Development of Microsatellite Markers for Croomia Japonica and Cross

Scientia Horticulturae 161 (2013) 228–232

Contents lists available at ScienceDirect

Scientia Horticulturae

journal homepage: www.elsevier.com/locate/scihorti

Development of microsatellite markers for Croomia japonica and

cross-ampliﬁcation in its congener

a a,1 b c d a,∗

Ming Fang , Chen-Xi Fu , Cheng-Xin Fu , You-Lin Zhu , Akiyo Naiki , En-Xiang Li

Key Laboratory of Plant Resources, College of Life Sciences and Food Engineering, Nanchang University, Nanchang 330031, China

Key Laboratory of Conservation Biology for Endangered Wildlife of the Ministry of Education, College of Life Sciences, Zhejiang University, Hangzhou

310058, China

Key Laboratory of Molecular Biology and Gene Engineering, College of Life Sciences and Food Engineering, Nanchang University, Nanchang 330031, China

Laboratory of Botany, Graduate School of Education (Science), Okayama University, Okayama 700-8530, Japan

a r t i c l e i n f o a b s t r a c t

Article history: Croomia is a small monocotyledonous genus with eastern Asian–eastern North American ﬂoristic disjunc-

Received 4 January 2013

tion. The Croomia species are endangered and in urgent need of conservation. In this study, we report

Received in revised form 11 July 2013

the development and characterization of 11 polymorphic compound microsatellite markers from Croo-

Accepted 12 July 2013

mia japonica. Moreover, transferability and polymorphism of these primers was tested across Croomia

heterosepala and Croomia pauciﬂora. All of them were transferable and polymorphic in these species. The

Keywords:

number of alleles per locus ranged from 2 to 14 (mean: 7.7), 2 to 20 (mean: 7.3) and 2 to 16 (mean: 8.2),

Croomia

while the observed (and expected) heterozygosities ranged from 0.053 to 1.000 (0.053–0.918), 0.000

Genetic diversity

Transferability to 1.000 (0.656–0.945) and 0.190 to 0.905 (0.251–0.937) in populations of C. japonica, C. heterosepala

and C. pauciﬂora, respectively. Most loci in the Croomia populations deviated signiﬁcantly from the HWE

expectations. Signiﬁcant heterozygosity deﬁciency was found but no bottleneck was detected in Croomia.

These polymorphic markers will be useful tool to study the genetic diversity and the population genetic

structure, evolution of Croomia species and for establishment of effective conservation strategies.

1. Introduction systematic relationship among these Croomia species needed to

be studied. In our previous study, inter-simple sequence repeat

Croomia Torr. is a genus of a small monocotyledonous family (ISSR) markers and chloroplast DNA (cpDNA) haplotypes were

Stemonaceae (APGIII, 2009). The genus Croomia comprises three used to study the genetic diversity and phylogeography of two

species with biogeographically interesting distribution patterns: Asian species (Li et al., 2008). As dominant markers may cause

Croomia pauciﬂora (Nut.) Tor. is distributed in Southeast of North biases in the estimates of genetic diversity and genetic differentia-

America and the other two species, Croomia japonica Miq. and Croo- tion (Nybom, 2004) and cpDNA sequences usually cannot provide

mia heterosepala (Bak.) Oku., are in East Asia (Rogers, 1982; Ji and enough polymorphic loci for analyzing, other polymorphic codom-

Duyfjes, 2000). The two Asian species have adjacently distribution inant markers are required to study the genetic structure and

in South Japan, and C. japonica also distribution on adjacent Asiatic evolution in Croomia. Owing to high level of polymorphism and

mainland in East China. Nowadays, all the three species of Croomia codominant inheritance, microsatellites (SSR) are very suitable to

are surviving in small range size and with small number of popula- assess population genetic diversity and gene ﬂow (Liu et al., 2009).

tions, so they are treated as “endangered” or “threatened” (Patrick In order to obtain sufﬁcient working SSR primers pairs, a variety

et al., 1995; Estill and Cruzan, 2001; Wang and Xie, 2004). With of methods for SSR isolation have been developed (Squirrell et al.,

elegant ﬁgure, Croomia species are capable to be cultivated as pre- 2003). Compound SSR primers have proved to be valuable tools

cious ornamentals. Based on slight difference, two new species of genetic studies (Hayden et al., 2004), because they can be used

Croomia were published (Kadota and Saito, 2010). Therefore, the for different markers anchored by the same type of compound

repeat sequence (Lian et al., 2006). An approach for developing

compound microsatellite markers, with substantial time and cost

savings, was introduced (Lian et al., 2006). This method is increas-

∗

Corresponding author. Present address: College of Life Sciences and Food Engi-

ingly used in studying population genetics (Inoue et al., 2012). Here,

neering, Nanchang University, Nanchang 330031, China.

we characterize 11 new compound microsatellite markers for Croo-

E-mail addresses: [email protected], [email protected] (E.-X. Li).

1 mia species.

Contributed equally to this work.

M. Fang et al. / Scientia Horticulturae 161 (2013) 228–232 229

Table 1

Location and sampling size of Croomia populations in this study.

Population code Location Latitude, longitude, altitude (m) Sample size

C. japonica

◦ ◦

JFL Fuliang County, Jingdezhen, China 29 36 11 N, 117 39 04 E, 650 20

◦ ◦

JTO Tosashimizu, Japan 32 52 04 N, 132 58 59 E, 30 19

C. heterosepala

◦ ◦

HZJ Numakubo Town, Fujinomiya, Japan 35 11 62 N, 138 35 10 E, 200 24

◦ ◦

HNB Nanbu Town, Fujinomiya, Japan 35 11 01 N, 138 27 58 E, 600 24

C. pauciﬂora

◦ ◦

PLO Lowndes County, Alabama, American 32 03 47 N, 86 44 11 W, 83 20

◦ ◦

PHE Henry County, AL, USA 31 37 35 N, 85 12 56 W, 105 21

2. Materials and methods Gorley, 2001). The primer pairs of speciﬁc primer (IP1) and com-

pound SSR primer were used as a compound SSR marker (Table 2).

2.1. Plant materials To obtain accurate data, the compound SSR primer (AC)6(AG)5,

(TC)6(AC)5 or (GT)6(TC)5 was labeled with a ﬂuorescent dye (6-

One hundred and twenty eight individuals from 6 Croomia popu- FAM, HEX or TAMARA). Thirty individuals from six populations

lations (Table 1), including two C. japonica populations (JFL and (ﬁve individuals per population) were used in the initial screen of

JTO), two C. heterosepala populations (HZJ and HNB) and two C. the 126 primers. Polymerase chain reactions were performed in

pauciﬂora populations (PLO and PHE), were used to evaluate lev- 15 ␮l of reaction mixture containing 40 ng of genomic DNA, 1U of

els of polymorphism to examine the effectiveness of the designed Taq polymerase (Takara, Dalian, Liaoning, China), 1.5 ␮l of 10 × PCR

primer pairs. Silica-dried samples of leaf material were placed in buffer, 0.8 ␮l of dNTPs (2.5 mM each), and 0.5 ␮l of each IP1 (10 ␮M)

◦

−

zip-lock plastic bags and stored at 76 C. and a compound SSR primer (AC)6(AG)5, (TC)6(AC)5 or (GT)6(TC)5.

The PCR ampliﬁcation conditions were as follows: initial dena-

◦ ◦

turation at 95 C for 5 min; 35 cycles of 30 s at 94 C, 30 s at the

2.2. Development of microsatellite markers

optimized annealing temperature (Table 2), 45 s of elongation at

◦ ◦

72 C, ending with a 10-min extension at 72 C. Fragment analysis

Total genomic DNA was extracted from silica-gel dried leaf

was performed on the MegaBACE1000 autosequencer (GE Health-

material using the CTAB (Cetyltrimethylammonium Bromide)

care Biosciences, Pittsburgh, PA, USA), and the data were scored

method (Doyle, 1991). The compound microsatellite marker

and compiled using Genetic Proﬁler version 2.2 (GE Healthcare

technique based on a dual-suppression-PCR method (Lian Biosciences).

et al., 2006) was used for developing microsatellite markers

in this study. First, an adaptor-ligated DNA library was con-

2.3. Data analysis

structed according to the protocol of Lian et al. (2001). Then

genomic DNA (ca.1000 ng) from C. japonica digested with HaeIII

The number of alleles (Na), observed (Ho) and expected

restriction enzyme (Takara Biotechnology Co., Dalian, Liao-

(He) heterozygosities, linkage disequilibrium (LD), and deviations

ning, China). The restricted fragments were then ligated with a

from Hardy–Weinberg equilibrium (HWE) were analyzed using

speciﬁc blunt unequal-length adaptor (consisting of a 48-mer: 5 -

GTAATACGACTCACTATAGGGCACGCGTGGTCGACGGCCCGGGCTG- GENEPOP version 4.0.7 (Rousset, 2008). CERVUS version 3.0.3

(Kalinowski et al., 2007) was employed to calculate the value of

GT-3 and an 8-mer the 3 -end capped by an amino residue:

polymorphic information content (PIC). An UPGMA (unweighted

5 -ACCAGCCC-NH2-3 ) by use of a DNA Ligation Kit (Takara

pair group method with arithmetic mean) tree was constructed

Biotechnology Co.). Subsequently, the fragments were ampli-

with Poptree2 (Takezaki et al., 2010) software. Bootstrap resam-

ﬁed from the HaeIII DNA library using compound SSR primers

pling (n = 1000) was performed to test dendrogram robustness. The

(AC)6(AG)5, (TC)6(AC)5 or (GT)6(TC)5 and an adaptor primer AP2

Cornuet and Luikart (1996) program BOTTLENECK v1.2.02 was used

(5 -CTATAGGGCACGCGTGGT-3 ). Polymerase chain reactions were

to detect the bottleneck hypothesis.

performed in a 50 ␮l reaction mixture containing 1 ␮l of the

ligated products, 1.5U of Taq polymerase (TaKaRa Biotechnology

Co.), 5 ␮l of 10 × PCR buffer with MgCl2, 5 ␮l of dNTPs (2.5 mM 3. Results

each), 0.5 ␮l of compound SSR primer (10 ␮M) and AP2 primer

(10 ␮M) for each. PCR ampliﬁcation conditions were as follows: 1 A total of 126 primer pairs were designed from microsatellite

◦ ◦ ◦

cycle of 9 min at 94 C, 30 s at 62 C and 1 min at 72 C; 5 cycles of sequences isolated from the microsatellite-enriched libraries. After

◦ ◦ ◦

30 s at 94 C, 30 s at 62 C and 1 min at 72 C; 35 cycles of 30 s at excluding those that did not amplify or yielded nonspeciﬁc ampli-

◦ ◦ ◦ ◦

94 C, 30 s at 62 C and 1 min at 72 C; 1 cycle of 30 s at 94 C, 30 s ﬁcation products, 16, 14 and 11 SSR markers can be ampliﬁed in C.

◦ ◦

at 62 C and 5 min at 72 C. After puriﬁcation, the PCR products japonica, C. heterosepala and C. pauciﬂora respectively. Only the 11

were ligated into pMD19-T vector (Takara) and transformed primer pairs with transferability were chosen to test for polymor-

into competent DH5␣cells (Takara Biotechnology Co.). Positive phism in three species (Table 2). One hundred and twenty eight

clones were checked using M13 primers to amplify the complete individuals from six Croomia populations (Table 1) were used to

microsatellite-containing insert. evaluate levels of polymorphism to examine the effectiveness of

A total of 607 positive clones were obtained and sequenced on these designed primer pairs. The allele sizes of the 11 microsatel-

an ABI Prism 3730 automated DNA sequencer (Applied Biosystems, lite loci ranged from 117 to 371 bp, and the ampliﬁcation products

Foster City, CA, USA). One hundred and twenty six sequences were were within the expected size range (Table 2). The number of alleles

found to contain (AC)6(AG)5, (TC)6(AC)5 or (GT)6(TC)5 compound per locus (Na) ranged from 12 to 46 (mean: 23; total: 255) (Table 2)

SSR sequences at one end and were suitable for designing speciﬁc in Croomia populations.

primers. A speciﬁc primer (IP1) was designed from the sequence The mean number of the alleles per locus (Na) was 10.1 (range:

ﬂanking the compound SSR using Premier Version 5.0 (Clarke and 5–14), 5.3 (range: 2–10), 6.6 (range: 2–12), 8 (range: 2–20), 9.5

230 M. Fang et al. / Scientia Horticulturae 161 (2013) 228–232

Table 2

Characteristics of 11 compound microsatellite loci developed from C. japonica.

◦

Locus Repeat motif Primer sequence (5 -3 ) Ta ( C) Size range (bp) Na GenBank accession no.

C-SSR1-10 (AC)6 (AG)5 F: (AC)6 (AG)5 51 152–177 19 JX491667

R: AAACGCAACTGAAAACGT

C-SSR1-13 (AC)6 (AG)5 F: (AC)6 (AG)5 51 16

C R: TTCTGCTGATTCTGAGG 164–208 JX491668

C-SSR1-14 (AC)6 (AG)5 F: (AC)6 (AG)5 55 46

R: AGTGAGGTTCTTATGTTCATCT 133–195 JX491669

C-SSR1-22 (AC)6 (AG)5 F: (AC)6 (AG)5

R: GCAAGAAAACTACAGGCT 55 187–205 16 JX491670

C-SSR1-23 (AC)6 (AG)5 F: (AC)6 (AG)5

51 R: GCATGGAGTGCTTGATTT 51 168–214 32 JX491671

C-SSR1-73 (AC)6 (AG)5 F: (AC)6 (AG)5

R: GCAACTACATTCGCCTTAC 55 349–371 20 JX491672

C-SSR2-93 (TC)6(AC)5 F: (TC)6(AC)5

R: CAAGTAGAGGGAGATGACAAA 48 117–194 15 AB761054

C-SSR2-98 (TC)6(AC)5 F: (TC)6(AC)5

R: GTTCGCGGTCGTACCTTC 54 131–154 12 AB761055

C-SSR2-109 (TC)6(AC)5 F: (TC)6(AC)5

R: CAGGGCGAAGAAAGAACAA 58 185–269 37 AB761056

C-SSR5-80 (GT)6 (TC)5 F: (GT)6 (TC)5

R: TACTTCTTCACGTTTTGCTC 55 173–240 26 JX491673

F: (GT)6 (TC)5

C-SSR5-122 (GT)6 (TC)5 R: CAATAGCCGTTCTTAGCC 54 178–221 16 AB761057

Note: F = forward primer; R = reverse primer; Ta = annealing temperature; Na = number of alleles per locus. Size range and Na are calculated from six populations.

(range: 5–16), 7 (range: 2–12) in populations JFL, JTO, HZJ, HNB, C. heterosepala respectively. As much difference was found among

PLO and PHE respectively (Table 3). At species level, the number of species and even among populations of the same species, we could

alleles per locus ranged from 5 to 21 (mean: 12.0; total: 132), 2 to infer that the gene ﬂow among populations was very limited.

24 (mean: 10.3; total: 113) and 5 to 20 (mean: 12.1; total: 133) in C. On average, the observed heterozygosities (Ho) were

japonica, C. heterosepala and C. pauciﬂora respectively. In C. japonica, 0.682 (range: 0.300–1.000), 0.680 (range: 0.053–1.000), 0.519

37 of 132 alleles were shared by JFL and JTO. In C. heterosepala, 48 (range: 0.000–1.000), 0.432 (range: 0.000–0.958), 0.682 (range:

of 113 alleles were shared by HZJ and HNB. And 48 of 133 alleles 0.350–0.900) and 0.580 (range: 0.190–0.905) in populations JFL,

were shared by PLO and PHE in C. pauciﬂora. Furthermore, 49 of JTO, HZJ, HNB, PLO and PHE respectively (Table 3). The expected

196 alleles were shared by two Asia species. And 53 of 212 and heterozygosities (He) and the value of polymorphic information

54 of 192 alleles were shared by C. pauciﬂora with C. japonica and content (PIC) were also showed in Table 3. The mean He ranged

Table 3

Results of initial primer screening in C. japonica, C. heterosepala and C. pauciﬂora.

Locus Population JFL Population JTO Population HZJ

Na Ho He PIC HWE Na Ho He PIC HWE Na Ho He PIC HWE

C-SSR1-10 8 0.750 0.774 0.719 * 2 1.000 0.514 0.375 *** 6 0.708 0.656 0.576 ***

C-SSR1-13 7 0.200 0.469 0.400 *** 2 0.053 0.053 0.050 n.s 4 0.750 0.568 0.459 ***

C-SSR1-14 13 0.500 0.665 0.635 ** 9 0.579 0.765 0.709 n.s 12 0.333 0.775 0.738 ***

C-SSR1-22 9 0.300 0.782 0.740 *** 5 0.421 0.548 0.503 n.s 4 0.083 0.233 0.219 **

C-SSR1-23 14 0.450 0.918 0.886 *** 10 0.737 0.788 0.735 *** 10 0.583 0.769 0.724 **

C-SSR1-73 9 0.950 0.736 0.673 *** 2 1.000 0.514 0.375 *** 10 1.000 0.709 0.645 ***

C-SSR5-80 14 0.800 0.912 0.879 * 8 1.000 0.805 0.758 n.s. 8 0.917 0.754 0.703 n.s.

C-SSR2-93 10 1.000 0.832 0.786 *** 5 1.000 0.657 0.575 *** 2 0.708 0.467 0.353 *

C-SSR2-98 5 0.750 0.704 0.632 ** 2 0.053 0.053 0.050 n.s 2 0.000 0.082 0.077 *

C-SSR2-109 11 0.900 0.794 0.745 *** 10 0.737 0.846 0.803 n.s 12 0.333 0.832 0.794 ***

C-SSR5-122 11 0.900 0.850 0.812 * 3 0.895 0.607 0.524 ** 3 0.292 0.260 0.231 n.s.

Mean 10.1 0.682 0.767 0.719 5.3 0.680 0.559 0.496 6.6 0.519 0.555 0.502

Locus Population HNB Population PLO Population PHE

Na Ho He PIC HWE Na Ho He PIC HWE Na Ho He PIC HWE

C-SSR1-10 9 0.500 0.806 0.766 *** 8 0.600 0.724 0.667 *** 9 0.762 0.767 0.727 *

C-SSR1-13 5 0.792 0.721 0.661 *** 5 0.500 0.691 0.617 * 5 0.762 0.546 0.453 **

C-SSR1-14 20 0.625 0.945 0.921 *** 12 0.650 0.833 0.790 * 8 0.429 0.545 0.510 n.s.

C-SSR1-22 4 0.042 0.488 0.431 *** 13 0.750 0.865 0.827 n.s. 6 0.429 0.719 0.667 ***

C-SSR1-23 11 0.458 0.830 0.794 *** 16 0.800 0.937 0.907 n.s. 10 0.810 0.797 0.749 ***

C-SSR1-73 4 0.792 0.559 0.454 * 11 0.600 0.769 0.729 ** 2 0.190 0.251 0.215 n.s.

C-SSR5-80 13 0.958 0.833 0.799 * 13 0.800 0.835 0.796 *** 12 0.714 0.868 0.830 ***

C-SSR2-93 2 0.000 0.082 0.077 * 5 0.900 0.722 0.648 *** 4 0.762 0.757 0.691 ***

C-SSR2-98 3 0.042 0.318 0.274 *** 5 0.350 0.591 0.528 * 7 0.238 0.639 0.577 ***

C-SSR2-109 12 0.333 0.840 0.803 *** 6 0.750 0.729 0.673 *** 6 0.286 0.375 0.346 n.s.

C-SSR5-122 5 0.208 0.397 0.369 ** 10 0.800 0.879 0.842 *** 8 0.905 0.832 0.786 ***

Mean 8.0 0.432 0.620 0.577 9.5 0.682 0.780 0.729 7.0 0.580 0.645 0.596

Note: Na number of alleles per locus, Ho observed heterozygosity, He expected heterozygosity, PIC polymorphism information content, HWE, Hardy–Weinberg equilibrium.

*, ** and ***, signiﬁcant deviation from HWE at P < 0.05, P < 0.01, P < 0.001, respectively. n.s. = not signiﬁcant.

M. Fang et al. / Scientia Horticulturae 161 (2013) 228–232 231

Table 4

Mutation-drift-equilibrium, heterozygosity excess/deﬁciency under different mutation models in Croomia populations.

Population Sample size T2 Wilcoxon test P-value Mode-shift test

IAM TPM SMM IAM TPM SMM

JFL 20 −1.711* −5.573*** −9.815*** 0.4492 0.0420 0.0010 Normal L-shaped

JTO 19 0.915 −0.545 −2.636** 0.8608 0.4492 0.1201 Normal L-shaped

HZJ 24 −0.915 −3.699 −7.513 0.1392 0.0081 0.0012 Normal L-shaped

−

HNB 24 0.141 1.939* −4.962*** 0.6499 0.0337 0.0015 Normal L-shaped

PHE 21 −0.580 −3.090** −7.142*** 0.4829 0.0615 0.0046 Normal L-shaped

PLO 20 0.442 −2.001* −5.312*** 0.6812 0.1030 0.0080 Normal L-shaped

IAM, inﬁnite allele model; TMP, two-phase model; SMM, stepwise mutation model; *, ** and ***, probability at P < 0.05, P < 0.01, P < 0.001, respectively.

One tail for H deﬁciency.

in the same species, which was proved in our previous research (Li

et al., 2008), so most of the primers designed were not transferable.

For the 11 polymorphic SSRs developed in this study, the number

of alleles per locus in Croomia populations ranged from 2 to 20,

suggesting that all of these markers are appropriate to analyze the

genetic diversity of Croomia species.

The mean expected heterozygosities (He) ranged from 0.555

to 0.780 and the mean value of polymorphic information content

(PIC) ranged from 0.496 to 0.729 among six populations (Table 3).

In this study, the mean expected heterozygosities were 0.734 and

0.610 in C. japonica and C. heterosepala respectively, while the mean

He revealed by ISSR markes were 0.085 and 0.125 respectively (Li

Fig. 1. UPGMA tree of Croomia populations based on a matrix of DSW distance.

et al., 2008). The results indicated that these microsatellite loci will

be more helpful to understand the genetic structure in Croomia

species.

from 0.555 to 0.780 and the mean PIC ranged from 0.496 to 0.729

Most loci in the Croomia populations deviated signiﬁcantly from

among six populations. Most loci in the Croomia populations

the HWE expectations (Table 3). This was consistent with the nature

deviated signiﬁcantly from the HWE expectations (Table 3), which

of Croomia, which are relict species with ancient distributed pat-

may be due to heterozygote deﬁciency. No signiﬁcant linkage

tern. Nowadays, the habitats of Croomia species are fragmented

disequilibrium (LD) was detected in comparisons of these primer

and their populations are very small. Most of the populations are far

pairs.

from other populations. As our previous study showed that the gene

The UPGMA tree showed that six populations were divided into

ﬂow among populations are restricted (Li et al., 2008). Therefore,

2 clusters (Fig. 1). One cluster contains JFL, JTO, HZJ and HNB popu-

only a small portion of total alleles were share among populations

lation, which distributed at the east of Asia, another cluster contains

or species.

PLO and PHE population from North America. This tree indicated

There are many factors contribute to genetic structure, among

that the genetic distance was consistent with the geographical dis-

them reproductive system is one the most important. Croomia is

tribution pattern.

generally thought to reproduce sexually through cross-pollination

In mutation-drift-equilibrium, heterozygosity deﬁ-

by ﬂies and asexually by spreading rhizomes (Ji and Duyfjes, 2000).

ciency/excess under different mutation models generated by

But with ﬁeld observations and bagging experiments people found

the BOTTLENECK showed that there were signiﬁcant deﬁciency of

that at least the Asian species are self-compatible and can produce

heterozygosity, but the genetic bottleneck speculated was found

fruits without pollinators (Li, 2006). So the signiﬁcant deﬁciency of

to be absent as the mode-shift curve is normal L-shaped showing

heterozygosity (Table 4) could be due to one or more of the follow-

lack of bottleneck in Croomia (Table 4).

ing reasons: small population size, hindrance of gene ﬂow (Li et al.,

2008), asexual reproduction or inbreeding.

4. Discussion

5. Conclusions

Because of their high degree of polymorphism and random

distribution across the genome and neutrality with respect to selec- In this study we developed 11 polymorphic loci and examined

tion, SSR markers are highly efﬁcient for the analyses of genetic the genetic diversity of C. japonica. Each of these loci showed high

diversity and population structure, genome mapping, and pedigree levels of polymorphism in this species. The cross-ampliﬁcation

reconstruction (Varshney et al., 2005; Ji et al., 2012; Wang et al., experiment revealed that these microsatellite loci were transfer-

2012). From 607 positive clones, 126 sequences were found to con- able to other Croomia species, C. heterosepala and C. pauciﬂora,

tain compound SSR sequences and suitable for designing speciﬁc under the same ampliﬁcation conditions. The results indicated

primers. As we want to study the genetic structure of the whole that these SSR markers are useful in studying genetic diversity,

genus, so the 126 primers were test through 6 populations from evolution and presenting effective conservation strategies of Croo-

3 Croomia species in the initial screen. Eventually, only 11 poly- mia species. Speciﬁcally, we anticipate that these newly developed

morphic microsatellite markers were available. The efﬁciency was primers will prove to be highly valuable in studying evolutionary

relatively low, because only the SSRs with transferability were stud- processes among populations of Croomia.

ied here. Another reason which affects the efﬁciency is the species

itself. Using the same method, the efﬁciencies are much higher in Acknowledgments

other species, such as in Neolitsea sericea (Bl.) Koidz. (Zhai et al.,

This research was supported by the National Science Foundation

2010) and Smilax aspera L. (Xu et al., 2011). As the result indicated

of China (grant no. 30960027).

that there were much difference among Croomia populations even

232 M. Fang et al. / Scientia Horticulturae 161 (2013) 228–232

References Lian, C.L., Wadud, M.A., Geng, Q., Shimatani, K., Hogetsu, T., 2006. An improved tech-

nique for isolating codominant compound microsatellite markers. J. Plant. Res.

119, 415–417.

APGIII, 2009. An update of the Angiosperm Phylogeny Group classiﬁcation for the

Lian, C.L., Zhou, Z.H., Hogetsu, T., 2001. A simple method for developing microsatel-

orders and families of ﬂowering plants. Bot. J. Linn. Soc. 161, 105–121.

lite markers using ampliﬁed fragments of inter-simple sequence repeat (ISSR).

Clarke, K.R., Gorley, R.N., 2001. Primer v5: User Manual/Tutorial. Primer-E, Ltd.,

J. Plant. Res. 114, 381–385.

Plymouth, UK.

Liu, M., Shi, M.M., Liu, M.H., Chen, X.Y., 2009. Isolation and characterization of

Cornuet, J.M., Luikart, G., 1996. Description and power analysis of two tests for

microsatellite loci in Fagus longipetiolata Seem (Fagaceae). Conserv. Genet. 10,

detecting recent population bottlenecks from allele frequency data. Genetics 1981–1983.

144, 2001–2014.

Nybom, H., 2004. Comparison of different nuclear DNA markers for estimating

Doyle, J.J., 1991. DNA protocols for plants-CTAB total DNA isolation. In: Hewittand,

intraspeciﬁc genetic diversity in plants. Mol. Ecol. 13, 1143–1155.

G.M., Johnston, A. (Eds.), Molecular Techniques in Taxonomy. Springer-Verlag,

Patrick, T.S., Allison, J.R., Krakow, G.A., 1995. Protected plants of Georgia. Georgia

Berlin, Germany, pp. 283–293.

Department of Natural Resources, Natural Heritage Program, Social Circle,

Estill, J.C., Cruzan, M.B., 2001. Phytogeography of rare plant species endemic to the

Georgia.

Southeastern United States. Castanea 66, 3–23.

Rogers, K.G., 1982. The Stemonaceae in the southeastern United States. J. Arnold.

Hayden, M.J., Stephenson, P., Logojan, A.M., Khatkar, D., Rogers, C., Koebner, R.M.D.,

Arbor. 63, 327–336.

Snape, J.W., Sharp, P.J., 2004. A new approach to extending the wheat marker

Rousset, F., 2008. Genepop’007 A complete re-implementation of the Genepop soft-

pool by anchored PCR ampliﬁcation of compound SSRs. Theor. Appl. Genet. 108,

733–742. ware for Windows and Linux. Mol. Ecol. Res. 8, 103–106.

Squirrell, J., Hollingsworth, P.M., Woodhead, M., Russell, J., Lowe, A.J., Gibby, M.,

Inoue, T., Kaneko, Y., Yamazaki, K., Anezaki, T., Yachimori, S., Ochiai, K., Lin, L.K., Pei,

Powell, W., 2003. How much effort is required to isolate nuclear microsatellites

K.J.C., Chen, Y.J., Chang, S.W., Masuda, R., 2012. Genetic population structure of

from plants? Mol. Ecol. 12, 1339–1348.

the masked palm civet Paguma larvata, (Carnivora Viverridae) in Japan, revealed

Takezaki, N., Nei, M., Tamura, K., 2010. POPTREE2 Software for constructing popula-

from analysis of newly identiﬁed compound microsatellites. Conserv. Genet. 13,

1095–1107. tion trees from allele frequency data and computing other population statistics

with Windows-interface. Mol. Biol. Evol. 27, 747–752.

Ji, Y., Luo, Y.M., Hou, B.W., Wang, W.Z., Zhaoa, J.F., Yang, L.M., Xue, Q.Y., Ding, X.Y.,

Varshney, R.K., Graner, A., Sorrells, M.E., 2005. Genic microsatellite

2012. Development of polymorphic microsatellite loci in Momordica charantia

markers in plants: features and applications. Trends Biotechnol. 23,

(Cucurbitaceae) and their transferability to other cucurbit species. Sci. Hortic. 48–55.

140, 115–118.

Wang, S., Xie, Y., 2004. China Species Red List, vol. 1. Higher Education Press, Beijing,

Ji, Z.H., Duyfjes, B.E.E., 2000. Stemonaceae. In: Wu, Z.Y., Raven, P.H. (Eds.), Flora of

pp. 416 (in Chinese).

China, vol. 24. Science Press/Missouri Botanical Garden Press, Beijing, China/St.

Wang, Y.L., Qin, Y.Y., Du, Z., Yan, G.Q., 2012. Genetic diversity and differ-

Louis, pp. 70–72.

entiation of the endangered tree Elaeagnus mollis Diels (Elaeagnus L.) as

Kadota, Y., Saito, M., 2010. Two new species of Croomia (Stemonaceae) from Miyazaki

revealed by Simple Sequence Repeat (SSR) Markers. Biochem. Syst. Ecol. 40,

prefecture, Kyushu, Southern Japan. J. Jpn. Bot. 85, 277–288.

25–33.

Kalinowski, S.T., Taper, M.L., Marshall, T.C., 2007. Revising how the computer pro-

Xu, X.H., Wan, Y., Qi, Z.C., Qiu, Y.X., Fu, C.X., 2011. Isolation of compound microsatel-

gram CERVUS accommodates genotyping error increases success in paternity

lite markers for the common Mediterranean shrub Smilax aspera (Smilacaceae).

assignment. Mol. Ecol. 16, 1099–1106.

Am J. Bot 98, e64–e66.

Li, E.X., 2006. Studies on Phylogeography of Croomia and Phylogeny of Croomia and

Zhai, S.N., Yan, X.L., Nakamura, K., Mishima, M., Qiu, Y.X., 2010. Isolation of compound

its Allies. Doctoral Dissertation. Zhejiang University, Hangzhou, China, pp. 66.

microsatellite markers for the endangered plant Neolitsea sericea (Lauraceae).

Li, E.X., Sun, Y., Qiu, Y.X., Guo, J.T., Comes, H.P., Fu, C.X., 2008. Phylogeography of two

Am. J. Bot. 97, e139–e141.

East Asian species in Croomia (Stemonaceae) inferred from chloroplast DNA and

ISSR ﬁngerprinting variation. Mol. Phylogenet. Evol. 49, 702–714.