DEVELOPMENT OF GENETIC TOOLS FOR THERMOTOGA SPP.
Dongmei Han
A Dissertation
Submitted to the Graduate College of Bowling Green State University in partial fulfillment of the requirements for the degree of
DOCTOR OF PHILOSOPHY
December 2013
Committee:
Dr. Zhaohui Xu, Advisor
Dr. Lisa C. Chavers Graduate Faculty Representative
Dr. George S. Bullerjahn
Dr. Raymond A. Larsen
Dr. Scott O. Rogers
© 2013
Dongmei Han
All Rights Reserved
iii ABSTRACT
Zhaohui Xu, Advisor
Thermotoga spp. may serve as model systems for understanding life sustainability under hyperthermophilic conditions. They are also attractive candidates for producing biohydrogen in industry. However, a lack of genetic tools has hampered the investigation and application of these organisms. We improved the cultivation method of Thermotoga spp. for preparing and handling Thermotoga solid cultures under aerobic conditions. An embedded method achieved a plating efficiency of ~ 50%, and a soft SVO medium was introduced to bridge isolating single Thermotoga colonies from solid medium to liquid medium. The morphological change of T. neapolitana during the growth process was observed through scanning electron microscopy and transmission electron microscopy.
At the early exponential phase, around OD600 0.1 – 0.2, the area of adhered region between toga and cell membrane was the largest, and it was suspected to be the optimal time for DNA uptake in transformation. The capacity of natural transformation was found in T. sp. RQ7, but not in T. maritima. A Thermotoga-E. coli shuttle vector pDH10 was constructed using pRQ7, a cryptic mini-plasmid isolated from T. sp. RQ7. Plasmid pDH10 was introduced to T. sp. RQ7 by liposome-mediated transformation, electroporation, and natural transformation, and to T. maritima through liposome- mediated transformation and electroporation. Transformants were isolated, and the transformed kanamycin resistance gene (kan) was detected from the plasmid DNA extract of the recombinant strains by PCR followed by restriction digestions. The transformed DNA was stably maintained in both Thermotoga and E. coli even without
iv the selection pressure. A uracil auxotrophic strain RQ7-15, with a 115 bp deletion near the 3' end of pyrE gene on T. sp. RQ7 chromosome, was isolated and used as the recipient cell for using pyrE as the selection marker. The pyrE gene from
Caldicellulosiruptor saccharolyticus was expressed in RQ7-15, driven by either promoter
PslpA from Thermus thermophilus or promoter PRQ7.pyr, which is the promoter of the pyrimidine synthesis operon of T. sp. RQ7. This work advanced the development of genetic tools for the study of Thermotoga.
v
Dedicated to my parents, Zhixiang Han and Enqiu Gao.
vi ACKNOWLEDGMENTS
I owe my deepest gratitude to my advisor, Dr. Zhaohui Xu. Without your support, guidance, encouragement, and patience, this work could not be accomplished successfully. I was honored to be your Ph.D. student and sincerely appreciate everything you have done for me. I would also like to thank my committee members, Dr. Scott
Rogers, Dr. George Bullerjahn, Dr. Ray Larsen, and Dr. Lisa Chavers, for their advice and help on my project.
I would like to thank Dr. Carol Heckman and Dr. Marilyn Cayer for your guidance and assistance with Electron Microscopes. I would like to thank Dr. Paul
Morris for lending me the equipment in his lab generously.
I would also like to thank the members of the Xu lab: Dr. Uksha Snini, Patel
Jigar, Jingjing Cao, Rutika Puranik, Hui Xu, and Stephen Morris. Many thanks to your help, suggestion, and support during the past five years. It was a great time to work together with all of you.
I am grateful to Linda Treeger, Susan Schooner, Chris Hess, Sheila Kratzer,
Steve Queen, and Dee Dee Wentland for all your help and patience.
Finally, I would like to thank my family for all your love and support.
vii
TABLE OF CONTENTS
GENERAL INTRODUCTION ...... 1
The evolutionary significance of Thermotoga ...... 2
The potentials of Thermotoga in producing biomass-based fuels ...... 4
The development of genetic tools for the study of hyperthermophiles ...... 7
Chapter I. Improvement of the cultivation method of Thermotoga spp...... 11
Introduction ...... 11
Materials and Methods ...... 13
Strains and growth condition ...... 13
Sensitivity of Thermotoga to oxygen ...... 16
Results and Discussion ...... 16
Sensitivity of Thermotoga to oxygen ...... 16
Improved methods for handling Thermotoga cultures in an aerobic
environment ...... 18
Isolation of single colonies from plates ...... 19
Conclusion ...... 21
Chapter II. The morphological change of Thermotoga during the growth process ..... 24
Introduction ...... 24
Materials and Methods ...... 25
Growth curve of Thermotoga ...... 25
Scanning electron microscopy (SEM) ...... 26 viii
Transmission Electron Microscopy (TEM) ...... 26
Results and Discussion ...... 27
Growth curve of T. neapolitana...... 27
The morphological change of Thermotoga cells revealed by Scanning
Electron Microscopy ...... 28
Transmission Electron Microscopy revealed the inside structure change of
Thermotoga cells ...... 30
Conclusion ...... 32
Chapter III. Construction and transformation of a Thermotoga-E. coli shuttle vector pDH10 ...... 34
Introduction ...... 34
Materials and Methods ...... 38
Strains and growth condition ...... 38
Nucleic acid extraction ...... 39
Sensitivity of Thermotoga to different antibiotics ...... 41
Construction of vectors ...... 42
Transformation and selection methods of Thermotoga ...... 44
Selection and verification of Thermotoga transformants ...... 46
Stability assays of the transformed DNA in Thermotoga and E. coli ...... 47
Results and Discussion ...... 48
Sensitivity of Thermotoga strains to different antibiotics ...... 48
Thermotoga is naturally transformable ...... 52 ix
Transformation of Thermotoga ...... 54
Verification of Thermotoga transformants ...... 55
Transformed pDH10 was stably maintained in Thermotoga ...... 57
Incorporation of pRQ7 increased the stability of pUC19 derivatives in E. coli
...... 58
Conclusion ...... 60
Chapter IV. Isolation of uracil auxotrophs of T. sp. RQ7 and a new thermostable
selective marker for Thermotoga ...... 63
Introduction ...... 63
Materials and Methods ...... 64
Strains and growth conditions ...... 64
DNA analysis ...... 65
Construction of vectors ...... 66
The inhibition concentration of 5-Fluoroorotic acid to Thermotoga strains . 69
Isolation of uracil auxotrophs of T. sp. RQ7 ...... 70
Transformation of the uracil auxotroph T. sp. RQ7-15 ...... 70
Selection and verification of RQ7-15 transformants ...... 71
Results and Discussion ...... 71
The inhibition concentration of 5-Fluoroorotic acid to Thermotoga strains . 71
Isolation of uracil auxotrophs of T. sp. RQ7 ...... 72
The pyrimidine biosynthesis operon of T. sp. RQ7 ...... 74
Transformation of vectors pDH25 and pDH28 ...... 76 x
Verification of T. sp. RQ7-15 transformants ...... 79
Conclusion ...... 80
Summary ...... 82
References ...... 84
xi
LIST OF FIGURES/TABLES
Figure/Table Page
Figure 1. The sensitivity of T. neapolitana and T. sp. RQ7 to oxygen…………...…..17
Figure 2. Single colonies formed by T. sp. RQ7 cells…………………………....…..19
Figure 3. The growth of T. neapolitana in soft SVO medium………………...……..21
Figure 4. Growth curve of T. neapolitana…………………………………………....28
Figure 5. Scanning electron microscopy photos……………………………………..30
Figure 6. Transmission Electron Microscopy photos……………………….……...... 32
Figure 7. Genetic map of the shuttle vector pDH10………………………………….44
Figure 8. Inhibition zone of Thermotoga spp. to different antibiotics…………...…..50
Figure 9. Sensitivity of Thermotoga spp. in liquid SVO medium………………...…52
Figure 10. Comparison of T. sp. RQ7 with and without transformation of T. neapolitana genomic DNA……………………………………………………...…...53
Figure 11. Detection of the transformed kan gene in RQ7/pDH10…………….…….56
Figure 12. Restriction digestion of the kan gene………………………………….….57
Figure 13. Comparison of the copy numbers of pDH10 and pKT1 in E. coli……….60
Figure 14. Genetic map of the E. coli-Thermotoga shuttle vector pDH25……….….67
Figure 15. Genetic map of the E. coli-Thermotoga shuttle vector DH28……….…...69
Figure 16. Detection of the pyrFE in T. sp. RQ7 chromosome……………………....73
Figure 17. The alignment of partial pyrFE sequence of T. sp. RQ7 and T. sp. RQ7-
15……………………………………………………………………………………..74
Figure 18. Analysis of the pyrimidine biosynthesis operon of T. sp. RQ7………...…75 xii
Figure 19. The growth of T. sp. RQ7, RQ7-15, and RQ7-15/pDH25 in minimal media
after transformation…………………………………………………………………..77
Figure 20. Verification of T. sp. RQ7-15 transformants………………………….…..80
Table 1. Strains used in this study……………………………………….………...…15
Table 2. Plasmids used in this study…………………………………………….……38
Table 3. Primers used in this study……………………………………………….…..43
Table 4. Percentage of Thermotoga colonies resistant to kanamycin after six transfers…………………………………………………………………………..…..58
Table 5. Percentage of E. coli colonies resistant to ampicillin during consecutive transfers………………………………………………………………………………59
Table 6. Transformation efficiency of pDH25 and pDH28 in T. sp. RQ7-15……..…78
1
GENERAL INTRODUCTION
Thermotoga is a member of the phylum Thermotogae, a group of non-sporulating,
Gram-negative, rod-shaped, anaerobic thermophilic or hyperthermophilic bacteria having an outer sheath-like envelope referred to as a "toga". In 1986, Thermotoga was isolated and identified as a novel genus of extremely thermophilic bacteria (Huber et al.
1986), and then many Thermotoga species were isolated and characterized during the following years (Balk et al. 2002, Belkin et al. 1986, Fardeau et al. 1997, Jannasch et al. 1988, Jeanthon et al. 1995, Ravot et al. 1995, Takahata et al. 2001, Windberger et al.
1989). Up to now (Aug. 18th, 2013), 50 Thermotoga strains have been isolated and
described in the NCBI taxonomy database. All members of Thermotoga were isolated
from hot liquids. T. maritima strain MSB8 was originally isolated from geothermally
heated sea floors in Italy and the Azores (Huber et al. 1986). T. neapolitana strain NS-
F was first found in a shallow submarine hot spring near Lucrino, Bay of Naples, Italy
(Belkin et al. 1986, Jannasch et al. 1988). T. thermarum strain LA3 was originally obtained from continental solfataric springs at Lac Abbé, Djibouti, Africa (Windberger et al. 1989). T. subterranea was isolated from a deep, continental oil reservoir in the
East Paris Basin, France (Jeanthon et al. 1995). T. elfii was acquired from an Africa oil production well (Ravot et al. 1995). Both T. petrophila and T. naphthophila were obtained from the Kubiki oil reservoir in Niigata, Japan (Takahata et al. 2001). 2
The evolutionary significance of Thermotoga
Besides Aquifex, Thermotoga are the only group of bacteria that can grow up to 90℃.
The 16S rRNA phylogeny placed this genus as one of the deepest and most slowly
evolving lineages in the bacteria (Nelson et al. 1999, Woese 1987). The natural habitats
of Thermotoga are quite similar to the environment of the early Earth – the surface was
hot and its atmosphere contained little oxygen. The position of Thermotoga in the phylogenetic tree supports the hypothesis that life originated at high temperature and the last common ancestor of living organisms was hyperthermophilic (Di Giulio 2001,
2003a, b, Wong et al. 2007). The first genome sequence of the Thermotoga species (T. maritima strain MSB8) was published in 1999 (Nelson et al. 1999). Comparative genome analysis of the genomes of other microbial species indicated that up to 24% of
T. maritima genes were acquired by horizontal gene transfer (HGT) from archaea
(Nelson et al. 1999). This result adds to the accumulating evidence that HGT is a potent
evolutionary force in prokaryotes (Logsdon and Faguy 1999). Although 16S rRNA
phylogeny placed Thermotoga at the base of the bacteria tree with Aquifex, single- and
muti-gene analyses of T. maritima strain MSB8 disagreed on the phylogenetic position
of Thermotoga. Nelson et al. concluded that the phylogenetic position of Aquifex and
Thermotoga, and the nature of the deepest branching eubacterial species, should be
considered ambiguous (Nelson et al. 1999). Zhaxybayeva et al. performed
comprehensive comparative analysis including T. maritima, T. petrophila, T. lettingae
together with other two Thermotogales Thermosipho melanesiensis and
Fervidobacterium nodosum, and Thermotogales should be considered members of 3
Firmicutes on the basis of the majority of genes in their genomes (Zhaxybayeva et al.
2009). In the past ten years, 6 genomes of Thermotoga strains have been published on
NCBI, including T. maritima MSB8 (GenBank Accession: AE000512), T. neapolitana
DSM 4359 (GenBank Accession: CP000916), T. naphthophila RKU-10 (GenBank
Accession: CP001839), T. lettingae TMO (GenBank Accession: CP000812), T.
thermarum DSM 5069 (GenBank Accession: CP002351), and T. petrophila RKU-1
(GenBank Accession: CP000702)
(http://www.ncbi.nlm.nih.gov/genome/?term=Thermotoga). In our lab, we sequenced
and annotated T. sp. RQ7 as well. All the sequences are valuable resources for the study
of phylogeny and lead to better understanding of the taxonomy and evolution of
Thermotoga. Using the genome sequence data, Gupta and Bhandari identified
molecular markers, Conserved Signature Indels (CSI), that are specific for different
bacterial groups (Gupta and Bhandari 2011). Nesbø et al. screened 16 strains from the
genus Thermotoga and other related Thermotogales for distribution of "archaeal" genes
gltB encoding the large subunit of glutamate synthase and inol encoding the myo-
inositol 1P synthase, and finally obtained the conclusion along with results from
phylogenetic analyses that they were acquired from Archaea during the divergence of
the Thermotogales (Nesbo et al. 2001).
The study of the molecular genetic of Thermotoga is expected to shed light on the
fundamental questions related to the origin of life as well as the mechanisms of the
thermostability of macromolecules under extreme conditions. 4
The potentials of Thermotoga in producing biomass-based fuels
Thermotoga also has potentials in producing biomass-based fuels. They metabolize
many simple and complex carbohydrates, including glucose, sucrose, amorphous
cellulose, starch, and xylan through fermentation, and produce H2, the non-fossil and
clean fuel, as one of the final products. As we all know, in global economic growth,
energy plays an integral and extremely important role. The Annual Energy Review of
2012 published by the U.S. Energy Information Administration indicated that 80.5% of the nation's energy came from fossil fuels, including 36% from petroleum, 26% from natural gas, 20% from coal, and nuclear electric power and renewable energy occupied
8% and 9% usage of the nation's energy respectively (EIA 2012). The majority of energy is derived from fossil fuels, which is non-renewable, and has limited supplies.
Crude oil production and natural gas will approach a theoretical depletion near 2060-
2070 (Klass 1998, 2003). The production and use of fossil fuels raise environmental concerns. Burning of fossil fuels produces large amount of carbon dioxide, the accumulation of which enhances the greenhouse effects, which causes global warming
(Hansen et al. 1981). Due to these reasons, a non-polluting and renewable energy source has been placed to an urgent position in recent years. Renewable energy sources include biomass, sunlight, wind, solar, geothermal, and hydropower. Hydrogen is one of the most environmental friendly renewable energy sources, because water, which does not cause any environmental pollution and climate change, is the only byproduct of the combustion of H2 (Levin et al. 2004). 5
Hydrogen is generally produced through thermal, electrolytic, or biological methods.
The thermal method is the most commonly commercialized technology currently.
However, this process requires natural gas or other hydrocarbons and produces carbon dioxide as well. For electrolysis of water, a large amount of electricity, the cost of which
accounts for 80% of this operation, is required. By contrast, the process of producing
hydrogen from biological systems only needs renewable substrates, such as agricultural
wastes or food processing waste (Fan et al. 2006, Wang 2006). Hydrogen can be
produced by algae, archaea, and bacteria through dark-fermentation or light-driven
processes using agricultural and industrial waste or residues. Accordingly, three types
of metabolic processes were attempted for producing biohydrogen. The first method is
by photosynthetic unicellular organisms utilizing either nitrogenase or hydrogenase
reactions to produce hydrogen (Kaplan and Moore 1998, Melis 2002). The second way
is through anaerobic fermentation (Vatsala 1990). The last one is a various stepwise
process with a combination of bacteria, in which one population predigests more
complex organic molecules to make simple organic molecules that can be subsequently
used by other hydrogen-producing organisms (Weaver 1990).
In the past decades, many hydrogen-producing microbes have been found in
environments. Under strict anaerobic growth conditions, bacteria of genera Clostridium,
Caldicellulosiruptor, Ruminococcus, Dictyoglomus, Anaerocellum, and Spirocheta are
able to produce hydrogen (Adams 1990, Balch and Wolfe 1976, Kostesha et al. 2011,
Masset et al. 2012, Miller and Wolin 1973). To date, all members of the order
Thermotogales produce hydrogen (Belkin et al. 1986, Childers et al. 1992, Van Niel et 6
al. 2002, Van Ooteghem et al. 2002, Van Ooteghem et al. 2004). The yield of hydrogen
from dark fermentation depends on the byproducts and metabolic pathways. When
acetic acid is the byproduct, there is a theoretical maximum yield of hydrogen around
4 mol H2/mol glucose; if butyric acid, or ethanol and acetic acid are the byproducts, 2
mol H2/mol glucose is produced (Hwang et al. 2004, Nandi and Sengupta 1998);
however, no hydrogen is produced when propionic acid is the byproduct (Hawkers et al. 2002). For Thermotoga, 1 mol of glucose can be completely fermented to 2 mol of acetate, 2 mol of CO2, and 4 mol of H2 (Schroder et al. 1994). The hydrogen yield of
Thermotoga approached 4 mol H2/mol glucose, which is the theoretical maximal yield of H2 from anaerobe microbial conversion of glucose (Eriksen et al. 2008, Schonheit
and Schafer 1995, Van Ooteghem et al. 2004).
In addition to the high hydrogen yield, there are many other benefits using Thermotoga
to produce hydrogen. Firstly, since only few bacteria can grow at high temperature,
bacteria growing at high temperatures have less contamination than in low temperatures.
Therefore, when using Thermotoga to produce hydrogen, sterilization which requires a large amount of energy might be omitted. Secondly, during the industrial fermentation process of hyperthermophiles, small cooling systems could suffice if proper insulation is used in fermentation systems, because the heat released during the hydrogen producing process could be used to maintain the high temperature for the growth of hyperthermophiles. 7
The development of genetic tools for the study of hyperthermophiles
Hyperthermophiles, including archaea and bacteria, are an extraordinarily important
class of organisms occupying the deepest, most slowly evolving branches of both
archaeal and bacterial domains (Achenbach-Richter et al. 1987, Achenbach-Richter et
al. 1988). Therefore, they are of evolutionary significance, and the fundamental questions related to the origin of life as well as mechanisms of the thermostability of macromolecules under extreme conditions are to be answered through the study of the molecular genetics of hyperthermophiles. Accordingly, the development of genetic tools holds an important position. In the past decades, the hyperthermophile world was rapidly expanded by the isolation of many archaea and bacteria from hot geological locations, whereas the genetic studies on these organisms were limited. With the advances in the cultivation of the hyperthermophiles, the discovery of genetic elements
for constructing vectors, and the construction of thermostable genetic selective markers,
genetic tools were developed for some genera.
Sulfolobus species, locating at the crenarchaeal branch of the archaeal domain, are the best-studied archaea. An electroporation method has been developed and improved for
Sulfolobus, and have been applied in many different strains (Albers and Driessen 2008,
Aucelli et al. 2006, Kurosawa and Grogan 2005, Suzuki et al. 2002). A few shuttle vectors, harboring the thermostable selective markers of an alcohol dehydrogenase and
hygromycin phosphotransferase which confer resistance to butanol and benzyl alcohol,
and hygromycin B, respectively, have been reported (Aravalli and Garrett 1997, Cannio 8
et al. 1998, 2001). Additionally, knockout systems also achieved in S. solfataricus by homologous recombination (Albers and Driessen 2008).
The development of genetic tools for another model thermophilic archaen Pyrococcus
is also an active research area. Shuttle vectors pYS2, which harbors the replicon of the endogenous plasmid pGT5 from P. abyssi stain GE5 and a selective marker of orotate phosphoribosyltransferase of Sulfolobus acidocaldarius, was constructed and maintained stably at a high copy number under selective conditions in P. abyssi (Lucas
et al. 2002). Later, vectors deriving from pYS2 were reported (Waege et al. 2010).
Farkas, et al. reported a series of replicating shuttle vectors consisting of the origin of
replication of the chromosome of P. furiosus and proved that plasmids based on the
chromosome origin were structurally unchanged and were stable without selection
(Farkas et al. 2011). Recently, natural competence in P. f u r i os u s was also discovered,
and was used to facilitate genetic manipulation of Pyrococcus (Lipscomb et al. 2011).
However, previous to this study, there still was no reliable genetic system for
Thermotoga. The first document, a doctoral dissertation, related to the genetic research
on Thermotoga was published in 1995. Vargas improved methods for the cultivation of
T. neapolitana, isolated auxotrophic and antimetabolite-resistant mutants of T.
neapolitana, constructed the potential shuttle vectors between Thermotoga and
Escherichia coli, and evaluated various transformation protocols in T. neapolitana,
including natural transformation, conjugation, and electroporation (Vargas 1995). He
finally isolated the auxotrophic mutants requiring leucine, tryptophan, adenine, and 9
histidine, which were of potential for the development of genetic methods (Vargas and
Noll 1994). Later, Yu, from the same laboratory, continued to work on developing the genetic tools for the study of T. neapolitana (Yu 1998). He constructed two vectors: (1) pJY1, by placing a thermostable chloramphenicol acetyltransferase encoding gene (cat gene) from Staphylococcus aureus under control of the tac promoter and plasmid pRQ7,
which was isolated from T. sp. RQ7 (Harriott et al. 1994), in a pBluescript vector; (2)
pJY2, using a kanamycin nucleotidyltranserase encoding gene to replace the cat gene
on pJY1. A modified liposome-mediated transformation method was used to introduce
the two vectors into T. neapolitana and T. maritima successfully (Yu 1998, Yu et al.
2001). However, no transformant were isolated from plates; the transformed
Thermotoga cells exhibited transient antibiotic resistance in liquid medium. Until the recent publication of our work (Han et al. 2012), that report remained the only
documented effort of developing genetic tools in Thermotoga, and neither vector has
been applied in other published work.
As a matter of fact, genetic manipulation of Thermotoga is still a challenge to the
researchers. Since the first effort of expressing heterologous genes in Thermotoga, ten
years have passed, and there were more and more related studies that encouraged us to
develop genetic tools for Thermotoga spp. The goal of this study is developing genetic
tools for Thermotoga species. Firstly, I optimized the cultivation method in both plates
and soft medium, developed the minimal medium, and established a method for
isolating single Thermotoga colonies from plates to liquid medium (Chapter I).
Secondly, I observed the morphological changes of Thermotoga during the growth 10
process for determining the optimal time to introduce competence ability and add DNA for transformation (Chapter II). Thirdly, I constructed a Thermotoga-E.coli shuttle vector and transformed it into Thermotoga cells using various transformation methods
(Chapter III). At the end, I isolated a uracil auxotroph of T. sp. RQ7 and developed a new thermostable selective marker for this auxotrophic cell (Chapter IV).
11
Chapter I. Improvement of the cultivation method of Thermotoga spp.
Introduction
Thermotoga was traditionally handled in an anaerobic glove chamber, which is
expensive and cumbersome to use. Before every use, the chamber must be purged with
nitrogen gas to create an anaerobic environment. During this time-consuming process,
a large amount of nitrogen is required.
Instead of using an anaerobic chamber, one may use a stream of high pressure nitrogen
gas to create a local anaerobic environment. This method, often referred to as the
Hungate technique, was first described in detail in 1950 (Hungate 1950). Later, many
researchers developed and modified this method for the cultivation of anaerobic
microorganisms (Bryant 1972, Macy et al. 1972, Miller and Wolin 1974, Sowers and
Noll 1995). The Hungate technique is effective for liquid cultures, but less so with solid
cultures. This method employs a conduit to introduce a stream of nitrogen gas for
replacing the head space gas inside of a tube or flask. However, for streaking or picking
up colonies from a solid culture, a bent needle or capillary is needed. It is an extreme
challenge to have a bent inoculating tool passing through the narrow openings of tubes
or flasks without touching the conduit. To avoid the frequency of cross contamination,
the conduit has to be sterilized frequently, costing extra amount of time and resources.
Alternatively, for solid culture, an overlay technique was developed by Jiang et al. In 12
this method, an inoculum is injected into a small volume of top agar in Hungate tubes, and then the cell-embedded top agar is immediately transferred by syringe into flasks stored in an anaerobic chamber that already contained a bottom layer of medium. Single, well-isolated colonies were observed and the plating efficiency (±1 SD) is 93 ± 7.5%
(Jiang et al. 2006).
All above methods have to be manipulated in anaerobic glove chamber, which more inconvenient than working on aerobe microorganisms. In fact, although Thermotoga was reported strict anaerobic, it still can tolerate brief exposure to oxygen (Le Fourn et al. 2008, Munro et al. 2009, Van Ooteghem et al. 2004). Therefore, we hoped to develop a method to prepare Thermotoga solid cultures and liquid cultures independent of an anaerobic chamber or conduit. In my study, I firstly tested the sensitivity of T. sp. RQ7 and T. neapolitana to oxygen in liquid medium and found that both can grow when the content of oxygen is below 6%. And then, based on this finding, I improved the plating method on the normal experimented bench. In a transformation effort, it is essential to obtain single Thermotoga transformant for further analysis and application. To facilitate the transfer of single colonies from solid to liquid medium under aerobic conditions, we introduced a soft SVO medium as an onward connection. In addition, although many media have been developed and improved for cultivating Thermotoga, there is still no report on an easily-prepared, effective minimal medium. In many genetic studies, one needs to use auxotrophs, which require minimal medium as a selection measure.
Accordingly, developing an effective minimal medium is one part of this study as well. 13
Materials and Methods
Strains and growth condition
Bacterial strains involved in this study are listed in Table 1.
Thermotoga neapolitana ATCC 49049 (same as T. neapolitana DSM 4359) was purchased from ATCC ( http://www.atcc.org/ ), strains T. sp. RQ7 and T. maritima
MSB8 were kindly provided by Dr. Harald Huber, University of Regensburg, Germany, and T. sp. RQ2 was kindly provided by Dr. Kenneth M. Noll, Department of Molecular and Cell Biology, University of Connecticut, Storrs, Connecticut, USA.
Thermotoga were cultivated at 77℃ in SVO medium developed by van Ooteghem et al (Van Ooteghem et al. 2002). Fifty milliliters of SVO was dispensed into 100 ml serum bottles (WHEATON, Millville, NJ, USA) and sparged with nitrogen gas to remove oxygen from the medium and the headspace. Serum bottles were then sealed by rubber stoppers, secured by aluminum caps (WHEATON, Millville, NJ, USA), and sterilized.
Inoculation of the liquid SVO was done by a syringe needle with a typical inoculum of
2%. Liquid cultures were shaken at 125 rpm.
For preparation of soft SVO, 0.075% Gelrite (Sigma-Aldrich Co., St. Louis, MO, USA) was dissolved in liquid SVO. Culture tubes with screw caps were filled with soft SVO up to two thirds of the volume capacity and were autoclaved. When isolating single colonies, they were picked up from the plates using an inoculation loop and were pushed down to the bottoms of the test tubes containing soft SVO. After 12 – 24 h of 14
incubation at 77℃, the cultures in soft SVO medium were transferred to liquid medium
using syringes to amplify their growth for further purpose.
To grow Thermotoga on plates, double strength (2 ×) of liquid SVO and various
concentrations of agar or Gelrite were autoclaved separately and then mixed with equal
volumes while they were still hot. The medium either was directly poured into Petri
dishes for standard spreading or streaking, or was mixed with cell cultures prior to
pouring for embedded growth. A Vacu-Quik jar (Almore International Inc., Portland,
OR, USA) containing a packet of 4 g of palladium catalyst was used for anaerobic cultivation of plates. The atmosphere inside of the jar was exchanged to 96:4 N2-H2 before it was placed into an incubator of 77℃.
Colonies usually appeared in 24 h and grow bigger in 48 h. Kanamycin was supplemented when needed at 150 μg ml-1 for liquid and 250 μg ml-1 for soft and solid
cultures. Cell growth in liquid was monitored by measuring the optical density of cell
cultures at 600 nm (OD600). All aforementioned operations were carried out on bench
tops.
In the minimal medium, 0.095g of NH4Cl replaced the supplement of yeast extract and tryptone, which are the nitrogen sources, in SVO medium. When cultivating
Thermotoga in the liquid minimal SVO medium, cells from 1 ml of overnight culture was collected by centrifugation at 13,523 g for 1 min, washed with 1 ml of degassed sterile minimal medium, resuspended in 100 μl of minimal medium, and finally injected into 50 ml of fresh minimal medium. The culture grew after overnight shaking with 125 15
rpm at 77℃.
Making minimal embedded plates is the same as preparing SVO plates. Thermotoga colonies could be observed after 72 h incubation in the anaerobic jar at 77℃.
Table 1 Strains used in this study Strain or plasmid Description Reference Thermotoga T. neapolitana DSM 4359 Isolated from African (Belkin et al. 1986) continental solfataric springs T. maritima MSB8 Isolated from geothermally (Huber et al. 1986) heated sea floors in Italy and the Azores T. sp. RQ7 Isolated from geothermally (Nesbo et al. 2006) heated sea floors in Ribeira Quente, the Azores T. sp. RQ2 Isolated from a geothermally (Swithers et al. heated region of the seafloor 2011) near Ribeira Quente, the Azores
Caldicellulosiruptor C. saccharolyticus Isolated from thermal spring in (Rainey et al. 1994) DSM 8903 New Zealand.
Escherichia coli DH5α F´/endA1 hsdR17 (rK– mK+) (Grant et al. 1990) glnV44 thi-1 recA1 gyrA (NalR) relA1 Δ(lacIZYA- argF)U169 deoR (φ80dlacΔ(lacZ)M15) XL1-Blue MRF’ F´ ::Tn10 Strategene proA+B+ lacIq Δ(lacZ)M15/ recA1 endA1 gyrA96 (NalR) thi hsdR17 (rK– mK+) glnV44 relA1 lac
16
Sensitivity of Thermotoga to oxygen
After the normal inoculation of Thermotoga in liquid SVO medium, air was injected using a syringe needle into the serum bottles with the volume of 5, 10, 15, 20, 25, 30, and 35 ml. According to the content of oxygen in the air and the headspace of the serum bottle containing 50 ml of SVO medium, the corresponding concentration of oxygen in the bottles were 1.52 %, 2.83 %, 3.98 %, 4.99 %, 5.88 %, 6.69 %, and 7.41 %. The growth of Thermotoga was detected after overnight incubation. T. sp. RQ7 and T. neapolitana were tested.
Results and Discussion
Sensitivity of Thermotoga to oxygen
Resazurin supplemented in the medium is a sensitive oxygen indicator. Even though there is a trace amount of oxygen, the resazurin medium retained a pink color. Thus, after injection of air into the degassed medium, it turned to pink from white immediately.
Although different amounts of oxygen were added into each bottle, it was not obvious by the density of color in the medium. Preliminary experiments revealed that after overnight incubation at 77℃, the non-inoculated oxygenated medium would become brown. This is because the unused carbohydrate in the medium was carbonized at high temperature and the sensitive oxygen indicator reacted with the supplemented oxygen 17
and showed pink color, resulting in a darker appearance. Because Thermotoga cells are
white, with the decreasing of cell density, the culture gradually deepened in color from
white to brown and became clear from turbid (Figure 1). No growth of T. neapolitana
and T. sp. RQ7 could be seen when 6.69 % and 5.88 % oxygen were added respectively.
With the same amount of oxygen, T. neapolitana always grew better than T. sp. RQ7
(Figure 1). Although T. neapolitana is a little more tolerant to oxygen than T. sp. RQ7, all strains can grow when the content of oxygen is below 6 %. In other words,
Thermotoga is not exactly strict, anaerobic, and short exposure to air is not fatal to
Thermotoga. Consequently, it is likely feasible to manipulate Thermotoga on the bench top.
Figure 1. The sensitivity of T. neapolitana and T. sp. RQ7 to oxygen. (A) and (B) are the tests of T. neapolitana and T. sp. RQ7, respectively. The contents of O2 in the serum bottles were 0 %, 1.52 %, 2.83 %, 3.98 %, 4.99 %, 5.88 %, 6.96 %, and 7.41 %. 18
Improved methods for handling Thermotoga cultures in an aerobic environment
The chance of obtaining Thermotoga transformants on plates can be seriously
compromised if plating efficiencies are low. Considering that Thermotoga is tolerant to
brief exposures to oxygen, the overlay methods reported by other groups (Kenneth Noll,
University of Connecticut, private communication) (Jiang et al. 2006) were simplified
to an embedded growth method, in which cells were embedded in the medium matrix
to reduce their exposure to oxygen. Properly diluted (103 – 105) overnight liquid
cultures were suspended in hot SVO containing 0.3 % Gelrite, and then the mixtures
were allowed to solidify in Petri dishes. As the cells were embedded in the medium
matrix, their exposure to oxygen was reduced much more than the standard surface
spreading method. A surface culture would typically generate 7.56×103 CFU/ml
(Figure 2 B). By contrast, 10μl of overnight culture of T. sp. RQ7 with a dilution factor of 104 formed 1256 colonies (Figure 2 A), which equals to 1.26×109 CFU/ml, ten
thousand times more than surface growth. Given the T. neapolitana cultures contain
approximate 3.0×109 cells after growing in liquid SVO for 14 h at 70℃ (Van
Ooteghem et al. 2004), we estimate that the plating efficiency of the embedded method is close to 50%, which is high enough for screening a large number of single colonies under aerobic conditions. 19
Figure 2. Single colonies formed by T. sp. RQ7 cells. (A) Embedded growth. Cells were mixed with hot SVO medium containing 0.3% Gelrite and were poured to Petri dishes before solidification. (B) Surface growth. Cells were spread evenly on the surface of freshly-made SVO plates containing 0.3% Gelrite and 0.7% agar. The number on each plate indicates the dilution factor of each culture.
Isolation of single colonies from plates
For aerobic bacteria, it is easy to pick up single colonies and transfer them to another
plate or liquid medium for further growth. However, for Thermotoga, when inoculating
in liquid medium, the inoculum should be injected into a sealed serum bottle using a syringe needle, by which it is almost impossible to pick up enough amount of cells from the single colonies for inoculation. It is very difficult to control the syringe needle to
absorb the cells into it for further injection, and the limited amount of cells adhered to
the needle tip cannot be effectively transported through the rubber stopper to the
medium. Additionally, even we can introduce a few cells on the needle into the bottle
successfully, the exposure to oxygen during the manipulation process would decrease
their survival chance greatly. Thus, to facilitate the transfer of single colonies from solid 20
to liquid medium under aerobic conditions, we introduced a soft SVO medium as a bridging step. The solidifying agent prevents atmospheric oxygen from penetrating deep into the medium and cysteine HCl, the reducing agent, reduces the oxygen dissolved in the medium. After 12 – 24 h of incubation, the single colonies grew. As shown in figure 3, if the culture grew very well, the cell aggregates floated to the top of the test tubes and the cells would stay. As we know, growth in test tubes are usually used to identify the preference of different bacteria to oxygen. If they grow on the top of test tubes, they are aerobes; the ones growing at the bottom are the anaerobes; the facultative anaerobes usually grow close to the top of the test tubes. Superficially, the growth position of Thermotoga in soft medium indicated Thermotoga are facultative anaerobes; however, the hydrogen production should be considered here to explain this result. The better the Thermotoga grows, the more hydrogen it produces. During this process, very tiny bubbles are generated, and cause the cells to float up, resulting in the cells appearing near the top of the test tubes. Meanwhile, it is also an evidence that
Thermotoga is tolerant to a very low concentration of oxygen. 21
Figure 3. The growth of T. neapolitana in soft SVO medium. (A) shows that when the cell did not grow very well, the cell pellicle stayed at the bottom, and (B) shows good growth of T. neapolitana in soft SVO medium.
In addition, it was found that the cultures kept in soft SVO medium remained alive even after two months. We transferred the cultures from the soft medium stored at 4℃ to fresh liquid and solid SVO medium. After an appropriate incubation time, Thermotoga grew in both media. However, as it should be, with the increase of storage time, the growth was poorer in both media. Nevertheless, soft SVO medium can serve as a temporary storage medium for Thermotoga.
Conclusion
The success of isolating transformants from solid media is essential to any genetic manipulation attempt. This may be not worthy of mentioning for facultative anaerobic 22
mesophiles like E. coli. However, for hyperthermophilic anaerobic organisms, their physiology is a limiting factor for their genetic investigation. The requirement of an anaerobic glove chamber is one of the obstacles to handle culture on plates. Since the colonies in the embedded plates are very small, only 1 – 2 mm in diameter, great precision is required for picking them. Actually, it has been proved that it is a great challenge for many of us to reach out to a single colony with an inoculation loop or a toothpick through thick gloves. Even though gloveless chambers are commercially available, they are costly to maintain. Methods derived from Hungate techniques, like the ones combining with rolling tubes or tissue culture flasks, may serve as alternatives
(Hermann et al. 1986, Jiang et al. 2006, Macy et al. 1972, Miller and Wolin 1974), but they are prone to cross contamination because of the narrow openings of these containers, and additional time and equipment are required to autoclave the containers to avoid the contamination. Based on the modest oxygen-tolerance of Thermotoga, especially when they are not actively growing (Childers et al. 1992, Huber et al. 1986,
Le Fourn et al. 2008, Van Ooteghem et al. 2004), we inoculated Thermotoga in solid medium with an embedded method, independent of an anaerobic chamber or an anoxic gas conduit. Compared to the traditional surface culturing and overlay plating method
(Jiang et al. 2006), the embedded method is much more convenient and has a higher survival efficiency. It sustains about a 50% plating efficiency, making it possible to select for Thermotoga transformants among a sizeable population of viable cells.
Additionally, a soft SVO medium, which is easy to make and convenient to use, was developed to bridge the transfer of cultures from solid media to liquid media in an 23
aerobic environment. Soft SVO medium also can serve as a storage medium for
Thermotoga up to two months at 4℃.
24
Chapter II. The morphological change of Thermotoga during the growth process
Introduction
Observation of the thin cross section of regular rod Thermotoga cell through
transmission electron microscopy (TEM) revealed a more electron-dense outer layer.
The sheath-like outer structure surrounded Thermotoga cells was called "toga", which
balloons at both ends of the cell and forms a pronounced periplasmic space, but adheres
to the cylindrical part of the cell body (Belkin et al. 1986, Huber et al. 1986). Belkin et
al. observed that the exponentially growing T. neapolitana NS-E exhibited diverse
morphological characteristics in different growth media. The cells appeared as regular,
single rods when glucose was used as a single carbon source supplemented with a small
amount of yeast extract. However, increasing the glucose concentration as high as 25
g/L resulted in initial elongation of the cells; after 24 h, the long cells divided into smaller rods, presumably in response to the decrease of glucose concentration. By contrast, in marine broth, the rod cells were somewhat enlarged and appeared half empty with the cytoplasm concentrated at the center of the cell (Belkin et al. 1986).
Huber et al. observed the cells of T. maritima MSB8 through phase contrast microscopy at room temperature and 85℃, and found the sheath-like structure could be seen under both conditions. There was a single subpolar flagellum of T. maritima MSB8, and no
murein layer could be observed in thin cross sections. In the thin sections of dividing
cells, septa formation also was not observed (Huber et al. 1986). 25
I developed method for genetic transformation of Thermotoga spp. Transformation usually involves two features: the acquisition of naked DNA from the extracellular environment and the formation of genetic competence. Transporting DNA into a bacteria cell is a complicated task. For the Gram-negative bacteria, such as Thermotoga, the incoming DNA must cross the outer membrane, the peptidoglycan layer, and then the cytoplasmic membrane. In gram-positive bacteria, which lack the outer membrane as a barrier for the DNA, DNA uptake is synonymous with passage across the cell wall and the cytoplasmic membrane (Dubnau 1999). Although the natural transformation mechanism is still not very clear, there is not a channel linked the cell outer membrane and plasma membrane to transport DNA. DNA should pass through the outer membrane and reach the periplasmic space firstly, and then was transport through plasma membrane (Dubnau 1999) . The periplasmic space between toga and plasma membrane probably affect the efficiency of transformation of Thermotoga. Thus, in this work, we used scanning electron microscopy (SEM) and transmission electron microscopy (TEM) to observe the morphological changes of T. neapolitana cells during the growth process for determining the optimal time to prepare the competence cells and add DNA.
Materials and Methods
Growth curve of Thermotoga
A freshly inoculated SVO liquid culture of T. neapolitana was shaken at 77℃ at 125 26
rpm. One milliliter of culture was withdrawn periodically up to 21 h. The OD600 values
of each sample was tested and recorded. Finally, the growth curve was made on the
basis of the optical density of the cells.
Scanning electron microscopy (SEM)
Thermotoga cells were collected by centrifugation at 13,523 g after 5, 7, 9, 11, 13, 15,
17, 19, 21, 31, and 60 h incubation. After washing twice with 0.1 M phosphate buffered
saline (PBS) buffer, pH 7.2 (Sigma, Saint Louis, MO, USA), the cells were fixed by 2%
of glutaraldehyde in 0.1 M phosphate buffer, pH 7.2, at 4℃ for overnight. Thereafter, the cells were washed by PBS buffer and then were dehydrated through a series of ethanol solutions (40%, 60%, 80%, 95%, and 100%). After spreading on glass cover slide, the cells were dried in a Samadri-780A critical point dryer, coated with AuPd in a Hummer VI-A sputter coater, and then imaged in a Hitachi 2700 electron microscope
(Hitachi High Technologies America, Inc., Dallas, TX, housed in the Electron
Microscopy facility in the Biological Sciences Department at Bowling Green State
University, OH).
Transmission Electron Microscopy (TEM)
To prepare the samples for transmission electron microscopy, the Thermotoga cells were washed twice with 0.1 M PBS buffer (pH 7.2), and pelleted by centrifugation at
13,523 g for 1 minute. The cell pellet was primary fixed in 2.5% glutaraldehyde in 0.1
M phosphate buffer, pH 7.2, for 1 h. After that, the cells were rinsed twice in phosphate 27
buffer for 15 min each. And then, the cells pellet was post-fixed in 1% OsO4/phosphate
buffer for 2 h. Thereafter, dehydration was achieved through a graded series of ethanol
(40%, 60%, 80%, 95%, 100%, 100%, and 100%) for 15 min in each step. After
dehydration, the cells were infiltrated with Spurr’s resin in four steps using 3:1, 1:1, 1:3
(parts 100% ethanol: parts resin), and 100% resin. Final polymerization of resin
occurred overnight at 60℃, and the specimen resin blocks were formed.
Subsequently, the specimen resin blocks were cut into thin sections of about 60 nm with
a Sorvall Ultramicrotome MT2 microtome (Bausch & Lomb Incorporated, Rochester,
NY) equipped with a glass knife. The sections were then applied onto formvar-coated
copper grids and stained with 4% uranyl acetate and 50% ethanol for 30 min, followed
by a rinse with 50% ethanol and 25% ethanol. Finally, the grids were dried after a rinse
of deionized H2O. A Zeiss EM10 high transmission electron microscope (Carl Zeiss,
Oberkochen, Germany, housed in the Electron Microscopy facility in the Biological
Sciences Department at Bowling Green State University, OH) was used to examine the samples.
Results and Discussion
Growth curve of T. neapolitana.
The growth curve was shown in Figure 4. After 4 h of incubation, the growth of T.
neapolitana entered the exponential phase from lag phase; stationary phase began 28
during the twelfth hour. The highest cell optical density during the growth process is about 0.6. The problem with this test is that there are much undissolved salt in SVO medium, which would affect the OD600. With the prolonged incubation time, undissolved salt was gradually utilized by the growing Thermotoga cells. Therefore, while the uninoculated SVO medium was used as control, the background caused by the undissolved salt was reduced with the growth of T. neapolitana. Because of this reason, the actual OD600 values should be higher the measured ones, especially in the stationary phase.
Figure 4. Growth curve of T. neapolitana. Result is from three independent tests.
The morphological change of Thermotoga cells revealed by Scanning Electron
Microscopy
T. neapolitana cells were collected after 5, 7, 9, 11, 13, 15, 17, 19, 21, 31, and 60 h incubation for SEM observation. All cells grown for 5 h more, which were in the early 29
exponential phase, showed the typical rod shape with length of 2 – 3 μm (Figure 5 A).
After 7 h of growth, the toga was indented at some point on the surface of cells and cells were shorter (Figure 5 B). A large change in cell configuration happened after 9 h of incubation, and about half of the cells were round and with apparent indentation on the surface, and the remaining rod-like cells were around 1 – 2 μm (Figure 5 C). Cells
collected after 11 h contained more rod cells than 9 h and seemed to exhibit a diauxic
growth, although the cells were at the inflection point of exponential phase and
stationary phase (Figure 5 D). At this time point, more short rods could be detected than
at the 9 h time point. A similar phenomenon was also observed by Rutika Puranik of
our group in her SEM study of T. neapolitana and T. sp. RQ7 (personal communication).
Diauxic growth usually happens during the stationary phase, and is caused by the
presence of two sugars in the medium, one of which is easier to metabolize and is
consumed first leading to the rapid growth; when the first sugar was used up, another
one is metabolized and the cells experiences a second slower growth phase. However,
there was not diauxic growth reflected in the Thermotoga growth curve (Figure 4).
Therefore, it was not a typical diauxic growth, but we suspect some metabolites produced in the exponential stage caused this. After entering the stationary phase, 80% of cells became round, and most of the remaining rod cells had surface indentations
(Figure 5 E-I). All Thermotoga cells were round with hollows on the surface after 31 h
growth (Figure 5 J). When the incubation time up to 60 h, the round cells became
aggregated (Figure 5 K). 30
Figure 5. Scanning Electron Microscopy photos.
Transmission Electron Microscopy revealed the inside structure change of
Thermotoga cells
For detecting the contact surface area of toga and cell membrane, TEM was applied to
observe the sections of Thermotoga cells collected after 5, 9, 13, 17, 21, 31, and 60 h 31
growth. At the early exponential phase, the toga adhered to the cell membrane on the side and balloons formed at each pole of the rods where the toga separated from the cell membrane (Figure 6 A). After 9 h of growth, during the middle exponential phase, the cytoplasm was condensed to the center and the balloons were enlarged, leading to the decrease of the contact area of toga and cell membrane (Figure 6 B). When entering the stationary phase, the cytoplasm was further condensed, but there was no obvious difference with the toga. The cross-sections indicated that the dents on the cells observed in SEM photographs were not caused by the collapse of the toga, but the condensed cytoplasm (Figure 6 C). After a period of time entering stationary phase, most of the cells are irregular spherical and the toga was reduced as well; a few short rod cells also were also observed, which presumably were still in a proliferative state
(Figure 6 D and E). In the 31 h sample, short rods were not detected, and all cells were irregular spheres. After 60 h, because of the cell autolysis, the specimen could not be stained very well, and no intact cells could be seen (Figure 6 G). 32
Figure 6. Transmission Electron Microscopy photos.
Conclusion
The periplasmic space between toga and cell membrane probably affects the
transformation efficiency of Thermotoga. According to SEM and TEM detection, we
found that the cells at early exponential phase has the smallest periplasmic space, and
the area of adhered region between toga and cell membrane is the largest. With growth,
the size of toga did not change greatly, but the cytoplasm condensed into the center of the cell, leading to the enlargement of empty balloons at each cell pole and the reduction 33
of the adhered region of toga and cell membrane. Accordingly, we hypothesized that the optimal time of preparing competent cells and adding DNA is the early exponential phase, when OD600 is around 0.1 – 0.2, because during this stage, almost all Thermotoga cells were rods and had the smallest periplasmic space between toga and cell plasma membrane.
34
Chapter III. Construction and transformation of a Thermotoga-E. coli shuttle vector pDH10
Introduction
Without effective genetic tools, the investigations of Thermotoga are still largely
limited to biochemical, genomic, and fermentative studies. The requirements of
developing genetic tools include: (1) identification of applicable thermostable selective
markers; (2) appropriate replication elements for constructing vector systems; (3) efficient transformation methods; (4) developing a gene disruption method and a complementation strategy. Since the first effort on expressing heterologous genes in
Thermotoga (Yu et al. 2001), twelve years have passed, and there have been more and more relevant studies which encouraged us to develop genetic tools for Thermotoga spp.
The most essential element on a vector is the replicon, which can ensure the survival
and passage of the vector in recipient cells. Most replicons used in constructing vectors
were derived from native plasmids or viruses. In 1994, the first Thermotoga cryptic
mini-plasmid pRQ7 was isolated from T. sp. RQ7 (Harriott et al. 1994). The pRQ7 is
the smallest plasmid (846 bp) described so far, and only encodes one apparent open
reading frame (ORF), presumably the replication protein. Studies of pRQ7 suggested
that it is negatively supercoiled and replicates by a rolling-circle mechanism (Harriott
et al. 1994, Yu and Noll 1997). Later, plasmid pMC24 and pRKU1 were identified in T.
maritima (Akimkina et al. 1999) and T. petrophila RKU-1 (Nesbo et al. 2006), 35
respectively. The three Thermotoga strains were isolated from geologically unrelated
locations; however, the three plasmids differ by no more than three point mutations.
The native plasmids discovered from Thermotoga provided replicons for constructing
Thermotoga-E.coli shuttle vectors. Yu et al. have demonstrated successful genetic
transformation of T. neapolitana and T. maritima using Thermotoga-E.coli shuttle
vectors pJY1 (chloramphenicol-resistant) and pJY2 (kanamycin-resistant), which were
derived from pRQ7 (Yu et al. 2001). However, no transformants could be isolated from
plates; the transformed Thermotoga cells had only transient antibiotic resistance in
liquid medium. Although the vectors have not been reported to be used in any further
research, it still lays a foundation for our work.
Selective markers, genes encoding a detectable phenotype, are essential for isolating
transformants. The most widely used selective makers in vectors are antibiotic
resistance markers. When selecting the marker, thermostability must be considered for
the antibiotics to be used and the enzymes conferring the resistance. Many of the
commonly used antibiotics are unstable at high temperatures (Noll and Vargas 1997).
Cammarano, et al. proved that many antibiotics were stable for short incubation at 75℃, but the activity would decrease with prolonged duration (Cammarano et al. 1985).
Hassani, et al. observed thermal degradation of tetracycline at temperatures ranging from 110 – 140 ℃ (Hassani et al. 2008). The stability of various antibiotics in
Thermotoga liquid media at 77℃ was tested by Yu, et al. They indicated that penicillin and thiostrepton lost detectable activity in 24 h; carbenicillin, hygromycin, chloramphenicol, and kanamycin were fourfold less potent in 48 h (Yu et al. 2001). 36
Studies of antibiotic stability at temperature above 75℃ are rather limited. Even so,
some information provided in the publications still can serve as a rough guide to select
for antibiotics used at high temperature. For example, 95℃ is the optimal growth
temperature for Pyrococcus furiosus, but chloramphenicol, carbomycin, and thiostrpton
could still inhibit its growth under this temperature (Aagaard et al. 1996). Because different concentrations were used to inhibit various microorganisms in the above reports, their results had some conflicting information. For example, in Yu's test, thiostrepton was not stable under 77℃, but it was effective at 95℃.Yu, et al. indicated
that T. maritima is sensitive to kanamycin (Yu et al. 2001) and T. neapolitana is
sensitive to chloramphenicol but not to kanamycin. However, more recent work states
that T. maritima is highly resistant to kanamycin (Jiang et al. 2006). For T. sp. RQ7,
there is simply no related report.
Meanwhile, thermostability of the enzymes should be considered as well. The folding
or modification of proteins, even only a few amino acids, would affect the stability or
functional efficiency of enzymes in thermophiles. Most enzymes conferring resistance
in mesophiles do not work at high temperatures; but after modification, such as site
directed mutations, they become heat-resistant. Matsumura and Aiba screened
thermostable kanamycin nucleotidyltransferase through mutagenesis with
hydroxylamine (Matsumura and Aiba 1985). Liao, et al. selected the thermostable
functional kanamycin nucleotidyltransferase encoding gene by introducing the gene
coding for a given enzyme from a mesophilic organism into Bacillus
stearothermophilus and by selecting the variants retaining the enzymatic activity at 37
higher growth temperatures (Liao et al. 1986). Using the same strategy, Turner, et al.
selected a thermostable variant of chloramphenicol acetyltransferase (Liao et al. 1986,
Turner et al. 1992). Brouns, et al. used directed evolution and selection in Thermus
thermophilus HB27 to find thermostable variants of a bleomycin-binding protein
conferring resistance to bleomycin (Brouns et al. 2005). Thus, we focused on detecting
the sensitivity of Thermotoga strains to the antibiotics whose thermostable resistance marker has been developed for constructing our vectors in this work.
After constructing a shuttle vector, we need to stably introduce it into Thermotoga.
Several transformation protocols are currently used, including natural transformation, conjugation, calcium chloride treatment method, liposome-mediated transformation, and electroporation. Vargas evaluated three transformation methods in T. neapolitana,
including natural transformation, conjugation, and electroporation, and proved that T. neapolitana was refractory to all three methods (Vargas 1995). Later, Yu, et al. respectively transformed vectors pJY1 and pJY2 to T. neapolitana and T. maritima through liposome-mediated transformation (Yu 1998, Yu et al. 2001). Therefore, when introducing our vector into Thermotoga cells, we first choose liposome-mediated method described by Yu, et al. Additionally, most bacteria become competent after a short electric pulse. Although the attempt of Vargas failed, we still decided to try again.
In addition, evidence for lateral gene transfer between archaea and bacteria from the genome sequence of T. maritima has been described in many works (Logsdon and
Faguy 1999, Mongodin et al. 2005, Nelson et al. 1999, Worning et al. 2000). Although
Vargas failed before, based on the genomic analysis, we suspected that Thermotoga 38
cells are capable of accepting exogenous DNA from their habitat by natural
transformation. Thus, we detected the natural transformability of Thermotoga strains in
this study as well.
Materials and Methods
Strains and growth condition
Bacterial strains and vectors involved in this study are listed in Table 1 and Table 2,
respectively.
The cultivation method of Thermotoga is the same as described in Chapter I. E. coli strains DH5α and XL1-Blue were used as the recipient strains for construction of vectors, and were grown at 37℃ in Luria Broth (1% tryptone, 0.5% NaCl, and 0.5% yeast extract), with 1.5% agar for plates. Ampicillin was supplemented at 50 μg/ml
when needed.
Table 2 Plasmids used in this study
plasmid Size (bp) Description Reference pUC19 2686 A high-copy number E. coli cloning GenBank: l09137 vector containing portions of pBR322 and M13 mp19 pRQ7 846 Cryptic mini-plasmid from T. sp. RQ7 (Harriott et al. 1994) pKT1 3934 pUC-derived plasmid, containing a (Lasa et al. 1992) kan cassette for thermostable Purchased form kanamycin selections Biotools, B&M Lab, Madrid, Spain. 39
pDH1 3517 pRQ7 DNA cloned between BamHI This study and EcoRI sites of pUC19; Apr pDH10 4762 pRQ7 DNA cloned between EcoRI This study; and XbaI sites of pKT1; Apr, Kanr GenBank JN813374 pDH25 4582 Replaced kan gene on pDH10 with This study pyrE gene cloned from C. saccharolyticus DSM8903; Apr pDH26 4762 Erased BsaI site in Apr gene on This study pDH10 pDH28 4728 Replaced promoter PslpA and kan gene This study cassette with promoter PRQ7.pyr and pyrE gene cloned from C. saccharolyticus DSM8903; Apr
Nucleic acid extraction
Plasmid DNA was extracted from E. coli using standard alkaline lysis method
(Sambrook and Russell 2006).
For preparing plasmid extracts from Thermotoga, 20 ml of 12 h old Thermotoga cells were collected by centrifugation at 13,523 g for 1 min in a 1.5 ml Eppendorf tube. One ml of STE buffer [0.1 M NaCl, 10 mM Tris-HCl (pH 8.0), and 1 mM EDTA (pH 8.0)] was used to resuspend the cell pellet. After centrifuging at 13,523 g for 1 min, the supernatant and the top loose layer of cell pellet were discarded. The cell pellet was resuspended in 200 μl of Solution I [50 mM glucose, 25 mM Tris-Cl (pH 8.0), and 10 mM EDTA (pH 8.0)] and placed on ice. Thereafter, the cell suspension was mixed gently with 400 μl of Solution II (0.2 M NaOH and 1% SDS) and placed on ice for 5 min. After that, 300 μl of Solution III (60 ml of 5 M potassium acetate, 11.5 ml of 40
glacial acetic acid, and 28.5 ml of H2O] was added and mixed gently and thoroughly.
After being kept on ice for 5 min, the tube was centrifuged at 13,523 g for 6 – 8 min
and the white protein precipitate was discarded. Next, the supernatant was transferred
to a fresh tube, and an equal volume of phenol/chloroform/isoamyl alcohol (v:v:v,
25:24:1) was added. After centrifugation at 13,523 g for 5 min, the upper phase was
transferred into a fresh tube. The phenol/chloroform/isoamyl alcohol solution was used twice more to remove cell debris. Finally, the plasmid DNA in the supernatant was precipitated with equal volume of isopropanol, washed twice with 70% ethanol, air-
dried, and dissolved in ddH2O containing 20 μg/ml RNase.
For extraction of large amount of genomic DNA, 250 ml of overnight Thermotoga
culture was centrifuged at 13,523 g for 10 min at room temperature to pellet the cells.
Then, 10 ml of STE was used to resuspend the cell pellet. After adding 500 μl of 10%
SDS and 100 μl of proteinase K solution (2 mg/ml), the mixture was gently swirled and
incubated at 50℃ for 6 h. Subsequently, the mixture was added with an equal volume
of phenol/chloroform/ isoamylol, mixed gently by swirling, and allowed to stand at 4℃
overnight. After centrifugation at 13,523 g for 15 min, the upper aqueous layer (about
50 ml) was transferred to a glass beaker, and then added with 250 μl of RNase (10
mg/ml) and incubated at 37℃ for 1 h. Thereafter, the cell debris was removed by two additional extractions with phenol/chloroform/isoamyl alcohol. The upper aqueous layer (about 40 ml) was transferred to a glass beaker and mixed with 4 ml of 3 M sodium acetate (pH 5.5) by swirling. Finally, the DNA was precipitated by adding 88 ml of ice cold ethanol, spooled using a glass rod, washed once with 1 ml of 70% ethanol, air- 41
dried, and dissolved in 10 mM Tris-EDTA buffer (pH 8.0) overnight.
For extracting small amount of genomic DNA, 10 ml of overnight Thermotoga culture
was centrifuged at 13,523 g for 1 min to pellet the cells. After washing the cells by STE
buffer, 180 μl of Solution I was used to suspend the cells. Then, 120 μl of 10% SDS
was added, and the mixture was incubated at 60℃ for 30 min. After that, proteins were salted out by adding 250 μl of 5 M NaCl and centrifugation at 13,523 g for 5 min. An equal volume of phenol/chloroform/isoamylol solution was used three times to remove cell debris in the supernatant. Finally, the genomic DNA was precipitated by adding a two-fold volume of ethanol at room temperature, washed once with 70% ethanol, air- dried, and dissolved in ddH2O containing 20 μg/ml RNase.
Sensitivity of Thermotoga to different antibiotics
One ml of overnight Thermotoga culture was mixed with 25 ml of solid SVO medium
and poured into Petri dishes. Whaltman qualitative filter paper was cut into small discs
of 7 mm in diameter which were then placed on solidified plates. Various amount of
chloramphenicol (30 μg, 60 μg, 90 μg, 120 μg, and 150 μg), kanamycin (50 μg, 100 μg,
150 μg, 200 μg, and 250 μg), tetracycline (12.5 μg, 25 μg, 37.5 μg, 50 μg, and 62.5 μg),
ampicillin (50 μg, 100 μg, 150 μg, 200 μg, and 250 μg), and bleomycin (10 μg, 20 μg,
30 μg, 40 μg, and 50 μg) were added to the filter paper discs. Inhibition zones
surrounding the discs were recorded after 48 h of anaerobic incubation.
To specify the selective levels of the antibiotic in both liquid and solid media, 42
kanamycin ranging from 50 to 300 μg/ml and chloramphenicol ranging from 30 to 300
μg/ml were supplemented, and the proliferation of Thermotoga was monitored for up
to 72 h.
Construction of vectors
There is a 22 bp region downstream of the ORF of plasmid pRQ7, and excepting three
stop codons, it does not contain any element essential to plasmid functions (Harriott et
al. 1994). Yu, et al. designed primers complementary to this region to maintain two stop
codons to amplify plasmid pRQ7 and used it to construct Thermotoga-E.coli shuttle
vectors, and finally proved that the pRQ7 origin of replication was functional (Yu et al.
2001). In our study, primer set RQ7-1U and RQ7-1D (Table 3), which would linearize
the plasmid immediately after the first stop codon, was used to amplify pRQ7. Taq DNA
polymerase (NEB, Ipswich, MA) was used, and the PCR condition for this pair of
primers was 95℃ for 5 min, 30 cycles of 95℃ for 30 sec, 56℃ for 30 sec, 72℃ for
1 min, followed by extension at 72℃ for 10 min. BamHI and EcoRI sites were introduced to the 5’ ends of the primers respectively, for inserting the linearized pRQ7 into the corresponding sites of pUC19 to give rise to pDH1. A 858 bp XbaI-EcoRI fragment of pDH1 was then inserted to pKT1 pre-digested with the same enzymes to generate pDH10 (Figure 7) (GenBank: JN813374) (Han et al. 2012).
All vectors were transformed to E. coli DH5α or XL1-Blue using the calcium chloride method (Sambrook and Russell 2006). 43
Table 3 Primers used in this study
Primer Sequence Linkers at 5' end RQ7-1U 5' GGGGATCCGAATGTGGTTAGTGTGATTAG BamHI 3'* RQ7-1D 5' GGGAATTCTTAACCATATCCCACTAGTTC 3' EcoRI Thkan-F 5' ATGAATGGACCAATAATAATGAC 3' N/A Thkan-R 5' GCTCTAGAAATTCCGTTCAAAATGGTATGC XbaI G 3' pyrE- 5' GCGCCGGGTCTCT ATGAATAAAGAAGCTTA BsaI DH10-1F CATTCAAATG 3' pyrE- 5' ATCATGCCATGGTTATTTCACCTTTCTACTC NcoI DH10-1R CC 3' pyrE- 5' ATCATGCCATGGACGGAATTCTTAACCATAT NcoI DH10-2F CCC 3' pyrE- 5' GCGCCGGGTCTCATCATATGCCTCACACCTC BsaI DH10-2R CTTAAGGG 3' DH10- 5' ATCATGGGTCTCGCGGTATCATTGCAGCACT N/A BsaI-F GGGGCCAGATGGTAAGC 3' DH10- 5' ATCGTCGGTCTCTACCGCGGGAACCACGCT BsaI BsaI-R CACCGGCTCCAGATTTATCAGC 3' pyrE-pro- 5’ GCGCCGGGTCTCT ATGAATAAAGAAGCTTA BsaI 1F CATTCAAATG 3’ pyrE-pro- 5' GCGCCGGGTCTCTTCAT GGTATCACCCTAT BsaI 1R GTATTTTAAAACG 3' BamHI, AscI, 5' CGGGATCCGGCGCGCCGGCATGCACGCGTG CspyrE- NaeI, SphI, TACACTAGTGGTACCTTATTTCACCTTTCTACT 1R MluI, BsrGI, CCCTGGC 3' SpeI, KpnI pro-pyrE- 5' CGCGGAGCTCAATAGGCGCGCCTAACTCGA SacI-AscI-XhoI- 184-F GATACTGTACAGCAGCATATTTTGTCACCTCCT BsrGI GCAAAATATTTTAGAAC 3' pro-pyrE- 5' CCGGTACCCTACCCGGGTTACCATGGGATAG KpnI-SmaI- 184-R GGCCCTTATTTCACCTTTCTACTCCCTGGCTTT NcoI-ApaI 44
ACAATAGGAATTCC 3' pyrFE-U 5' CTTTTCAAGGATCCCGGTATCG 3' N/A pyrFE-D 5' CTTCTATGAAGATATCCCTTCTGG 3' N/A
*: Underlined sequences indicated the restriction endonuclease recognition sites.
Figure 7. Genetic map of the shuttle vector pDH10. The region highlighted in bold represents the sequence of pRQ7. Enzymes with unique restriction sites are shown.
Transformation and selection methods of Thermotoga
Liposome-mediated transformation was developed from a protocol reported by Yu, et al (Yu et al. 2001). All procedures were carried out on the bench top. To prepare the spheroplasts, 1 ml of overnight Thermotoga culture was transferred to 50 ml of SVO 45
liquid media and allowed to grow to early stationary phase. Then, the cells were
harvested by centrifugation at 2,348 g for 10 min and resuspended to a final volume of
500 μl of solution (4.5 mM NH4Cl, 0.3 mM CaCl2, 0.34 mM K2HPO4, 22 mM KCl, 2 mM MgSO4, 340 mM NaCl, and 20 mM HEPES, pH 7.4) with 300 μg/ml lysozyme.
The cell suspension was incubated at 37℃ for 30 min and then at 77℃ for 5 min. At
the same time, a DNA: liposome mixture was prepared by adding 1 μg of DNA to 25
μl of 20 mM HEPES buffer (pH 7.4), adding 10 μl of DOTAP (Roche Diagnostics,
Indianapolis, IN) with thorough mixing, diluting the mixture with 15 μl of 20 mM
HEPES buffer (pH 7.4), and incubating the mixture at room temperature for 15 min.
The DNA:liposome mixture was then added into the spheroplast suspension, and
incubated at 37℃ for 1 h. Next, 500 μl of spheroplast suspension was transferred to 10
ml of SVO liquid media and incubated at 77℃ for 6 h for cell recovery. Finally, 1 ml
of recovered cell suspension was embedded into 25 ml of hot SVO solid media
supplemented with 250 μg/ml kanamycin when needed, poured into Petri dishes, and incubated in an anaerobic jar to select for transformants.
To prepare electrocompetent cells, 1 ml of overnight Thermotoga culture was
transferred to 50 ml of SVO liquid media and allowed to grow until the cell density
(OD600) reached around 0.2. Then, the cells were harvested by centrifugation at 2,348
g for 15 min, washed once with cold deionized water and twice with the washing
solution (10% glycerol and 0.85 M sucrose), and then resuspended in 500 μl of the same
solution. For electroporation, 4 μg of plasmid DNA was added to 50 μl of the freshly
made competent cells and incubated on ice for 5 min prior to the introduction to a pre- 46
chilled cuvette of 1 mm gap. The operation setting of 25 μF capacitance, 200 Ω
resistance, and 1.5, 1.8, or 2.0 kV voltage (Gene Pulser XcellTM, Bio-Rad Laboratories,
Hercules, CA) was applied. Immediately after electroporation, 1 ml of warmed fresh
SVO liquid medium was added to each cuvette, and the cell suspension was then
transferred to a sealed serum bottle filled with N2 and incubated at 77℃ with a rotation of 100 rpm for 3 h for recovery. After this period, 500 μl of the recovered culture was mixed with 25 ml of hot SVO solid media supplemented with the 250 μg/ml kanamycin to pour a plate to select for transformants.
In natural transformation, 1 ml of overnight Thermotoga culture was transferred to 50 ml of SVO liquid media with 0.35 mM Ca2+ and 0.4 mM Mg2+, and allowed to grow
until the cell optical density reached around 0.1 and 0.2. And then, one milliliter of the
culture was transferred to a sterile 10 ml sealed serum bottle filled with N2 by sterile
syringe. At the same time, DNA samples were added to the culture to desired final
concentrations. For testing the transformation ability, the genomic DNA of T.
neapolitana was used as the donor DNA to a final concentration of 80 μg/ml. When
transforming plasmid vectors into Thermotoga cells, the final concentration of plasmid
was 50 μg/ml. After 6 h of incubation at 77℃ with gentle stirring at 100 rpm, 500 μl
of this culture was used to make an embedded plate. Kanamycin was supplemented at
250 μg/ml when needed.
Selection and verification of Thermotoga transformants
After 48 h of anaerobic incubation at 77℃, large single colonies on the SVO plates 47
supplemented with 250 μg/ml of kanamycin were transferred to soft SVO medium as described in Chapter I, and subsequently to liquid SVO medium for the extraction of plasmid and genomic DNA. PCR using primers Thkan-F and Thkan-R (Table 3), which were specific to the kan gene, was used to verify the transformants. Taq DNA polymerase was used and the PCR condition was 94℃ for 5 min, 30 cycles of 94℃
for 30 sec, 48℃ for 30 sec, 72℃ for 1 min, followed by extension at 72℃ for 10 min.
Thereafter, the purified PCR product were subjected to the digestion of AgeI for further
verification.
Stability assays of the transformed DNA in Thermotoga and E. coli
An inoculum of 2% of Thermotoga recombinant strains were transferred to 50 ml of
SVO liquid media in the presence or absence of kanamycin every 12 h up to 72 h. An
aliquot of each transferred culture was withdrawn and diluted to 10-4. After that, 10 μl
of each dilution was mixed with 10 ml of hot SVO solid media with or without
kanamycin, and then was poured into one compartment of a four-section Petri dish.
Samples of the same strain with different treatments were arranged into different
sections of the same plates. After 48 h of anaerobic incubation at 77℃, colonies grew
up in each section were counted and tested.
For testing the stability of transformed DNA in E. coli, 1% inoculum of E.coli
recombinant liquid culture was transferred to plain LB media every 12 h for six times.
Samples from each transfer were properly diluted (10-5 and 10-6), and 100 μl of each
dilution was spread on plain LB. And then, 100 colonies were randomly picked up and 48
transferred to LB plates supplemented with 100 μg/ml ampicillin. Control strain
DH5α/pKT1 and DH5α/pUC19 were tested in parallel.
Results and Discussion
Sensitivity of Thermotoga strains to different antibiotics
The most commonly used selective markers are antibiotic resistance markers. However, their limited thermostability restricts their applications in thermophiles. For developing the genetic tools for thermophiles, several engineered thermostable selective markers have been developed and applied, such as thermostable belomycin resistance marker, kanamycin resistance marker, chloramphenicol marker, and tetracycline resistance marker, etc (Brouns et al. 2005, Matsumura et al. 1986, Petit et al. 1990). To determine which thermostable selective marker can be used for Thermotoga, the sensitivity of T. neapolitana and T. sp. RQ7 to bleomycin, kanamycin, chloramphenicol, and tetracycline, and T. maritima to kanamycin and chloramphenicol were investigated.
After 48 h of incubation at 77℃, sensitive cells approximating to the paper discs were unable to grow and resulted in clear halos; by contrast, resistant cells grew into a dense lawn, forming a visible background. T. sp. RQ7 and T. neapolitana grow well on the plates mixed with bleomycin, tetracycline, and ampicillin, and no clear halo formed around the paper discs. For T. neapolitana, slight inhibition was shown when 100 µg of kanamycin was applied, and when 250 µg of the antibiotic was used, a small faint 49
inhibition zone was apparent; by contrast, a small halo appeared around the paper disc
loaded with 100 µg of chloramphenicol, and the halo became clearer and a slightly larger when 250 µg of this antibiotic was used (Figure 8). On T. maritima plates, a
distinctive clear inhibition zone was visible when either 50 µg of kanamycin or
chloramphenicol was used; with the increase of the antibiotic, the diameter of the zone
became larger (Figure 8). This result revealed that T. maritima is indeed sensitive to both kanamycin and chloramphenicol. T. sp. RQ7 displayed a similar level of sensitivity to kanamycin to T. maritima. However, the sensitivity to chloramphenicol of T. sp. RQ7
was similar to T. neapolitana (Figure 8). Later, the sensitivity of T. sp. RQ2 to
kanamycin was tested as well, and was found to be sensitive to this antibiotic. In
summary, kanamycin may serve as a good selective marker for T. maritima, T. sp. RQ7,
and T. sp. RQ2, but not for T. neapolitana (Han et al. 2012).
50
Figure 8. Inhibition zone of Thermotoga spp. to different antibiotics. Sensitive cells formed inhibition zones surrounding the paper discs loaded with kanamycin (A), chloramphenicol (B), tetracycline (C), and bleomycin (D) with various amounts as indicated in the first diagraph of each panel. Gas bubbles produced by the Thermotoga cells were clearly visible in each plate. Tn, T. neapolitana; Tm, T. maritima; RQ7, T. sp. RQ7.
Next, we specified the selective levels of kanamycin and chloramphenicol in liquid medium. For kanamycin, as low as 50 μg/ml could totally inhibit the growth of T. sp.
RQ7 within 24 or 48 h of incubation, but for up to 72 h of incubation, 150 μg/ml was required (Figure 9 A). Only 50 μg/ml could completely inhibit the growth of T. 51
maritima up to 72 h incubation (Figure 9 C). However, none of the concentrations could completely inhibit the growth of T. neapolitana, even within 24 h (Figure 9 E). Testing chloramphenicol, 100 μg/ml was the effective concentration to inhibit the growth of T. sp. RQ7 within 24 h, 150 μg/ml within 48 h, and 200 μg/ml within 72h (Figure 9 B). T. maritima could be completely inhibited within 24 h and 48 h by 90 μg/ml and 150 μg/ml of chloramphenicol, respectively, but grew well after 72 h even with up to 180 μg/ml of chloramphenicol (Figure 9 D). By contrast, 200 μg/ml and 300 μg/ml of chloramphenicol could partially inhibit the growth of T. neapolitana within 24 h and 48 h, respectively (Figure 9 F). Later, T. sp. RQ2 cultivated in liquid SVO medium supplemented with kanamycin was tested following the same method, and 150 μg/ml could completely inhibit its growth.
On SVO plates, spontaneous mutants of T. maritima and T. sp. RQ2 occasionally appeared after 48 h of incubation when up to 200 μg/ml of kanamycin was added, but when increasing the concentration to 250 μg/ml, spontaneous mutants rarely appeared.
However, on the plates with 250 μg/ml of kanamycin, only a few spontaneous mutants appeared after 48 h when inoculating the original T. sp. RQ7 stocked at -80℃; but the continuously passaged culture of this strain had many spontaneous mutants on the same plates.
Based on the observations, for the rest of this study, 250 μg/ml of kanamycin was added to SVO plates, and 150 μg/ml of this antibiotic was used for liquid medium.
52
Figure 9. Sensitivity of Thermotoga spp. in liquid SVO medium. Optical densities of T. sp. RQ7 (A and B), T. maritima (C and D), and T. neapolitana (E and F) liquid cultures grown with kanamycin (A, C, and E) and chloramphenicol (B, D, and F). Results of three independent tests.
Thermotoga is naturally transformable
T. neapolitana is resistant to kanamycin, which means there may be kanamycin resistance gene(s) on its chromosome. Therefore, to test whether Thermotoga is natural transformable, the genomic DNA of T. neapolitana was used as donor DNA, and T. sp.
RQ7, which is sensitive to kanamycin, was used as the recipient cell. According to the
SEM (Figure 5) and TEM results (Figure 6) and the growth curve of Thermotoga 53
(Figure 4), when the OD600 is in the range of 0.1 – 0.2, all the cells are rod and toga clings to the cell membrane. It means that under this condition, foreign DNA has the highest chance to pass through toga and cell membrane to enter Thermotoga cells.
Therefore, when performing this experiment, DNA was added into T. sp. RQ7 culture when its OD600 is between 0.1 and 0.2. Figure 10 shows the comparison of T. sp. RQ7 with and without transformation. For the variable factors in each repeat, such as the exposure time to oxygen of the Thermotoga cells, the palladium catalyst efficiency, and the spontaneous mutation of T. sp. RQ7, the colonies number varied in each independent
repeat. However, it was obvious that the colonies number of T. sp. RQ7 transformants
(684±298.4) (±standard deviation) was around 5 – 10 times of the untransformed
RQ7 (58.4 ± 66.0). This result indicated that the kanamycin resistant substance
encoding gene(s) of T. neapolitana was/were transformed to T. sp. RQ7. Accordingly,
T. sp. RQ7 is naturally transformable.
Figure 10. Comparison of T. sp. RQ7 with and without transformation of T. neapolitana genomic DNA. Results of five independent tests. 54
Transformation of Thermotoga
Liposome-mediate transformation (LT)
Liposome-mediate transformation was the only method used before for introducing foreign DNA into Thermotoga (Yu et al. 2001). To ensure that pDH10 transformed into
Thermotoga cells successfully, we used this reported method first. Plasmid pDH10 was introduced into T. sp. RQ7 and T. maritima through liposome-mediated transformation.
Four RQ7/pDH10 (LT) and five Tm/pDH10 (LT) transformants were obtained from
1μg of plasmid DNA and cells collected from 50 ml of culture, as opposed to zero colonies from the samples treated with liposomes only.
Electroporation (ET)
An electric pulse of 2.0 kV resulted in five RQ7/pDH10 (ET) and one Tm/pDH10 (ET) transformants. Eight RQ7/pDH10 (ET) transformants were obtained when a pulse of
1.8 kV was employed; no T. maritima transformants grew up this time. When the voltage dropped to 1.5 kV, no transformants were available with either species. These results suggested that the optimal voltage for Thermotoga is around 1.8 – 2.0 kV using a 1 mm gapped cuvette. T. sp. RQ7 and T. maritima cells treated with a pulse of 1.8 kV in the absence of DNA were used as control, and no spontaneous mutants were found.
Natural Transformation (NT)
After 48 h of anaerobic incubation, there were 132 of RQ7/pDH10 (NT) grew up in 55
total from 1 ml of transformed culture and 50 μg DNA, but only 20 T. sp. RQ7 spontaneous colonies were found on selective plates.
This experiment was then repeated several times, although the numbers of T. sp. RQ7 spontaneous colonies varied in the range of dozens to hundreds, but the RQ7/pDH10
(NT) transformants number increased correspondingly and were always at least 10 times of the spontaneous colonies.
Verification of Thermotoga transformants
All transformations obtained from all transformation methods displayed visible growth after overnight incubation in soft SVO medium in the presence of 150 μg/ml of kanamycin. Four RQ7/pDH10 (NT) strains and three RQ7/pDH10 (ET) strains and a single Tm/pDH10 (ET) strain were propagated in liquid SVO media for the extraction of plasmid and genomic DNA. Before DNA preparation, the transformant cultures were normalized and equal amount of cells were used for extracting plasmid and genomic
DNA. On agarose gels, pDH10 could not be detected from any of the plasmid extracts form any RQ7/pDH10 strain, even though pRQ7 was clearly visible. PCR analysis showed that a fragment of 778 bp was obtained from each plasmid extract but was missing from the genomic of RQ7/pDH10 (NT) #2, 5, and 6, RQ7/pDH10 (ET) #5 and
6, and Tm/pDH10 (ET) (Figure 11). The PCR products were then purified from gel and were digested by AgeI, which would cut the kan gene into two fragments of 208 and
570 bp (Figure 12). All samples released these expected fragments after digestion, indicating that all the PCR products were authentic kan genes. 56
The RQ7/pDH10 (LT) and Tm/pDH10 (LT) also grew well in both soft and liquid SVO
selective media. The same PCR method were used to verify them, and the presence of the kan gene was confirmed to all of them.
Figure 11. Detection of the transformed kan gene in RQ7/pDH10. PCR products of the kan gene were obtained from the plasmid extracts (7-10, 14-16, and 19) or the genomic DNA preparations (3-6, 11-13, and 18) of the recombinant strains. PCR products of the kan gene were obtained from (1) DH5α/pDH10 plasmid extract; (3-6) RQ7/pDH10 NT #2, #5, #6, and #20 genomic DNA; (7-10) RQ7/pDH10 NT #2, #5, #6, and #20 plasmid extracts; (11-13) RQ7/pDH10 ET #5, #6, and #13 genomic DNA; (14- 16) RQ7/pDH10 ET #5, #6, and #13 plasmid extracts; (18) Tm/pDH10 ET genomic DNA; (19) Tm/pDH10 ET plasmid extract. RQ7 plasmid DNA (2) and Tm genomic DNA (17) were used as negative control. NT means the transformants were obtained by natural transformation, and ET indicated that they were obtained by electroporation. M, λ/HindIII. Analyzed with a 1% agarose gel.
57
Figure 12. Restriction digestion of the kan gene. PCR products of the kan gene were prepared from the plasmid extracts of DH5α/pDH10 (lanes 1 and 4), RQ7/pDH10 (lanes 2 and 5), and Tm/pDH10 (lanes 3 and 6). Lanes 1-3 represent the PCR products of the kan gene, and lanes 4-6 are samples digested by AgeI. M, 2-log DNA ladder. Analyzed with a 1% agarose gel.
Transformed pDH10 was stably maintained in Thermotoga
To determine the stability of pDH10, liquid cultures of RQ7/pDH10 and Tm/pDH10 were transferred to fresh SVO medium, with or without kanamycin, every 12 h for six consecutive times. Cultures from each transfer were spread on both SVO and
SVO+Kan plates. The number of colonies on a plain SVO plate represents the total viable cells, whereas the number from a SVO+Kan plate defines the abundance of resistant cells. Without the selection pressure, foreign plasmids are usually unstable and are prone to be lost. However, by the end of our experiment, 100% of both RQ7/pDH10 and Tm/pDH10 still contained pDH10 even without the selection pressure (Table 4). 58
The kan gene was confirmed by PCR from the plasmid preparations of all strains after
each transfer.
Table 4 Percentage of Thermotoga colonies resistant to kanamycin after six transfers*
Recombinant strain Transfer medium Resistant colonies (%) RQ7/pDH10 SVO 104.92 ± 9.57 SVO + Kan 106.66 ± 3.56 Tm/pDH10 SVO 100.96 ± 23.72 SVO + Kan 108.59 ± 7.54
*Results of three independent tests (Han et al. 2012)
Incorporation of pRQ7 increased the stability of pUC19 derivatives in E. coli
The stable maintenance of pDH10 in Thermotoga motivated us to test the stability of pDH10 in E. coli under non-selective conditions. The parent commercial vector, which
has the ColE replicon, was used as the control. Surprisingly, in contrast to pKT1,
pDH10 was much more stable in E. coli. Approximately 90% of DH5α/pKT1 cells lost
pKT1 after a single transfer, and after three transfers, pKT1 was completely eliminated
from the population (Table 5). By contrast, pDH10 was harbored by about 90% of the
cells after three transfers, and approximately 32% of the cells after six transfers. Intact
pDH10 was obtained from the resistant colonies. When pDH1 and pUC19 were
compared, similar result was obtained: pDH1 was much more stable than pUC19 in
DH5α. These data indicated that the insertion of the pRQ7 sequence somehow enhances
the stability of pUC family vectors. 59
Table 5 Percentage of E. coli colonies resistant to ampicillin during consecutive transfers*
Number of transfers pDH10 pKT1 1 96.75 ± 1.30 7.25 ± 5.54 2 95.5 ± 2.5 1.75 ± 1.48 3 90 ± 6.04 0 4 68.5 ± 6.34 - 5 44 ± 11.68 - 6 32.25 ± 15.20 -
*Results of three independent tests (Han et al. 2012)
Next, we compared the copy numbers of pDH10 and pKT1 in their E. coli hosts. The two plasmids were isolated from the same amount of cells and digested by EcoRI and
XbaI, which were originally used for inserting pRQ7 sequence to pKT1 to generate pDH10 (Figure 7). After digestion, the shared vector were compared on agarose gel for test their abundance (Figure 13). Their comparable abundances suggested that the copy numbers of two vectors were probably similar. Therefore, the dramatically improved stability of pDH10 is not because of an increase in copy number.
60
Figure 13. Comparison of the copy numbers of pDH10 and pKT1 in E coli. Plasmid was isolated from the same amount of recombinant cells and was digested by XbaI and EcoRI. M, λ/HindIII; 1, pKT1/XbaI+EcoRI; 2, pDH10/XbaI+EcoRI; 3, undigested pKT1; 4, undigested pDH10. The arrow indicates the shared vector backbone of the two vectors. Analyzed with a 0.8% agarose gel.
Conclusion
A heterologous kan gene has been functionally expressed and stably established in
Thermotoga. The kan gene, harbored on the E. coli-Thermotoga shuttle vector pDH10,
was introduced into Thermotoga by liposome-mediated transformation, electroporation,
and natural transformation. Among the three methods, if only consider the amount of
DNA added, liposome-mediated transformation yields the highest efficiency, which is
4 – 5 transformants per μg of DNA. Electroporation has an efficiency of ~ 0.25
transformants per μg of DNA in T. maritima and ~2 transformants in T. sp. RQ7. A
transformation efficiency of ~2.64 transformants per μg of DNA in T. sp. RQ7 was observed in the case of natural transformation. However, if the recipient cell amount and the manipulation process are considered, natural transformation should be the most efficient method. In natural transformation, all transformants were obtained from only 61
1 ml of culture added with 50 μg of DNA, but cells from 5 ml and 50 ml of culture in early exponential stage were used to be transformed with 4μg and 1μg of DNA in electroporation and liposome-mediated transformation, respectively.
Two factors might have caused the transformation efficiencies to be low: the activities of restriction-modification systems and the damages caused by oxygen. For the first factor, Hui Xu in our lab already proved that the restriction-modification system specific to Thermotoga, TneDI, is not functional in Thermotoga (data not published).
For the second factor, the oxygen damages, because the preparation of spheroplasts or electrocompetent cells and the transformation procedure of either liposome-mediated transformation or electroporation process were performed under aerobic conditions, a significant portion of Thermotoga cells do not survive the handling. Performing the experiment in an anaerobic chamber should help to improve the transformation efficiencies, albeit the operations would be cumbersome. However, natural transformation greatly minimized the exposure of Thermotoga cells to oxygen. Thus, natural transformation demonstrated to be the optimal method to introduce exogenous
DNA into Thermotoga. However, not all Thermotoga strains are naturally transformable, such as T. maritima.
Although intact plasmid pDH10 has not been detected in Thermotoga transformants, we favor the idea that pDH10 is autonomous in Thermotoga, because the kan gene is always associated to a plasmid preparation instead of a genomic DNA extract (Figure
11). If pDH10 had been integrated into the chromosome, we would have seen the kan 62
gene appearing more often from the genomic samples than from the plasmid extracts.
Our data stated otherwise (Figure 11), suggesting that pDH10 is likely an episome
rather than part of the chromosome. Because genomic DNA can include both
chromosomal and plasmid DNA, it is not surprising to occasionally obtain a positive signal from a genomic DNA sample, even though the kan gene is carried by a free- living plasmid. We suspect that pDH10 has an extremely low copy number in
Thermotoga, because the attempts to detect it by inverse PCR (amplifying pDH10 outward from the kan gene), retransformation (transform E. coli with plasmid extracts
of Thermotoga transformants), or Southern blotting (using digoxygenin-labled probes
made from either the kan gene or pRQ7) did not generate any positive results. The expected inverse PCR product is ~ 4 kb, much bigger than the kan gene. This makes the inverse PCR technically more challenging than just amplifying the kan gene.
63
Chapter IV. Isolation of uracil auxotrophs of T. sp. RQ7 and a new thermostable selective marker for Thermotoga
Introduction
As introduced in Chapter III, genes encoding a detectable phenotype are usually used
as selective markers in genetic systems. In addition to antibiotics and the enzymes
conferring resistance, the genetic markers such as those resulting in complementation
of auxotrophy also have been widely used in developing genetic tools. Genes of the
uracil biosynthetic pathway, orotidine-5'-phosphate decarboxylase (OMPdase)
(designated URA3 for yeasts and pyrF for prokaryotes) and orotate
phoshoribosyltransferase (OPRTase) (designated URA5 or URA10 for yeast and pyrE for prokaryotes) genes, have been successfully and widely applied for genetic systems in many microorganisms, many prokaryotes and a few eukaryotes (Cottarel et al. 1993,
Silar and Thiele 1991, Vonstein et al. 1995, Zhou et al. 1994). URA3 and URA5 genes first served as an effective selective markers in Saccharomyces cerevisiae (Boeke et al.
1984). Later, these genes were cloned, characterized, and commonly used as genetic markers in many other microorganisms, such as Haloferax volcanii, Clostridium thermocellum, Thermococcus kodakaraensis, Halobacterium salinarum, Prococcus abyssi, Thermus thermophiles, etc (Bitan-Banin et al. 2003, Lucas et al. 2002, Peck et al. 2000, Sato et al. 2003, Tripathi et al. 2010, Yamagishi et al. 1996).
Strains defective in one of these genes are uracil auxotrophs and become resistant to 5- 64
fluoroorotic acid (5-FOA) (Boeke et al. 1987), which can inhibit the growth of
numerous organisms that utilize orotic acid as a source of pyrimidine rings. 5-FOA can
be converted into 5-fluorouracil (5-FU), which is a pyrimidine analogue and can be
misincorporated into RNA and DNA in place of uracil or thymine and interferes the
RNA and DNA processing and functions (Ko et al. 2008). Thus, 5-FOA can be used for
positive isolation of uracil auxotrophs, which may serve as recipient strains in
transformations; OMPdcase and OPRTase can be used as the genetic makers.
Vargas and Noll isolated various T. neapolitana auxotrophic mutants for the
development of genetic systems (Vargas and Noll 1994); however, there were no
follow-up studies. In this chapter, I tested the sensitivity of Thermotoga strains to 5-
FOA, and then used it to select for uracil auxotrophs. Fortunately, at the first round of
screening, a uracil auxotroph of T. sp. RQ7 was obtained, which lacks 115 bp near the
3' end of orotate phosphoribosyltransferase encoding gene pyrE. To prevent
homologous recombination, the pyrE gene from another thermophilic bacteria
Caldicellulosiruptor saccharolyticus, was used as the selective marker in Thermotoga.
Materials and Methods
Strains and growth conditions
Bacterial strains and vectors involved in this study are listed in Table 1 and Table 2, 65
respectively.
Caldicellulosiruptor saccharolyticus was kindly provided by Dr. Robert Kelly, North
Carolina State University, USA, and was cultivated at 70℃ in the medium DSMZ 640
(http://www.dsmz.de/microorganisms/medium/pdf/DSMZ_Medium640.pdf).
DNA analysis
The Open Reading Frame Finder (ORF Finder)
(http://www.ncbi.nlm.nih.gov/gorf/gorf.html) was used to predict open reading frames
(ORF) of Thermotoga or C. saccharolyticus. Every ORF was thoroughly examined
using BLAST (http://blast.ncbi.nlm.nih.gov/) and the putative start codon was assigned
according to the BLAST results.
We analyzed the pyrimidine biosynthesis operon of T. sp. RQ7 and predicted its promoter using Bacterial Operon and Gene Prediction (FGENESB)
(http://linux1.softberry.com/berry.phtml?topic=fgenesb&group=programs&subgroup=
gfindb) and BPROM
(http://linux1.softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=g
findb).
The construction process of vectors was simulated using Clone Manager Professional
Suite (version 8) (Sci-Ed Software, Cary, NC). Multiple alignments of DNA and protein
were developed using ClustalW (Thompson et al. 2002). 66
Construction of vectors
All primers used in this study were listed in table 3.
The pyrE gene (Csac_1938) from C. saccharolyticus DSM8903 chromosome was
amplified using primers pyrE-DH10-1F and pyrE-DH10-1R, in which BsaI and NcoI
sites were introduced at the 5' ends, respectively. Taq DNA polymerase was used for
this PCR and the condition was 94℃ for 5 min, 30 cycles of 94℃ for 30 sec, 55℃
for 30 sec, 72℃ for 1 min 10 sec, followed by extension at 72℃ for 5 min. Meanwhile, primers pyrE-DH10-2F and pyrE-DH10-2R, with the same restriction sites at each 5' ends, were used to amplify the pDH10 backbone without the kan gene. The PCR condition was 94℃ for 3 min, 30 cycles of 94℃ for 30 sec, 58℃ for 30 sec, 65℃ for 5 min, followed by extension at 65℃ for 10 min, and LongAmp Taq DNA polymerase was used. After digestion and ligation, the pyrE gene replaced the kan gene on pDH10, leading to pDH25 (Figure 14). 67
Figure 14. Genetic map of the E. coli-Thermotoga shuttle vector pDH25. The region highlighted in bold represents the sequence of pRQ7; the slash box indicates the promoter PslpA. Enzymes with unique restriction sites are shown.
For simplifying subsequent operations, the BsaI site was eliminated from pDH10 by
replacing the BsaI recognition site "GGTCTC" with "GGGAAC". During this process,
plasmid pDH10 was amplified using primers DH10-BsaI-F, and DH10-BsaI-R. The
PCR condition was 94℃ for 3 min, 30 cycles of 94℃ for 30 sec, 63℃ for 30 sec, 65℃
for 5 min, followed by extension at 65℃ for 10 min, and LongAmp Taq DNA
polymerase was used. Vector pDH26 was generated after digestion and self-ligated at
the BsaI sites.
Three-piece ligation was applied to replace the promoter PslpA and kan gene cassette on
pDH10 with promoter PRQ7.pyr and pyrE gene from C. saccharolyticus DSM8903. For 68
ligating promoter PRQ7.pyr with the C. saccharolyticus pyrE gene, BsaI site was used to avoid introducing additional nucleotides. Promoter PRQ7.pyr and the C. saccharolyticus pyrE gene were amplified using primers pyrE-pro-1F and pyrE-pro-1R and pyrE-
DH10-1F and CspyrE-1R, respectively, with the same PCR condition: 94℃ for 5 min,
35 cycles of 94℃ for 30 sec, 60℃ for 30 sec, 72℃ for 1 min, followed by extension at 72℃ for 5 min, and Taq DNA polymerase. After digestion and ligation at BsaI site,
PRQ7.pyr–pyrE cassette was generated in the ligation product, which was then used as the template for amplifying this cassette using primers pro-pyrE-184-F and pro-pyrE-184-
R under the condition: 94℃ for 3 min, 30 cycles of 94℃ for 30 sec, 63℃ for 30 sec,
65℃ for 1 min 30 sec, followed by extension at 65℃ for 5 min, and LongAmp Taq
DNA polymerase. After digestion by XhoI and NcoI, this PCR amplicon was ligated at the same sites to the DNA fragment amplified by using pDH26 as the template and pyrE-DH10-2F and pyrE-DH10-2R as the primers, leading to pDH28 (Figure 15).
LongAmp Taq DNA polymerase was used, and the PCR condition was 94℃ for 3 min,
30 cycles of 94℃ for 30 sec, 58℃ for 30 sec, 65℃ for 5 min, followed by extension at 65℃ for 10 min.
All vectors were transformed to E. coli DH5α or XL1-Blue using the calcium chloride method (Sambrook and Russell 2006).
69
Figure 15. Genetic map of the E. coli-Thermotoga shuttle vector pDH28. The region highlighted in bold represents the sequence of pRQ7; the slash box indicates the promoter PRQ7.pyr.
The inhibition concentration of 5-Fluoroorotic acid to Thermotoga strains
Since 5-Fluoroorotic acid is only slightly soluble in water, it was dissolved in dimethyl sulfoxide (DMSO) to a final concentration of 100 mg/ml as the stock solution. When making SVO plates, 5-FOA was added to a final concentration of 0.1, 0.25, 0.4, 0.55,
0.7, 0.85, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, or 4.5 mg/ml. Divided petri dishes were used here, and each section contained 8 ml of SVO solid media embedded with 100 μl of overnight Thermotoga culture. After two days of incubation, the colony numbers were 70
counted and compared.
Isolation of uracil auxotrophs of T. sp. RQ7
Using the embedded method, 2.5 ml of overnight T. sp. RQ7 culture was poured into
one SVO plate supplemented with fresh prepared 5-FOA to the final concentration of 2
mg/ml. Four plates were prepared in total. After 48 h of incubation in anaerobic jar at
70℃, mutants on the plates were transferred to soft SVO media, and subsequently to liquid SVO media. Their genomic DNA was extracted to examine the pyrFE region by
PCR using primers pyrFE-U and pyrFE-D (Table 3) under the condition: 94℃ for 2
min, 35 cycles of 94℃ for 30 sec, 52℃ for 30 sec, 65℃ for 1 min 40 sec, followed by
extension at 65℃ for 5 min, and LongAmp Taq DNA polymerase.
Transformation of the uracil auxotroph T. sp. RQ7-15
T. sp. RQ7-15 was inoculated to 30 ml of SVO liquid media and allowed to grow for 6
h. And then, 1 ml of this culture was withdrawn and centrifuged at 5,867 g for 1 min.
The cell pellet was resuspended in 100 μl of minimal media. Next, the resuspended
cells were injected into 20 ml of minimal media together with 400 μg of DNA sample.
After a desired period of shaking at 77℃ with 100 rpm, 100 μl of the diluted culture
(10-4) was used to make an SVO embedded plate. Two days later, the colonies grown
on the plates were counted and isolated. 71
Selection and verification of RQ7-15 transformants
The transformants were transferred into soft SVO medium, and subsequently to liquid
SVO medium for extracting the plasmid DNA. Thereafter, PCR was used to verify the
presence of the vectors in the RQ7-15 transformants using primers pyrE-DH10-1F and
pyrE-DH10-1R (Table 3), which were designed for detecting the pyrE gene of C.
saccharolyticus. Taq DNA polymerase was used for this PCR and the condition was 94℃ for 5 min, 30 cycles of 94℃ for 30 sec, 55℃ for 30 sec, 72℃ for 1 min 10 sec, followed by extension at 72℃ for 5 min. The PCR products were then verified by digestion with NdeI, PstI, and EcoRV. The parallel experiment on the PCR product of pyrE gene from T. sp. RQ7 chromosome was performed as the control.
Results and Discussion
The inhibition concentration of 5-Fluoroorotic acid to Thermotoga strains
For different organisms, the working concentrations of 5-FOA are different. The 0.8 –
1.2 mg/ml 5-FOA can inhibit the growth of hyperthermophilic archaeon Pyrococcus abyssi (Lucas et al. 2002); yeast cannot survive in 1 mg/ml 5-FOA (Boeke et al. 1984); by contrast, as low as 0.25 mg/ml and 0.15 mg/ml of 5-FOA would completely inhibit the growth of archaea Halobacterium salinarum (Peck et al. 2000) and Haloferax
volcanii (Bitan-Banin et al. 2003), respectively. Thus, various concentration of 5-FOA 72
were supplemented to the SVO plates to test the sensitivity of Thermotoga. Under 77℃,
T. sp. RQ7 grew well when supplying up to 0.4 mg/ml of 5-FOA; thousands of colonies were visible when there was 0.55 or 0.7 mg/ml 5-FOA. When increasing the concentration to 0.85 – 3.5 mg/ml, big single colonies evenly distributed on the plate, but the colony number was reduced with the increase of 5-FOA; when the concentration
was above 4 mg/ml, the growth of T. sp. RQ7 was completely inhibited. For T. neapolitana, colonies could be clearly observed when the concentration of 5-FOA was below 2.5 mg/ml; when it was 3 mg/ml, very tiny colonies could be identified; no colony could grow when the concentration was above 3.5 mg/ml. By contrast, T.
maritima and T. sp. RQ2 were much more sensitive to 5-FOA and their growth could
be inhibited by 1 mg/ml and 0.55 mg/ml of 5-FOA, respectively.
To reduce the degradation of 5-FOA at high temperatures, 70℃, at which Thermotoga
can still grow, was used to incubate the T. sp. RQ7 and T. neapolitana plates. At this
condition, single colonies could be detected when the concentration of 5-FOA is 1.5
mg/ml and below, but when it is above 2 mg/ml, the growth of both T. neapolitana and
T. sp. RQ7 could be completely inhibited.
Isolation of uracil auxotrophs of T. sp. RQ7
There were a total of 2232 T. sp. RQ7 spontaneous on the four plates of 2 mg/ml of 5-
FOA. Fifty of the large colonies were transferred into soft SVO media. After overnight
incubation at 77℃, 16 of the largest colonies were transferred to 30 ml of SVO liquid
media. The chromosome of the 16 spontaneous were isolated and used as template for 73
PCR to detect the pyrFE region on T. sp. RQ7 chromosome. Fortunately, the PCR
product of T. sp. RQ7-15 is smaller than the expected size of 1288 bp (Figure 16).
Figure 16. Detection of the pyrFE in T. sp. RQ7 chromosome. PCR products of the pyrFE gene were obtained from the genomic DNA of T. sp. RQ7 spontaneous mutants (1-16) and T. sp. RQ7 (17). 2-log DNA ladder was used as marker (M). The arrow indicated the pyrFE mutant.
The PCR product was then purified for sequencing. Compared to the wild-type pyrE
gene of T. sp. RQ7, a 115 bp deletion was found near the 3' end of pyrE gene of T. sp.
RQ7-15 (Figure 17). The uracil auxotroph T. sp. RQ7-15 was transferred into fresh
SVO medium without the selection stress of 5-FOA every 12 h up to 72 h, and then genomic DNA of the sixth generation of T. sp. RQ7-15 was isolated for PCR detection.
The result indicated that the 115 bp deletion had not reverted.
74
Figure 17. The alignment of partial pyrFE sequence of T. sp. RQ7 and T. sp. RQ7- 15. A 115 bp deletion was found near the 3’ end of pyrE gene in T. sp RQ7-15.
The pyrimidine biosynthesis operon of T. sp. RQ7
The whole genomic sequence of T. sp. RQ7 was sequenced and annotated in our lab
(unpublished data), and the pyrimidine biosynthesis operon was then analyzed. In this
operon, there are eight ORFs encoding the enzymes of Fe-S oxidoreductase (orf0429),
hydrolases of the alpha/beta superfamily (orf0428), dihydroorotase and related cyclic
amidohydrolases (pyrC), 2-polyprenylphenol hydroxylase and related flavodoxin 75
oxidoreductases (orf0426), dihydroorotae dehydrogenase (pyrD), orotidine-5'-
phosphate decarboxylase (pyrF), orotate phosphoribosyltransferase (pyrF), and metal- dependent hydrolase with the TIM-barrel fold (orf0422) (Figure 18 A).
The promoter PRQ7.pyr of the pyrimidine biosynthesis operon of T. sp. RQ7 was predicted
using FGENESB and BPROM (Figure 18 B). In order to ensure the integrity and
efficiency of the promoter, 364 bp upstream sequence of the start codon of the first gene
orf0429 in this operon was cloned and fused with the pyrE gene from C. saccharolyticus
DSM8903.
Figure 18. Analysis of the pyrimidine biosynthesis operon of T. sp. RQ7. (A) The pyrimidine biosynthesis operon of T. sp. RQ7. PRQ7.pyr is the promoter of this operon. The arrows are the primers designed for detecting the pyrFE region. The white box in pyrE gene below the operon indicated the 115 bp deletion on the chromosome of T. sp. RQ7-15. (B) The predicted promoter PRQ7.pyr of the pyrimidine biosynthesis operon of T. sp. RQ7. The sequence underlined by thick line was -35 region; the sequence underlined by dotted line was -10 region; the sequence in box was SD sequence; Italics was the start codon of gene orf0429.
76
Transformation of vectors pDH25 and pDH28
The uracil auxotroph T. sp. RQ7-15 could not grow in minimal medium without the supplementation of uracil. The defined medium is usually used to select for the transformants of the vectors harboring the pyrFE selective genetic marker. We transformed pDH25 to T. sp. RQ7-15 following the protocol introduced in Chapter III.
Wild-type T. sp. RQ7 was used as the control. However, because the colonies, even the wild-type, formed on the minimal medium plates were very small, it was difficult to pick individual colonies and inoculate into soft and liquid SVO medium. Considering that T. sp. RQ7-15 could not grow in minimal medium, and the transformation happened at the very early growth stage, we performed the transformation directly in the minimal medium. To ensure the SVO medium was not carried over to the minimal medium, 1 ml of overnight T. sp. RQ7-15 culture was washed by minimal medium before injected into a 20 ml of minimal medium. The cells, which were just injected into minimal medium, still could grow for a short time using the nutrients stored in the cell. During this period, the extracellular DNA would have a chance to be uptaken by the cells naturally. To amplify the number of transformants and minimize the amount of untransformed T. sp. RQ7-15, the transformation time was extended to 12, 24, 36, and
48 h. RQ7-15/pDH25 grew slower than the wild type (Figure 19). With the extension of the incubation time, RQ7 and RQ7-15/pDH25 experienced lag phase, exponential phase, stationary phase, and entered decline phase. That is likely why these cultures became clearer at the end (Figure 19). This demonstrated that the pyrE gene of pDH25 had been transformed and expressed successfully in RQ7-15. Because RQ7 grew faster 77
and entered decline phase earlier than RQ7-15/pDH25, after 12 h and 24 h, the OD600 values of RQ7 were greater than RQ7-15/pDH25, but after 36 h and 48 h, it was just the opposite. By contrast, without the supplemented uracil, RQ7-15 did not grow in the minimal medium, so there was no obvious change of OD600 values (Figure 19).
Figure 19. The growth of T. sp. RQ7, RQ7-15, and RQ7-15/pDH25 in minimal media after transformation
78
Since the minimal medium had pre-selected transformants during the transformation
process, to obtain large colonies, SVO solid medium was used to isolate transformants.
After 12 h and 24 h of incubation in minimal medium, 10 times more RQ7-15/p1025
were obtained than T. sp. RQ7-15 on the SVO plates (table 6). Prolonging the
incubation time to 36 h, the number of RQ7-15/pDH25 colonies were similar with T.
sp. RQ7-15; after 48 h of incubation, the number of RQ7-15/pDH25 colonies decreased
dramatically (table 6). By contrast, the numbers of T. sp. RQ7-15 colonies collected
after different incubation times always stayed at the same level (table 4). That was
because the T. sp. RQ7-15 cells were essentially dormant in minimal medium, so in the
SVO solid medium, they required a long time to recover and grew very slowly. For this
reason, there was no significant different in the number of colonies in the 12 h, 24 h, 36
h, and 48 h incubated samples.
Table 6. Transformation efficiency of pDH25 and pDH28 in T. sp. RQ7-15* 12 h 24 h 36 h 48 h Strains incubation incubation incubation incubation (CFU/ml) (CFU/ml) (CFU/ml) (CFU/ml) RQ7-15 2.37×106 8.06×106 9.43×106 5.59×106
RQ7-15/pDH25 6.839×107 1.9224×108 8.07×106 1×104
RQ7-15/pDH28 2.876×107 9.6×107 NT NT
*: The data in this form is an average result from two independent experiments; the CFUs are resulted from SVO plates. NT: not tested
The difference of the numbers of RQ7-15/pDH25 colonies and T. sp. RQ7-15 indicated 79
that pDH25 was transformed into RQ7-15 successfully. The natural transformation
method in minimal medium was efficient, and 12 – 24 h incubation was long enough
for minimizing the background of untransformed RQ7-15 in SVO solid media.
Via the same way, pDH28 was successfully transformed to T. sp. RQ7-15 as well, and
similar number of pDH25 transformants were obtained.
Verification of T. sp. RQ7-15 transformants
For RQ7-15/pDH25 and RQ7-15/pDH28 transformants, 50 colonies of each strain were isolated from plates and transferred to soft SVO media. When they grew, 10 best growing cultures were transferred to liquid SVO medium randomly for plasmid DNA isolation. At the same time, 10 RQ7-15 colonies were also tested.
Same with pDH10, neither pDH25 nor pDH28 could be directly seen on the gel.
However, a fragment of 576 bp, corresponding to the size of the pyrE gene, was obtained from all plasmid extracts of RQ7-15/pDH25 and RQ7-15/pDH28 (Figure 20
A and B). Subsequently, the PCR product of XL1-Blue/pDH25 and RQ7-15/pDH25 #
3 was subject to restriction digestions with NdeI, PstI, and EcoRV, which were expected to cleave the pyrE gene into two fragments of 238 bp and 363 bp, 161 bp and 440 bp, and 125 bp and 476 bp, respectively. Indeed, the digestion reactions released these expected fragments from every sample (Figure 20 C), indicating that the PCR products were the authentic pyrE gene. The PCR product from the plasmid extract of RQ7-
15/pDH28 was subjected to digestion with the same enzymes as well, and the expected 80
fragments were obtained.
Figure 20. Verification of T. sp. RQ7-15 transformants. (A) shows the PCR of RQ7- 15/pDH25 # 1-10 (2-11) and XL1-Blue/pDH25 (1). (B) shows the PCR of RQ7- 15/pDH28 # 1-10 (2-11), XL1-Blue/pDH25(1), and RQ7-15 (12). (C) shows the digested PCR product of XL1-Blue/pDH25 with NdeI (1), PstI (3), and EcoRV (5), and PCR product of RQ7-15/pDH25 #3 with NdeI (2), PstI (4), and EcoRV (6).
Conclusion
From the SVO plates supplemented with 2 mg/ml of 5-FOA, a uracil auxotroph T. sp.
RQ7-15 was isolated. A fragment of 115 bp, near the 3' end of the pyrE on T. sp. RQ7
chromosome, was deleted. However, pyrE gene is not the 3' terminal gene in the operon, 81
and downstream, there is another gene, orf0422, encoding metal-dependent hydrolase
with the TIM-barrel fold. There is a risk that the partial deletion in pyrE gene would
affect the expression of orf0422, thereby affecting the cell growth. However, according
to the observation of cell growth, no obvious difference was found between T. sp. RQ7-
15 and T. sp. RQ7 in both SVO liquid and solid medium. Therefore, strain T. sp. RQ7-
15 is suitable to be used as a recipient cell in the development of a genetic tool.
Both pDH25 and pDH28 were transformed to T. sp. RQ7-15 successfully by natural
transformation in minimal medium. The expression of pyrE gene complemented the mutant. On pDH25, the pyrE gene cloned from C. saccharolyticus DSM8903 was under control of promoter PslpA, which was the original promoter on pKT1 used to construct pDH10. This promoter has been successfully used to express the kan gene in
RQ7/pDH10, thus it should be efficient on the vector pDH25 as well. Subsequently, the survival of RQ-15/pDH25 in minimal medium illustrated the function of orotate phoshoribosyltransferase encoded by the C. saccharolyticus pyrE gene.
To clone another useful promoter for the expression of foreign genes in Thermotoga,
we analyzed the pyrimidine biosynthesis operon of T. sp. RQ7, predicted its promoter,
and replaced the promoter PslpA and kan gene on pDH10 with PRQ7.pyr and C.
saccharolyticus pyrE, resulting in pDH28. The successfully transformation of pDH28
and expression of pyrE driven by PRQ7.pyr illustrated that cloned promoter PRQ7.pyr is effective in Thermotoga.
82
Summary
This dissertation introduced the development of genetic systems in Thermotoga.
Thermotoga was traditionally handled in an anaerobic glove chamber, which is
expensive and cumbersome to use. We developed an embedded method for handling
Thermotoga cultures, independent of an anaerobic chamber. This method greatly
facilitated the manipulation and increased the plating efficiency to 50%, making it
possible to select for Thermotoga transformants. Subsequently, for the isolation of
transformants, soft SVO medium was introduced to bridge the transfer of cultures from
solid medium to liquid medium in an aerobic environment. (See chapter I)
In Chapter II, we observed the morphological changes of T. neapolitana during the
growth process through SEM and TEM. The toga formed balloons at both ends of each
cell leading to a pronounced periplasmic space, but it adhered to the cylindrical part of
the cell body. The cells at the early exponential phase were long rod shaped, and the
area of adhered region between the toga and the cell membrane was most abundant.
With the cell growth, the size of toga did not change greatly, but the cytoplasm
condensed into the center of the cell, resulting in an enlargement of empty balloon
structures and a reduction of the adhered region of toga and cell membrane.
Accordingly, exogenous DNA should be added into the cell culture when the OD600 reaches 0.1 – 0.2.
Chapter III introduced the construction and transformation of a Thermotoga-E.coli shuttle vector pDH10 in T. sp. RQ7 and T. maritima. On the basis of genome analysis 83
of Thermotoga strains, which indicated the potential capacity of natural transformability of Thermotoga, we developed a natural transformation method. By comparing the transformation efficiency of this method with liposome-mediated transformation and electroporation, we proved that natural transformation is the most convenient and efficient way to transform exogenous DNA to Thermotoga. However,
T. maritima is not naturally transformable. Although intact plasmid DNA of pDH10 was not detected in Thermotoga transformants, according to the PCR detection using plasmid and genomic DNA extracts, pDH10 is most likely to be autonomous in
Thermotoga.
In Chapter IV, we isolated a uracil auxotroph T. sp. RQ7-15, which has a deletion in the pyrE gene A pyrE gene cloned from Caldicellulosiruptor saccharolyticus was introduced to T. sp. RQ7 to complement the auxotrophy. We also verified the function of promoter PRQ7.pyr and constructed the PRQ7.pyr-pyrE cassette as the second available
selective marker in Thermotoga.
In summary, our shuttle vectors should allow the introduction and expression of
exogenous genes in Thermotoga cells. Many related applications may be achieved with
the two systems established in this work.
84
References
Aagaard C, Leviev I, Aravalli RN, Forterre P, Prieur D, Garrett RA. 1996. General vectors for archaeal hyperthermophiles: strategies based on a mobile intron and a plasmid. FEMS Microbiol Rev 18: 93-104.
Achenbach-Richter L, Gupta R, Stetter KO, Woese CR. 1987. Were the original eubacteria thermophiles? Syst Appl Microbiol 9: 34-39.
Achenbach-Richter L, Gupta R, Zillig W, Woese CR. 1988. Rooting the archaebacterial tree: the pivotal role of Thermococcus celer in archaebacterial evolution. Syst Appl
Microbiol 10: 231-240.
Adams MW. 1990. The metabolism of hydrogen by extremely thermophilic sulfur- dependent bacteria. FEMS Microbiol Rev 75: 219-238.
Akimkina T, Ivanov P, Kostrov S, Sokolova T, Bonch-Osmolovskaya E, Firman K,
Dutta CF, McClellan JA. 1999. A highly conserved plasmid from the extreme thermophile Thermotoga maritima MC24 is a member of a family of plasmids distributed worldwide. Plasmid 42: 236-240.
Albers SV, Driessen AJ. 2008. Conditions for gene disruption by homologous recombination of exogenous DNA into the Sulfolobus solfataricus genome. Archaea 2:
145-149.
Aravalli RN, Garrett RA. 1997. Shuttle vectors for hyperthermophilic archaea.
Extremophiles 1: 183-191.
Aucelli T, Contursi P, Girfoglio M, Rossi M, Cannio R. 2006. A spreadable, non- 85
integrative and high copy number shuttle vector for Sulfolobus solfataricus based on the genetic element pSSVx from Sulfolobus islandicus. Nucleic Acids Res 34: e114.
Balch WE, Wolfe RS. 1976. New approach to the cultivation of methanogenic bacteria:
2-mercaptoethanesulfonic acid (HS-CoM)-dependent growth of Methanobacterium ruminantium in a pressureized atmosphere. Appl Environ Microbiol 32: 781-791.
Balk M, Weijma J, Stams AJ. 2002. Thermotoga lettingae sp. nov., a novel thermophilic, methanol-degrading bacterium isolated from a thermophilic anaerobic reactor. Int J
Syst Evol Microbiol 52: 1361-1368.
Belkin S, Wirsen CO, Jannasch HW. 1986. A New Sulfur-Reducing, Extremely
Thermophilic Eubacterium from a Submarine Thermal Vent. Appl Environ Microbiol
51: 1180-1185.
Bitan-Banin G, Ortenberg R, Mevarech M. 2003. Development of a gene knockout system for the halophilic archaeon Haloferax volcanii by use of the pyrE gene. J
Bacteriol 185: 772-778.
Boeke JD, LaCroute F, Fink GR. 1984. A positive selection for mutants lacking orotidine-5'-phosphate decarboxylase activity in yeast: 5-fluoro-orotic acid resistance.
Mol Gen Genet 197: 345-346.
Boeke JD, Trueheart J, Natsoulis G, Fink GR. 1987. 5-Fluoroorotic acid as a selective agent in yeast molecular genetics. Methods Enzymol 154: 164-175.
Brouns SJ, Wu H, Akerboom J, Turnbull AP, de Vos WM, van der Oost J. 2005.
Engineering a selectable marker for hyperthermophiles. J Biol Chem 280: 11422-11431.
Bryant MP. 1972. Commentary on the Hungate technique for culture of anaerobic 86
bacteria. Am J Clin Nutr 25: 1324-1328.
Cammarano P, Teichner A, Londei P, Acca M, Nicolaus B, Sanz JL, Amils R. 1985.
Insensitivity of archaebacterial ribosomes to protein synthesis inhibitors. Evolutionary
implications. EMBO J 4: 811-816.
Cannio R, Contursi P, Rossi M, Bartolucci S. 1998. An autonomously replicating
transforming vector for Sulfolobus solfataricus. J Bacteriol 180: 3237-3240.
Cannio R, Contursi P, Rossi M, Bartolucci S. 2001. Thermoadaptation of a mesophilic hygromycin B phosphotransferase by directed evolution in hyperthermophilic Archaea: selection of a stable genetic marker for DNA transfer into Sulfolobus solfataricus.
Extremophiles 5: 153-159.
Childers SE, Vargas M, Noll KM. 1992. Improved Methods for Cultivation of the
Extremely Thermophilic Bacterium Thermotoga neapolitana. Appl Environ Microbiol
58: 3949-3953.
Cottarel G, Beach D, Deuschle U. 1993. Two new multi-purpose multicopy
Schizosaccharomyces pombe shuttle vectors, pSP1 and pSP2. Curr Genet 23: 547-548.
Di Giulio M. 2001. The universal ancestor was a thermophile or a hyperthermophile.
Gene 281: 11-17.
Di Giulio M. 2003a. The universal ancestor was a thermophile or a hyperthermophile:
tests and further evidence. J Theor Biol 221: 425-436.
Di Giulio M. 2003b. The universal ancestor and the ancestor of bacteria were
hyperthermophiles. J Mol Evol 57: 721-730.
Dubnau D. 1999. DNA uptake in bacteria. Annu Rev Microbiol 53: 217-244. 87
EIA. 2012. Annual Energy Review 2011 in Administration USEI, ed.
Eriksen NT, Nielsen TM, Iversen N. 2008. Hydrogen production in anaerobic and microaerobic Thermotoga neapolitana. Biotechnol Lett 30: 103-109.
Fan YT, Zhang YH, Zhang SF, Hou HW, Ren BZ. 2006. Efficient conversion of wheat straw wastes into biohydrogen gas by cow dung compost. Bioresour Technol 97: 500-
505.
Fardeau ML, Ollivier B, Patel BK, Magot M, Thomas P, Rimbault A, Rocchiccioli F,
Garcia JL. 1997. Thermotoga hypogea sp. nov., a xylanolytic, thermophilic bacterium from an oil-producing well. Int J Syst Bacteriol 47: 1013-1019.
Farkas J, Chung D, DeBarry M, Adams MW, Westpheling J. 2011. Defining components of the chromosomal origin of replication of the hyperthermophilic archaeon Pyrococcus furiosus needed for construction of a stable replicating shuttle vector. Appl Environ Microbiol 77: 6343-6349.
Grant SG, Jessee J, Bloom FR, Hanahan D. 1990. Differential plasmid rescue from transgenic mouse DNAs into Escherichia coli methylation-restriction mutants. Proc
Natl Acad Sci U S A 87: 4645-4649.
Gupta RS, Bhandari V. 2011. Phylogeny and molecular signatures for the phylum
Thermotogae and its subgroups. Antonie Van Leeuwenhoek 100: 1-34.
Han D, Norris SM, Xu Z. 2012. Construction and transformation of a Thermotoga-E. coli shuttle vector. BMC Biotechnol 12: 2.
Hansen J, Johnson D, Lacis A, Lebedeff S, Lee P, Rind D, Russell G. 1981. Climate impact of increasing atmospheric carbon dioxide. Science 213: 957-966. 88
Harriott OT, Huber R, Stetter KO, Betts PW, Noll KM. 1994. A cryptic miniplasmid
from the hyperthermophilic bacterium Thermotoga sp. strain RQ7. J Bacteriol 176:
2759-2762.
Hassani M, Lazaro R, Perez C, Condon S, Pagan R. 2008. Thermostability of oxytetracycline, tetracycline, and doxycycline at ultrahigh temperatures. J Agric Food
Chem 56: 2676-2680.
Hawkers FR, Dinsdale R, Hawker DL, Hussy I. 2002. Sustainable fermentative hydrogen production: challenges for process optimisation. International Journal of
Hydrogen Energy 27: 1339-1347.
Hermann M, Noll KM, Wolfe RS. 1986. Improved Agar Bottle Plate for Isolation of
Methanogens or Other Anaerobes in a Defined Gas Atmosphere. Appl Environ
Microbiol 51: 1124-1126.
Huber R, Langworthy TA, konig H, Thomm M, Woese C, Sleytr UB, Stetter K. 1986.
Thermotoga maritima sp. nov. represents a new genus of unique extremely thermophilic eubacteria growing up to 90 ℃. Arch Microbiol 144: 324-333.
Hungate RE. 1950. The anaerobic mesophilic cellulolytic bacteria. Bacteriol Rev 14:
1-49.
Hwang MH, Jang NJ, Hyun SH, Kim IS. 2004. Anaerobic bio-hydrogen production from ethanol fermentation: the role of pH. J Biotechnol 111: 297-309.
Jannasch HW, Huber R, Belkin S, Stetter K. 1988. Thermotoga neapolitana sp. nov. of the extremely thermophilic, eubacterial genus Thermotoga. Arch Microbiol 150: 103-
104. 89
Jeanthon C, Reysenbach AL, L'Haridon S, Gambacorta A, Pace NR, Glenat P, Prieur D.
1995. Thermotoga subterranea sp. nov., a new thermophilic bacterium isolated from a
continental oil reservoir. Arch Microbiol 164: 91-97.
Jiang Y, Zhou Q, Wu K, Li XQ, Shao WL. 2006. A highly efficient method for liquid
and solid cultivation of the anaerobic hyperthermophilic eubacterium Thermotoga
maritima. FEMS Microbiol Lett 259: 254-259.
Kaplan S, Moore MD. 1998. Process for the production of hydrogen using
photosynthetic proteobacteria. U.S. patent 5804424 A.
Klass DL. 1998. Biomass for Renewable Energy, Fuels and Chemicals. San
Diego(California), USA.: Academic Press.
Klass DL. 2003. A critical assessment of renewable energy usage in the USA. Energy
Policy 31: 353-367.
Ko N, Nishihama R, Pringle JR. 2008. Control of 5-FOA and 5-FU resistance by
Saccharomyces cerevisiae YJL055W. Yeast 25: 155-160.
Kostesha N, Willquist K, Emneus J, van Niel EW. 2011. Probing the redox metabolism
in the strictly anaerobic, extremely thermophilic, hydrogen-producing
Caldicellulosiruptor saccharolyticus using amperometry. Extremophiles 15: 77-87.
Kurosawa N, Grogan DW. 2005. Homologous recombination of exogenous DNA with
the Sulfolobus acidocaldarius genome: properties and uses. FEMS Microbiol Lett 253:
141-149.
Lasa I, Caston JR, Fernandez-Herrero LA, de Pedro MA, Berenguer J. 1992. Insertional
mutagenesis in the extreme thermophilic eubacteria Thermus thermophilus HB8. Mol 90
Microbiol 6: 1555-1564.
Le Fourn C, Fardeau ML, Ollivier B, Lojou E, Dolla A. 2008. The hyperthermophilic
anaerobe Thermotoga Maritima is able to cope with limited amount of oxygen: insights
into its defence strategies. Environ Microbiol 10: 1877-1887.
Levin DB, Pitt L, Love M. 2004. Biohydrogen production: prospects and limitations to practical application. International Journal of Hydrogen Energy 29: 173-185.
Liao H, McKenzie T, Hageman R. 1986. Isolation of a thermostable enzyme variant by cloning and selection in a thermophile. Proc Natl Acad Sci U S A 83: 576-580.
Lipscomb GL, Stirrett K, Schut GJ, Yang F, Jenney FE, Jr., Scott RA, Adams MW,
Westpheling J. 2011. Natural competence in the hyperthermophilic archaeon
Pyrococcus furiosus facilitates genetic manipulation: construction of markerless deletions of genes encoding the two cytoplasmic hydrogenases. Appl Environ
Microbiol 77: 2232-2238.
Logsdon JM, Faguy DM. 1999. Thermotoga heats up lateral gene transfer. Curr Biol 9:
R747-751.
Lucas S, Toffin L, Zivanovic Y, Charlier D, Moussard H, Forterre P, Prieur D, Erauso
G. 2002. Construction of a shuttle vector for, and spheroplast transformation of, the hyperthermophilic archaeon Pyrococcus abyssi. Appl Environ Microbiol 68: 5528-
5536.
Macy JM, Snellen JE, Hungate RE. 1972. Use of syringe methods for anaerobiosis. Am
J Clin Nutr 25: 1318-1323.
Masset J, Calusinska M, Hamilton C, Hiligsmann S, Joris B, Wilmotte A, Thonart P. 91
2012. Fermentative hydrogen production from glucose and starch using pure strains
and artificial co-cultures of Clostridium spp. Biotechnol Biofuels 5: 35.
Matsumura M, Aiba S. 1985. Screening for thermostable mutant of kanamycin
nucleotidyltransferase by the use of a transformation system for a thermophile, Bacillus
stearothermophilus. J Biol Chem 260: 15298-15303.
Matsumura M, Yasumura S, Aiba S. 1986. Cumulative effect of intragenic amino-acid
replacements on the thermostability of a protein. Nature 323: 356-358.
Melis A. 2002. Green alga hydrogen production: process, challenges and prospects.
International Journal of Hydrogen Energy 27: 1217-1228.
Miller TL, Wolin MJ. 1973. Formation of hydrogen and formate by Ruminococcus
albus. J Bacteriol 116: 836-846.
Miller TL, Wolin MJ.. 1974. A serum bottle modification of the Hungate technique for
cultivating obligate anaerobes. Appl Microbiol 27: 985-987.
Mongodin EF, Hance IR, Deboy RT, Gill SR, Daugherty S, Huber R, Fraser CM, Stetter
K, Nelson KE. 2005. Gene transfer and genome plasticity in Thermotoga maritima, a
model hyperthermophilic species. J Bacteriol 187: 4935-4944.
Munro SA, Zinder SH, Walker LP. 2009. The fermentation stoichiometry of
Thermotoga neapolitana and influence of temperature, oxygen, and pH on hydrogen
production. Biotechnol Prog 25: 1035-1042.
Nandi R, Sengupta S. 1998. Microbial production of hydrogen: an overview. Crit Rev
Microbiol 24: 61-84.
Nelson KE, et al. 1999. Evidence for lateral gene transfer between Archaea and bacteria 92
from genome sequence of Thermotoga maritima. Nature 399: 323-329.
Nesbo CL, Dlutek M, Doolittle WF. 2006. Recombination in Thermotoga: implications
for species concepts and biogeography. Genetics 172: 759-769.
Nesbo CL, L'Haridon S, Stetter KO, Doolittle WF. 2001. Phylogenetic analyses of two
"archaeal" genes in thermotoga maritima reveal multiple transfers between archaea and
bacteria. Mol Biol Evol 18: 362-375.
Noll KM, Vargas M. 1997. Recent advances in genetic analyses of hyperthermophilic archaea and bacteria. Arch Microbiol 168: 73-80.
Peck RF, DasSarma S, Krebs MP. 2000. Homologous gene knockout in the archaeon
Halobacterium salinarum with ura3 as a counterselectable marker. Mol Microbiol 35:
667-676.
Petit MA, Bruand C, Janniere L, Ehrlich SD. 1990. Tn10-derived transposons active in
Bacillus subtilis. J Bacteriol 172: 6736-6740.
Rainey FA, Donnison AM, Janssen PH, Saul D, Rodrigo A, Bergquist PL, Daniel RM,
Stackebrandt E, Morgan HW. 1994. Description of Caldicellulosiruptor
saccharolyticus gen. nov., sp. nov: an obligately anaerobic, extremely thermophilic,
cellulolytic bacterium. FEMS Microbiol Lett 120: 263-266.
Ravot G, Magot M, Fardeau ML, Patel BK, Prensier G, Egan A, Garcia JL, Ollivier B.
1995. Thermotoga elfii sp. nov., a novel thermophilic bacterium from an African oil-
producing well. Int J Syst Bacteriol 45: 308-314.
Sambrook J, Russell DW. 2006. The Condensed Protocols from Molecular Cloning: A
Laboratory Manual: Cold Spring Harbor Laboratory Press. 93
Sato T, Fukui T, Atomi H, Imanaka T. 2003. Targeted gene disruption by homologous
recombination in the hyperthermophilic archaeon Thermococcus kodakaraensis KOD1.
J Bacteriol 185: 210-220.
Schonheit P, Schafer T. 1995. Metabolism of Hyperthermophiles. World Journal of
Microbiology & Biotechnology 11: 26-57.
Schroder C, Selig M, Schonheit P. 1994. Glucose fermentation to Acetate, CO2 and H2 in the anaerobic hyperthermophilic eubacterium Themrotoga maritima involvement of the Embden-Meyerhof pathway. Archives of Microbiology 161: 460-470.
Silar P, Thiele DJ. 1991. New shuttle vectors for direct cloning in Saccharomyces cerevisiae. Gene 104: 99-102.
Sowers KR, Noll KM. 1995. Techniques for anaerobic growth, methanogenic archeae
Archaea, a Laboratory Manual, Cold Spring Harbor Laboratory Press, NY.
Suzuki T, Iwasaki T, Uzawa T, Hara K, Nemoto N, Kon T, Ueki T, Yamagishi A,
Oshima T. 2002. Sulfolobus tokodaii sp. nov. (f. Sulfolobus sp. strain 7), a new member of the genus Sulfolobus isolated from Beppu Hot Springs, Japan. Extremophiles 6: 39-
44.
Swithers KS, et al. 2011. Genome sequence of Thermotoga sp. strain RQ2, a hyperthermophilic bacterium isolated from a geothermally heated region of the seafloor near Ribeira Quente, the Azores. J Bacteriol 193: 5869-5870.
Takahata Y, Nishijima M, Hoaki T, Maruyama T. 2001. Thermotoga petrophila sp. nov. and Thermotoga naphthophila sp. nov., two hyperthermophilic bacteria from the
Kubiki oil reservoir in Niigata, Japan. Int J Syst Evol Microbiol 51: 1901-1909. 94
Thompson JD, Gibson TJ, Higgins DG. 2002. Multiple sequence alignment using
ClustalW and ClustalX. Curr Protoc Bioinformatics Chapter 2: Unit 2 3.
Tripathi SA, et al. 2010. Development of pyrF-based genetic system for targeted gene deletion in Clostridium thermocellum and creation of a pta mutant. Appl Environ
Microbiol 76: 6591-6599.
Turner SL, Ford GC, Mountain A, Moir A. 1992. Selection of a thermostable variant of
chloramphenicol acetyltransferase (Cat-86). Protein Eng 5: 535-541.
Van Niel EWJ, Budde MAW, De Hass GG, Van der Wal FJ, Claassen PAM, Stams AJM.
2002. Distinctive properties of high hydrogen producing extreme thermophiles,
Caldicellulosiruptor saccharolyticus and Thermotoga elfii. International Journal of
Hydrogen Energy 27: 1391-1398.
Van Ooteghem SA, Beer SK, Yue PC. 2002. Hydrogen production by the thermophilic
bacterium Thermotoga neapolitana. Appl Biochem Biotechnol 98-100: 177-189.
Van Ooteghem SA, Jones A, Van Der Lelie D, Dong B, Mahajan D. 2004. H(2)
production and carbon utilization by Thermotoga neapolitana under anaerobic and
microaerobic growth conditions. Biotechnol Lett 26: 1223-1232.
Vargas M. 1995. Development of genetic methods in the hyperthermophilic bacterium
Thermotoga neapolitana. Doctoral Dissertation. University of Connecticut.
Vargas M, Noll KM. 1994. Isolation of auxotrophic and antimetabolite-resistant
mutants of the hyperthermophilic bacterium Thermotoga neapolitana. Arch Microbiol
162: 357-361.
Vatsala TM. 1990. Microbial process for photohydrogen production from cellulose in 95
high saline water medium. U. S. Patent 4921800.
Vonstein V, Johnson SP, Yu H, Casadaban MJ, Pagratis NC, Weber JM, Demirjian DC.
1995. Molecular cloning of the pyrE gene from the extreme thermophile Thermus flavus.
J Bacteriol 177: 4540-4543.
Waege I, Schmid G, Thumann S, Thomm M, Hausner W. 2010. Shuttle vector-based transformation system for Pyrococcus furiosus. Appl Environ Microbiol 76: 3308-3313.
Wang CH, Lin, P.J., Chang, J.S. 2006. Fermentative conversion of sucrose and pineapple waste into hydrogen gas in phosphate-buffered culture seeded with municipal sewage sludge. Process Biochemistry 41: 1353-1358.
Weaver PF. 1990. Photoenhanced anaerobic digestion of organic acids. U.S. Patent
4919813.
Windberger E, Huber R, Trincone A, Fricke H, Stetter K. 1989. Thermotoga thermarum sp. nov. and Thermotoga neapolitana occurring in African continental solfataric springs.
Arch Microbiol 151: 506-512.
Woese CR. 1987. Bacterial evolution. Microbiol Rev 51: 221-271.
Wong JT, Chen J, Mat WK, Ng SK, Xue H. 2007. Polyphasic evidence delineating the root of life and roots of biological domains. Gene 403: 39-52.
Worning P, Jensen LJ, Nelson KE, Brunak S, Ussery DW. 2000. Structural analysis of
DNA sequence: evidence for lateral gene transfer in Thermotoga maritima. Nucleic
Acids Res 28: 706-709.
Yamagishi A, Tanimoto T, Suzuki T, Oshima T. 1996. Pyrimidine biosynthesis genes
(pyrE and pyrF) of an extreme thermophile, Thermus thermophilus. Appl Environ 96
Microbiol 62: 2191-2194.
Yu JS. 1998. Genetic tools for the study of Thermotoga. Doctroal Dissertation.
University of Conneticut.
Yu JS, Noll KM. 1997. Plasmid pRQ7 from the hyperthermophilic bacterium
Thermotoga species strain RQ7 replicates by the rolling-circle mechanism. J Bacteriol
179: 7161-7164.
Yu JS, Vargas M, Mityas C, Noll KM. 2001. Liposome-mediated DNA uptake and transient expression in Thermotoga. Extremophiles 5: 53-60.
Zhaxybayeva O, et al. 2009. On the chimeric nature, thermophilic origin, and phylogenetic placement of the Thermotogales. Proc Natl Acad Sci U S A 106: 5865-
5870.
Zhou P, Szczypka MS, Young R, Thiele DJ. 1994. A system for gene cloning and manipulation in the yeast Candida glabrata. Gene 142: 135-140.