63
Results and discussion ...... 63
Expression and localization of the chimeric enzymes in E. coli ...... 63
Detection of endoglucanase activities in Thermotoga ...... 66
Validating Thermotoga transformants ...... 68
Detection of the exoglucanase activity in Thermotoga...... 71
Localization of the recombinant cellulases in Thermotoga ...... 73
Stabilities of the recombinant strains ...... 74
Conclusion ...... 80
SUMMARY ...... 81
REFERENCES ...... 83
ix
LIST OF FIGURES
Figure Page
1 Schematic representation of the hydrolysis of amorphous and microcrystalline cellulose by
noncomplexed (A) and complexed (B) cellulase systems ...... 11
2 Screening of 30 E. coli BL21(DE3)/pDH21 transformants expressing methylase M.TneDI
...... 25
3 SDS-PAGE analysis of M.TneDI ...... 26
4 Methylase M.TneDI activity Comparison of E. coli XL1-Blue MRF’/pJC340 and E. coli
BL21(DE3)/pDH21#3 ...... 28
5 Investigation of stability of E. coli BL21(DE3)/pDH21#3 ...... 30
6 Exploration of restriction-modification (R-M) system TneDI in Thermotoga ...... 32
7 Protection of M.TneDI on total DNA of T. sp. strain RQ7 ...... 33
8 Digestions of Thermotoga total DNA with BstUI ...... 35
9 Growth curve of Caldicellulosiruptor saccharolyticus DSM 8903 on different
concentrations of cellobiose ...... 42
10 Degradation of genomic DNA of Caldicellulosiruptor saccharolyticus DSM 8903 in fresh
SVO medium (A) and in overnight supernatant of Thermotoga sp. strain RQ7 (B) .... 43
11 Transformation frequency of Thermotoga sp. strain RQ7 and Thermotoga sp. strain RQ2
...... 45
12 Verification of transformants Thermotoga sp. strain RQ2/pDH12 using PCR ...... 46
13 Maps of the expression vectors pHX02 (A), pHX04 (B) and pHX07 (C) ...... 59
14 Detection of endoglucanase activities in E. coli DH5α transformants (showing
DH5α/pHX02 as an example) ...... 64 x
15 Localization of recombinant enzymes in E. coli DH5α transformants ...... 65
16 Screening of endoglucanase activities in Thermotoga transformants RQ2/pHX02 (A),
RQ2/pHX04 (B) and RQ2/pHX07 (C) ...... 67
17 Amplification of the exoglucanase domain in Thermotoga sp. strain RQ2 transformants
...... 69
18 Restriction digestion of PCR products of the exoglucanase domain of Thermotoga sp.
strain RQ2 transformants...... 70
19 Detection of exoglucanase activities in T. sp. strain RQ2 transformants ...... 72
20 Localization of recombinant proteins in T. sp. strain RQ2 transformants ...... 73
21 Stabilities of the E. coli recombinant strains at DNA level ...... 75
22 Stabilities of the E. coli recombinant strains at protein level ...... 76
23 Expression of the E.coli recombinant strains with induction ...... 77
24 Stabilities of the Thermotoga sp. strain RQ2 recombinant strains based on endoglucanase
(A) and exoglucanase activities (B) ...... 79
xi
LIST OF TABLES
Table Page
1 Strains and vectors used in Chapter I ...... 18
2 Transformation comparison between XL1-Blue MRF’ and BL21(DE3) ...... 23
3 Number of Thermotoga sp. strain RQ2 transformants resulting from M.TneDI methylated
and unmethylated DNA ...... 48
4 Number of predicted carbohydrate-active enzymes in Thermotoga genomes ...... 52
5 Strains and vectors used in Chapter III ...... 53
6 Nucleotide sequences of primers ...... 57 1
GENERAL INTRODUCTION
What is Thermotoga?
Thermotoga strains are anaerobic, hyperthermophilic bacteria. They are non-sporulating,
Gram-negative and rod-shapped, and have a unique sheath-like outer membrane, called a “toga”.
There have been 11 type strains available: T. maritima [1], T. neapolitana [2], T. thermarum [3],
T. elfii [4], T. subterranean [5], T. hypgea [6], T. petrophila and T. naphthophila [7] and T.
lettingae [8], T. profunda and T. caldifontis [9]. The strains were isolated from hot springs,
submarine thermal vents, an oil well, an oil reservoir, geothermal heated marine sediment and
some other high-temperature environments. Their optimum growth temperature is in the range of
60°C-80°C [9]. At present there are 66 strains listed in NCBI taxonomy database (updated on
Feb 26th, 2015).
In T. maritima, it was noticed that the sheath-like structure was comprised of subunits in
a hexagonal array [1]. Later electron microscopy and biochemical analyses proved that the toga
was the outer-membrane. One protein was 42 kDa (open reading frame [ORF] not identified) carrying the features of trimeric porins, resembling the classic OmpF of E.coli [10]. This porin-
like protein was confirmed to be a true porin with 4.4 fold selectivity for cations over anions,
which was also called Ompβ because of its predominant β-sheet secondary structure [11].
Another protein associated with the toga was also purified and characterized, which was called
Ompα (Tm1729) because of its predominant α-helical structure and spanned the periplasm to make the outer-membrane connected to inner-membrane [12]. It was still unclear how Ompα
exactly connects the outer-membrane and inner-membrane. It was demonstrated that MreB protein (bacterial actin) of T. maritima was directly bound to the membrane through an insertion
loop [13], which was up-regulated during stationary phase [14] and might be related to the 2
corresponding morphology change from rod to sphere [1, 14]. Except for these structural
proteins, some enzymes are also attached to the toga, for example, amylase A [15-17] and
xylanase A [16].
Thermotoga with O2
Even though Thermotoga strains are anaerobic, they have various degrees of oxygen tolerance. Exposed to air at low temperature, T. maritima culture can still be used as inocula for
over a year, even though high temperature with oxygen would kill T. maritima strains [1]. Later
T. maritima was reported to be able to grow with oxygen concentration up to 0.5% (v/v) in gas
phase [18]. Strain NS-E, which is later described as T. neapolitana [2], only showed oxygen
sensitivity when the temperature was at or above the growth temperature range [19, 20].
Actually, T. neapolitana and T. hypgea could grow in the presence of micro-molar levels of
oxygen at growth temperature 70°C [21, 22]. Tolerance of Thermotoga to oxygen must be
related to the isolation habitats where temporary exposure to oxygen might occur [23]. Besides,
exposure to oxygen also shifted the glucose fermentation into lactate production [24]. Because of
tolerance of Thermotoga to oxygen, it is very convenient to handle Thermotoga strains on the
bench top [20, 25-27], while obtaining relatively high plating efficiency [20, 25, 26].
The NAD(P)H oxidases catalyze the oxidation of NAD(P)H and the reduction of oxygen
into H2O, which are found in many anaerobic microorganisms and are considered as a defense
mechanism for anaerobes to reduce the toxicity of oxygen [28, 29]. In fact, two NADH oxidase
genes and one putative alkyl hydroperoxide reductase gene are found in T. maritima genome
[30]. NADH oxidases purified and characterized from T. maritima (TM1432 and TM1433) and
T. hypgea, were proposed to be coupled to hydrogen peroxide-scavenging enzymes to be part of
oxygen-scavenging systems in Thermotoga strains [22, 31]. However, no NADH peroxidase was 3
found in genome of T. maritima [30]. Probably NADH-independent peroxidases TM0657
(rubrerythrin) and TM0807 (alkyl hydroperoxide reductase AhpC) catalyzed the following reduction of hydrogen peroxide into H2O [31]. Under oxidative conditions, T. maritima
overexpressed i) TM0755 operon: oxygen reductase (TM0755), NADH oxidoreductase
(TM0754), and genes for possible formation of biofilm, which is used as a protective strategy: α-
glucosidase (TM0752), a galactosyl transferase (TM0756), and a glucosyl transferase (TM0757),
and ii) proteins involving in reactive oxygen species (ROS) detoxification: a rubrerythrin
(TM0657), a neelaredoxin (TM0658) and a rubredoxin (TM0659), iron-sulfur center
synthesis/repair: FeS assembly ATPase SufC (TM1368), and the cysteine biosynthesis pathway: a cysteine synthase (TM0665) and an O-acetylhomoserine sulfhydrylase (TM0882) [18]. It was proposed that oxygen reductase FprA (TM0755) directly eliminate oxygen into H2O when
exposed to the low oxygen concentration, and ROS-scavenging systems: alkyl hydroperoxide reductase and peroxiredoxin-encoding genes were expressed when exposed to added peroxide and oxygen [18, 32]. It was also proposed that three-partner chain involving an NADH oxidoreductase (NRO) (TM0754), a rubredoxin (Rd) (TM0659) and an oxygen reductase (FprA)
(TM0755) plays a key role in O2 tolerance of T. maritima [23].
Thermotoga with H2
H2 is a clean and renewable energy which is oxidized to water, compared with fossil
fuels which release carbon-based emissions causing environmental pollution and climate change
[33]. Besides, H2 has other features of rapid burning speed, higher energy yield, and high octane
number [34], which make hydrogen to be a potential future energy source. Pyrolysis, electrolysis
and bioprocesses can produce H2, among which only bioprocesses have a low energy
requirement, low cost and few environmental problems [33, 35]. H2 was the major fermentation 4
product observed in Thermotoga, and elemental sulfur decreased the H2 production to 40% [1].
Thermotoga strains could utilize a variety of substrates to produce H2: glucose, xylose, arabinose,
cellobiose, glycerol, CMC (Carboxymethyl cellulose), starch and etc. [35-38].
-1 Many bacteria can produce H2 ranging from 1 to 2.5 mol H2 mol glucose, but
-1 Thermotoga strains can produce H2 around the maximum theoretical yield of 4 mol H2 mol
glucose [36], which is also called Thauer limit [34, 39]. Embden-Meyerhoff glucose catabolism
pathway was confirmed in T. maritima [40], and later it was proposed that high H2 yield was related to bifurcating iron-hydrogenase [41]. In addition to high rate of H2 production in
Thermotoga, there are still other advantages of H2 fermentation: Thermotoga are anaerobes, which survive in a reducing environment where H2 molecules are stable; and they are
hyperthermophiles, which survive in a very high-temperature environment which
thermodynamically favors H2 production and decreases microbial contamination during
fermentation and cooling cost [42, 43].
Co-culture of mixed H2-producing bacteria was investigated to enhance H2 production. It
was reported that co-culture of Clostridium thermocellum and Thermoanaerobacterium
thermosaccharolyticum made Clostridium thermocellum have more than 2-fold H2 yield increase
than Clostridium thermocellum alone [44]. Co-culture of Clostridium acetobutylicum and Ethanoigenens harbinense had enhanced H2 production compared with Clostridium
acetobutylicum alone [45]. Also sequential co-culture of Enterococcus gallinarum and
Ethanoigenens harbinense also increased the H2 yield of Enterococcus gallinarum [46]. Co-
culture of Caldicellulosiruptor saccharolyticus and Caldicellulosiruptor kristjanssonii had
higher H2 production rate than either strain alone [45]. In regards to Thermotoga strains, co-
culture of T. maritima and Methanococcus jannaschii could increase cell density of T. maritima 5
5 times [47]. It was proposed that Caldicellulosiruptor and Thermotoga strains are almost the perfect ideal H2 producers, which should have these features: a). thermophilic; b). available
genetic tools; c). having Fd-dependent hydrogenases; d). not auxotrophic to amino acids; e).
utilizing a variety of substrates; f). no carbon catabolite repression; g) shifting metabolism under
stress; h). tolerant to osmotic stress; i). tolerant to oxygen [34]. It is still unclear whether co-
culture of Thermotoga strains themselves or Thermotoga strains with other species will enhance
the H2 rate. In silico re-design of T. maritima metabolism yielding enhanced H2 production is a
future goal [48].
Evolution and horizontal (or lateral) gene transfer of Thermotoga
Thermotoga was indicated as one of the deepest branches in the phylogenetic tree of
small subunit ribosomal RNA (SSU rRNA) [49, 50]. However, it is not clear whether
Thermotoga was more ancient than Aquifex, or vice versa [30, 51]. It was also confirmed that
Thermotogales was a sister group to Aquificales based on ribosomal protein genes, and
phylogeny within the proteome showed Thermotogales were members of class Clostridia within
the Firmicutes [52]. Phylogenetic analysis based on tRNAs suggests that the last bacterial
common ancestor (LBACA) was closest to hyperthermophilic Thermotoga [53], which is
consistent with the conclusion that the last universal common ancestor (LUCA) was
hyperthermophile [54]. Besides, conserved signature indels (CSI) in protein sequences of
Thermotoga strains [55], would help to systematically identify Thermotoga strains in the future.
Lateral gene transfers play important roles in the evolution [56-58]. T. maritima and T.
petrophila shared 11% ORFs (Open Reading Frame) with Archaea, and T. lettingae shared 9%
[52]. Phylogenetic analyses of the large subunit of glutamate synthase (gltB) and the myo-inositol
1P synthase (ino1) genes found in Thermotoga strains, showed that they were acquired from 6
archaea during evolution [59]. The phylogenetic analyses of three-partner oxygen reduction
system: NRO, Rd and FprA suggested that the ancestor of Thermotoga or Thermotogales
acquired these genes from an ancestor of Thermococcales by single gene transfer event [23].
Aside from the lateral gene transfer events between Thermotoga and archaea, genetic exchange was also indicated among Thermotoga species [60, 61]. Another indirect indicator of possible
lateral gene transfers is co-existence of Thermotoga species with other bacteria and archaea in
the same locations: high-temperature hydrocarbon reservoir in the Bass Strait [62], high-
temperature petroleum reservoir at an offshore oilfield [63] and geothermally heated sea floor of
Vulcano [1, 64], which might make them have high chance of contact with each other and
consequent genetic exchanges. All these emphasize on the evolutionary significance of
Thermotoga.
Thermotoga with genetic tools
Methods of introducing foreign DNA into host cells include natural processes and
artificial means [65]. Besides, lightning-triggered electroporation and electrofusion [66] was also
proposed. Due to the lack of genetic tools, it is difficult to conduct genetic modification with
Thermotoga. Even though conjugation, natural transformation and electro-transformation were
attempted and failed in T. neapolitana [65, 67], liposome-mediated transformation in T.
neapolitana and T. maritima [68] and electroporation transformation in T. maritima and T. sp.
strain RQ7 [25] did succeed. However, both methods are time-consuming and have low
efficiency.
Natural transformation is an effective way for microorganisms to gain foreign DNA,
which exists among many microorganisms and needs competence genes, ComM, ComE, ComEC,
ComFC, and etc. [69-73]. In general, two steps are involved: the first step is the transfer of 7
foreign DNA from cell surface to cytoplasmic membrane, and the second step is the
translocation of foreign DNA across the cytoplasmic membrane [74]. Almost all of these
competence genes are present among all the Thermotoga strains since the first published genome
[30]. Further experimental evidence showed that natural transformation occurred in T. sp. strain
RQ7 [26], and T. sp. strain RQ2 [27, 75], which provides the convenience for genetic engineering of Thermotoga.
Restriction-modification (R-M) systems are thought as the primitive immune system because of the function in differentiating self and non-self DNA [76, 77], and R-M systems are mainly divided into four types (I, II, III and IV) [78]. The type II R-M system, TneDI, which are widely distributed among Thermotoga strains, provides the barrier to genetically modify
Thermotoga strains [79]. Besides, CRISPR-Cas (CRISPR, clustered regularly interspaced short palindromic repeats; Cas, CRISPR-associated genes) can serve as an adaptive immunity system, due to spacers as memory of earlier phage and plasmid evasions [80-83]. The presence of
CRISPR in Thermotoga implies that these organisms are subject to phage and/or plasmid
infections [52]. Isolation and characterization of Thermotoga-specific phages could lead to
another direction for developing genetic tools.
It was reported that CRISPR-Cas and restriction-modification systems worked together to
prevent phage invasions, and methylation of phage DNA didn’t escape CRISPR-Cas degradation
[84]. CRISPR Interference could prevent natural transformation in Streptococcus pneumoniae
[85]. CRISPR existing among Thermotoga strains [60], might impair natural tansformation of
Thermotoga.
8
Genomics, transcriptomics, and proteomics of Thermotoga
Since the first genome of T. maritima was published in 1999 [30], there are several more
Thermotoga strains sequenced: T. neapolitana DSM 4359 [86], T. petrophila RKU-1 and T.
lettingae TMO, [52], T. sp. strain RQ2 [87], T. profunda and T. caldifontis [9], and etc. In the
NCBI genome database, there are 11 entries of complete genome sequence available (updated on
Mar 10th, 2015).
The first genome of T. maritima provided the evidence of lateral gene transfer between
Thermotoga and archaea [30]. Further genomic analysis showed that strong binding free energies of RBS (ribosome binding site) and high conservation of promoter and RBS sequence might explain the hyperthermophilic lifestyle of Thermtoga [88]. Comparative genome hybridization
(CGH) study using T. maritima as reference [60] and suppressive subtractive hybridization (SSH)
[61] showed more evidences for gene rearrangement and insertions, genomic diversity among
different Thermotoga strains. Multiple genome comparison of Thermotoga strains not only
revealed unique genes belonging to each species, but also showed the recombination events [52].
Even though CRISPRs found in Thermotoga strains indicated the potential phage invasions, no
prophage was discovered in the genomes of Thermotoga [52, 60]. Natural transformation [26, 27,
75], recently discovered among Thermotoga strains, might contribute to the genome diversities
of Thermotoga and play a role in the evolution of Thermotoga. A transcriptomic study based on
carbohydrate utilization suggested variations in regulations among Thermotoga strains [89, 90].
Thermotoga strains have the priority in industrial applications because they naturally co-ferment
glucose and xylose [89]. Transcriptomic study focusing on growth phase transition showed that
putative small peptides or proteins encoded in locus (TM1298-TM1336) of T. maritima might
play some roles of physiology and ecology, and serve as potential antimicrobial agents [14]. 9
Proteomics study of T. maritima showed that many proteins in central carbohydrate metabolism
were upregulated upon thermal stress [91], which was not consistent with previous
transcriptomic study that many SOS regulon genes were upregulated during heat stress [92].
Models of metabolism and expression (ME-Model) in T. maritima might possess significance in
future study on molecular and cellular physiology [93].
Along with the large amount and complexity of data available, methods and tools for
multi-omics data analysis are still incomplete. More bioinformatics work needs to be done with
Thermotoga to elucidate the mechanisms of lateral gene transfer, gene rearrangement, thermo-
adaptation, evolution, phylogenetic taxonomy, metabolic pathway engineering, etc..
Cellulose and cellulases
Cellulose is most abundant renewable biomass [94]. Every year, about 56 x109 tons net
CO2 is fixed by photosynthesis of land plants, and biomass by land plants are about 170-200 x109 tons, of which, about 70% is in plant cell walls [95]. In general, cellulose is the core
component of plant cell wall [96], which also consists of pectin [97], hemicellulose [98], and proteins and glycoproteins [99]. However, some bacteria (eg. Gluconacetobacter xylinus) [100] and the only known members of metazoan taxon can also produce cellulose [101-104]. Typically
about 35-50% of plant dry weight is cellulose [105], such as 34.9% of wheat straw, 39.4% of
corn stover, 46.1% of switchgrass [95].
Cellulose is a linear polymer of D-glucopyranose linked by β-1,4-glycosidic bonds with a
degree of polymerization (DP) from 100 to 20,000 [106]. For example, cellulose of wood and
cotton has the degree of polymerization 10,000 and 15,000, respectively [107]. Natural cellulose
contains crystalline regions (highly ordered through hydrogen bond and Van der Waals force)
and amorphous regions (disordered) [108]. The crystallinity index (CI) was used to measure the 10
crystalline regions in cellulose, and generally CI ranging from 0.45-0.9, such as cotton 0.81-0.95,
filter paper 0-0.45 [106, 108]. Cellulose cannot dissolve into H2O and many organic solvents
[109], and is very stable with a half-life of 5-8 million years for β-glucosidic bond cleavage at
25°C [94, 110]. However, enzymatic degradation will be much faster than non-catalyzed
hydrolysis [110].
Cellulose biodegradation is vital for agricultural and waste treatment to produce
bioenergy (eg. bioethanol and bio-hydrogen) which can cope with the depleting of fossil fuels
[111-115]. Generally speaking, enzymatic cellulose degradation needs three enzymes working
together: endo-1,4-β-glucanase (EC 3.2.1.4), exo-1,4-β-glucanase (also called cellobiohydrolase)
(EC 3.2.1.91), and β-glucosidase (EC 3.2.1.21) [116-119]. Endoglucanase randomly breaks
down the β-1,4 linkages in the amorphous regions to produce new ends, exoglucanase
processively removes cellobiose units from the ends of cellulose chains, and β-glucosidase
converts cellobiose into glucose. There are two cellulase systems: 1.) non-complexed system,
includes the free endoglucanse, exoglucanase, β-glucosidase; 2.) complexed system
(cellulosome), has no free enzymes, but forms a multiple-enzyme complex (Figure 1). A typical cellulosome consists of a scaffoldin subunit, cohesin modules, dockerin modules, and catalytic subunits (cellulases). Cohesin modules on the scaffoldin will interact with the dockerin modules on each enzymatic subunit, and cellulosome complex is anchored on cell surface through anchoring protein and attached to cellulose by cellulose-binding module (CBM) in the scaffodin subunit, consequently making all these enzymes working synergistically [120]. CBM modules are also found in some catalytic cellulases, eg. Csac_1076 (CelA), Csac_1078 (CelB), and
Csac_1079 (CelC) in Caldicellulosiruptor saccharolyticus [121], which can increase the catalytic activities through close and prolonged association with substrates [122]. 11
Figure 1 Schematic representation of the hydrolysis of amorphous and microcrystalline cellulose by noncomplexed (A) and complexed (B) cellulase systems. The solid squares represent reducing ends, and the open squares represent nonreducing ends. Amorphous and crystalline regions are indicated. Cellulose, enzymes, and hydrolytic products are not shown to scale. The figure and legend are taken from reference [105].
12
Microorganisms with the ability of hydrolysis and utilization of cellulose, are widely
spread in domain Bacteria and in fungi kingdom of domain Eucarya, but not in domain Archaea
[105]. In bacteria, some use the non-complex celluase systems, eg. Cellulomonas, Thermobifida,
Caldicellulosiruptor, and some use the cellulosome systems, eg. Clostridium, Acetivibrio and
Bacteroides [123]; in fungi, some use the non-complex celluase systems, eg. Trichoderma,
Aspergillus and Phanerochaete [105, 124], and some use the cellulose systems, eg. Anaeromyces,
Neocallimastix, and Orpinomyces [108, 124]. However, there are no reports about
hyperthermophilic microorganism (Topt ≥80°C), which can utilize the crystalline cellulose.
Cellulases are widely used in textile industry, detergent industry, food industry, pulp and paper industries [94, 108, 125, 126]. Most commercially available cellulases are from fungi
Trichoderma and Aspergillus species [94, 125, 126]. The large potential market of cellulases
prompts the development of cellulases, which have higher catalytic efficiency, higher thermo- stability, and higher end-product inhibition tolerance [94]. Cellulase engineering includes 1.)
rational design, based on known cellulase structures and catalytic mechanisms; 2.) directed
evolution, based on screening of cullulase with novel properties after random mutagenesis and
recombination [94]. Site mutagenesis of position Glu64 near the catalytic center to serine in T.
maritima Cel12B (TM1525) enhanced the endoglucanase activity about 30% [127]. Random
mutagenesis using error-prone PCR created mutants of Clostridium cellulovorans endogluanases
EngB and EngD with about seven-fold enhanced thermo-stability without compromising the
catalytic activity [128].
Thermotoga with carbohydrate-active enzymes
Thermotoga strains carry a large amount of genes related to carbohydrate-active enzymes
in the genomes: glycoside hydrolase family, glycosyl transferase family, polysaccharide lyase 13 family, carbohydrate esterase family and carbohydrate-binding module family
(http://www.cazy.org/), about 37 genes above per Mb genome sequence [129], of which some are directly purified and characterized from Thermotoga strains and some are cloned, expressed and characterized in E. coli.
In T. sp. strain FjSS3-B.1, exo-1,4-β-cellobiolhydrolase [118] and endo-1,4-β-xylanase
[130] were purified and characterized from culture supernatant and cell lysate, respectively. In T. maritima, cellulase I and cellulase II [116], amylase [17], and xylanases A and B [16, 131] were purified and characterized from cell lysates. α-amylase A (TM1840) [15], α-amylase B (TM1650)
[132], α-amylase B (TM1650) and α-amylase C (TM1438) [133, 134] were further cloned and characterized in E. coli, among which, α-amylase A from T. maritima was the first amylase with transglycosylation function [135]. Xylanase genes, eg. XynA (TM0061) from T. maritima [136], and XynB (Theth_1636) from T. thermarum [137] were also cloned and characterized in E. coli.
Endo-glucanases Cel12A (TM1524) and Cel12B (TM1525) [127, 138], Cel5A (TM1751) and
Cel5B (TM1752) [139-141], and Cel74 (TM0305) [142] were also cloned and characterized in E. coli. Cel5B (TM1752) is a special endo-glucanase because it also has the lichenase activity [143].
Some other characterized carbonhydrate-active enzymes in Thermotoga include β-glucosidase
(TM1862) [144], mannanase (TM1227) [139], etc..
Because of thermo-stability, resistance to detergents and proteinase, etc., enzymes from hyperthermophilic microbes are widely used in industrial applications [132]. xylanases can be used in textile, paper and pulp, food industry, animal feed, and pharmaceutical and chemical applications [137, 145-147]; amylases are widely used in food industry, and detergents, fuel alcohol production, textile industry, and paper industry [148-150]; mannanases are also used in oil and gas industries and bioethanol production [151, 152]. 14
Goals of this study
Scanning of Thermotoga genomes suggests that none of the available strains has exo- glucanase genes. Lacking of exo-glucanase genes leads to limited cellulose degradation in
Thermotoga.
The goal of this study is to genetically modify Thermtoga strains to degrade cellulose
efficiently (Chapter III). However, technical preparations need to be done before genetic
modification of Thermtoga to utilize cellulose, a.) overexpression of the methylase M.TneDI for
in vitro methylation of foreign DNA (Chapter I); b.) optimization of natural transformation of
Thermotoga (Chapter II), which provides the effective transformation method and convenience
for genetic modification of Thermtoga. Subsequently, Thermotoga-E. coli shuttle vectors
carrying cellulases from Caldicellulosiruptor were successfully constructed and transformed into
T. sp. strain RQ2, which showed enhanced cellulose degradation abilities.
15
CHAPTER I. OVEREXPRESSION OF A LETHAL METHYLASE M.TNEDI IN E. COLI BL21(DE3)
Introduction
A type II RM system, TneDI, has been characterized in T. neapolitana [79], which has a
great potential in producing hydrogen gas, thermostable enzymes, and chemical intermediates.
The restriction enzyme R.TneDI cuts DNA at the center of the recognition site (CG↓CG), and
the cognate methylase M.TneDI modifies one of the cytosines and prevents the cleavage. This
RM system imposes a barrier for genetic modification of Thermotoga spp., for if not properly
modified the recombinant DNA will suffer specific degradation immediately after they enter the
host cell, through transformation [25, 68] or other potential routes of entry. An in vitro treatment
of the DNA with M.TneDI will be highly desirable. Therefore, there is a need to prepare the
methylase in a large quantity for treating substrate DNA on a routine basis if it is destined to be
in a Thermotoga host.
M.TneDI has been successfully expressed from the tetracycline promoter of pACYC184
[79]. The resulted vector pJC340 renders sufficient in vivo protection against R.TneDI to the E.
coli strain XL1-Blue MRF’, but the expression level of the methylase is too low to satisfy the
demand to purify it for in vitro usage. A new expression system of M.TneDI needs to be
developed to meet the demand. The pET system naturally becomes our first choice, which
employs the powerful T7 promoter to massively synthesize desired proteins in a E. coli
BL21(DE3) strain.
Many E. coli strains carry the McrBC nuclease, which attacks DNA methylated at
cytosine following a purine [153, 154], such as in a CGCG context. Expressing methylase
modifying cytosine at these sites could be lethal to the host. McrBC- mutants expressing such
methylases can sometime be isolated, allowing overexpression and characterization of these 16
methylase, such as in the case of M.PvuII, which recognizes 5’-CAGCTG-3’ and modifies the internal cytosine [155, 156].
It was observed that co-transforming pJC339, which expresses R.TneDI from the T7 promoter of pET-24a(+), and pJC340 into E. coli BL21(DE3) was much harder than attempting
the same with E. coli XL1-Blue MRF’ [79]. The latter is known to have its mcrBC deleted;
however, the genetic background of mcrBC is unclear for BL21(DE3). In this chapter, the
mcrBC background of BL21(DE3) was tested, and the M.TneDI gene was cloned into pET-
24a(+). A BL21(DE3) recombinant strain was isolated with the M.TneDI activity ~ 4 times of
XL1-Blue MRF’/pJC340. Exploration of R-M systems TneDI of Thermotoga strains were also
investigated, which suggested that Thermotoga strains are genetically recalcitrant because of
active R-M systems of TneDI under normal growth conditions.
Materials and Methods
Strains and cultivation conditions
All bacterial strains and vectors used in this chapter are summarized in Table 1.
E. coli strains were cultivated in Luria-Bertani broth (1% tryptone, 1% NaCl, 0.5% yeast
extract) at 37°C, unless otherwise specified. When needed, ampicillin, kanamycin, and
chloramphenicol were supplemented at 50, 50, and 30 µg per ml, respectively. Luria-Bertani plates were added with 1.5% agar. Induction of BL21 (DE3) recombinant cells were accomplished by adding 0.4 mM IPTG (isopropyl-β-D-thiogalactopyranoside) when cell density at 600 nm (OD600) reached around 0.5. The induced cultures were allowed to grow overnight at
16°C prior to further analyses.
Thermotoga strains were generally cultivated at 77°C, 125 rpm in SVO medium [38]. 2%
inoculum was done by 1 millimeter syringe needle. Fifty milliliters or 10 milliliters of SVO 17 medium in 100 ml serum bottle (Wheaton Industries Inc. Millville, NJ, USA) was sparged with nitrogen gas (Praxair, Inc. Danbury, CT, USA) about 10-15 minutes while heating at 88°C in oil bath. Serum bottle were then sealed and capped with stopper and aluminum cap, and sterilized
(121°C, 15 minutes). SVO plates were added with 0.25% gelrite (Sigma-Aldrich Co., ST. Louis,
MO, USA). Plating method was embedded growth [25]. Double concentrated (2x) SVO medium was mixed with 0.5% gelrite when the temperature of them was around 77°C. Meanwhile
Thermotoga cells were mixed with them and then poured to petri dish to prepare plates. All plates were put in Vacu-Quik Jar (Almore International Inc., Portland, OR, USA) filled with 96:4
N2-H2 and 4g palladium catalyst to remove oxygen, and incubated at 77°C, 48 hours. If needed, kanamycin was added at 150 µg per ml in liquid culture and 250 µg per ml in solid medium.
When minimum medium is needed, yeast extract and peptone were replaced by 0.095 g NH4Cl per 100ml.
18
Table 1 Strains and vectors used in Chapter I
Strain or plasmid Description Reference
E. coli
XL1-Blue MRF’ Δ(mcrA)183 Δ(mcrCB-hsdSMR- Strategene
mrr)173 endA1 supE44 thi-1 recA1
gyrA96 relA1 lac [F′ proAB
lacIqZΔM15 Tn10 (Tetr)]
– - BL21(DE3) F ompT gal [dcm] [lon] hsdSB (rB [157]
- mB ) with DE3, a λ prophage carrying
the T7 RNA polymerase gene
Thermotoga
T. sp. strain RQ7 Isolated from geothermally heated sea [1]
sediment, Ribieira Quente, Săo
Miguel, Azores.
T. sp. strain RQ2 Isolated from geothermally heated sea [1]
sediment, Ribieira Quente, Săo
Miguel, Azores.
T. neapolitana DSM 4359 The second type strain of Thermotoga [2]
isolated from shallow submarine hot
springs near Lucrino, Bay of Naples,
Italy.
T. maritima MSB8 The first type strain of Thermotoga [1]
isolated from geothermally heated sea 19
sediments, Porto di Levante, Vulcano,
Italy.
Plasmids
pUC19 High-copy number E. coli cloning GenBank Accession
vector containing portions of pBR322 #: L09137
and M13mp19; Apr
pET-24a(+) E. coli expression vector possessing an Novagen
N-terminal T7·Tag® sequence and a C-
terminal His·Tag® sequence; Knr
pPvuM1.9 A pBR322 derivative expressing [155]
M.PvuII; Apr
pJC340 Coding region of CTN_0340 inserted [79]
into the NdeI-BamHI sites of pJC184;
Cmr
pDH21 Coding region of CTN_0340 inserted [27]
into the NdeI-BamHI sites of pET-
24a(+); Knr
Note: T. neapolitana DSM 4359 (ATCC 49049) was bought from ATCC (http://www.atcc.org/);
T. sp. strain RQ7 and T. maritima MSB8 were gained from Dr. Huber, University of Regensburg,
Germany; T. sp. RQ2 were gained from Dr. Noll, University of Connecticut, Storrs, Connecticut,
USA. 20
Plasmid and chromosome DNA extract
Plasmid DNA from E. coli was extracted following standard alkaline lysis method [158].
Method for extracting plasmid DNA from Thermotoga strains were modified from standard alkaline lysis procedure. Cells of 20 ml overnight Thermotoga culture were collected by centrifugation at 13,500 g, 1 minute and washed once with 1 ml STE [0.1 M NaCl, 10 mM Tris-
HCl (pH 8.0), 1 mM EDTA (pH 8.0)]. Two hundred microliters solution I [50 mM glucose, 25 mM Tris-HCl (pH 8.0), 10 mM EDTA (pH 8.0)] were added to re-suspended cells followed by adding 400 µl Solution II [0.2 M NaOH, 1% (w/v) SDS]. After 5 minutes incubation on ice, 300
µl Solution III [60 ml (5 M potassium acetate), 11.5 ml glacial acetic acid, 28.5 ml distilled water] were added. After another 5 minutes incubation on ice, supernatant were gained through centrifugation at 13,500 g 5 minutes, and then added with equal volume of phenol/chloroform/isoamyl alcohol (25:24:1). After centrifugation at 13,500 g 5 minutes, upper layer was transferred into another 1.5 ml Eppendorf tube. Phenol extract were repeated 3 times, until no obvious protein layer existed. At the end equal volume of isopropanol were added into tube which was kept at -20°C, 15 minutes. Plasmid DNA precipitation were got by centrifugation at 13,500 g, 10 minutes. After washed with 70% alcohol twice and air-dried, 20 µl distilled water was added to dissolve plasmid DNA with 20 µg per ml RNase A.
Thermotoga genomic DNA was prepared from cells which were collected from 250 ml overnight Thermotoga culture at 13,500 g, 10 minutes. Ten milliliters STE [0.1 M NaCl, 10 mM
Tris-HCl (pH 8.0), 1 mM EDTA (pH 8.0)] were added to re-suspended cells. Re-suspended cells were added with proteinase K (20 µg per ml) and SDS (w/v, 5%) and were incubated at 50°C, 6 hours. And then the mixture was added with equal volume of phenol/chloroform/isoamyl alcohol
(25:24:1). After centrifugation at 13,500 g 5 minutes, upper layer was transferred into another 21
clean tube. Phenol extract were repeated 3 times, until no obvious protein layer existed. Finally
equal volume of isopropanol was added into tube which was kept at -20°C, 15 minutes. Genomic
DNA precipitation was got by centrifugation at 13,500 g, 10 minutes. After washed with 70%
alcohol twice and air-dried, distilled water (volume of distilled water is determined by genomic
DNA precipitation) was added to dissolve genomic DNA with 20 µg per ml RNase A, at 37°C,
30 minutes.
Preparation and assay of M.TneDI
Ten milliliters of the culture expressing M.TneDI was harvested by microcentrifugation,
washed three times with lysis buffer (10 mM Tris-HCl, 10 mM MgCl2, 50 mM NaCl, 1 mM
DTT, pH 8.0), and resuspended in 150 µl of the same buffer. After the addition of lysozyme to a
final concentration of 0.3 mg per ml [159], the suspension was subject to repetitive freeze-thaw
cycles to lyse the cells. Cell lysate was then heated at 77°C for 30 min to denature E. coli
proteins, followed by centrifugation at 21,130 g for 5 minutes. The supernatant containing
M.TneDI was then recovered for immediate use or stored at 4°C or at -20°C in 50% glycerol for later use. Up to 10 µl of the above M.TneDI extract was mixed with 1 µg of pUC19 DNA prepared from XL1-Blue MRF’. S-adenosyl-L-methionine was supplemented to a final
concentration of 20 µg/ml. The mixture was incubated at 77°C for 1 h followed by 1 h of digestion with 1 unit of R.TneDI, prepared in the same way as M.TneDI. One unit of M.TneDI is defined as the quantity required to completely protect 1 µg of pUC19 DNA for 1 h at 77°C.
Results and Discussion
Confirmation of the McrBC background in BL21(DE3)
The goal of this chapter is to maximize M.TneDI production for in vitro DNA modifications, which motivated us to use the pET system to express M.TneDI, because it is the 22
most efficient expression vector constructed so far. The pET vectors must be used with E. coli
BL21(DE3) as the host strain to achieve maximal production. However, the McrBC background
of BL21(DE3) is not clear. Finally, BL21(DE3) is indeed a McrBC positive strain, which
complicates our strategy of expressing M.TneDI in this strain.
To have an better estimation of our chance of isolating BL21(DE3) carrying pDH21 [27] overexpressing functional M.TneDI, verification of the McrBC background of BL21(DE3) was
done. Plasmid pPvuM1.9 expressing M.PvuII was used to transform the strain. M.PvuII modifies
the internal cytosine of 5’-CAGCTG-3’ sites [155, 156], and poses a lethal threat to any McrBC
positive strains. In our tests, plasmid pUC19 was used as the control plasmid, and E. coli XL1-
Blue MRF’, a known McrBC negative strain, was used as the control strain. Competent cells of
BL21(DE3) and XL1-Blue MRF’ were prepared using the standard CaCl2 method and
transformed with 1 µl of the plasmid DNA with the heat shock method. The same amount of
pUC19 DNA that resulted in 4113 XL1-Blue MRF’/pUC19 transformants gave rise to 1396
BL21(DE3)/pUC19 colonies, indicating the transformation efficiency of the BL21(DE3)
competent preparation is 33.9% of that of the XL1-Blue MRF’ cells (Table 2). When 1 µl of
pPvuM1.9 DNA resulted in 299 colonies of XL1-Blue MRF’/pPvuM1.9, it was expected to
observe about 102 BL21(DE3)/pPvuM1.9 transformants. However, none was obtained. This
indicates that pPvuM1.9 is impermissible in BL21(DE3), and consequently, BL21(DE3) does
have a McrBC background. However, since transformants expressing M.PvuII were obtained at
low frequencies with E. coli strains JM83 and JM107, which are also McrBC positive [155], it
was reasoned that it was equally possible to isolate BL21(DE3)/pPvuM1.9 transformants if the
cells were given enough chances. Indeed, when six times more DNA was used, 1820 XL1-Blue
MRF’/PvuM1.9 and two BL21(DE3)/pPvuM1.9 transformants were obtained. These data 23
suggest that it is possible to isolate BL21(DE3)/pDH21 transformants expressing functional
M.TneDI. This possibility is further enhanced by the fact that thermophilic enzymes are
generally less active at mesophilic temperatures, as is the case of R.TneDI at 30°C and 37°C [79].
Table 2 Transformation comparison between XL1-Blue MRF’ and BL21(DE3)
Plasmid pUC19 pPvuM1.9
Strain
XL1-Blue MRF’ 4113 ± 338 299 ± 57
BL21(DE3) 1396 ± 267 0
Screening for BL21(DE3) transformants expressing functional M.TneDI
Initially, thirty BL21(DE3)/pDH21 transformants were isolated from kanamycin plates at
30°C and denoted as #1-#30. These isolates were inoculated in liquid LB medium at 30°C for
overnight, and then transferred to fresh liquid medium and cultivated for another 4 h followed by
IPTG induction. Please note that because monitoring the cell density of so many cultures
simultaneously was neither practical nor necessary for the initial screening, IPTG was added
based on the length of cell growth instead of cell densities. In later experiments, however, the
cell densities of all cultures were closely monitored and IPTG was added around OD600 of 0.5.
After induction at 16°C for overnight, the cultures were grouped into 3 classes (Figure 2) based on cell growth. Group I comprised #7, #8, #13, #20, #22, and #25 (total 6), which did growth well even before the induction and resulted in a final OD600 of 0.3 or less. Isolates having
cell densities between 0.4 and 0.7 (total 14) composed group II. The rest 10 isolates, with an
OD600 in range of 0.7 ~ 1.1, belonged to group III. M.TneDI extracts made from the induced cultures were analyzed for their protecting activity against R.TneDI extracts belonging to the 24
same growth group were arranged together in Figure 2. All 6 samples treated with the group I extracts experienced dramatic DNA degradation, indicating limited M.TneDI activities in these reaction mixtures, which might be due to the overall low cell densities of the original cultures. In contrast, at least 7 out of the 14 DNA samples treated group II extracts and 7 out of the 10 samples treated with group III extracts showed considerable levels of protection against the restriction digestion, suggesting high levels of M.TneDI activity in the extracts. The methylase activity observed in these 14 isolates seemed to be equivalent or higher than observed in the positive control XL1-Blue MRF’/pJC340. Therefore, they were potentially better choices for extracting M.TneDI. Since most group III isolates showed little inhibitive effects on cell growth from expressing the methylase, one of them (#3) was chosen as the candidate production strain and was subjected to further investigations.
25
Figure 2 Screening of 30 E. coli BL21(DE3)/pDH21 transformants expressing methylase
M.TneDI. Ten microliters of M.TneDI extract were used in each reaction. The numbers denote the identity of the isolates. Restriction digestion was done with R.TneDI. XB, XL1-Blue MRF’.
26
Expression of M.TneDI in BL21(DE3)/pDH21#3
Next it was attempted to detect the expression of M.TneDI at the protein level. Cell extracts were prepared from BL21(DE3)/pDH21#3 and BL21(DE3)/pET24a(+), respectively, and were analyzed with a 12% SDS-PAGE gel. A prominent band corresponding to the expected size of M.TneDI (theoretical mass: 35.5 kDa) was observed in BL21(DE3)/pDH21#3 but absent in BL21(DE3)/pET24a(+) (Figure 3). A slightly smaller band was also noticeable in
BL21(DE3)/pDH21#3, which probably was the partially degraded M.TneDI. The expression of
M.TneDI was unable to be detected at the protein level in XL1-Blue MRF’/pJC340.
Figure 3 SDS-PAGE analysis of M.TneDI. M, protein markers; 1, BL21(DE3)/pDH21#3; 2,
BL21(DE3)/pET24a(+).
Comparison of the M.TneDI activities in BL21(DE3)/pDH21#3 and XL1-Blue
MRF’/pJC340
A semi-quantitative experiment was conducted to compare M.TneDI activity in strains
BL21(DE3)/pDH21#3 and XL1-Blue MRF’/pJC340. M.TneDI extracts were prepared from the
two strains and diluted in 2-fold steps (Figure 4). Substrate DNA was incubated with the
M.TneDI extracts prior to being treated with R.TneDI. Five microliters of the E. coli
BL21(DE3)/pDH21#3 extract completely protected pUC19 DNA from the restriction the
R.TneDI, in contrast to the same amount of the XL1-Blue MRF’/pJC340 extract. When 2.5 µl of 27
the extracts were used, BL21(DE3)/pDH21#3 still provided a near complete protection to the
substrate DNA, whereas the DNA in the XL1-Blue MRF’/pJC340 sample suffered an extensive digestion to a level equivalent to using just 0.625 µl of the BL21(DE3)/pDH21#3 extract. It demonstrated that the M.TneDI activity of BL21(DE3)/pDH21#3 was about 4 times of that of
XL1-Blue MRF’/pJC340. The findings were confirmed by two more independent comparison
tests.
28
Figure 4 Methylase M.TneDI activity Comparison of E. coli XL1-Blue MRF’/pJC340 and E. coli BL21(DE3)/pDH21#3. The numbers indicate the amount of M.TneDI extract used in each sample. Restriction digestion was done with R.TneDI. XB, XL1-Blue MRF’; BL, BL21(DE3).
29
Stability of E. coli BL21(DE3)/pDH21#3 expressing M.TneDI
Even though the transformants E. coli BL21(DE3)/pDH21 were mutants which can
tolerate the methylation of M.TneDI, they are quite stable. The stability of the mutant strain was
carried within mutant strain BL21(DE3)/pDH21#3. Following 5 continuous transfers with
kanamycin 50 µg per ml, the strain BL21(DE3)/pDH21#3 still kept 100% methylation activity
compared with the 1st transfer (Figure 5). Compared with methylase activity in Figure 4,
M.TneDI methylase activity in Figure 5 was about 1 time less, possibly because of handling within 2 different batches for extracting methylase M.TneDI. Freeze-thaw methods could not be exactly repeated very well, but comparison within the same batch are confident.
30
Figure 5 Investigation of stability of E. coli BL21(DE3)/pDH21#3. 5, 2.5 and 1.25 indicate the methylase extract used in each sample; Ordinal numbers denote each transfer with kanamycin 50
µg per ml. T: Transfer.
31
Exploration of restriction-modification (R-M) system TneDI in Thermotoga strains
Restriction-modification (R-M) system TneDI was first identified in T. neapolitana through cloning and expression in E. coli [79]. Even though the identity at protein level were 100% among T. maritima, T. petrophila RKU-1, T. sp. strain RQ2, T. naphthophila RKU-10 and T. neapolitana, this can only indicate all genes’ products from TneDI R-M system are functional.
However, it is not clear whether all these genes are transcribed, translated and folded properly in
Thermotoga. Here exploration of R-M system TneDI was investigated among T. maritima, T. neapolitana, T. sp. strain RQ2 and T. sp. strain RQ7.
For culturing Thermotoga strains, both minimum medium and rich medium SVO were tried. Complete genome sequence of T. sp. strain RQ7 (accession number CP007633) shows that this strain only has partial truncated R.TneDI and M.TneDI genes, which indicates that T. sp. strain RQ7 lacks of R-M system TneDI. T. maritima, T. neapolitana and T. sp. strain RQ2 are suggested to have R-M system active in vivo both in rich SVO medium and minimum medium
(Figure 6). Total DNA from all these 3 strains cannot be digested by R.TneDI, which suggested that all the recognition sites (CGCG) by R.TneDI were methylated inside cells. However T. sp. strain RQ7 total DNA can be digested by R.TneDI because of lacking functional methylase
M.TneDI inside cell (Figure 6&7), which is consistent with its genetic backgroud. When total
DNA from T. sp. strain RQ7 were treated with M.TneDI in vitro, it cannot be digested by
R.TneDI (Figure 7). All these data indicated that R-M system TneDI from T. maritima, T. neapolitana and T. sp. strain RQ2 were active under lab conditions, and T. sp. strain RQ7 lacks
TneDI R-M system because of truncated R.TneDI and M.TneDI genes. Methylation of foreign
DNA seems necessary for transforming Thermotoga strains, which occupy active TneDI R-M systems. 32
Figure 6 Exploration of restriction-modification (R-M) system TneDI in Thermotoga. Total
DNA extracted from rich SVO medium (left); total DNA extracted from minimum medium
(right). 1 µg total DNA was treated with 1 U R.TneDI, 77°C, 1 h. T.RQ7: T. sp. strain RQ7; T.n:
T. neapolitana; T.RQ2: T. sp. strain RQ2; T.m: T. maritima. 33
Figure 7 Protection of M.TneDI on total DNA of T. sp. strain RQ7. 1 µg total DNA treated with 1 U M.TneDI, 77°C, 1 h; and then digested with 1 U R.TneDI at 77°C, 1 h. T.n: T.
neapolitana; T.RQ7: T. sp. strain RQ7.
34
However, when all the Thermotoga total DNA samples were treated with BstUI, one of 6
commercially available isochizomers (AccII, Bsh1236I, BspFNI, BstFNI, BstUI and MvnI) of
R.TneDI (http://rebase.neb.com), all the DNA samples can be digested (Figure 8). Our results
showed that methylation by M.TneDI cannot block BstUI restriction. It is true that BstUI can be
blocked by m5C [160], which provides clues that methylation by M.TneDI might be m4C. It was also proposed that m4C was adapted instead of m5C by thermophiles to decrease A-T transitions because of the high frequency of deamination [161]. Besides, motif analysis suggested that
M.TneDI was an m4C Methylase [162].
35
Figure 8 Digestions of Thermotoga total DNA with BstUI. Each Thermotoga total DNA was treated with 2.5U BstUI, 37°C, overnight. T.m: T. maritima; T.n: T. neapolitana; T.RQ2: T. sp. strain RQ2; T.RQ7: T. sp. strain RQ7.
36
Conclusion
In summary, this work provides the background information of TneDI R-M system of
Thermotoga strains and technical preparations for transforming Thermotoga spp.. Among all the tested strains, it was suggested that only T. sp. strain RQ7 lacks the active TneDI R-M system under normal gowth conditions. M.TneDI methylated DNA substrates enhanced natural transformation efficiency in T. sp. strain RQ2 (Chapter II, optimization of natural transformation). However, the usefulness of the M.TneDI is not limited to Thermotoga spp.. The methylase prepared in this chapter could also protect substrate DNA against isoschizomers of
R.TneDI found in other bacterial species, such as the AccII, FnuDII, ThaI, BsuE, Bsh1236I, BepI,
MvnI, and SelI [163-169]. The simplicity of preparing M.TneDI from E. coli offers an attractive commercialization potential.
37
CHAPTER II. OPTIMIZATION OF NATURAL TRANSFORMATION OF
THERMOTOGA STRAINS
Introduction
To fully release the industrial and biochemical potential of Thermotoga, one often wishes to modify these bacteria at the genetic level. However, Thermotoga spp. are considered genetically recalcitrant. Their first transformants were isolated only recently after decades of efforts [25]. Making these species more genetically accessible remains a priority for the research community. Effective delivery of recombinant DNA stands as a critical step in any genetic modification attempt dealing with Thermotoga. Previous studies have demonstrated that
Thermotoga cells are transformable by liposome-mediated transformation and electroporation
[25, 68]. Effective as these methods are, they are labor-intensive and time-consuming. A more
convenient approach would be highly desirable if one needs to transform Thermotoga on a daily
basis.
Many prokaryotes possess the ability to take up DNA directly from the environment
without human intervention, i.e. they are naturally competent. Some bacteria efficiently import
DNA from any source, whereas others prefer to acquire homologous DNA through the
recognition of specific uptake signal sequences [170, 171]. The process of natural transformation involves the steps of DNA binding, translocation, and recombination. In most competent bacteria, the machinery responsible for DNA binding and translocation is related to Type IV pili (T4P) and Type II secretion systems (T2S) [172, 173]. T4P are retractile appendages that contribute to twitching motility, biofilm formation, adhesion, and conjugation, in addition to natural transformation. A working model proposed for Neisseria gonorrhoeae suggests that exogenous
DNA crosses the outer membrane through a pore made of the secretin protein PilQ and 38
transverses the periplasmic space with the aid of the PilE complex and a high affinity DNA- binding protein ComE. One strand of the DNA is then degraded by a nuclease, and the other strand travels across the inner membrane through a channel comprised of the membrane protein
ComA [69, 174]. In Gram-positives, DNA is transported across the cell envelope in a similar manner, except that it does not need to overcome the outer membrane barrier. Once in the cytoplasm, the single-stranded DNA has to be protected by single strand DNA binding proteins to avoid degradation by host nucleases. Recent evidence suggests that DNA protection protein
DprA conveys incoming ssDNA to RecA, the ubiquitous recombinase responsible for the initiation of homologous recombination [175-177]. Protein ComM influences transformation at a very late stage presumably by affecting recombination of the donor DNA into the chromosome
[178].
More than 60 bacterial species have been documented as naturally transformable [179], which actually represents a minute fraction of all the bacterial species characterized thus far.
Natural transformation is therefore considered a rare phenomenon. However, competence genes are wide-spread in bacterial species, even though many of which have not been reported to be naturally competent. Part of the reason is that natural competence usually develops only under certain physiological states that are inducible by environmental factors. Often these conditions are ill-defined and thus cannot be reproduced in laboratory settings. It is very likely that natural competence occurs much more frequently than observed. For example, this mechanism was only recently noted in such well-studied organisms as Vibrio cholerae [180], Bacillus cereus [181], and E. coli [182]. Natural uptake of DNA has not been reported for any bacteria growing optimally at, or above, 80oC, although this ability has been documented for hyperthermophilic archaeon Thermococcus kodakarensis [183]. 39
Analyses of the published Thermotoga genomes present evidence of frequent lateral gene transfer events between Thermotoga and other bacteria, archaea, and even eukaryotes [30, 52,
184, 185]. The chimeric nature of Thermotoga genomes suggests that these bacteria have a remarkable efficiency for acquisition of foreign genes. Putative competence genes have long been noticed in their genomes, including those encoding T2S- and T4P-related proteins [30].
Moreover, mini-plasmids pRQ7, pMC24, and pRKU1 have been discovered in T. sp. strain RQ7
[186], T. maritima [187], and T. petrophila RKU-1 [61], respectively. Therefore, it is possible that Thermotoga spp. are capable of acquiring foreign DNA directly. Searching of the T. maritima genome sequence did not uncover any specific uptake signal sequences [171]. For this reason, if Thermotoga spp. were to acquire DNA naturally, they should do so indiscriminately.
The aim of this chapter was to establish natural competency in Thermotoga spp. and to develop a natural transformation protocol to facilitate the genetic engineering of Thermotoga. In this chapter, it is reported that T. sp. strain RQ2 was naturally competent. Meanwhile optimization of natural transformation in this strain was investigated, which would provide further information to genetically modify Thermotoga strains.
Materials and methods
Strains and cultivation conditions
Thermotoga strains were listed in Table 1, and cultured following the described method
(Chapter I, materials and methods).
Caldicellulosiruptor saccharolyticus DSM 8903, which was got from Dr. Robert Kelly at
North Carolina State University, USA, was cultured in the medium DSMZ 640
(http://www.dsmz.de/microorganisms/medium/pdf/DSMZ_Medium640.pdf), with the exception
of cellobiose concentration 0.3% (w/v). 40
Natural transformation in Thermotoga sp. strain RQ2
Generally, cells from 1 milliliter of overnight T. sp. strain RQ2 culture in SVO medium
were collected at 13,500 g for 30 seconds and resuspended in 200 µl fresh SVO medium. And
then cell suspension and 50 µg DNA substrates are inoculated into fresh 10 ml SVO medium in
100-ml serum bottle. After incubation at 77°C, 4 to 6 h, 125 rpm, the culture was poured into
selective plates with a culture to medium ratio of 1:9 (v/v) and kanamycin 250 µg ml-1. Usually colony forming unit was calculated based on the colony number of each 4 ml of 10 ml transformant culture. The plates will be continued to be incubated at 77°C, 48 h in Vacu-Quik Jar
(Almore International Inc., Portland, OR, USA). Finally the colonies on plates will be counted, and transformation efficiency will be calculated as transformants per microgram of DNA substrates and transformation frequency expressed as transformants per microgram of DNA per viable cell.
Based on the standard procedure described above, optimization of natural transformation was investigated. a.) Comparison of linear and circular DNA: the procedure is the same as that mentioned above, except that DNA substrates are different: circular pDH12 [26] and linear pDH12 which was treated with BsaI. b.) Comparison of gentle shaking and static condition: using the linear pDH12 as DNA substrates, one serum bottle is set at 0 rpm, and another is set
125 rpm; c.) Optimization of incubation time before adding DNA (pre-adding DNA): 200 µl cells suspension was inoculated into 10 ml SVO medium and then incubated with different time:
0 h, 2 h and 4h before adding linear pDH12 DNA substrates. d.) Optimization of concentrations of DNA substrates: after 200 µl cells suspension was inoculated into 10 ml SVO medium and incubated 4 h, and then DNA substrates were added with different concentrations: 5 to 50 µg ml-
1. PCR of kanamycin-resistant genes using plasmid extracts as templates was done to verify 41
natural transformants T. sp. strain RQ2/pDH12 with primers pairs Thkan F
(5’ATGAATGGACCAATAATAATGAC3’) and Thkan R
(5’GCTCTAGAAATTCCGTTCAAAATGGTATGCG3’).
Results and Discussion
Optimization of culturing Caldicellulosiruptor saccharolyticus DSM 8903
Because of large amount of genomic DNA of Caldicellulosiruptor saccharolyticus DSM
8903 is needed, optimization of culturing this strain was carried out simply focused on concentration of cellobiose. It was shown that DSM 640 medium with 0.3% cellobiose have the highest concentration of cells among tested cellobiose concentrations (Figure 9). In the following experiments for culturing Caldicellulosiruptor saccharolyticus DSM 8903, 0.3% cellobiose is used, which leads to double harvested cells compared with original 0.1% cellobiose in DSM 640 medium.
42
Figure 9 Growth curve of Caldicellulosiruptor saccharolyticus DSM 8903 on different concentrations of cellobiose.
DNA stability in transformation environment
During the whole process of natural transformation, DNA substrates face several challenges, eg. pH, heat and nucleases. Firstly, to figure out how foreign DNA behaves in fresh
SVO medium of Termotoga. Genomic DNA from Caldicellulosiruptor saccharolyticus DSM
8903 with optimum growth temperature at 70°C [188] was incubated at fresh SVO medium (pH
8.5) at 77°C for different time (0-6 h) (Figure 10A). It was shown that DNA molecules were degraded gradually into small fragments with the size of 6.5 kb to 500 bp. As the average bacterial gene is around 1 kb, the final small DNA molecules are perfect substrates for transformation. DNA molecules are quite stable at fresh SVO medium. However, when the genomic DNA were incubated in overnight supernatant (pH 5.5), genomic DNA are quickly degraded into small pieces (Figure 10B), possibly because of secreted nucleases from
Thermotoga host cells. Incubation within 3 hours in supernatant is equal to incubation 6 h in 43 fresh SVO medium, which create DNA fragments around 6.5 kb or smaller. For the following optimization of natural transformation, the maximum incubation time of DNA substrates is kept within 6 h.
Figure 10 Degradation of genomic DNA of Caldicellulosiruptor saccharolyticus DSM 8903 in fresh SVO medium (A) and in overnight supernatant of Thermotoga sp. strain RQ7 (B).
Confirmation of natural transformation in Thermotoga sp. strain RQ2
Thermotoga strains in our lab include T. maritima, T. neapolitana, T. sp. strain RQ7, and
T. sp. strain RQ2, among which only T. neapolitana is kanamycin-resistant [25]. Natural transformation was performed using pDH12 [26], which carries kanamycin resistant gene and genomic DNA from T. neapolitana. Transformation efficiencies with genomic DNA from T. neapolitana and kanamycin-resistant plasmid pDH12, are almost equal in T. sp. strain RQ7 and
T. sp. strain RQ2 (Figure 11). T. sp. strain RQ7 presented a transformation frequency of (6.03 ±
1.52) × 10-7 (n = 3) with the genomic DNA and a frequency of (1.45 ± 0.02) ×10-7 (n = 2) with 44 the plasmid DNA; for transformation efficiency, the figures were 16.62 ± 3.88 (n = 3) and 19.34
± 3.80 (n = 2), respectively. Thermotoga sp. strain RQ2 presented a transformation frequency of
(1.75 ± 0.42) × 10-9 (n = 3) with the genomic DNA and a frequency of (1.82 ± 1.71) ×10-9 (n = 2) with the plasmid DNA; for transformation efficiency, the figures were 0.23 ± 0.10 (n = 3) and
0.10 ± 0.07 (n = 2), respectively. Because the mechanism of T. neapolitana kanamycin- resistance is not clear, confirmation of transformants were done by T. sp. strain RQ2 with pDH12. Transformants were picked up on selective medium with kanamycin 250 µg ml-1. Using plasmid extracts of each transfromant as templates to do PCR of kanamycin-resistance gene, almost all the transformantss are real because of showing the expected band (Figure 12).
Compared with natural transformation of T. sp. strain RQ7 [26], the band intensity of PCR products of T. sp. strain RQ2 is not as strong as that of T. sp. strain RQ7. It is possible that host differences lead to the low copy numbers of pDH12 in T. sp. strain RQ2, because T. sp. strain
RQ7 has its own cryptic plasmid pRQ7 [186], which favors plasmids to exist in host cells. Also transformation efficiency and frequency of T. sp. strain RQ2 is much less than those of T. sp. strain RQ7, possibly because of mutations of some proteins involving natural transformation of T. sp. strain RQ2 lead to impaired natural transformation. Natural transformation was also attempted in T. maritima, but no transformant was gained. It is still unclear why natural transformation doesn’t work in T. maritima, probably because of genetic differences among different Thermotoga hosts.
45
Figure 11 Transformation frequency of Thermotoga sp. strain RQ7 and Thermotoga sp. strain RQ2. T. sp. RQ7: T. sp. strain RQ7; T. sp. RQ2: T. sp. strain RQ2. 46
Figure 12 Verification of transformants Thermotoga sp. strain RQ2/pDH12 using PCR. T. sp. RQ2: T. sp. strain RQ2.
47
Optimization of natural transformation
To better apply the natural transformation in T. sp. strain RQ2, optimization of natural transformation was investigated in this strain.
It was shown that linear DNA is more efficient than circular molecules, and it is easy to
understand when combined with the whole process of natural transformation [74, 189]: linear
double stranded DNA was degraded into single strand DNA after passing through membrane.
Linear DNA has the priority to enter into cells, but circular DNA must be changed into linear
DNA by physical forces or bio-chemical degradation at the very first step. Comparison of gentle
agitation and static condition, it is clearly shown that gentle agitation give much more
transformants probably because of higher chance of DNA molecules binding to cell membrane
than diffusion at static condition. Simialr to T. sp. strain RQ7 [26] and Helicobacter pylori [190],
T. sp. strain RQ2 is also highly natural transformable in early exponential phase, not like
Thermus thermophiles [191], which is natural transformable along with all the phases. With
increase of DNA substrates, more transformants appeared within 5 to 25 µg ml-1. However,
excess DNA will have less transformants produced.
Application of methylase M.TneDI in natural transformation
As the R-M system TneDI is suggested to be active within T. sp. strain RQ2 (Figure 6,
Chapter I), methylase M.TneDI methylated DNA was used to get more natural transformants
because of low risk of degradation by R.TneDI inside Thermotoga cells. For convenience of the
following projects, an E. coli-Thermotoga shuttle vector, pHX02 (kanamycin-resistant) [75], was
used to determinate the application of M.TneDI in transforming Thermotoga strains. Both methylated and unmethylated DNA was introduced into T. sp. strain RQ2, and the number of
kanamycin-resistant colonies from the two types of samples were compared (Table 3). Overall, 48
M.TneDI-treated samples delivered more transformants than untreated samples although the levels of improvement were less than expected.
Table 3 Number of Thermotoga sp. strain RQ2 transformants resulting from M.TneDI
methylated and unmethylated DNA
DNA Unmethylated Methylated
Independent tests (c.f.u.) (c.f.u.)
1 6 10
2 9 15
3 53 58
4 80 95
5 55 73
Our data suggested that R.TneDI treated DNA only enhance natural transformation a little bit, which indicated that R-M system TneDI is not the determinant factor for Thermotoga to defend foreign DNA invasions. Possible unknown R-M systems might play some roles in degradation of foreign DNA. Indeed, according to REBASE, there are potentially two more Type
II methylases in T. sp. strain RQ2, and one of them is predicted to recognize GATC sites
(http://tools.neb.com/~vincze/genomes/view.php?seq_id=2117&list=1). Restrictive nucleases are generally hard to be predicted by bioinformatical methods because they do not share much sequence similarity. Identification and characterization of additional R-M systems in
Thermotoga spp. will help to specify ways to further improve transformation efficiencies in these bacteria.
49
Conclusion
Natural transformation also occurred in early exponential phase of T. sp. strain RQ2.
Optimization of natural transformation shows that linear DNA works better than circular forms
and gentle agitation produces more transformants compared with static conditions. The
optimized DNA concentration is around 10 to 25 µg ml-1. The widely-distributed methylase
M.TneDI from restriction modification system TneDI of Thermotoga could enhance natural transformation even given our limited knowledge of restriction modification systems.
Optimization will definitely provide further information for application of natural transformation among Thermotoga strains.
50
CHAPTER III. EXPRESSION OF HETEROLOGOUS CELLULASES IN
THERMOTOGA SP. STRAIN RQ2
Introduction
Cellulose is a linear polymer of D-glucose units linked by 1,4-β-D-glycosidic bonds. It
becomes useful as a food and energy source once it is broken down into soluble cellobiose (β-1,4
glucose dimer) and glucose, a process called hydrolysis because a water molecule is incorporated
for each dissociated glycosidic bond. Effective hydrolysis of cellulose requires the cooperation
of three enzymes, namely, endo-1,4-β-glucanase (EC 3.2.1.4), exo-1,4-β-glucanase (also called cellobiohydrolase) (EC 3.2.1.91), and β-glucosidase (EC 3.2.1.21) [116-119]. Endoglucanase randomly breaks down the β-1,4 linkages in the regions of low crystallinity, exoglucanase removes cellobiose units from the nonreducing ends of cellulose chains, and β-glucosidase converts cellobiose into glucose. In general, exoglucanases degrade cellulose more efficiently than endoglucanases.
Hyperthermophilic bacteria Thermotoga are attractive candidates for the production of biohydrogen and thermostable enzymes. Surveying of Thermotoga genomes in the CAZy database (http://www.cazy.org/) revealed dozens of carbohydrate-active enzymes, the molecular foundation that allows Thermotoga strains growing on a wide range of carbon sources such as glucose, xylose, semicellulose, starch, and carboxymethyl cellulose (CMC) [4, 5, 8, 19].
Nevertheless, the apparent absence of exoglucanases suggests the limited ability of these
organisms to use cellulose as their main carbon and energy source. Up to date, there are only two
reports describing low levels of exoglucanase activities in Thermotoga [116, 118], a phenomenon probably caused by nonspecific reactions of endoglucanases [192-194]. 51
This chapter aimed at introducing heterologous exoglucanase activities into Thermotoga
by genetic engineering. T. sp. strain RQ2 was selected as the host strain, because its genome
encodes the largest repertoire of carbohydrate-active enzymes among all published Thermotoga
genomes (Table 4). Moreover, T. sp. strain RQ2 has recently been discovered to be naturally
transformable, making the transformation procedure straightforward [26]. The selection of
candidate cellulases was focused on Caldicellulosiruptor saccharolyticus, a Gram-positive
anaerobe growing optimally at 70°C and can use cellulose as a sole carbon source [188].
Csac_1076 (CelA) [195, 196] and Csac_1078 (CelB) [121, 197] of C. saccharolyticus DSM
8903 have been experimentally characterized as multidomain proteins with both endo- and exoglucanase activities and are suitable candidates to be introduced into T. sp. strain RQ2.
However, Caldicellulosiruptor are Gram-positives and Thermotoga are Gram-negatives; CelA
and CelB are unlikely to be secreted properly in T. sp. strain RQ2. The Thermotoga host would not benefit much from the heterologous cellulases unless the enzymes can be secreted to the extracellular environment. Signal peptides with a Thermotoga origin would be required to guide the transportation of foreign proteins in T. sp. strain RQ2. A literature search revealed that T. maritima TM1840 (amylase A, AmyA) [15-17] and TM0070 (xylanase B, XynB) [16] have been experimentally confirmed to be secretive proteins. The former is anchored on the “toga” part with catalytic domain facing outward, and the latter is secreted into the environment after the cleavage of its signal peptide. Therefore, the promoter regions and the signal peptide sequences of TM1840 (amyA) [15-17] and TM0070 (xynB) [16] were chosen to control the expression and transportation of the Caldicellulosiruptor cellulases in T. sp. strain RQ2.
52
Table 4 Number of predicted carbohydrate-active enzymes in Thermotoga genomes
Family categories a b c d e f g Glycoside Hydrolase Family 52 49 49 50 40 36 32 Glycosyl Transferase Family 20 22 21 17 19 20 13 Polysaccharide Lyase Family 1 1 0 1 0 1 0 Carbohydrate Esterase Family 5 5 3 5 4 5 2 Carbohydrate-Binding Module Family 20 17 17 15 15 4 8 Total 98 94 90 88 78 66 55
Note: data collected from http://www.cazy.org/ on August 7th, 2014. a, T. sp. strain RQ2; b, T.
maritima MSB8; c, T. neapolitana DSM 4359; d, T. petrophila RKU-1; e, T. naphthophila
RKU-10; f, T. lettingae TMO; g, T. thermarum DSM 5069.
Materials and methods
Strains and cultivation conditions
The bacterial strains and vectors used in this chapter are summarized in Table 5. All E.
coli strains were cultivated in Luria-Bertani (LB) medium (1% tryptone, 1% NaCl, 0.5% yeast
extract) at 37°C. Thermotoga strains were cultivated at 77°C, 125 rpm in SVO medium [38].
SVO plates were made with 0.25% (w/v) gelrite [25]. Thermotoga plates were put into Vacu-
Quik Jars (Almore International Inc., Portland, OR, USA) filled with 96:4 N2-H2 and 4 g palladium catalyst (to remove oxygen) and incubated at 77°C for 48 h. When needed, ampicillin was supplemented into LB medium to a final concentration of 100 µg ml-1, and kanamycin was added into liquid SVO medium and SVO plates to a final concentration of 150 and 250 µg ml-1,
respectively.
53
Table 5 Strains and vectors used in Chapter III
Strain or plasmid Description Reference
E. coli
DH5α F- endA1 hsdR17 (rk-, mk+) supE44 thi-1 λ- recA1 [198]
gyrA96 relA1 deoR Δ(lacZYA-argF)-
U169ϕ80dlacZΔM15
Thermotoga
T. sp. strain RQ2 Isolated from geothermally heated sea sediment, [1]
Ribieira Quente, Săo Miguel, Azores.
T. maritima MSB8 The first type strain of Thermotoga, isolated from [1]
geothermally heated sea sediments, Porto di Levante,
Vulcano, Italy.
Caldicellulosiruptor
C. saccharolyticus Isolated from wood in the flow of geothermal spring, [188]
DSM 8903 Taupo, New Zealand.
Plasmids pDH10 Thermotoga-E. coli shuttle vector; Apr, Kanr * [25] pDH26 pDH10-derived, with BsaI site erased; Apr, Kanr [75] pDH27 pDH26-derived, with NdeI site erased; Apr, Kanr [75] pHX01 pDH27-derived, having lacZ residual sequence [75]
removed; Apr, Kanr 54 pHX02.1 Promoter and signal peptide region of TM1840 [75]
(amyA) were inserted into the NotI-SacI sites of
pHX01; Apr, Kanr pHX02 Coding region (without the signal peptide) of [75]
Csac_1078 (celB) was inserted into BsaI-SacI sites of
pHX02.1; Apr, Kanr pHX04.1 Promoter and signal peptide region of TM0070 [75]
(xynB) were inserted into the NotI-SacI sites of
pHX01; Apr, Kanr pHX04 Coding region (without the signal peptide) of [75]
Csac_1078 (celB) was inserted into the BsaI-SacI
sites of pHX04.1; Apr, Kanr pHX07.1 Promoter and signal peptide region of TM0070 [75]
(xynB) were inserted into the XhoI-PstI sites of
pHX01; Apr, Kanr pHX07 Coding region (without the signal peptide) of [75]
Csac_1076 (celA) was inserted into the BsaI-PstI
sites of pHX07.1; Apr, Kanr
*Ap: ampicillin; Kan: kanamycin
55
Construction of vectors
All vectors were constructed by following standard cloning methods and verified by
restrictive digestions. Primers used in this chapter are summarized in Table 6. The Thermotoga-E. coli shuttle vector pDH10 was used as the parent vector. Inverse PCR was performed with pDH10 [25] using primers DBs F and DBs R, and the amplicon was digested with BsaI followed by self-ligation to give rise to pDH26. With the same approach, pDH27 was generated based on pDH26 using primers DNd F and DNd R, and pHX01 was created from pDH27 using primers
DLZ F and DLZ R. Compared to pDH10, pHX01 is 342 bp shorter and is free of the BsaI and
NdeI recognition sites, which makes it a better cloning vector than pDH10. Based on pHX01, intermediate vectors pHX02.1, pHX04.1 and pHX07.1 were constructed. Vector pHX02.1 carries the promoter and signal peptide region of TM1840 (amyA), which was inserted immediately upstream of the Apr gene (Figure 13A); primers AmP F and Amp R were used to
amplify the desired region from T. maritima chromosome, and the amplicon was digested with
NotI and SacI. Vectors pHX04.1 and pHX07.1 both carry the promoter and signal peptide region
of TM0070 (xynB), but one has the insert upstream of the Apr gene (Figure 13B) and the other has it downstream of the ori region (Figure 13C). Because the two insertions sites were recognized by different restriction enzymes, primers XyBPB F and XyBPB R were used to
amplify the insert for pHX04.1, and the amplicon was digested with NotI and SacI; primers
XyBPA F and XyBPA R were used to prepare the insert for pHX07.1, and the amplicon was digested by XhoI and PstI. As a result, a BsaI site was introduced immediately after the signal peptide sequence in each vector to facilitate the insertion of the coding regions of the C. saccharolyticus cellulases. 56
Once the regulation and transportation regions were in place, the cellulases genes from C. saccharolyticus were inserted into pHX02.1, pHX04.1, and pHX07.1 to give rise to pHX02, pHX04, and pHX07, respectively (Figure 13). The total DNA of C. saccharolyticus DSM 8903 was used as the template. Primers CelB F and CelB R were used to amplify Csac_1078 (celB), and the amplicon was digested with BsaI and SacI. Primers CelA F and CelA R were used to amplify Csac_1076 (celA), and the amplicon was digested with BbsI and PstI.
The transformation of E. coli was done with standard calcium chloride method, and the transformation of Thermotoga was done by natural transformation, as described previously [26].
The DNA substrates used to transform Thermotoga were in vitro methylated by methylase
M.TneDI [27, 79].
57
Table 6 Nucleotide sequences of primers
Primer Sequence and restriction sites
DBs F 5’ATCATGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGC 3’
BsaI
DBs R 5’ATCGTCGGTCTCTACCGCGGGAACCACGCTCACCGGCTCCAGATTTATCAGC3’
BsaI
DNd F 5’ATCGTCGGTCTCTATATGCATGTGCACCAAACCACTTTGAGTACGTTCCCG3’
BsaI
DNd R 5’ATCGTCGGTCTCCATATATTATTTAGAGGACCTTATATTCCCCAAGATTGG3’
BsaI
DLZ F 5’GTCTGACTAGTGCAACGCATGCGAGGTTCTAGAGATTAGGGTGATGGTTCACG
TAGTGG3’ SphI
DLZ R 5’GACACGCATGCCGACGGCCAGTGAATTGTAATACGAC3’
SphI
AmP F 5’CGAGGAACGAAGCGGCCGCGGACACCTCCTTTAGATTACAAAGAGTTTAC3’
NotI
AmP R 5’GACTTAGAGCTCGATGACGGTCTCACTGGGCTAGTACCATCTGTGTTTGTGCT
GTTTG3’ SacI BsaI
XyBPB F 5’CGAGGAACGAAGCGGCCGCGAAAACTCACCTCCCTTGATTGTATG3’
NotI
XyBPB R 5’GACTTAGAGCTCGATGACGGTCTCACTGGAGAGCTGAAAACTGGAACACATC
CCAAC3’ SacI BsaI 58
XyBPA F 5’CGAGGACTCGAGGAAAACTCACCTCCCTTGATTGTATG3’
XhoI
XyBPA R 5’GATTAGCTGCAGGATGACGGTCTCAATGGAGAGCTGAAAACTGGAACACATC
CCAAC3’
PstI BsaI
CelB F 5’GACGACGGTCTCACCAGACTGGAGTATTCCAAGTTTATG3’
BsaI
CelB R 5’GGCGCGGAGCTCTCATCAGTGATGGTGATGGTGATGTTTTGAAGCTGGAACTG
GCTCAGGCTCATTATTG3’
SacI
CelA F 5’GACTACGAAGACATCCATGGCAGGAGGCTAGGGCTGGTTC3’
BbsI
CelA R 5’GGCGCGCTGCAGTCATCAGTGATGGTGATGGTGATGTTGATTACCGAACAGAA
TTTCATATGTTG3’
PstI
CelBV F 5’AGACGCGATGGGACATATCTATCCGGTATGG3’
CelBV R 5’GAAGCTGGAACTGGCTCAGGCTCATTATTG3’
59
60
61
Figure 13 Maps of the expression vectors pHX02 (A), pHX04 (B) and pHX07 (C). Gray region represents sequence of pRQ7. Unique restriction sites are shown.
62
Detection of endoglucanase activity with CMC plates
Endoglucanase activities were evaluated using Congo red assays [199]. For preliminary
screening, E. coli transformants were inoculated on CMC plates (1% NaCl, 0.5% yeast extract,
0.2% CMC, 1.5% agar) and incubated at 37°C for overnight. The plates were then kept at 77°C
for 8 h, stained with 0.1% Congo red (dissolved in water) at room temperature for 15 min, and washed with 1 M NaCl until clear halos showed up. After that, the plates were rinsed with 1 M
HCl, which changed the background color into blue, providing a better contrast for the halos. To test liquid cultures, 40 µl of each normalized overnight culture was directly loaded onto CMC plates. To minimize the sizes of the loading spots, the liquid cultures were loaded through 8 times with 5 µl in each loading. The next round of loading only happened when the liquid from the previous loading had been completely absorbed. To localize the expression of the recombinant proteins, supernatants were collected from 1 ml of normalized overnight culture by centrifugation. Meanwhile, the cells were washed once with fresh medium and resuspended in 1 ml of the same medium.
Detection of endoglucanase activities with zymogram
Native polyacrylamide gel electrophoresis was modified from a previous report [200].
SDS (sodium dodecyl sulfate) was omitted from the gel (10%, w/v), but CMC was added to a final concentration of 0.08% (w/v). Protein samples were prepared in the absence of SDS, reducing agents, and the heat treatment. After electrophoresis, gels were rinsed with deionized water for 3 times prior to immersion in 0.25 M Tris-HCl (pH 6.8) for 8 h at 77°C. Following the enzymatic reaction, gels were visualized with Congo red, as detailed above.
63
Detection of exoglucanase activity
MUC (4-Methylumbelliferyl β-D-cellobioside) agar was used to detect exoglucanase
activity [197, 201]. Under the hydrolysis of exoglucanase, MUC is converted to cellobiose and
MU (4-methylumbelliferone), which shows fluorescence under ultraviolet light. Forty microliters of normalized overnight culture of each Thermotoga transformant was spotted on MUC plates, incubated at 77°C for 8 h, and examined under UV light. The formation of fluorescent halos surrounding the loading spots indicates the activity of exo-glucanase.
Results and discussion
Expression and localization of the chimeric enzymes in E. coli
In the endoglucanase activity screening experiment, all tested DH5α/pHX02 (Figure 14),
DH5α/pHX04 and DH5α/pHX07 strains showed clear halos surrounding the overnight colonies,
indicating functional expression of the recombinant cellulases in E. coli. To determine the
localizations of the recombinant cellulases, cultures were normalized and supernatants and cell
suspensions were tested separately. Because pHX07 and pHX04 share the same localization
signal, experiments were carried out with just pHX04 and pHX02 transformants. On CMC plates,
the pHX04 transformant demonstrated a higher endoglucanase activity than the transformants of
pHX02 (Figure 15). For both constructs, most of the endoglucanase activity was associated with
the cell suspensions (Figure 15). This is not surprising for pHX02, because its fusion protein is
designed to be anchored on the outer membrane of a Gram-negative host. As for pHX04, since
its fusion protein is meant to be released into the medium, these data suggest that the signal
peptide of TM0070 (XynB) is not functional in E. coli, even though its promoter is.
64
Figure 14 Detection of endoglucanase activities in E. coli DH5α transformants (showing
DH5α/pHX02 as an example). #1-#6, DH5α/pHX02 transformants; DH5α/pHX02.1, negative control.
65
Figure 15 Localization of recombinant enzymes in E. coli DH5α transformants.
DH5α/pHX02.1 and DH5α/pHX04.1 were used as negative controls.
66
Detection of endoglucanase activities in Thermotoga
As the main purpose was to express the recombinant cellulases in Thermotoga, next these
3 expression vectors were transformed into T. sp. strain RQ2. Eleven T. sp. strain RQ2/pHX02, eleven RQ2/pHX04 and eight RQ2/pHX07 transformants were isolated and tested with Congo red assays. Wild type T. sp. strain RQ2 and C. saccharolyticus DSM 8903 were used as the negative and positive controls. Almost all transformants showed enhanced endoglucanase activities compared with the wild type strain (Figure 16), indicating the successful transformation and expression of the recombinant enzymes. These transformants were validated by PCR and restriction digestions.
67
Figure 16 Screening of endoglucanase activities in Thermotoga transformants RQ2/pHX02
(A), RQ2/pHX04 (B) and RQ2/pHX07 (C). +, C. saccharolyticus DSM 8903, positive control;
-, T. sp. strain RQ2, negative control.
68
Validating Thermotoga transformants
Three RQ2/pHX02 transformants (#2, #3, and #4) and three RQ2/pHX04 transformants
(#3, #4, and #5) were picked up from SVO plates and grown overnight in liquid SVO medium
with 150 µg kanamycin ml-1. Plasmid extracts were prepared and used as the templates to
amplify the exoglucanase domain of recombinant celB gene with primers celBV F and celBV R.
One RQ2/pHX02 isolate (#4) and two RQ2/pHX04 isolates (#4 and #5) showed bands with the expected size (in addition to some non-specific bands) (Figure 17). The positive bands from
RQ2/pHX02 #4 and RQ2/pHX04 #5 were gel-purified, re-amplified using the same primers, and digested with HaeIII (Figure 18). Both amplicons developed the expected digestion profile, demonstrating the authenticity of the two transformants, which were then selected to be further characterized in later studies. The attempts to amplify either exo- or endoglucanase domain from the pHX07 transformants failed. Since pHX07 carries the celA gene, instead of the celB as found in pHX02 and pHX04, further optimization of PCR conditions and/or primer selections may eventually allow one to validate the transformants of this vector. Nevertheless, pHX07 #2 was selected for further studies, because it at least displayed strong endoglucanase activity on CMC plates. 69
Figure 17 Amplification of the exoglucanase domain in Thermotoga sp. strain RQ2 transformants. 70
Figure 18 Restriction digestion of PCR products of the exoglucanase domain of Thermotoga sp. strain RQ2 transformants.
71
Detection of the exoglucanase activity in Thermotoga
The exoglucanase activity of the Thermotoga transformants was tested with MUC plates
(Figure 19). Compared to the host strain, RQ2/pHX02 and RQ2/pHX04 demonstrated greatly enhanced exoglucanase activities, as bright fluorescent light emitted under UV light from the spots where their overnight cultures were loaded. This suggests that the exoglucanase domain of
Caldicellulosiruptor CelB was successfully expressed and fully functional in T. sp. strain RQ2.
However, the fluorescence level displayed by RQ2/pHX07 was at about the same level to the wild type strain. Because the recombinant enzymes carried by pHX04 and pHX07 share the same promoter and signal peptide, the low level of exoglucanase activity presented by
RQ2/pHX07 indicates the exodomain of Caldicellulosiruptor CelA was either lost (which echoes the PCR results above) or not functional in T. sp. strain RQ2.
72
Figure 19 Detection of exoglucanase activities in T. sp. strain RQ2 transformants. RQ2, wild type strain, used as the negative control.
73
Localization of the recombinant cellulases in Thermotoga
Localization of the recombinant enzymes were carried with T. sp. strain RQ2/pHX02 #4, pHX04 #5 and pHX07 #2 by comparing the endoglucanase activity in supernatants versus cell suspensions. Unlike what happened in E. coli where the majority of the activity was associated with cell suspensions, the Thermotoga transformants had about half of the endoglucanase activity found in supernatants (Figure 20A). The endoglucanase activity in the supernatants was double-checked with native polyacrylamide gels followed by Congo red assay. All supernatants showed brighter bands than the wild type strain, indicating enhanced cellulases activities (Figure
20B). No protein bands were detectable in the supernatants by Coomassie brilliant blue staining.
The cell suspensions retained the other half of the enzymatic activities, probably because of the cytoplasmic proproteins of the chimeric enzymes (Figure 20A).
Figure 20 Localization of recombinant proteins in T. sp. strain RQ2 transformants. (a)
CMC plate; (b) zymogram of the supernatants. T. sp. strain RQ2 was used as the negative control.
74
Stabilities of the recombinant strains
Stabilities of the E. coli and T. sp. strain RQ2 recombinant strains were tested by
consecutively transferring corresponding cultures under the selection of antibiotics. After four
transfers, all shuttle vectors were readily detected in the E. coli transformants (Figure 21A). The endo- and exodomains of celA and celB were also successfully amplified from the plasmid DNA extracts (Figure 21B). Congo red assays with DH5α/pHX02 showed that the enzyme from 4th
transfer was as active as that from 1st transfer (Figure 22) and the expression level of the enzyme
was not affected by the inclusion of 0.25% starch in the medium [1, 17] (Figure 23). These
results indicate that, in E. coli DH5α, the constructed vectors are stably maintained and the
enzymes are constitutively expressed.
75
Figure 21 Stabilities of the E. coli recombinant strains at DNA level. The bacterial cultures were transferred for four consecutive times with 100 µg ml-1 ampicillin and were subject to plasmid extraction (A), and PCR of endodomain or exodomain using extracted plasmid from 4th transfter (B). +, previously correct pHX02, pHX04, or pHX07, which were confirmed by different restriction digestions; -, water. 76
Figure 22 Stabilities of the E. coli recombinant strains at protein level. The bacterial cultures were transferred for four consecutive times with 100 µg ml-1 ampicillin and subject to Congo red plate assays (showing DH5α/pHX02 as an example). Samples used for plate assays were prepared from normalized cultures. +, C. saccharolyticus DSM 8903; -, E.coli DH5α. 77
Figure 23 Expression of the E.coli recombinant strains with induction. Samples used for plate assays were prepared from normalized cultures (showing DH5α/pHX02 as an example). +,
C. saccharolyticus DSM 8903.
78
Unfortunately, in T. sp. strain RQ2, the vectors seemed to be gradually lost, as indicated by decreasing enzyme activities with each transfer. After the 3rd transfer, the activities of both endo- (Figure 24A) and exoglucanase (Figure 24B) were at the same level as the negative control.
Trying to induce the cultures with 0.25% starch or 0.25% xylose [1, 17, 131] did not result in improved expression of the enzymes, suggesting the diminishing of enzyme activities was a result of loss of genes rather than a lack of expression. Besides detection of exo- and/or endodomains through PCR using extracted plasmids failed. Our previous study demonstrated that the Thermotoga-E.coli shuttle vector pDH10 is stably maintained in both E. coli and
Thermotoga [25]. However, the vectors constructed in this chapter, which are derived from pDH10, were only stable in E. coli, but not in Thermotoga. This might be due to different genetics of the Thermotoga hosts. In the previous study, T. sp. strain RQ7 and T. maritima were used, and in this chapter, the host was T. sp. strain RQ2. Cryptic miniplasmids pRQ7 and pMC24 have been found in T. sp. strain RQ7 and T. maritima [186, 187], but no natural plasmids have ever been seen in T. sp. strain RQ2. Plasmids pRQ7 and pMC24 are only 846 bp in length and encode just one apparent protein, which seems to play a role in plasmid replication but lacks the site-specific nuclease activity typical to a fully functional replication protein [202]. It is possible that the genomes of T. sp. strain RQ7 and T. maritima encode gene(s) essential to the replication of pRQ7-like plasmids, allowing the survival of pRQ7/pMC24-based vectors, whereas T. sp. strain RQ2 may lack such gene(s). As about half of the Thermotoga genomes encode uncharacterized proteins, finding such gene(s) requires thorough functional genomics studies and will be the future direction of our work.
79
Figure 24 Stabilities of the Thermotoga sp. strain RQ2 recombinant strains based on endoglucanase (A) and exoglucanase activities (B). The bacterial cultures were transferred for three consecutive times with 150 µg ml-1 kanamycin. Samples used for plate assays were prepared from normalized cultures. +, C. saccharolyticus DSM 8903, -, T. sp. strain RQ2. 80
Conclusion
This work demonstrated that it is possible to functionally express large heterologous proteins in Thermotoga. Transformed with the recombinant Caldicellulosiruptor cellulases, T. sp. strain RQ2 displayed increased endoglucanase activity with the expression of all three engineered enzymes, namely TM1840 (AmyA)-Csac_1078 (CelB), TM0070 (XynB)-Csac_1078
(CelB), and TM0070 (XynB)-Csac_1076 (CelA). Exoglucanase activity was also improved significantly in T. sp. strain RQ2 transformants expressing the chimeric enzymes TM1840
(AmyA)-Csac_1078 (CelB) and TM0070 (XynB)-Csac_1078 (CelB). However, the Thermotoga transformants lost their recombinant genes after three consecutive transfers. This chapter represents an important milestone in the effort of using Thermotoga to produce biohydrogen directly from cellulosic biomass. Future studies should be focused on improving the stability of the transformants, so that the engineered traits remain functional in an industrial application.
81
SUMMARY
In Chapter I, a pET-based vector pDH21 expressing the methylase, M.TneDI,
(recognizing CGCG) from Thermotoga was constructed, and transformed into E. coli
BL21(DE3). Despite E. coli BL21(DE3) being McrBC positive, 30 transformants were isolated, which were suspected to be McrBC- mutants. The overexpression of M.TneDI was verified by
SDS-PAGE analysis. Compared to the previously constructed pJC340 vector, a pACYC184
derivative expressing M.TneDI from a tet promotor, the newly constructed pDH21 vector
improved the expression of the methylase about four fold, allowing complete protection of DNA
substrates. This chapter not only demonstrates a practical approach to overexpress potential
lethal proteins in E. coli, but also delivers a production strain of M.TneDI that might be useful in
various in vitro methylation applications. It was suggested that restriction-modification system
TneDI was active during normal growth of T. maritima, T. sp. strain RQ2, and T. neapolitana,
not in T. sp. strain RQ7. Also methylation by M.TneDI was suggested to be at position of m4C.
In chapter II, natural transformation was confirmed to exist, and further optimized in
Thermotoga sp. strain RQ2, which provides convenience for genetic modification of Thermotoga.
Natural transformation happened best in early exponential phase, and preferred linear DNA
substrates compared with circular ones. Gentle agitation favored natural transformation than
static condition. Within DNA substrate concentration 10 to 25 µg ml-1, natural transformation
worked best. Supernatant of overnight Thermotoga culture causing rapid DNA degradation
complicated the natural transformation procedure. Methylation of DNA substrates by M.TneDI
could further enhance natural transformation in Thermotoga sp. strain RQ2.
In Chapter III, cellulase genes Csac_1076 (celA) and Csac_1078 (celB) from
Caldicellulosiruptor saccharolyticus were cloned into T. sp. strain RQ2 for heterologous 82
overexpression. Coding regions of Csac_1076 and Csac_1078 were fused to the signal peptide of
TM1840 (amyA) and TM0070 (xynB), resulting in three chimeric enzymes, namely, TM1840-
Csac_1078, TM0070-Csac_1078, and TM0070-Csac_1076, which were carried by Thermotoga-
E. coli shuttle vectors pHX02, pHX04, and pHX07, respectively. All three recombinant enzymes were successfully expressed in E. coli DH5α and T. sp. strain RQ2, rendering the hosts with increased endo- and/or exoglucanase activities. In E. coli, the recombinant enzymes were mainly bound to the bacterial cells, whereas in T. sp. strain RQ2, about half of the enzyme activities were observed in the culture supernatants. However, the cellulase activities were lost in T. sp.
strain RQ2 after three consecutive transfers. Nevertheless, this is the first time heterologous
genes bigger than 1 kb (up to 5.3 kb) have ever been expressed in Thermotoga, demonstrating
the feasibility of using engineered Thermotoga spp. for efficient cellulose utilization.
In a summary, this dissertation overexpressed the methylase M.TneDI and explored the
restriction-modification systems of Thermotoga strains, optimized the natural transformation method, and made progress in genetically modifying Thermotoga to utilize the cellulose. In the future, Thermotoga might be used in industrial-scale production of bioenergy.
83
REFERENCES
1. Huber R, Langworthy TA, Konig H, Thomm M, Woese CR, Sleytr UB, Stetter KO:
Thermotoga maritima sp. nov. represents a new genus of unique extremely
thermophilic eubacteria growing up to 90°C. Archives of Microbiology 1986,
144(4):324-333.
2. Jannasch HW, Huber R, Belkin S, Stetter KO: Thermotoga neapolitana sp. nov. of the
extremely thermophilic, eubacterial genus Thermotoga. Archives of Microbiology
1988, 150(1):103-104.
3. Windberger E, Huber R, Trincone A, Fricke H, Stetter KO: Thermotoga thermarum sp.
nov. and Thermotoga neapolitana Occurring in African Continental Solfataric
Springs. Archives of Microbiology 1989, 151(6):506-512.
4. Ravot G, Magot M, Fardeau M-L, Patel BK, Prensier G, Egan A, Garcia JL, Ollivier B:
Thermotoga elfii sp. nov., a Novel Thermophilic Bacterium from an African Oil-
Producing Well. International Journal of Systematic Bacteriology 1995, 45(2):308-314.
5. Jeanthon C, Reysenbach A-L, L᾽Haridon S, Gambacorta A, Pace NR, Glénat P, Prieur D:
Thermotoga subterranea sp. nov., a new thermophilic bacterium isolated from a
continental oil reservoir. Archives of Microbiology 1995, 164(2):91-97.
6. Fardeau ML, Ollivier B, Patel BKC, Magot M, Thomas P, Rimbault A, Rocchiccioli F,
Garcia JL: Thermotoga hypogea sp. nov., a xylanolytic, thermophilic bacterium from
an oil-producing well. International Journal of Systematic Bacteriology 1997,
47(4):1013-1019.
7. Takahata Y, Nishijima M, Hoaki T, Maruyama T: Thermotoga petrophila sp nov and
Thermotoga naphthophila sp nov., two hyperthermophilic bacteria from the Kubiki 84
oil reservoir in Niigata, Japan. International Journal of Systematic and Evolutionary
Microbiology 2001, 51:1901-1909.
8. Balk M, Weijma J, Stams AJM: Thermotoga lettingae sp. nov., a novel thermophilic,
methanol-degrading bacterium isolated from a thermophilic anaerobic reactor.
International Journal of Systematic and Evolutionary Microbiology 2002, 52(4):1361-
1368.
9. Mori K, Yamazoe A, Hosoyama A, Ohji S, Fujita N, Ishibashi J, Kimura H, Suzuki K:
Thermotoga profunda sp. nov. and Thermotoga caldifontis sp. nov., anaerobic
thermophilic bacteria isolated from terrestrial hot springs. International Journal of
Systematic and Evolutionary Microbiology 2014, 64(Pt 6):2128-2136.
10. Rachel R, Engel AM, Huber R, Stetter KO, Baumeister W: A Porin-Type Protein Is the
Main Constituent of the Cell-Envelope of the Ancestral Eubacterium Thermotoga-
Maritima. Febs Letters 1990, 262(1):64-68.
11. Engel AM, Brunen M, Baumeister W: The functional properties of Ompβ, the
regularly arrayed porin of the hyperthermophilic bacterium Thermotoga maritima
FEMS Microbiology Letters 1993, 109(2-3):231-236.
12. Engel AM, Cejka Z, Lupas A, Lottspeich F, Baumeister W: Isolation and cloning of
Ompα, a coiled-coil protein spanning the periplasmic space of the ancestral
eubacterium Thermotoga maritima. The EMBO Journal 1992, 11(12):4369-4378.
13. Salje J, van den Ent F, de Boer P, Lowe J: Direct Membrane Binding by Bacterial
Actin MreB. Molecular Cell 2011, 43(3):478-487.
14. Frock AD, Montero CI, Blumer-Schuette SE, Kelly RM: Stationary Phase and Nutrient
Levels Trigger Transcription of a Genomic Locus Containing a Novel Peptide 85
(TM1316) in the Hyperthermophilic Bacterium Thermotoga maritima. Applied and
Environmental Microbiology 2013, 79(21):6637-6646.
15. Liebl W, Stemplinger I, Ruile P: Properties and Gene Structure of the Thermotoga
maritima α-Amylase AmyA, a Putative Lipoprotein of a Hyperthermophilic
Bacterium. Journal of Bacteriology 1997, 179(3):941-948.
16. Liebl W, Winterhalter C, Baumeister W, Armbrecht M, Valdez M: Xylanase
Attachment to the Cell Wall of the Hyperthermophilic Bacterium Thermotoga
maritima. Journal of Bacteriology 2008, 190(4):1350-1358.
17. Schumann J, Wrba A, Jaenicke R, Stetter KO: Topographical and enzymatic
characterization of amylases from the extremely thermophilic eubacterium
Thermotoga maritima. FEBS Letters 1991, 282(1):122-126.
18. Le Fourn C, Fardeau ML, Ollivier B, Lojou E, Dolla A: The hyperthermophilic
anaerobe Thermotoga Maritima is able to cope with limited amount of oxygen:
insights into its defence strategies. Environmental Microbiology 2008, 10(7):1877-1887.
19. Belkin S, Wirsen CO, Jannasch HW: A New Sulfur-Reducing, Extremely
Thermophilic Eubacterium from a Submarine Thermal Vent. Applied and
Environmental Microbiology 1986, 51(6):1180-1185.
20. Childers SE, Vargas M, Noll KM: Improved Methods for Cultivation of the
Extremely Thermophilic Bacterium Thermotoga neapolitana. Applied and
Environmental Microbiology 1992, 58(12):3949-3953.
21. Van Ooteghem SA, Jones A, Van Der Lelie D, Dong B, Mahajan D: H(2) production
and carbon utilization by Thermotoga neapolitana under anaerobic and
microaerobic growth conditions. Biotechnology Letters 2004, 26(15):1223-1232. 86
22. Yang X, Ma K: Purification and characterization of an NADH oxidase from
extremely thermophilic anaerobic bacterium Thermotoga hypogea. Archives of
Microbiology 2005, 183(5):331-337.
23. Le Fourn C, Brasseur G, Brochier-Armanet C, Pieulle L, Brioukhanov A, Ollivier B,
Dolla A: An oxygen reduction chain in the hyperthermophilic anaerobe Thermotoga
maritima highlights horizontal gene transfer between Thermococcales and
Thermotogales. Environmental Microbiology 2011, 13(8):2132-2145.
24. Lakhal R, Auria R, Davidson S, Ollivier B, Dolla A, Hamdi M, Combet-Blanc Y: Effect
of Oxygen and Redox Potential on Glucose Fermentation in Thermotoga maritima
under Controlled Physicochemical Conditions. International Journal of Microbiology
2010, 2010:896510.
25. Han D, Norris SM, Xu Z: Construction and transformation of a Thermotoga-E. coli
shuttle vector. BMC Biotechnology 2012, 12:2.
26. Han D, Xu H, Puranik R, Xu Z: Natural transformation of Thermotoga sp. strain RQ7.
BMC Biotechnology 2014, 14(1):39.
27. Xu H, Han D, Xu Z: Overexpression of a lethal methylase M.TneDI in E. coli
BL21(DE3) Biotechnology Letters 2014, 36(9):1853-1859.
28. Kengen SWM, van der Oost J, de Vos WM: Molecular characterization of H2O2-
forming NADH oxidases from Archaeoglobus fulgidus. European Journal of
Biochemistry 2003, 270(13):2885-2894.
29. Ward DE, Donnelly CJ, Mullendore ME, van der Oost J, de Vos WM, Crane EJ, 3rd:
The NADH oxidase from Pyrococcus furiosus. Implications for the protection of 87
anaerobic hyperthermophiles against oxidative stress. European Journal of
Biochemistry 2001, 268(22):5816-5823.
30. Nelson KE, Clayton RA, Gill SR, Gwinn ML, Dodson RJ, Haft DH, Hickey EK,
Peterson JD, Nelson WC, Ketchum KA et al: Evidence for lateral gene transfer
between Archaea and bacteria from genome sequence of Thermotoga maritima.
Nature 1999, 399(6734):323-329.
31. Yang XQ, Ma KS: Characterization of an exceedingly active NADH oxidase from the
anaerobic hyperthermophilic bacterium Thermotoga maritima. Journal of
Bacteriology 2007, 189(8):3312-3317.
32. Lakhal R, Auria R, Davidson S, Ollivier B, Durand MC, Dolla A, Hamdi M, Combet-
Blanc Y: Oxygen uptake rates in the hyperthermophilic anaerobe Thermotoga
maritima grown in a bioreactor under controlled oxygen exposure: clues to its
defence strategy against oxidative stress. Archives of Microbiology 2011, 193(6):429-
438.
33. Levin DB, Pitt L, Love M: Biohydrogen production: prospects and limitations to
practical application. International Journal of Hydrogen Energy 2004, 29(2):173-185.
34. Pawar SS, van Niel EWJ: Thermophilic biohydrogen production: how far are we?
Applied Microbiology and Biotechnology 2013, 97(18):7999-8009.
35. Nguyen TAD, Kim JP, Kim MS, Oh YK, Sim SJ: Optimization of hydrogen
production by hyperthermophilic eubacteria, Thermotoga maritima and Thermotoga
neapolitana in batch fermentation. International Journal of Hydrogen Energy 2008,
33(5):1483-1488. 88
36. Eriksen NT, Riis ML, Holm NK, Iversen N: H(2) synthesis from pentoses and biomass
in Thermotoga spp. Biotechnology Letters 2011, 33(2):293-300.
37. Maru BT, Bielen AAM, Kengen SWM, Constanti M, Medina F: Biohydrogen
production from glycerol using Thermotoga spp. Energy Procedia 2012, 29:300-307.
38. Van Ooteghem SA, Beer SK, Yue PC: Hydrogen Production by the Thermophilic
Bacterium Thermotoga neapolitana. Applied Biochemistry and Biotechnology 2002, 98-
100:177-189.
39. Thauer RK, Jungermann K, Decker K: Energy conservation in chemotrophic
anaerobic bacteria. Bacteriology Reviews 1977, 41(1):100-180.
40. Schroder C, Selig M, Schonheit P: Glucose Fermentation to Acetate, CO2 and H2 in
the Anaerobic Hyperthermophilic Eubacterium Thermotoga maritima - Involvement
of the Embden-Meyerhof Pathway. Archives of Microbiology 1994, 161(6):460-470.
41. Schut GJ, Adams MWW: The Iron-Hydrogenase of Thermotoga maritima Utilizes
Ferredoxin and NADH Synergistically: a New Perspective on Anaerobic Hydrogen
Production. Journal of Bacteriology 2009, 191(13):4451-4457.
42. Verhaart MRA, Bielen AAM, van der Oost J, Stams AJM, Kengen SWM: Hydrogen
production by hyperthermophilic and extremely thermophilic bacteria and archaea:
mechanisms for reductant disposal. Environmental Technology 2010, 31(8-9):993-
1003.
43. Wiegel J, Ljungdahl LG: The Importance of Thermophilic Bacteria in Biotechnology.
Critical Reviews in Biotechnology 1986, 3(1):39-108. 89
44. Liu Y, Yu P, Song X, Qu YB: Hydrogen production from cellulose by co-culture of
Clostridium thermocellum JN4 and Thermoanaerobacterium thermosaccharolyticum
GD17. International Journal of Hydrogen Energy 2008, 33(12):2927-2933.
45. Wang AJ, Ren NQ, Shi YG, Lee DJ: Bioaugmented hydrogen production from
microcrystalline cellulose using co-culture - Clostridium acetobutylicum X-9 and
Etilanoigenens harbinense B-49. International Journal of Hydrogen Energy 2008,
33(2):912-917.
46. Wang AJ, Gao LF, Ren NQ, Xu JF, Liu C: Bio-hydrogen production from cellulose by
sequential co-culture of cellulosic hydrogen bacteria of Enterococcus gallinarum G1
and Ethanoigenens harbinense B49. Biotechnology Letters 2009, 31(9):1321-1326.
47. Johnson MR, Montero CI, Conners SB, Shockley KR, Bridger SL, Kelly RM:
Population density-dependent regulation of exopolysaccharide formation in the
hyperthermophilic bacterium Thermotoga maritima. Molecular Microbiology 2005,
55(3):664-674.
48. Nogales J, Gudmundsson S, Thiele I: An in silico re-design of the metabolism in
Thermotoga maritima for increased biohydrogen production. International Journal of
Hydrogen Energy 2012, 37(17):12205-12218.
49. Achenbach-Richter L, Gupta R, Stetter KO, Woese CR: Were the Original Eubacteria
Thermophiles? Systematic and Applied Microbiology 1987, 9(1-2):34-39.
50. Woese CR: Bacterial Evolution. Microbiological Reviews 1987, 51(2):221-271.
51. Pennisi E: Is it time to uproot the tree of life? Science 1999, 284(5418):1305-1307.
52. Zhaxybayeva O, Swithers KS, Lapierre P, Fournier GP, Bickhart DM, Deboy RT, Nelson
KE, Nesbo CL, Doolittle WF, Gogarten JP et al: On the chimeric nature, thermophilic 90
origin, and phylogenetic placement of the Thermotogales. Proceedings of the National
Academy of Sciences of the United States of America 2009, 106(14):5865-5870.
53. Wong JTF, Chen J, Mat WK, Ng SK, Xue H: Polyphasic evidence delineating the root
of life and roots of biological domains. Gene 2007, 403(1-2):39-52.
54. Di Giulio M: The universal ancestor and the ancestor of bacteria were
hyperthermophiles. Journal of Molecular Evolution 2003, 57(6):721-730.
55. Gupta RS, Bhandari V: Phylogeny and molecular signatures for the phylum
Thermotogae and its subgroups. Antonie Van Leeuwenhoek 2011, 100(1):1-34.
56. Gyles C, Boerlin P: Horizontally Transferred Genetic Elements and Their Role in
Pathogenesis of Bacterial Disease. Veterinary Pathology 2014, 51(2):328-340.
57. Logsdon JM, Faguy DM: Evolutionary genomics: Thermotoga heats up lateral gene
transfer. Current Biology 1999, 9(19):R747-R751.
58. Syvanen M: Cross-species gene transfer; implications for a new theory of evolution.
Journal of Theoretical Biology 1985, 112(2):333-343.
59. Nesbø CL, L'Haridon S, Stetter KO, Doolittle WF: Phylogenetic Analyses of Two
"Archaeal" Genes in Thermotoga maritima Reveal Multiple Transfers Between
Archaea and Bacteria. Molecular Biology and Evolution 2001, 18(3):362-375.
60. Mongodin EF, Hance IR, Deboy RT, Gill SR, Daugherty S, Huber R, Fraser CM, Stetter
K, Nelson KE: Gene Transfer and Genome Plasticity in Thermotoga maritima, a
Model Hyperthermophilic Species. Journal of Bacteriology 2005, 187(14):4935-4944.
61. Nesbø CL, Dlutek M, Doolittle WF: Recombination in Thermotoga: Implications for
Species Concepts and Biogeography. Genetics 2006, 172(2):759-769. 91
62. Sutcliffe B, Midgley DJ, Rosewarne CP, Greenfield P, Li D: Draft Genome Sequence of
Thermotoga maritima A7A Reconstructed from Metagenomic Sequencing Analysis
of a Hydrocarbon Reservoir in the Bass Strait, Australia. Genome Announc 2013,
1(5).
63. Li H, Yang SZ, Mu BZ, Rong ZF, Zhang J: Molecular phylogenetic diversity of the
microbial community associated with a high-temperature petroleum reservoir at an
offshore oilfield. FEMS Microbiology Ecology 2007, 60(1):74-84.
64. Fiala G, Stetter KO: Pyrococcus furiosus sp. nov. represents a novel genus of marine
heterotrophic archaebacteria growing optimally at 100°C. Archives of Microbiology
1986, 145(1):56-61.
65. Noll KM, Vargas M: Recent advances in genetic analyses of hyperthermophilic
Archaea and Bacteria. Archives of Microbiology 1997, 168(2):73-80.
66. Kotnik T: Lightning-triggered electroporation and electrofusion as possible
contributors to natural horizontal gene transfer. Physics of Life Reviews 2013,
10(3):351-370.
67. Vargas M: Development of genetic methods in the hyperthermophilic bacterium
Thermotoga neapolitana. PhD Thesis, University of Connecticut, Storrs, USA 1995.
68. Yu JS, Vargas M, Mityas C, Noll KM: Liposome-mediated DNA uptake and transient
expression in Thermotoga. Extremophiles 2001, 5(1):53-60.
69. Averhoff B, Friedrich A: Type IV pili-related natural transformation systems: DNA
transport in mesophilic and thermophilic bacteria. Archives of Microbiology 2003,
180(6):385-393. 92
70. Chen I, Dubnau D: DNA uptake during bacterial transformation. Nature Reviews
Microbiology 2004, 2(3):241-249.
71. Chen I, Gotschlich EC: ComE, a competence protein from Neisseria gonorrhoeae
with DNA-binding activity. Journal of Bacteriology 2001, 183(10):3160-3168.
72. Claverys JP, Martin B, Polard P: The genetic transformation machinery: composition,
localization, and mechanism. FEMS Microbiology Reviews 2009, 33(3):643-656.
73. Draskovic I, Dubnau D: Biogenesis of a putative channel protein, ComEC, required
for DNA uptake: membrane topology, oligomerization and formation of disulphide
bonds. Molecular Microbiology 2005, 55(3):881-896.
74. Kruger NJ, Stingl K: Two steps away from novelty – principles of bacterial DNA
uptake. Molecular Microbiology 2011, 80(4):860-867.
75. Xu H, Han D, Xu Z: Expression of Heterologous Cellulases in Thermotoga sp. Strain
RQ2 BioMed Research International (In press) 2015.
76. Bickle TA: Restricting restriction. Mol Microbiol 2004, 51(1):3-5.
77. Loenen WA: Tracking EcoKI and DNA fifty years on: a golden story full of
surprises. Nucleic Acids Research 2003, 31(24):7059-7069.
78. Roberts RJ, Vincze T, Posfai J, Macelis D: REBASE-restriction enzymes and DNA
methyltransferases. Nucleic Acids Research 2005, 33(Database issue):D230-232.
79. Xu Z, Han D, Cao J, Saini U: Cloning and characterization of the TneDI restriction-
modification system of Thermotoga neapolitana. Extremophiles 2011, 15(6):665-672.
80. Barrangou R, Fremaux C, Deveau H, Richards M, Boyaval P, Moineau S, Romero DA,
Horvath P: CRISPR Provides Acquired Resistance Against Viruses in Prokaryotes.
Science 2007, 315(5819):1709-1712. 93
81. Bolotin A, Quinquis B, Sorokin A, Ehrlich SD: Clustered regularly interspaced short
palindrome repeats (CRISPRs) have spacers of extrachromosomal origin.
Microbiology 2005, 151(8):2551-2561.
82. Brouns SJJ, Jore MM, Lundgren M, Westra ER, Slijkhuis RJH, Snijders APL, Dickman
MJ, Makarova KS, Koonin EV, van der Oost J: Small CRISPR RNAs Guide Antiviral
Defense in Prokaryotes. Science 2008, 321(5891):960-964.
83. Horvath P, Romero DA, Coûté-Monvoisin A-C, Richards M, Deveau H, Moineau S,
Boyaval P, Fremaux C, Barrangou R: Diversity, Activity, and Evolution of CRISPR
Loci in Streptococcus thermophilus. Journal of Bacteriology 2008, 190(4):1401-1412.
84. Dupuis M-È, Villion M, Magadán AH, Moineau S: CRISPR-Cas and restriction-
modification systems are compatible and increase phage resistance. Nature
Communications 2013, 4:2087.
85. Bikard D, Hatoum-Aslan A, Mucida D, Marraffini LA: CRISPR Interference Can
Prevent Natural Transformation and Virulence Acquisition during In Vivo
Bacterial Infection. Cell Host & Microbe 2012, 12(2):177-186.
86. Lee D, Seo H, Park C, Park K: WeGAS: A Web-Based Microbial Genome Annotation
System. Bioscience Biotechnology and Biochemistry 2009, 73(1):213-216.
87. Swithers KS, DiPippo JL, Bruce DC, Detter C, Tapia R, Han SS, Saunders E, Goodwin
LA, Han J, Woyke T et al: Genome Sequence of Thermotoga sp. Strain RQ2, a
Hyperthermophilic Bacterium Isolated from a Geothermally Heated Region of the
Seafloor near Ribeira Quente, the Azores. Journal of Bacteriology 2011,
193(20):5869-5870. 94
88. Latif H, Lerman JA, Portnoy VA, Tarasova Y, Nagarajan H, Schrimpe-Rutledge AC,
Smith RD, Adkins JN, Lee DH, Qiu Y et al: The Genome Organization of Thermotoga
maritima Reflects Its Lifestyle. PLOS Genetics 2013, 9(4).
89. Frock AD, Gray SR, Kelly RM: Hyperthermophilic Thermotoga Species Differ with
Respect to Specific Carbohydrate Transporters and Glycoside Hydrolases. Applied
and Environmental Microbiology 2012, 78(6):1978-1986.
90. Rodionov DA, Rodionova IA, Li XQ, Ravcheev DA, Tarasova Y, Portnoy VA, Zengler
K, Osterman AL: Transcriptional regulation of the carbohydrate utilization network
in Thermotoga maritima. Frontiers in Microbiology 2013, 4.
91. Wang ZW, Tong W, Wang QH, Bai X, Chen Z, Zhao JJ, Xu NZ, Liu SQ: The
Temperature Dependent Proteomic Analysis of Thermotoga maritima. PLOS ONE
2012, 7(10).
92. Pysz MA, Ward DE, Shockley KR, Montero CI, Conners SB, Johnson MR, Kelly RM:
Transcriptional analysis of dynamic heat-shock response by the hyperthermophilic
bacterium Thermotoga maritima. Extremophiles 2004, 8(3):209-217.
93. Lerman JA, Hyduke DR, Latif H, Portnoy VA, Lewis NE, Orth JD, Schrimpe-Rutledge
AC, Smith RD, Adkins JN, Zengler K et al: In silico method for modelling metabolism
and gene product expression at genome scale. Nature Communications 2012, 3:929.
94. Zhang YHP, Himmel ME, Mielenz JR: Outlook for cellulase improvement: Screening
and selection strategies. Biotechnology Advances 2006, 24(5):452-481.
95. Pauly M, Keegstra K: Cell-wall carbohydrates and their modification as a resource
for biofuels. Plant Journal 2008, 54(4):559-568. 95
96. Somerville C: Cellulose synthesis in higher plants. Annual Review of Cell and
Developmental Biology 2006, 22:53-78.
97. Harholt J, Suttangkakul A, Vibe Scheller H: Biosynthesis of pectin. Plant Physiology
2010, 153(2):384-395.
98. Scheller HV, Ulvskov P: Hemicelluloses. Annual Review of Plant Biology, Vol 61 2010,
61:263-289.
99. Rose JKC, Lee SJ: Straying off the Highway: Trafficking of Secreted Plant Proteins
and Complexity in the Plant Cell Wall Proteome. Plant Physiology 2010, 153(2):433-
436.
100. Shoda M, Sugano Y: Recent advances in bacterial cellulose production. Biotechnology
and Bioprocess Engineering 2005, 10(1):1-8.
101. Hirose E, Kimura S, Itoh T, Nishikawa J: Tunic morphology and cellulosic
components of pyrosomas, doliolids, and salps (Thaliacea, Urochordata). Biological
Bulletin 1999, 196(1):113-120.
102. Kimura S, Ohshima C, Hirose E, Nishikawa J, Itoh T: Cellulose in the house of the
appendicularian Oikopleura rufescens. Protoplasma 2001, 216(1-2):71-74.
103. Vandaele Y, Revol JF, Gaill F, Goffinet G: Characterization and Supramolecular
Architecture of the Cellulose-Protein Fibrils in the Tunic of the Sea Peach
(Halocynthia papillosa, Ascidiacea, Urochordata). Biology of the Cell 1992, 76(1):87-
96.
104. Hirose E, Nakashima K, Nishino A: Is there intracellular cellulose in the
appendicularian tail epidermis? Communicative & Integrative Biology 2011, 4(6):768-
771. 96
105. Lynd LR, Weimer PJ, van Zyl WH, Pretorius IS: Microbial cellulose utilization:
Fundamentals and biotechnology. Microbiology and Molecular Biology Reviews 2002,
66(3):506-577.
106. Zhang YHP, Lynd LR: Toward an aggregated understanding of enzymatic hydrolysis
of cellulose: Noncomplexed cellulase systems. Biotechnology and Bioengineering 2004,
88(7):797-824.
107. OSullivan AC: Cellulose: the structure slowly unravels. Cellulose 1997, 4(3):173-207.
108. Quiroz-Castañeda RE, Folch-Mallol JL: Hydrolysis of Biomass Mediated by Cellulases
for the Production of Sugars Sustainable Degradation of Lignocellulosic Biomass -
Techniques, Applications and Commercialization, Dr. Anuj Chandel (Ed.), ISBN:
978-953-51-1119-1, InTech. 2013:119-155.
109. Medronho B, Romano A, Miguel MG, Stigsson L, Lindman B: Rationalizing cellulose
(in)solubility: reviewing basic physicochemical aspects and role of hydrophobic
interactions. Cellulose 2012, 19(3):581-587.
110. Wolfenden R, Snider MJ: The depth of chemical time and the power of enzymes as
catalysts. Accounts of Chemical Research 2001, 34(12):938-945.
111. Angenent LT, Karim K, Al-Dahhan MH, Domiguez-Espinosa R: Production of
bioenergy and biochemicals from industrial and agricultural wastewater. Trends in
Biotechnology 2004, 22(9):477-485.
112. Das H, Singh SK: Useful byproducts from cellulosic wastes of agriculture and food
industry - A critical appraisal. Critical Reviews in Food Science and Nutrition 2004,
44(2):77-89. 97
113. Demain AL, Newcomb M, Wu JHD: Cellulase, clostridia, and ethanol. Microbiology
and Molecular Biology Reviews 2005, 69(1):124-+.
114. Fang HHP, Zhang T, Liu H: Microbial diversity of a mesophilic hydrogen-producing
sludge. Applied Microbiology and Biotechnology 2002, 58(1):112-118.
115. Reddy N, Yang Y: Biofibers from agricultural byproducts for industrial applications.
Trends in Biotechnology 2005, 23(1):22-27.
116. Bronnenmeier K, Kern A, Liebl W, Staudenbauer WL: Purification of Thermotoga
maritima Enzymes for the Degradation of Cellulosic Materials. Applied
Environmental Microbiology 1995, 61(4):1399-1407.
117. Park JI, Kent MS, Datta S, Holmes BM, Huang Z, Simmons BA, Sale KL, Sapra R:
Enzymatic hydrolysis of cellulose by the cellobiohydrolase domain of CelB from the
hyperthermophilic bacterium Caldicellulosiruptor saccharolyticus. Bioresource
Technology 2011, 102(10):5988-5994.
118. Ruttersmith LD, Daniel RM: Thermostable cellobiohydrolase from the thermophilic
eubacterium Thermotoga sp. strain FjSS3-B.1. Purification and properties.
Biochemical Journal 1991, 277:887-890.
119. Wang H, Squina F, Segato F, Mort A, Lee D, Pappan K, Prade R: High-Temperature
Enzymatic Breakdown of Cellulose. Applied and Environmental Microbiology 2011,
77(15):5199-5206.
120. Shoham Y, Lamed R, Bayer EA: The cellulosome concept as an efficient microbial
strategy for the degradation of insoluble polysaccharides. Trends in Microbiology
1999, 7(7):275-281. 98
121. VanFossen AL, Ozdemir I, Zelin SL, Kelly RM: Glycoside Hydrolase Inventory Drives
Plant Polysaccharide Deconstruction by the Extremely Thermophilic Bacterium
Caldicellulosiruptor saccharolyticus. Biotechnology and Bioengineering 2011,
108(7):1559-1569.
122. Shoseyov O, Shani Z, Levy I: Carbohydrate binding modules: Biochemical properties
and novel applications. Microbiology and Molecular Biology Reviews 2006, 70(2):283-
295.
123. Bayer EA, Shoham Y, Lamed R: Cellulose-decomposing bacteria and their enzyme
systems. In: Dworkin M, Falkow S, Rosenberg E, Schleifer KH, Stackebrandt E (eds)
The Prokaryotes, vol 2. Springer, New York. 2006:578-617.
124. Dashtban M, Schraft H, Qin WS: Fungal Bioconversion of Lignocellulosic Residues;
Opportunities & Perspectives. International Journal of Biological Sciences 2009,
5(6):578-595.
125. Cherry JR, Fidantsef AL: Directed evolution of industrial enzymes: an update.
Current Opinion in Biotechnology 2003, 14(4):438-443.
126. Kirk O, Borchert TV, Fuglsang CC: Industrial enzyme applications. Current Opinion
in Biotechnology 2002, 13(4):345-351.
127. Shi H, Zhang Y, Wang LL, Li X, Li WQ, Li XQ, Wang F: Molecular analysis of
hyperthermophilic endoglucanase Cel12B from Thermotoga maritima and the
properties of its functional residues. BMC Structural Biology 2014, 14.
128. Murashima K, Kosugi A, Doi RH: Thermostabilization of cellulosomal endoglucanase
EngB from Clostridium cellulovorans by in vitro DNA recombination with non-
cellulosomal endoglucanase EngD. Molecular Microbiology 2002, 45(3):617-626. 99
129. Chhabra SR, Shockley KR, Conners SB, Scott KL, Wolfinger RD, Kelly RM:
Carbohydrate-induced Differential Gene Expression Patterns in the
Hyperthermophilic Bacterium Thermotoga maritima. The Journal of Biological
Chemistry 2003, 278(9):7540-7552.
130. Simpson HD, Haufler UR, Daniel RM: An extremely thermostable xylanase from the
thermophilic eubacterium Thermotoga. Biochemical Journal 1991, 277:413-417.
131. Winterhalter C, Liebl W: Two Extremely Thermostable Xylanases of the
Hyperthermophilic Bacterium Thermotoga maritima MSB8. Applied and
Environmental Microbiology 1995, 61(5):1810-1815.
132. Lim WJ, Park SR, An CL, Lee JY, Hong SY, Shin EC, Kim EJ, Kim JO, Kim H, Yun
HD: Cloning and characterization of a thermostable intracellular alpha-amylase
gene from the hyperthermophilic bacterium Thermotoga maritima MSB8. Research
in Microbiology 2003, 154(10):681-687.
133. Ballschmiter M, Futterer O, Liebl W: Identification and characterization of a novel
intracellular alkaline alpha-amylase from the hyperthermophilic bacterium
Thermotoga maritima MSB8. Applied and Environmental Microbiology 2006,
72(3):2206-2211.
134. Dickmanns A, Ballschmiter M, Liebl W, Ficner R: Structure of the novel alpha-
amylase AmyC from Thermotoga maritima. Acta Crystallographica Section D-
Biological Crystallography 2006, 62:262-270.
135. Moreno A, Damian-Almazo JY, Miranda A, Saab-Rincon G, Gonzalez F, Lopez-
Munguia A: Transglycosylation reactions of Thermotoga maritima α-amylase. Enzyme
and Microbial Technology 2010, 46(5):331-337. 100
136. Kleine J, Liebl W: Comparative characterization of deletion derivatives of the
modular xylanase XynA of Thermotoga maritima. Extremophiles 2006, 10(5):373-381.
137. Shi H, Zhang Y, Zhong H, Huang Y, Li X, Wang F: Cloning, over-expression and
characterization of a thermo-tolerant xylanase from Thermotoga thermarum.
Biotechnology Letters 2014, 36(3):587-593.
138. Liebl W, Ruile P, Bronnenmeier K, Riedel K, Lottspeich F, Greif I: Analysis of a
Thermotoga maritima DNA fragment encoding two similar thermostable cellulases,
CelA and CelB, and characterization of the recombinant enzymes. Microbiology
1996, 142:2533-2542.
139. Chhabra SR, Shockley KR, Ward DE, Kelly RM: Regulation of endo-acting glycosyl
hydrolases in the hyperthermophilic bacterium Thermotoga maritima grown on
glucan- and mannan-based polysaccharides. Applied and Environmental Microbiology
2002, 68(2):545-554.
140. Kim MK, Kang TH, Kim J, Kim H, Yun HD: Evidence Showing Duplication and
Recombination of cel Genes in Tandem from Hyperthermophilic Thermotoga sp.
Applied Biochemistry and Biotechnology 2012, 168(7):1834-1848.
141. Pereira JH, Chen ZW, McAndrew RP, Sapra R, Chhabra SR, Sale KL, Simmons BA,
Adams PD: Biochemical characterization and crystal structure of endoglucanase
Cel5A from the hyperthermophilic Thermotoga maritima. Journal of Structural
Biology 2010, 172(3):372-379.
142. Chhabra SR, Kelly RM: Biochemical characterization of Thermotoga maritima
endoglucanase Ce174 with and without a carbohydrate binding module (CBM).
FEBS Letters 2002, 531(2):375-380. 101
143. Mohammed ASK, Mohammed A, Motomitsu K, Kiyoshi H: A unique thermostable
lichenase from Thermotoga maritima MSB8 with divergent substrate specificity.
Indian Journal of Biotechnology 2007, 6:315-320.
144. Liebl W, Gabelsberger J, Schleifer KH: Comparative amino acid sequence analysis of
Thermotoga maritima beta-glucosidase (BglA) deduced from the nucleotide sequence
of the gene indicates distant relationship between beta-glucosidases of the BGA
family and other families of beta-1,4-glycosyl hydrolases. Molecular and General
Genetics 1994, 242(1):111-115.
145. Juturu V, Wu JC: Microbial xylanases: Engineering, production and industrial
applications. Biotechnology Advances 2012, 30(6):1219-1227.
146. Polizeli MLTM, Rizzatti ACS, Monti R, Terenzi HF, Jorge JA, Amorim DS: Xylanases
from fungi: properties and industrial applications. Applied Microbiology and
Biotechnology 2005, 67(5):577-591.
147. Harris AD, Ramalingam C: Xylanases and its Application in Food Industry: A
Review. Journal of Experimental Sciences 2010, 1(7):01-11.
148. de Souza PM, Magalhaes PDE: Application of microbial α-amylase in industry-a
review. Brazilian Journal of Microbiology 2010, 41(4):850-861.
149. Nielsen JE, Borchert TV: Protein engineering of bacterial α-amylases. Biochimica et
Biophysica Acta 2000, 1543(2):253-274.
150. Sundarram A, Krishna-Murthy TP: α-Amylase Production and Applications: A
Review. Journal of Applied & Environmental Microbiology 2014, 2(4):166-175 102
151. Chauhan PS, Puri N, Sharma P, Gupta N: Mannanases: microbial sources, production,
properties and potential biotechnological applications. Applied Microbiology and
Biotechnology 2012, 93(5):1817-1830.
152. Dhawan S, Kaur J: Microbial Mannanases: An Overview of Production and
Applications Critical Reviews in Biotechnology 2007, 27:197–216.
153. Raleigh EA: Organization and function of the mcrBC genes of Escherichia coli K-12.
Molecular Microbiology 1992, 6(9):1079-1086.
154. Raleigh EA, Wilson G: Escherichia coli K-12 restricts DNA containing 5-
methylcytosine. Proceedings of the National Academy of Sciences of the United States of
America 1986, 83(23):9070-9074.
155. Blumenthal RM, Gregory SA, Cooperider JS: Cloning of a restriction-modification
system from Proteus vulgaris and its use in analyzing a methylase-sensitive
phenotype in Escherichia coli. Journal of Bacteriology 1985, 164(2):501-509.
156. Butkus V, Klimasauskas S, Petrauskiene L, Maneliene Z, Lebionka A, Janulaitis A:
Interaction of AluI, Cfr6I and PvuII restriction-modification enzymes with
substrates containing either N4-methylcytosine or 5-methylcytosine. Biochimica et
Biophysica Acta 1987, 909(3):201-207.
157. Studier FW, Rosenberg AH, Dunn JJ, Dubendorff JW: Use of T7 RNA polymerase to
direct expression of cloned genes. Methods in Enzymology 1990, 185:60-89.
158. Sambrook J, Russell DW: The Condensed protocols from Molecular Cloing: A
Laboratory Manual Cold Spring Harbor Laboratory Press 2006. 103
159. Pierce JJ, Turner C, Keshavarz-Moore E, Dunnill P: Factors determining more efficient
large-scale release of a periplasmic enzyme from E. coli using lysozyme. Journal of
Biotechnology 1997, 58(1):1-11.
160. Jin SG, Kadam S, Pfeifer GP: Examination of the specificity of DNA methylation
profiling techniques towards 5-methylcytosine and 5-hydroxymethylcytosine.
Nucleic Acids Research 2010, 38(11):e125.
161. Ehrlich M, Gama-Sosa MA, Carreira LH, Ljungdahl LG, Kuo KC, Gehrke CW: DNA
methylation in thermophilic bacteria: N4-methylcytosine, 5-methylcytosine, and N6-
methyladenine. Nucleic Acids Research 1985, 13(4):1399-1412.
162. Malone T, Blumenthal RM, Cheng X: Structure-guided analysis reveals nine sequence
motifs conserved among DNA amino-methyltransferases, and suggests a catalytic
mechanism for these enzymes. Journal of Molecular Biology 1995, 253(4):618-632.
163. Gaido ML, Prostko CR, Strobl JS: Isolation and Characterization of BsuE
Methyltransferase, a CGCG Specific DNA Methyltransferase from Bacillus subtilis.
Journal of Biological Chemistry 1988, 263(10):4832-4836.
164. Gaido ML, Strobl JS: Methylation Sensitivity of the Restriction Enzymes FnudII and
AccII. Archives of Microbiology 1987, 146(4):338-340.
165. Lui ACP, Mcbride BC, Vovis GF, Smith M: Site specific endonuclease from
Fusobacterium nucleatum. Nucleic Acids Research 1979, 6(1):1-15.
166. Miyake M, Kotani H, Asada Y: Isolation and identification of restriction
endonuclease, SelI from a cyanobacterium, Synechococcus elongatus. Nucleic Acids
Research 1992, 20(10):2605. 104
167. Strobl JS, Thompson EB: Methylation of either cytosine in the recognition sequence
CGCG Inhibits ThaI cleavage of DNA. Nucleic Acids Research 1984, 12(21):8073-
8083.
168. Thomm M, Frey G, Bolton BJ, Laue F, Kessler C, Stetter KO: MvnI: a Restriction
Enzyme in the Archaebacterium Methanococcus vannielii. FEMS Microbiology
Letters 1988, 52(3):229-234.
169. Venetianer P, Orosz A: BepI restriction endonuclease, a new isoschisomer of FnudII.
Nucleic Acids Research 1988, 16(1):350.
170. Schwarzenlander C, Averhoff B: Characterization of DNA transport in the
thermophilic bacterium Thermus thermophilus HB27. The FEBS journal 2006,
273(18):4210-4218.
171. Smith HO, Gwinn ML, Salzberg SL: DNA uptake signal sequences in naturally
transformable bacteria. Res Microbiol 1999, 150(9-10):603-616.
172. Dubnau D: Binding and transport of transforming DNA by Bacillus subtilis: the role
of type-IV pilin-like proteins – a review. Gene 1997, 192(1):191-198.
173. Dubnau D: DNA uptake in bacteria. Annual Review of Microbiology 1999, 53:217-244.
174. Claverys JP, Martin B: Bacterial "competence" genes: signatures of active
transformation, or only remnants? Trends in Microbiology 2003, 11(4):161-165.
175. Berge M, Mortier-Barriere I, Martin B, Claverys JP: Transformation of Streptococcus
pneumoniae relies on DprA- and RecA-dependent protection of incoming DNA
single strands. Molecular Microbiology 2003, 50(2):527-536. 105
176. Berge M, Moscoso M, Prudhomme M, Martin B, Claverys JP: Uptake of transforming
DNA in Gram-positive bacteria: a view from Streptococcus pneumoniae. Molecular
Microbiology 2002, 45(2):411-421.
177. Mortier-Barriere I, Velten M, Dupaigne P, Mirouze N, Pietrement O, McGovern S,
Fichant G, Martin B, Noirot P, Le Cam E et al: A key presynaptic role in
transformation for a widespread bacterial protein: DprA conveys incoming ssDNA
to RecA. Cell 2007, 130(5):824-836.
178. Gwinn ML, Ramanathan R, Smith HO, Tomb JF: A new transformation-deficient
mutant of Haemophilus influenzae Rd with normal DNA uptake. Journal of
bacteriology 1998, 180(3):746-748.
179. Johnsborg O, Havarstein LS: Regulation of natural genetic transformation and
acquisition of transforming DNA in Streptococcus pneumoniae. FEMS microbiology
reviews 2009, 33(3):627-642.
180. Meibom KL, Blokesch M, Dolganov NA, Wu CY, Schoolnik GK: Chitin induces
natural competence in Vibrio cholerae. Science (New York, NY 2005, 310(5755):1824-
1827.
181. Mironczuk AM, Kovacs AT, Kuipers OP: Induction of natural competence in Bacillus
cereus ATCC14579. Microbial biotechnology 2008, 1:226-235.
182. Tsen SD, Fang SS, Chen MJ, Chien JY, Lee CC, Tsen DH: Natural plasmid
transformation in Escherichia coli. J Biomed Sci 2002, 9(3):246-252.
183. Cava F, Hidalgo A, Berenguer J: Thermus thermophilus as biological model.
Extremophiles 2009, 13(2):213-231. 106
184. Nesbø CL, Doolittle WF, Mongodin EF, Nelson KE: Outside forces helped shape the
Thermotoga metagenome. Microbe 2006, 1(5):235-241.
185. Noll KM, Thirangoon K: Interdomain transfers of sugar transporters overcome
barriers to gene expression. Methods in Molecular Biology 2009, 532:309-322.
186. Harriott OT, Huber R, Stetter KO, Betts PW, Noll KM: A Cryptic Miniplasmid from
the Hyperthermophilic Bacterium Thermotoga sp. Strain RQ7. Journal of
Bacteriology 1994, 176(9):2759-2762.
187. Akimkina T, Ivanov P, Kostrov S, Sokolova T, Bonch-Osmolovskaya E, Firman K, Dutta
CF, McClellan JA: A Highly Conserved Plasmid from the Extreme Thermophile
Thermotoga maritima MC24 is a Member of a Family of Plasmids Distributed
Worldwide. Plasmid 1999, 42(3):236-240.
188. Rainey FA, Donnison AM, Janssen PH, Saul D, Rodrigo A, Bergquist PL, Daniel RM,
Stackebrandt E, Morgan HW: Description of Caldicellulosiruptor saccharolyticus gen.
nov., sp. nov: An obligately anaerobic, extremely thermophilic, cellulolytic
bacterium. FEMS Microbiology Letters 1994, 120(3):263-266.
189. Johnston C, Martin B, Fichant G, Polard P, Claverys JP: Bacterial transformation:
distribution, shared mechanisms and divergent control. Nature Reviews Microbiology
2014, 12(3):181-196.
190. Israel DA, Lou AS, Blaser MJ: Characteristics of Helicobacter pylori natural
transformation. FEMS Microbiology Letters 2000, 186(2):275-280.
191. Koyama Y, Hoshino T, Tomizuka N, Furukawa K: Genetic transformation of the
extreme thermophile Thermus thermophilus and of other Thermus spp. Journal of
Bacteriology 1986, 166(1):338-340. 107
192. Bok JD, Yernool DA, Eveleigh DE: Purification, Characterization, and Molecular
Analysis of Thermostable Cellulases CelA and CelB from Thermotoga neapolitana.
Applied and Environmental Microbiology 1998, 64(12):4774-4781.
193. Teeri TT: Crystalline cellulose degradation: new insight into the function of
cellobiohydrolases. Trends in Biotechnology 1997, 15(5):160-167.
194. Tomme P, Warren RA, Gilkes NR: Cellulose hydrolysis by bacteria and fungi.
Advances in Microbial Physiology 1995, 37:1-81.
195. Te'o VSJ, Saul DJ, Bergquist PL: celA, another gene coding for a multidomain
cellulase from the extreme thermophile Caldocellum saccharolyticum. Applied
Microbiology and Biotechnology 1995, 43(2):291-296.
196. Zverlov V, Mahr S, Riedel K, Bronnenmeier K: Properties and gene structure of a
bifunctional cellulolytic enzyme (CelA) from the extreme thermophile
'Anaerocellum thermophilum' with separate glycosyl hydrolase family 9 and 48
catalytic domains. Microbiology 1998, 144 (2):457-465.
197. Saul DJ, Williams LC, Grayling RA, Chamley LW, Love DR, Bergquist PL: celB, a
Gene Coding for a Bifunctional Cellulase from the Extreme Thermophile
"Caldocellum saccharolyticum". Applied and Environmental Microbiology 1990,
56(10):3117-3124.
198. Grant SGN, Jessee J, Bloom FR, Hanahan D: Differential plasmid rescue from
transgenic mouse DNAs into Escherichia coli methylation-restriction mutants.
Proceedings of the National Academy of Sciences of United States of America 1990,
87(12):4645-4649. 108
199. Teather RM, Wood PJ: Use of Congo Red-Polysaccharide Interactions in
Enumeration and Characterization of Cellulolytic Bacteria from the Bovine Rumen.
Applied and Environmental Microbiology 1982, 43(4):777-780.
200. Laderman KA, Davis BR, Krutzsch HC, Lewis MS, Griko YV, Privalov PL, Anfinsen
CB: The Purification and Characterization of an Extremely Thermostable α-
Amylase from the Hyperthermophilic Archaebacterium Pyrococcus furiosus. The
Journal of Biological Chemistry 1993, 268(32):24394-24401.
201. Han SJ, Yoo YJ, Kang HS: Characterization of a Bifunctional Cellulase and Its
Structural Gene - THE cel GENE OF BACILLUS SP. D04 HAS EXO- AND
ENDOGLUCANASE ACTIVITY. The Journal of Biological Chemistry 1995,
270(43):26012-26019.
202. Yu JS, Noll KM: Plasmid pRQ7 from the Hyperthermophilic Bacterium Thermotoga
Species Strain RQ7 Replicates by the Rolling-Circle Mechanism. Journal of
Bacteriology 1997, 179(22):7161-7164.