SAIRA MUFTI 05-Arid-421

Home , Neeli Bar

AN EPIDEMIOLOGICAL STUDY OF BOVINE FASCIOLOSIS

IN POTOHAR REGION, PAKISTAN

SAIRA MUFTI 05-arid-421

Department of Zoology Faculty of Sciences Pir Mehr Ali Shah Arid Agriculture University, Rawalpindi Pakistan 2011

AN EPIDEMIOLOGICAL STUDY OF BOVINE FASCIOLOSIS IN POTOHAR REGION, PAKISTAN

SAIRA MUFTI (05-arid-421)

A thesis submitted in partial fulfillment of the requirement for the degree of

Doctor of Philosophy

Zoology

Department of Zoology Faculty of Sciences Pir Mehr Ali Shah Arid Agriculture University, Rawalpindi Pakistan 2011

CERTIFICATION

I hereby undertake that this research is an original one and no part of this thesis falls under plagiarism. If found otherwise, at any stage, I will be responsible for the consequences.

Name: Saira Mufti Signature: ______

Registration No: 05-arid-421 Date: ______

Certified that the contents and form of thesis entitled “An Epidemiological Study of Bovine Fasciolosis in Potohar Region, Pakistan” submitted by Ms. Saira Mufti have been found satisfactory for the requirement of the degree. Supervisor: ______

(Dr. Mazhar Qayyum)

Co-Supervisor: ______

(Dr. Yusuf Zafar)

Member: ______

(Dr. M. Sajid Nadeem)

Member: ______

(Dr. Ghazala Kaukab)

Chairman, Department of Zoology: ______

Dean, Faculty of Sciences: ______

Director, Advanced Studies: ______

DEDICATED TO MY PARENTS AND MY FAMILY

CONTENTS

Pag

List of Tables x

List of Figures xiii

List of Plates xvi

List of Abbreviations xvii

Acknowledgement xx

Abstract xxii

1. GENERAL INTRODUCTION 1

1.1 Fasciolosis 2

1.2 Taxonomy and classification 3

1.3 Life cycle of Fasciola spp 4

1.4 Snail’s as intermediate hosts 7

1.5 Fasciolosis status 7

1.6 Economic importance 8

1.7 Historical background 10

1.8 Human fasciolosis 10

1.9 Animal Fasciolosis 11

1.10 Pathogenesis and pathology 12

1.11 Diagnosis in humans 15

1.12 Diagnosis in animals 15

1.13 Treatment and prevention 16

1.14 Study rationale 16

2. REVIEW OF LITERATURE 19

2.1 Fasciolosis in Pakistan 19

2.2 Morphometry 23

2.3 Molecular markers 25

2.4 SSR markers 27

2.5 Cercariae / metacercariae (Infective stages) of Fasciola spp 30

2.6 Snail fauna serving as an intermediate snail host(s) for 32

Fasciola spp

2.7 Coprological studies of fasciolosis 35

2.8 Sero-diagnosis of fasciolosis 37

2.9 Present Study 41

3. Morphological characterization and identification of Fasciola spp 43

in Potohar region, Pakistan

3.1 Introduction 43

3.2. Materials and Methods 45

3.2.1 Study Area 45

3.2.2 Topography 46

3.2.3 Climate 46

3.2.4 Sample collection 47

3.2.5 Morphometry 50

3.2.6 Staining of the flukes 50

3.2.7 Measurement techniques and data analyses 50

3.2.8 Morphometric measurement of adults 51

3.2.9 Lineal biometric characters 51

3.2.9.1 Areas 51

3.2.9.2 Ratios 52

3.3 Results 56

3.4 Discussion 70

4. Identification and characterization of Fasciola by the using PCR 74 based gene specific primers of the ribosomal DNA internal transcribed spacer ITS-1 and ITS-2 regions

4.1 Introduction 74

4.2 Materials and Methods 75

4.2.1 Sample collection 75

4.2.2 Extraction of Genomic DNA 76

4.2.3 Genetic markers r DNA ITS-1, ITS-2 77

4.2.4 PCR amplification of Genetic markers (r DNA 77

ITS-1, 2)

4.2.5 PCR Profile for FG ITS-1 and FH ITS-1 81

4.2.6 PCR Profile for FG ITS-2 and FH ITS-2 82

4.2.7 Gel Electrophoresis 83

4.2.8 PCR Purification Cloning and Sequencing 83

4.2.9 Phylogenetic analysis 83

4.2.9.1 Sequence Alignments 84

4.2.10 Data analysis 84

4.2.10.1 Blocks curation 84

4.2.10.2 Tree Construction 84

4.2.10.3 Tree Rendering and Visualization 85

4.2.11 Phylogenetic diversity in Fasciola by using 85

microsatellite (SSR) markers

4.2.12 Development of microsatellite primers 85

4.2.13 PCR microsatellite amplification 88

4.2.14 PCR Profile 89

4.2.15 Gel Electrophoresis 90

4.3 Results 90

4.3.1 Allele Scoring and Data Analysis 101

4.4 Discussion 104

5. Sero-prevalence of fasciolosis in bovines grazed in Potohar region, 113

Pakistan by applying indirect ELISA technique

5.1 Introduction 113

5.2 Materials and Methods 114

5.2.1 Animal Age 114

5.2.2 Animal breeds 114

5.2.3 Animal data Information 115

5.2.4 Parasitological Protocols /Techniques 115

5.2.4.1 Coprology 115

5.2.4.2 ZnSO4 Flotation method 115

5.2.4.3 McMaster egg counting technique 126

5.2.4.4 Identification of Fasciola egg 116

5.2.4.5 Serology 116

vii

5.2.4.6 Enzyme Linked Immunosorbent Assay 117

(ELISA)

5.2.4.7 Fasciola Excretory Secretory (ES) 117

Antigen Preparation

5.2.4.8 Procedure 118

5.3 Results 119

5.3.1 Animal information 119

5.3.2 Seroprevalence 119

5.3.3 Species wise seroprevalence 119

5.3.4 Breed wise seroprevalence 119

5.3.5 Age wise seroprevalence 120

5.3.6 Sex wise seroprevalence 120

5.3.7 Coprology (Fecal Egg Count) 127

5.3.8 FEC Species wise 127

5.3.9 FEC Breed wise 127

5.3.10 FEC Age wise 128

5.3.11 FEC Sex wise 128

5.4 Discussion 135

6. The availability of cercariae/metacercariae (Infective stages) of 141

Fasciola spp on herbage with special reference to freshwater

snail fauna of Potohar region, Pakistan

6.1 Introduction 141

6.2 Materials and methods 142

viii

6.2.1 Study sites 142

6.2.2 Snail Collection 142

6.2.3 Snail Identification 143

6.2.4 Vegetation Type 143

6.2.5 Experimental Design 143

6.2.5.1 Identification and Isolation 144

6.2.5.2 Physicochemical Characteristics of water 144

6.2.5.3 Statistical Analyses 147

6.2.5.4 Exposure to Infection 147

6.2.6 Cercariae and Metacercariae collection 147

6.3 Results 148

6.4 Discussion 154

7. GENERAL DISCUSSION 159

7.1 Outcome of Study 163

7.2 Suggestions/Recommendations 165

SUMMARY 167

LITERATURE CITED 169

APPENDICES 217

LIST OF TABLES

TABLE NO. PAGE

1. Morphometric data of liver flukes hosted in cattle and buffalo 54 from Potohar (Pakistan) compared with available data of Fasciola present in bovines from Iran and Egypt. All measurements are in millimeters (mm).

2. The ANOVA table shows that the p-values of both types 61 (species) and parameters are significantly different (<0.05)

3. Proximity matrix of 20 morphometrical parameters between 62 the 8 homogenous groups showing Squared Euclidean Distance. This is a dissimilarity matrix.

4. Proximity matrix of 5 (BL, BW, BL/BW, VS-Vit, VS-Post) 64 morphometrical parameters between the 8 homogenous groups showing Squared Euclidean Distance. This is a dissimilarity matrix.

5. Agglomeration Schedule of 20 morphometrical characters of 66 homogenous groups (1=Buf-Pak, 2=Cat-Pak, 3=Bov-Iran-Fg, 4=Bov-Iran Fsp, 5=Bov-Iran-Fh, 6=Bov-Egypt-Fg, 7=Bov- Egypt-Fsp, 8=Bov-Egypt-Fh)

6. Agglomeration Schedule of 5 (BL, BW, BL/BW, VS-Vit, VS- 77 Post) morphometrical characters of 8 homogenous groups (1=Buf-Pak, 2=Cat-Pak, 3=Bov-Iran-Fg, 4=Bov-Iran Fsp, 5=Bov-Iran-Fh, 6=Bov-Egypt-Fg, 7=Bov-Egypt-Fsp, 8=Bov- Egypt-Fh)

7 Sample codes, host species and geographical origins of the 78 samples used for genomic DNA extraction and amplification of ITS markers and SSR.

8. Primers pairs used for amplification of ITS markers with 79 Gene bank accession No.

9. Accession No's of markers used with sequence, annealing 87 temperature, the alleles amplified and their allele size with base pair ranges.

10. Comparison of FG ITS-1 of Fasciola spp hosted in bovines 91 (present study) with F. gigantica from different geographical locations. The variable positions with the country and accession number are also specified.

11. Comparison of the FG ITS-2 of Fasciola spp hosted in 94 bovines (present study) with F. gigantica from different geographical locations. The variable positions along with its country and accession numbers are also specified.

12. Comparison of the FH ITS-2 of Fasciola spp hosted in 97 bovines (present study) with Fasciola hepatica from different geographical locations. The variable positions along with its country and accession number are specified.

13. Neeli Ravi buffaloes of two different locations examined for 1121 fasciolosis.

14. Different breeds and sex of cattle examined for fasciolosis 121

15. Seroprevalence of fasciolosis in buffalo (Nili Ravi) with 122 respect to location

16. Relationship between different breeds of cattle and 122 seroprevalence of fasciolosis

17. Relationship between age groups of buffalo and 123 seroprevalence of fasciolosis

18. Relationship between age groups of cattle and 123 seroprevalence of fasciolosis

19. Relationship between different sex groups of buffalo and 124 seroprevalence of fasciolosis

20. Relationship between different sex groups of cattle and 124 seroprevalence of fasciolosis.

21. Fecal egg count of fasciolosis in buffalo (Nili Ravi) with respect 129 to location

22. Relationship between different breeds of cattle and fecal egg 129 count in fasciolosis

23. Relationship between age groups of buffalo and fecal egg 130 count in fasciolosis

24. Relationship between age groups of cattle and fecal egg count 130 in fasciolosis

25. Relationship between different sex groups of buffalo and fecal 131 egg count in fasciolosis

26. Relationship between different sex groups of cattle and fecal 131 egg count in fasciolosis

27. Prevalence of fasciolosis in buffalo and cattle by fecal analysis 132 and Proportion of positive animals by indirect ELISA test related to age

28. Prevalence of fasciolosis in buffalo and cattle by fecal analysis 133 and Proportion of positive animals by indirect ELISA test related to breed

29. Prevalence of fasciolosis in buffalo and cattle by fecal analysis 134 and Proportion of positive animals by indirect ELISA test related to sex

30. ANOVA showing the relationship of cercarial recovery from 149 the snails in different months with respect to fasciolosis

31. ANOVA showing the relationship of metacercarial recovery 151 from the aquatic plants in different months with respect to fasciolosis.

xii

LIST OF FIGURES

PAGE FIGURE NO.

1. Life Cycle of Fasciola species 5

2. Fasciola gigantica whole mount 6

3. Map of Pakistan showing Punjab province. 48

4. Map of Punjab showing Potohar region in grey and the 49 study area in white.

5. Standardized measurements in gravid fasciolid adults: (A) 53 Fasciola hepatica and (B) Fasciola gigantica.

6. Body length (BL) of Pakistani Fasciola compared with 57 Fasciola gigantica (Fg), Fasciola hepatica (Fh), Fasciola species (Fsp)/ Intermediate in Iran and Egypt.

7. Length range from Ventral Sucker to Posterior end (VS- 57 Post) of Pakistani Fasciola compared with Fasciola gigantica (Fg), Fasciola hepatica (Fh), Fasciola species (Fsp)/ Intermediate in Iran and Egypt.

8. Body width (BW) of Pakistani Fasciola compared with 58 Fasciola gigantica (Fg), Fasciola hepatica (Fh), Fasciola species (Fsp)/ Intermediate in Iran and Egypt.

9. Ratio of Body length/Body width (BL/BW) of Pakistani 58 Fasciola compared with Fasciola gigantica (Fg), Fasciola hepatica (Fh), Fasciola species (Fsp)/ Intermediate in Iran and Egypt.

10. Length range from Ventral Sucker to union of Vitelline 59 glands (VS-Vit) of Pakistani Fasciola compared with Fasciola gigantica (Fg), Fasciola hepatica (Fh), Fasciola species (Fsp)/ Intermediate in Iran and Egypt.

11. Dendrogram using Average Linkage (Between Groups) 68 based on 20 morphometrical parameters among 8 groups. (Rescaled Distance Cluster Combine).

xiii

12. Dendrogram using Average Linkage (Between Groups) 69 based on 5 morphometrical parameters among 8 groups (Rescaled Distance Cluster Combine).

13. Phylogenetic tree of FG ITS-1 constructed by Bayesian 93 methods showing similarity of FG ITS1 (Pakistan) with the FG ITS1 species in India, South Korea, and China. Accession no. with country and Fasciola type is also given. Fg: Fasciola gigantica, Fh: Fasciola hepatica and Fas sp: Fasciola species/intermediate. Numbers in red on tree branches show the branch support values in percentage.

14. Phylogenetic tree of FG ITS-2 constructed using Bayesian 96 methods indicates that FG ITS2 found in Pakistan is unique from the FG ITS2 found at other places. Accession no. with country and Fasciola type is also given. Fg: Fasciola gigantica, Fh: Fasciola hepatica and Fas sp: Fasciola species/intermediate. Numbers in red on tree branches show the branch support values in percentages.

15. Phylogenetic tree of FH ITS2 constructed using Bayesian 98 analysis suggests that the closest neighbours of FH ITS2 in Pakistan are Vietnam and Iran. Accession no. with country and Fasciola type is also given. Fg: Fasciola gigantica, Fh: Fasciola hepatica and Fas sp: Fasciola species/intermediate. Numbers in red on tree branches show the branch support values in percentages.

16. PCR amplification of FG ITS1 and FG ITS 2 99

17. PCR amplification of FH ITS 2 100

18. Amplification profile of marker 2 (AJ508371) on 10 bovine 102 genotypes showing 229-243 bp range.

19. Amplification profile of marker 4 (AJ508373) on 10 bovine 102 genotypes showing 276-282 bp range.

20. Amplification profile of marker 5 (AJ508370) on 10 bovine 103 genotypes ranging from 122-136 base pairs.

21. Amplification profile of marker 6 (AJ003821) on 10 bovine 103 genotypes showing 146-176 bp range

xiv

22. Prevalence of fasciolosis in bovines as shown by FEC and 125 ELISA.

23. Prevalence of fasciolosis in bovine breeds as shown by FEC 125 and ELISA.

24. Prevalence of fasciolosis in different age groups of bovine 126 as shown by FEC and ELISA.

25. Prevalence of fasciolosis in different sexes of bovine as 126 shown by FEC and ELISA.

26. Relationship between infection in snails and monthly 150 recovery of cercariae.

27. Relationship between infection in aquatic plants and 152 monthly recovery of metacercariae.

28. Prevalence of fresh water snails at Khairimurat and Rawal 153 dam water bodies

LIST OF PLATES

PLATE NO. PAGE

1. Aquatic plants selected for isolation of metacercariae consist 145 of Hydrilla spp, Vallisenaria spp and Najas spp.

2. Gyraulus convexiusculus selected snail species used in trial 146

3. Lymnaea acuminata selected snail species used in trial 146

xvi

LIST OF ABBREVIATIONS

ANOVA Analysis of variance

A-VS Distance between anterior to ventral sucker

BA Body area

BL Body length

BL/BW Ratio between body length and body width bp base pairs

BSA Bovine serum albumin

BW Body width

CL cone length

CW cone width d NTPs 2,3-deoxyribonucleotide 5-triphosphate

DNA Deoxyribonucleic acid

EDTA Ethylene diamine tetra acetic acid

ELISA Indirect Enzyme Linked Immunosorbent Assay

EPG Egg per gram

FEC Fecal egg count

FG ITS Fasciola gigantica internal transcribed spacer

FH ITS Fasciola hepatica internal transcribed spacer g gram

GC Guanine cytosine content

IgG Immunoglobulin

ITS Internal transcribed spacer

xvii

Kb Kilo bite mg/ml milligram per milliliter

MgCl2 Magnesium chloride

NARC National Agricultural Research Center

NCBI National Center for Biotechnology Information

NIGAB National Institute for Genomics and Advanced Biotechnology

OS Oral sucker

OSA Oral sucker area

OSA/VSA Ratio of oral sucker area and ventral sucker area

OS-VS Distance between oral sucker and ventral sucker

PBS Phosphate buffer saline

PBS-T PBS containing Tween-20

PCR polymerase chain reaction

Ph W Pharynx width r DNA Ribosomal DNA

RNAse Ribonuclease

SD standard deviation

SDS Sodium dodecyl sulphate

SED Squared Euclidean Distance

SPSS Statistical package for social scientists

SSR Simple sequence repeats

TAE Tris acetate ethylene diamine tetra acetic acid

TBE Tris Borate EDTA

Tris-HCl Tris- Hydrochloric acid

xviii

ul Micro-liter

VS Ventral sucker

VSA Ventral sucker area

VS-Post Distance between ventral sucker and posterior end

VS-Vit Distance between ventral sucker to area where vitellaria join

xix

ACKNOWLEDGEMENT

All praises to Almighty Allah alone, the compassionate and merciful, who has always blessed me and guided me on the path of righteousness

First and foremost, I humbly thank Allah almighty for all his blessings bestowed upon me and who has made it possible to make my fathers dream come true. It is a pleasure to thank all those who made this thesis possible, primarily my

Supervisor Prof. Dr. Mazhar Qayyum, Chairman, Department of Zoology,

PMAS Arid Agriculture University, for his incessant interest, ceaseless support and valuable guidance in writing this dissertation as well as the challenging research behind it.

I am very grateful to my Co-Supervisor Dr. Yusuf Zafar, Director

General, Agriculture and Biotechnology, Biosciences Division, Pakistan

Atomic Energy Commission for his deep concern, unconditional support and sincere encouragement to help me pursue my research in NIGAB (NARC). My sincere appreciation goes to thank all the members of competent team of researchers at NIGAB (NARC), especially Miss Farhat Nazir, Senior Scientific

Officer (SSO) for her research expertise, insightful comments, tolerant attitude and priceless friendship, throughout my research work at NIGAB (NARC). I would like to thank Dr. M. Sajid Nadeem and Dr. Ghazala Kaukab, the members of my supervisory committee who were always very helpful and cooperative throughout the tenure.

I am indebted to the assistance and contributions provided by Mr. Abdul

Shakoor, Chairman Department of Statistics and also to Mr. M. Jabbar, Mr.

Zahid Shareef, Miss Kiran Afshan and Mr. Nisar regarding their help and expertise in the statistical analysis. I am heartily thankful to Dr. Fauzia Yusuf,

Chairperson of Biosciences, COMSATS and Mr. Khalid Hassan, lecturer,

COMSATS for the proficiency and support regarding the Bioinformatics computation and analysis.

I would also like to acknowledge in admiration the cooperative attitude shown by the entire faculty of Zoology Department whenever I approached them for their endless service and advice, especially worthy of mention are the services of Dr. Farhana Chaudhry, Mr. M. Irfan, Mr. Israr Shah. The cooperation and help extended by Mr. Amir, Mr. Fayyaz, Mr. Zafar and Mr. Khalil was extraordinary.

I would also like to mention my appreciation for the care and support provided by my lab fellows especially Miss Shumaila Erum, Miss Sadaf Ijaz,

Mr. Ali and Mr. Haroon.

Last but not least I cannot thank enough my divine mother, whose endless prayers have made me attain my goal, my ingenuous husband who always had complete confidence in me when I doubted myself and my superb children who served as my coach on and off, whenever I needed them.

xxi

I really thank you all from the core of my heart as without your contributions I could never ever have completed this dissertation. May Allah

Almighty bless you always.

SAIRA MUFTI

xxii

Abstract

This study was conducted during 2007-2010 on the Fasciola species isolated from bovines grazing in the Potohar (Punjab) region of Pakistan. The objective of the study was to generate information and baseline data on the identification of Fasciola species with the help of morphometry and genomics. The

Phenotypic analysis comprised on the study of morphological parameters and molecular characterization was based on genetic markers (r DNA ITS-1 and ITS-

2), simultaneously genetic diversity was investigated by using microsatellite markers. The prevalence of fasciolosis was also established in the Potohar area by screening grazing cattle and buffaloes. This was achieved by analyzing and comparing fecal egg count and serology. Immunodiagnosis was done by an indirect

ELISA test, which was developed to diagnose fasciolosis in this region. The antigen used was ES antigen isolated from the liver flukes present in bovines of

Potohar. The species of Fasciola identified in this area was an intermediate, resembling F.gigantica and there is no commercially available ELISA kit to detect infection between F.gigantica and Fasciola spp / F. intermedia. Since the prevalence of fasciolosis is dependent on its intermediate fresh water snail host, the occurrence of snails in selected water bodies of Potohar area was also observed including their infective stages; cercariae along with metacercariae. The monthly cercarial prevalence isolated from two selected snail species was taken into account along with prevalence of aquatic vegetation in the marked water bodies. The snails were observed for monthly cercarial activity, whereas the aquatic vegetation was observed for the presence of metacercariae.

xxiii

The results of the present study report that the species of Fasciola in the

Potohar area is an intermediate resembling F.gigantica more than F.hepatica. The microsatellite markers used, show polymorphism and the presence of genetic diversity in Fasciola. Prevalence of fasciolosis was fifty five percent in the bovines grazing in this area. This was seen to be breed, age and sex related and more prevalent in buffaloes as compared to cattle. The snail species prevalent in the marked water bodies were Lymnaea acuminata and Gyraulus convexiusculus and the aquatic vegetation comprised of Vallisenaria, Najas and Hydrilla species. The monthly cercarial activity was highest in Fasciola spp recovered from L. acuminata in the month of September, 2009, whereas recovery of cercariae of

Fasciola spp from Gyraulus convexiusculus was highest in the month of July. The over all study results revealed that more cercariae of Fasciola were recovered from

L. acuminata compared to Gyraulus convexiusculus. The plant species most successful for metacercarial deposition was Hydrilla and Najas as compared to

Vallisenaria.

This present study is unique in a sense that no such type of study has previously been reported especially in Potohar region, Punjab, Pakistan. These results will be the basis for developing effective control strategies of fasciolosis, based on its occurrence and to facilitate design targeted and cost effective drugs to control fasciolosis in Potohar region.

xxiv

Chapter 1

INTRODUCTION

Livestock is an essential component of the agriculture sector of Pakistan as it contributes 11.3 percent of the national GDP and 51.8 percent of the agriculture sector which is more than the crop segment’s contribution (Government of

Pakistan, 2009). Livestock, in Pakistan, has grown at a rate of 3.7 percent over the past few years; where buffalo and cattle are the major dairy animals sharing maximum milk production to meet the nutritional requirements of the ever growing human population of the country. The livestock population of buffaloes and cattle in Pakistan is 29.9 and 33.0 million, with Punjab's share being 65 percent and 49 percent respectively. There are five breeds of buffalo in Pakistan, Nili, Ravi, Nili-

Ravi, Kundhi and Azakhali (Khan, 2003; Bilal et al., 2006) along with some of the finest breeds of cattle (Bos indicus) viz., Sahiwal, Cholistani, Red Sindhi, Thari,

Bhagnari, Dhanni, Dajal, Rojhan, Lohani and Freesian x Sahiwal crosses that provide milk and meat (Shah, 1994; Aslam et al., 2002).

The climatic changes, inflation, globalization and changing nutritional patterns have lead to a significant increase in the consumption and demand of livestock products. Thus escalation of prices of value added dairy products has proved as an incentive for greater production in the livestock sector. The income of about 36 million people residing in rural areas depends solely on the livestock and dairy sector which serves as a major contributor generating income. So the livestock industry has come forward as a main substitute source of income

especially for those farmers possessing no land. Hence it is essential to boost the livestock sector by improving the quality and quantity of its products. In a developing country like Pakistan, fasciolosis is probably a major limiting factor as it affects productivity of buffaloes and cattle.

1.1 Fasciolosis

Fasciolosis is a vital food borne zoonotic disease resulting from Fasciola trematode parasites. The two types are widely distributed across the globe affecting humans as well as animals (Esteban et al., 1998; Torgerson and Claxton, 1999;

Spithill et al., 1999; Baig et al., 2005; Chen et al., 2006; Le et al., 2008; Mascoma,

2009). F. hepatica is found world wider and is prevalent in almost all temperate regions where sheep and other ruminants are raised. It originated in the European continent and gradually migrated to other continents (Boray, 1969). F. gigantica is restricted mainly to tropical areas such as Africa, South America, Southeast Asia,

Southern Europe and Hawaii and also in the former USSR (McCarthy and Moore,

2000). The two species of flukes show a wide distribution in African and Asian continents and have common characteristics.

Considering the worldwide spread, occurrence and zoonotic nature, fasciolosis has emerged as a major global and regional concern affecting all domestic animals and infection is most prevalent in regions with intensive sheep and cattle production (WHO, 2007, 2008).

1.2 Taxonomy and classification

Taxonomically Fasciola belongs to invertebrates and classification is presented as follows:

Kingdom: Animalia

Phylum: Platyhelminthes

Class: Trematoda

Order: Digenea

Family: Fasciolidea

Genus: Fasciola

Species: Fasciola hepatica; Linnaeus, 1758 and

Fasciola gigantica; Cobbold, 1856

The adult mature and gravid fluke is flat with its body shaped like a leaf.

The size range is 25 to 30 mm and 8 to 15 mm in length and width respectively, depending upon the species. The adult parasitizes the liver/or gallbladder of the final hosts (Despommier and Karapelou, 1987; Andrews and Dalton, 1999). The fluke has an elongated anterior end known as a cephalic cone in which has an oral and ventral sucker. The intestines are highly branched and present throughout the body. The male and female reproductive organs are present near the posterior sucker in the centre of the body. The female reproductive tract is a dense ovary and is located just above the testes and is linked to a short convoluted uterus that opens in to a genital pore above the ventral sucker. The vitellaria are highly dispersed and divided in the lateral and posterior region of the body. F. gigantica and F. hepatica parasites are very similar to each other, varying in length and width. In addition, the cephalic cone of F. hepatica is shorter than F. gigantica. The shape of the eggs

of the two flukes is also very similar (Soulsby, 1982) with the measurements of F. hepatica and F. gigantica being approximately 150μm x 90μm and 200μm x 100

µm, respectively (Dunn, 1978).

1.3 Life cycle

The life cycle of Fasciola spp (Figure 1) consists of a wide range of final host, consisting of both, domestic and wild mammals (Reinhard, 1957; Boray,

1969). The final host is mainly a vertebrate, including a diverse group of herbivorous mammals, including cattle, buffalo, goat, sheep, horse, zebra, donkey and rabbit. Sometimes humans can also serve as an accidental host. Furthermore, infection has also been reported in birds (Vaughan, et al., 1997).

The intermediate hosts of liver flukes are hermaphroditic freshwater snail species, belonging to the Family Lymnaeidae (Gastropods: Basommatophora) inhabiting water bodies (Mascoma et al., 2005). The immature stages

(cercaria/metacercaria) are made available for definitive hosts or aquatic plants.

Humans and animals acquire infection by ingestion of aquatic plants (watercress, mint, spring water) that are contaminated with metacercariae (Markell and Voge,

1999; Rondelaud, 2000). Several species of aquatic plants in Europe have been considered as an infection source for human fasciolosis (Mascoma et al., 1999).

Furthermore, cercariae of Fasciola can float on water and encyst thus humans can

Figure 1: Life Cycle of Fasciola spp (Courtesy of Dr. Clive Bennett 1999)

Figure 2: Fasciola gigantica whole mount

become infected via metacercariae consumed with contaminated water (Chen and

Mott, 1990). An experimental study by Taira et al. (1997) suggested that humans consuming raw liver or semi-cooked liver dishes infected with juvenile flukes could easily be prone to infection.

1.4 Snail’s as intermediate hosts

The ecology of the snail intermediate host serves as a major contributing factor in the epidemiology of fasciolosis. The intermediate host for Fasciola is the freshwater snail of the genus Lymnaea (Bargues et al., 2001; 2003). In Europe,

Asia, Africa and North America F. hepatica is transmitted via Lymnaea truncatula; whereas in North America and in Australia L. bulimoides and L. tomentosa are the main intermediate fresh water snail hosts respectively. Other species like L. viator and L. diaphena transmit fasciolosis in South America and L. columnella in the

USA, Australia, Central America and New Zealand (Dunn, 1978; Soulsby, 1982;

Njau et al., 1989; Urquhart, 1996; Yilma and Malone, 1998). Fasciolosis in humans and animals in Brazil is mostly transmitted via Lymnaea columnella, which serves as the most important intermediate host (Coelho and Lima, 2003). Studies conducted in Indo-Pakistan and Malaysia identified L. rufescens, L. acuminate and

L. rubiginosa as intermediate hosts for Fasciola spp.

1.5 Fasciolosis status

Fasciolosis is an important disease among all the zoonotic helminthes worldwide (Haridy et al., 1999). The two liver fluke species infect a wide range of

mammal's especially cattle and sheep and therefore are considered of economic significance (Rolfe et al., 1997; Boray, 1997, 1999; Daniel and Mitchell, 2002), while humans are regarded as accidental hosts (Yamaguti, 1958; Mas-Coma et al.,

2005).

Fasciolosis is an up-and-coming threat among the list of parasitic infections in a large number of countries as a result of environmental changes and man-made modifications; occurring in areas where conditions are suitable for the survival of its intermediate hosts. It is mostly prevalent in countries having well-developed cattle and sheep production farming. Furthermore, human fasciolosis has also been reported in developing countries, except Western Europe (Mas-Coma et al., 1999).

In some advanced countries fasciolosis may persist up to 75 percent (Spithill et al.,

1998). Whereas in humid regions which are under developed, fasciolosis is considered to be the most prevalent infection in large ruminants prevailing up to 90 percent in Africa and Indonesia, ranging to an alarming 100 percent in India

(Spithill et al., 1999). Infection in humans occurs when they consume uncooked aquatic vegetables or drink fresh water contaminated with metacercariae/cercariae

(Mas-Coma et al., 1999).

1.6 Economic importance

The economic importance of fasciolosis in veterinary medicine is well established and considered as a significant limiting factor that affects the production potential in small and large ruminants. Fasciolosis results in economic losses in livestock appearing in the form of mortalities, reduced fertility, abortions, slow growth and reduction of milk and meat production, infected livers and

withered carcasses (Phiri et al., 2006). Fasciolosis in general, causes colossal economic losses of 200 million US$ annually to the agriculture budget (Ramajo et al., 2001). Apart from this it affects productivity of large ruminant’s world wide by causing up to 20 percent loss in body weight, decreased milk and beef production and decreased fertility in cattle (Torgerson and Claxton, 1999). Furthermore, detrimental effects of fasciolosis in sheep consist of reduction of weight gain and wool production as well as sudden deaths of animals (Sinclair, 1962; Roseby,

1970). Foreyt and Todd, (1976; 1982) considered fasciolosis as a major factor of liver condemnations and reduced feed intake resulting in reduced livestock productive efficiency.

In the United States cattle and sheep producers bear annual economic losses of $30,000,000, as a result of direct and indirect effects of fasciolosis. Direct losses are attributed to infected livers at slaughter (Malone, 1986). In England, the direct losses of 600,000 bovine livers represented approximately £1 million / $1.7 million

U.S loss (Haseeb et al., 2002). While, indirect losses include reductions in average daily weight gain and reduced milk yield (Rose, 1970; Hope-Cowerdy, et al., 1977;

Bell, 2005; Schweizer et al., 2005; Phiri et al., 2006), production in dairy cattle

(Randell and Bradley, 1980), and reduced herd performance in cow-calf operations

(Malone et al., 1982; Dargie, 1986). In France, Fasciola treated infected dairy cows enhanced conception rates by 23 percent (Mage, 1989). An infection of even thirty adult Fasciola affects the quality and quantity of wool growth in sheep

(Dargie, 1986; Clarkson, 1989). Animal productivity worldwide was affected by fasciolosis with an estimated loss ranging up to approximately US$3.2 billion per annum (Spithill et al., 1999).

1.7 Historical background

Fasciola is an ancient parasite coexisting with man and animal back to approximately 3,500 BC to 200 AD. History reports that literature Jean de Brie

(1379) described a "sheep liver rot" malady in France that affected sheep production and since then F. hepatica has been prevalent in all parts of the world.

The first sketch of an adult Fasciola isolated from a ram liver was made by

Francesco Redi in 1668 and. Then in 1698, in Hague a 34-page book was written and illustrated by Govard Bidloo, an anatomy professor, on the sheep liver fluke. In the sixteenth century, fasciolosis appeared in the form of an epidemic throughout

Europe, with the worst hit areas being Holland and Germany. The majority of infections occurred in animals that were pastured in the vicinity of areas that had stagnant water and poor drainage. Fasciola hepatica was identified in 1758 by

Linnaeus. "Fasciola" in Latin means fillet or small bandage and "hepatica" meaning liver (Borror, 1971).

1.8 Human fasciolosis

Bouchet et al. (2003) reported that Fasciola existed in prehistoric human populations of the Stone Age, an era of agricultural development that lead to domestic utility of animals. The first record of human fasciolosis infection was found in a female patient during an autopsy preformed by Pallas in 1760 in Berlin

(Dittmar and Teegen 2003). Since 1950, human fasciolosis has been reported from

61 countries. According to a report by the WHO (1995) fasciolosis has been reported in 8 different countries where approximately 180 million people are at risk of infection and 2.4 million are estimated to be infected. F. hepatica is considered

to be more adapted to the human host than F. gigantica. The report also states that human disease due to the latter has been reported in comparatively few geographical areas. Human coprolites have been examined for Fasciola eggs and their presence suggests that fasciolosis was common in prehistoric humans

(Aspock et al., 1999; Dittmar and Teegen, 2006).

The geographical distribution pattern shows that human fasciolosis is highest in South America (Bolivia, Peru and Chile), followed by Europe, Africa, and Asia, with the fewest cases being reported in Oceania (New Zealand, Australia and Philippines). Recent research has shown human fasciolosis (HF) as a major health hazard in several areas globally including the Nile Delta in Egypt and central

Vietnam (Lotfy and Hillyer, 2003; 2008; Lotfy et al 2008). The most prevalent (72-

100 percent) human fasciolosis is most common in the Bolivian Altiplano infecting more than 300,000 humans are infected (Hillyer and Apt, 1997; Esteban et al.,

1999; Mascoma et al., 1999). However, in other countries fasciolosis is more common in animals (Chen and Mott, 1990; Esteban et al., 1998).

The WHO reported that 2.4 million people are infected with Fasciola, and about 180 million may be exposed to infection (Okewole et al., 2000; WHO,

2000). Whereas McCarthy and Moore (2000) indicated infection in 40 million people by this trematode parasite. The infection was limited in the past to specific and typical geographical areas, where animal to human transmission was common, but recently a few human outbreaks have been recorded due to human-to-human transmission in South America, which was attributed to watercress consumption

(WHO 2007).

1.9 Animal Fasciolosis

The earliest appearance of Fasciola hepatica in animals dates back to the

Roman Iron Age. This was discovered during an excavation undertaken (1996-

1999) in a valley in Central Germany. The excavation was carried out in a graveyard containing skeletons of horses, cattle and humans. Eggs similar to F. hepatica were present in soil samples taken from the pelvic area of a single human skeleton and a bovine. Snail shells belonging to the genus Lymnaea were also recovered from the excavation area (Dittmar and Teegen, 2003). Eggs belonging to Liver fluke have been found in many paleo-parasitological studies carried out in the old world but not in the New World continents which clearly indicates that fasciolosis has been introduced in America recently (Gonzalves et al., 2002).

1.10 Pathogenesis and pathology

When the encysted metacercariae is ingested by an herbivore it excysts in the intestinal lumen, and migrates to the liver. The immature fluke feeds on the parenchymal cells destroying hence resulting in widespread hemorrhage. Growth is slow and adults reside in the bile ducts, sexual maturity is achieved in 2 months.

The fluke is hermaphroditic, and thus fertilization and cross fertilization occurs within host. There are two phases of infection, the parenchymal or migratory phase and the biliary phase. The former condition represents the penetration of the juvenile flukes into the intestinal wall and the invasion of the abdominal organs.

Fasciola possess affinity for the liver tissue (Dubinský, 1993; Behm and Sangster,

1999). Occasionally, liver flukes occupy some organs in other locations in the body

resulting in ectopic infection (Boray, 1969; Chen and Mott, 1990). During fluke migration mechanical destruction of the tissues occurs which leads to inflammation surrounding the migratory tracks. When they come across the infected bile ducts the parasite matures and produces eggs. This is termed as the biliary phase which results in hyperplasia of the bile duct.

The eggs of flukes are un-embryonated and are released after several weeks of development of the parasite. These eggs are passed from bile ducts into the intestines and are defecated. The development of the egg is completed after it is deposited in freshwater and hatches after approximately two weeks when environmental conditions are favorable. Low temperatures may cause delayed development. The newly hatched ciliated miracidium swims actively and tries to find a suitable snail host to penetrate and start development by asexual reproduction. Inside the snail the miracidia are transformed into the sporocyst, and then into rediae. The individual redia gives rise to numerous cercariae, which are motile and break through the snail body tissue into the water. They finally find aquatic plants upon which they encyst and are known as metacercariae, they are not affected by slight changes in environmental conditions.

The signs and symptoms of fasciolosis depend upon the intensity of infection, which signifies the number of metacercariae ingested by the animal. In sheep and cattle, clinical presentation is divided into 4 types (Dubinský, 1993;

Behm and Sangster, 1999). Acute Type I Fasciolosis occurs when the animal ingests more than 5000 metacercariae, which may lead to its sudden death, without showing any previous clinical signs. The common signs are ascites, weakness and

extensive abdominal hemorrhage. In Acute Type II Fasciolosis infection occurs as a result of the ingestion of 1000-5000 metacercariae. In this case the animal dies by showing signs of pallor, loss of condition and ascites. Sub acute Fasciolosis occurs due to the ingestion of 800-1000 metacercariae. The animal becomes weak, anemic and weight loss may occur resulting in death of the animal. Chronic Fasciolosis occurs when 200-800 metacercariae are ingested. This is prolonged and does not have clear key symptoms except for gradual weight loss (Behm and Sangster,

1999).

Sykes et al. (1980) and Anderson et al. (1981) reports that since fasciolosis is a disease affecting the liver, therefore liver enzymes such as glutamate dehydrogenase (GLDH), gamma-glutamyl transferase (GGT), and lactate dehydrogenase (LDH) are elevated, and occur from three months after the ingestion of metacercariae. A secondary infection by Clostridium bacteria (C. novyi type B) may occur in the damaged liver tissue of sheep and cattle, also known as

"black disease", which may result in death (Doyle, 1973; Haroun and Hillyer,

1986).

Resistance to infection also develops as the infection persists. In order to develop a vaccine against the parasite an immune response to Fasciola is important to be studied. For this purpose any mechanism of resistance of fasciolosis has to be studied in different animal species which will provide a better understanding

(Haroun and Hillyer, 1986). Resistance to fasciolosis is an important aspect in sheep and goats (Roberts et al., 1997; Milligen et al. 1998; Moreno et al. 1998).

Resistance in humans has so far not been reported.

1.11 Diagnosis in humans

Fasciolosis in humans is diagnosed by finding eggs in feces egg counts and by immunodiagnosis (ELISA and Western blot). This method of coprological examinations may not be sufficient to identify infections; therefore, immunonological methods have to be relied upon for early and prompt diagnosis

(Martinez-Moreno et al., 1997; Hillyer, 1988; O'Neill et al., in 1998; Hillyer,

1999). Less frequent diagnosis based on detection of antigens in sera or in feces has also been used. Investigations based on biochemical and hematological examinations of blood are helpful in diagnosing fasciolosis. Sometimes a condition known as pseudo-fasciolosis or false fasciolosis may exist due to eggs observed in the feces, as a result of recent ingestion of infected livers containing eggs and not from an actual infection (Hillyer, 1999).

1.12 Diagnosis in animals

In animals, diagnosis is mostly done through coprology and immunology but other factors like clinical signs, biochemical and hematological profiles can be taken in to account (Torgerson and Claxton, 1999). Coprological examinations are not that reliable in animals or in humans. In spite of this egg count is still commonly used, however, it is not useful until about 8-10 weeks post infection.

Immunodiagnosis provides early detection of fasciolosis within a month of infection (Zimmerman et al., 1982; Duménigo et al., 2000).

1.13 Treatment and prevention

Anthelmintics are used to treat and prevent fasciolosis. The safest and most effective drug used in humans is triclabendazole (Savioli et al., 1999; Ishii et al.,

2002), while nitazoxanide was used in Mexico (Rossignol et al., 1998). Bithionol has also been used in treating F. hepatica infection. No drug alternatives are available for humans.

Prevention of human fasciolosis can be undertaken by avoiding the consumption of aquatic plants containing metacercariae especially in high incidence areas (Mas-Coma., et al 1995; 2004a).

The drugs have used to control animal fasciolosis among are halogenated phenols, salicylanilides, benzimidazoles, phenoxyalkanes and praziquantel or triclabendazole, the latter is the most effective drug (Overend and Bowen, 1995;

O’Brien, 1998; Mitchell et al., 1998; Fairweather and Boray, 1999). Constant use of these drugs may result in resistance (Moll et al., 2000). Recently, a new fasciolicide called 'Compound Alpha', chemically similar to triclabendazole was introduced (Ibarra et al., 2004).

1.14 Study rationale

In Pakistan, the prevalence of fasciolosis has been reported in different provinces (Kendall, 1954, 1965). The results of previous studies were based on morphology, incidence or worm populations originating from wider areas rather than exact area. A comprehensive epidemiological study has not previously been conducted in any of Pakistan's agro-ecological zones especially in Potohar region, where the presence of widespread water bodies encourages the survival and

transmission of metacercarial infective stages to its ultimate host(s). At the moment epidemiological information about fasciolosis in Punjab is scarce, nevertheless, the epidemiological research data from other countries is available and provides a source of information and help, but unfortunately these procedures cannot be applied to our local conditions. Climatic changes have taken place in Pakistan which has affected the occurrence of fasciolosis. It is therefore necessary to evaluate the epidemiological pattern of fasciolosis in Potohar region, where large ruminants are of economical importance especially to the farmers who raise buffalo and cattle to earn their livelihood and thus contribute significantly to the national economy. In Potohar region, the agro-climatic conditions are particularly favorable for development and survival of various fresh water snail species serving as an intermediate host. It is therefore necessary to have updated information of the prevailing scenario to assess the epidemiology of fasciolosis in Potohar region,

Pakistan.

The proposed hypothesis of the present study is:

"Genetic Variation and Epidemiological patterns of Fasciola spp are associated with agro-ecological zones of Potohar region, Pakistan"

Keeping in view the above hypothesis the aims and objectives of the present study were:

 Morphological characterization and identification of Fasciola spp in

Potohar region, Pakistan.

 Identification and characterization of Fasciola by using PCR based gene

specific primers and cloning of the ribosomal DNA internal transcribed

spacer (r DNA ITS-1 and ITS-2) regions of nuclear ribosomal genes and

their sequence comparison.

 To study the phylogenetic diversity in Fasciola by using microsatellite

markers.

 To study the sero-prevalence of fasciolosis in bovines grazed in Potohar

region, Pakistan by applying indirect ELISA technique.

 To study the availability of cercariae / metacercariae (Infective stages) of

Fasciola spp on herbage with special reference to freshwater snail fauna of

Potohar region, Pakistan.

Chapter 2

REVIEW OF LITERATURE

Fasciolosis menace has been recognized across the world by veterinarians and research scientists who have drawn attention to uncover its biology and economical significance in the livestock sector. As a result, extensive studies have been conducted to gather a plethora of literature on different aspects of morphology and epidemiology of Fasciola spp. It is important to know the species of Fasciola, in our region, as the pathology and epidemiology may vary (Mas-Coma et al.,

2005; Soliman, 2008)

2.1 Fasciolosis in Pakistan

In Pakistan, earlier fasciolosis studies were focused on the occurrence of the disease in various regions. In Jhelum valley (AJK), sheep and goats were found to be infected with a variety of parasites from July to August. Among these, fasciolosis (73.2 percent) was most prevalent (Hashmi and Muneer, 1981). In

Baluchistan province, Naseer Ahmed (1984) concluded five million sheep and goats were suffering from fasciolosis. Similarly, domesticated animals in Sindh province revealed heavy infection of F. hepatica and F. gigantica. Moreover, F. gigantica was reported at high altitudes in N.W.F.P province; whereas F. hepatica occurred in deltoic regions of Punjab and Sindh provinces, Pakistan (Bureiro et al.,

1984). Similar, findings were previously reported by Kendall (1954). In Faisalabad

district (Central Punjab), overall prevalence of fasciolosis was found to be 17.55 percent, of which F. gigantica contributed 9.83 percent, F. hepatica 5.7 percent.

However mixed infection was revealed in 2.02 percent animals (Hayat et al.,

1986). The biological and geo-climatic conditions played a significant role on the epidemiological pattern of fasciolosis (Sheikh et al., 1984) and it was concluded that water reservoirs and vegetation play an important role on the growth and propagation of snails. Furthermore, in Sindh province, F. gigantica was found to be the sole trematode parasite accountable for the onset of fasciolosis.

In Punjab province fasciolosis has been reported in all of its areas which are favorable for the development and survival of metacercariae and freshwater snails acting as their intermediate hosts. The greatest prevalence was reported in large ruminants (25.3 percent) followed by small ruminants (12.9 percent) and camels

(10.7 percent). Moreover, low lying, swampy areas were heavily infested with

Lymnaea acuminate a potential intermediate host of Fasciola spp (Sheikh, 1984).

In southern Punjab, liver fluke is considered as a constant threat to livestock development programs, especially in the waterlogged area, that generate an ideal condition for snail propagation (Chaudhry and Niaz, 1984). The incidence of fasciolosis, in Sargodha division (Central Punjab), showed that prevalence was highest in small and large ruminants during spring as compared to summer and winter seasons (Malik, 1984). In Multan division (Southern Punjab) highest infection was reported in buffalo during winter season (Masud and Majid, 1984).

The prevalence of F. hepatica in sheep was widespread, as compared to F. gigantica (Saleem et al., 1986). In Central Punjab, Afzal et al. (1995), in Kajli

sheep and Afzal et al. (1997) in goats investigated the seasonal outbreak of fasciolosis and concluded that the acute phase was associated with the occurrence of freshwater snails living in stagnant water near grazing area. Anwar and

Chaudhry (1984) conducted a surveillance study in Faisalabad (Central Punjab) and found that 58.5 percent of goats and sheep were infected. The overall prevalence of fasciolosis in Rawalpindi division (Potohar region) was reported to be 37.53 percent and 31.74 percent in buffalo and cattle, respectively (Khan et al.,

1991).

A study in different districts of Punjab by Maqbool et al. (2002) revealed the epidemiology of fasciolosis, which was highest in buffaloes maintained on livestock farms, followed by slaughterhouse buffaloes, veterinary hospitals and household buffaloes respectively. The seasonal pattern showed that frequency rate was highest in autumn followed by spring, winter and summer seasons. Overall

Fasciola hepatica was reported to be 28.75 percent, more prevalent in Teddy

(42.10 percent) than in Nachi breed (16.67 percent) of goat in southern Punjab,

Pakistan (Tasawar et al., 2007). Furthermore, a significant relationship of fasciolosis was observed in relation to age and body weights of the host. It was noted that the highest prevalence of fasciolosis occurred in animal groups 13-24 months (35.71 percent) as compared to greater than 36 month of age (18.18 percent). The biochemical changes in livers of bovines infected with fasciolosis in

Sindh province was determined by Sheikh et al. (2007) where the total protein and lipid content in the livers were significantly higher in infected than in control animals, while there was no change in total carbohydrate content. The prevalence

and treatment of fasciolosis in bovines from Punjab was observed by Khan et al.

(2008), through coprological analysis.

The prevalence of F. hepatica infection was highest in dairy animals reared in milk producing areas of Punjab (Pakistan) and control strategy using proper anthelmintic treatment were suggested (Iqbal et al., 2007). In another study by

Khan et al., (2009), the prevalence of bovine fasciolosis was found to be 25.46 percent in five districts of Punjab Province, with F. gigantica (22.40 percent) higher than F. hepatica (3.06 percent). The highest prevalence of fasciolosis was in the following order; winter (39.08 percent), spring (29.50 percent), autumn (20.33 percent) and summer (12.92 percent), respectively and was commonly present in the districts of Sargodha (40.31 percent) and occasionally in Layyah (11.77 percent). Buffaloes (30.50 percent) showed more infection compared to cattle

(20.42 percent).

The epidemiology of human fasciolosis was conducted out by Qureshi et al.

(2005), in six different rural areas of Lahore, in which feces of humans were investigated for presence of eggs. The study revealed an overall infection of 0.31 percent, with the greatest prevalence in August and January (0.667 percent) and lowest in March (0.0 percent). Furthermore, the highest infection rate was in summer (0.42 percent) followed by winter (0.33 percent), and the lowest in spring and autumn (0.167 percent) seasons. Female hosts were more prone to infection

(0.30 percent) as compared to males (0.28 percent) and all infected persons were below 20 years of age.

Salam et al. (2009) compared four different diagnostic tests viz., Direct

Smear (DS), Agar gel precipitation (AGP), Sedimentation (Sd), and Zinc Sulfate

(ZnSO4) flotation, for diagnosing fasciolosis in dairy buffaloes, through fecal analysis. The conclusion was that diagnosis by using ZnSO4 was the most precise followed by Sd and AGP, while AGP was the best technique for timely diagnosis.

The efficacy of different fasciolicides in buffalo was conducted by Maqbool and Irfan (1983). Infected animals were treated with various anthelmintics, and oxyclozanide was found to be most effective. Similarly, the comparative efficacy of oxyclozanide, nitroxynil and hexachlorophene (anti-fasciolitic drugs) were conducted by Ahmed et al. (1985) in sheep and again the best efficacy was oxyclozanide. Maqbool et al. (2002) carried out a study to highlight the effectiveness of ethno-veterinary plant extracts viz., Nigella sativa, Fumaria parviflora, Caesalpinia crista and Saussurea lapp with triclabendazole to treat fasciolosis in buffaloes. It was concluded that Triclabendazole and Fumaria parviflora were most effective followed by Caesalpinia crista and Nigella sativa whereas Saussurea lappa showed the least anthelmintic activity.

2.2 Morphometry

Due to species overlap it is difficult to identify the prevalent species accountable for infection in these areas, as the distribution patterns of both

Fasciola spp overlap (Lotfy and Hillyer, 2003). This may be a reason that

infections diagnosed due to F. gigantica are less compared to F. hepatica (Marcilla et al., 2002).

The three species of Fasciola (F. hepatica, F. gigantica, with intermediate forms) are morphometrically very similar to each (Srimuzipo et al., 2000; Terasaki et al., 2000). Earlier morphometric studies on adult flukes or their eggs were used to identify the different species. These were isolated from various domesticated animal hosts (Bergeon and Laurent, 1970).

Valero et al. (2005) and Periago et al. (2006) used the computer image analysis system (CIAS) technique to measure the variations in morphometry between different populations of Fasciola. Previously this technique was performed on morphometry of both pure species of Fasciola adults in cattle from different regions (Valero et al., 2001; Valero et al., 2002). In Egypt (African region), Periago et al. (2006) used the CIAS technique to investigate inter and intra specific morphological diversity by analyzing specific morphological characteristics. Ashrafi et al. (2006) concluded that among various morphometrical parameters like VS-P, BL/BW, pharynx and oral sucker size can serve as a valuable taxonomic feature for species differentiation by using CIAS technique.

Moreover, Lotfy et al. (2002) reported that fluke length, testes length and length of the area behind the testes were the most striking dimensions to discriminate the two species.

Morphologic, morphoanatomic and morphometric information can certainly differentiate between species; however these approaches are inapplicable when the

intermediate form is involved. Therefore, in such cases the soluble protein isoelectric focusing (IEF) method has been considered as a useful tool for differentiating two species (Lee and Zimmerman, 1992; Lotfy et al., 2002). In endemic areas, where there was overlapping of the two Fasciola species, the molecular markers provided a better tool for species differentiation (Le et al.,

2008).

Specific differentiation of various species can only be made by a morphological study of adult flukes and by using molecular tools (Periago, 2008).

In general fasciolids can be differentiated by morphometric techniques (Ashrafi et al., 2006), but flukes with intermediate characters can cause misunderstanding

(Itagaki et al., 2005a, b). Especially in local areas, the existence of two species may result in hybrids through crossbreeding (Lotfy and Hiller, 2003). This phenomenon has lead to necessitate the use of molecular methods to recognize the existing species (Semyenova et al., 2003, 2005, 2006; Lin et al., 2007; Le et al., 2008).

2.3 Molecular markers

Genomic studies were very useful to explore the epidemiology, genetic variation and diagnosis of fasciolids (Mas-Coma et al., 2005). Recent applications in molecular biology, particularly; amplification of specific DNA regions and direct sequencing has allowed the differentiation of closely related species.

Previous findings have revealed that the sequences of ITS-1 and ITS-2 of r DNA are dependable genetic markers. Due to its highly repeated and conserved regions the nuclear ribosomal DNA is especially designed for molecular studies (Hillis and

Dixon 1991; Luton et al., 1992; Adlard et al., 1993; Bowles et al., 1995; Gasser and Chilton, 1995; Jousson et al., 1998; 1998 a; 1998b).) This region ranges from

18S, 5.8S, and 28S coding regions, have been used for species recognition (1995;

Leon-Regagnon et al., 1999; Kostadinova et al., 2003; Tandon et al., 2007; Prasad et al., 2008).

Similar studies based on ITS-2 sequences of fasciolids were conducted in different Asian countries for species differentiation (Hashimoto et al., 1997; Itagaki and Tsutsumi 1998; Agatsuma et al., 2000; Huang et al., 2004). Huang et al.

(2004), genetically characterized fasciolids originating from different hosts and regions of China. Alasaad et al. (2007) characterized, Spanish Fasciola isolated from a variety of hosts from various geographical zones of Spain by using

ITS1/ITS2 sequences of rDNA and finally concluded that that all Spanish Fasciola were F.hepatica.

Prasad et al. (2008) in Assam (India) tried to establish the phylogenic location of Fasciola spp by using ITS rDNA molecular data and relevant NCBI databases were compared with these sequences and phylogenetic trees were constructed which revealed a similarity between Indian isolates with F. gigantica isolates from some Asian and African countries. The significant relationship was shown with the Chinese isolate with significant bootstrap values.

Le et al. (2008) identified intermediate or hybrid forms of liver flukes from humans in Vietnam; using ribosomal DNA as well as mitochondrial markers (cox1,

and nad1). Phylogeny using Parsimony was done to compare species-of-origin which concluded that ITS2 sequences of Vietnamese resemble F. gigantica or F. hepatica, whereas all mitochondrial sequences were similar to F. gigantica only.

Erensoy et al. (2009) confirmed the occurrence F.hepatica in Turkish sheep by using ITS2 marker and its comparison with all three species of Fasciola, with help of the GenBank program Blast. The MEGA programme used in Phylogeny tree-building showed a close relationship of Turkish species with three different isolates in China. Human fasciolosis is considered as an important zoonotic disease in Vietnam by the World Health Organization (WHO, 2007).

Lotfy et al. (2008) carried out a study on molecular phylogenetic of fasciolids based on their origin, diversity and geographical location by using the

28S, region of nuclear rDNA, and mitochondrial nicotinamide dehydrogenase subunit 1 (nad1) sequences of different fasciolid species. The study concluded that liver flukes migrated from Africa to Eurasia and than back to Africa, switching over their intermediate host from a planorbid to a lymnaeid. There was also an addition of another definitive host (human) and a change in habitat, intestinal to hepatic within mammals.

2.4 SSR markers

Microsatellite markers, also known as simple sequence repeats (SSR's), these markers are most useful and commonly used amongst the different classes of molecular markers. These are DNA sequences repeatedly present in the genome of

Eukaryotes (Philips et al., 2001) as well as Prokaryotes (Varshney, 2004) and in bacterial genomes (Gur-Arie et al., 2000). According to Bruford et al. (1996) and

Turnpenny and Ellard (2005) SSR's are short repetitive DNA sequences of 1-6 base pairs that are distributed through the whole genome and are highly polymorphic and flanked by highly conserved sequences that varies in species and chromosomes, both in non-coding DNA and protein-encoding DNA (Toth et al.,

2000). Metzgar et al. (2000) suggests that SSR's are present in large numbers in non-coding regions in eukaryotic organisms. Gupta and Varshney (2000) suggest that frequency of microsatellites is higher in transcribed regions, especially in untranslated regions (UTR's)

Yeast and vertebrate genomes possess a large number of these sequences

(Hamada et al., 1982; Tautz and Renz, 1984). Chistiakov et al. (2006) hybridized and reported different microsatellite sequences from a variety of organisms. Earlier repetitive DNA was termed as "junk" DNA due to its function being unknown.

SSR-based markers have been commonly used to investigate diversity in a species and hence make it an important research tool (Varshney, 2002; Rudd, 2003). These markers are used as tools for techniques like genotyping, genetic mapping, medical genetics, forensics, positional cloning of genes, phylogeny, evolutionary biology and in oncology research.

Utility of microsatellites as molecular markers in genome characterization and mapping is due to their small size 92-6 base pairs and they can be generated by amplifying and can be analyzed by PCR, whereas electrophoresis can be used for

easy assessment. Developing SSR's is actually a laborious and time consuming process and steps in development limits their use in diversity evaluation. There are two general strategies for establishing SSR markers which include a search in the available data bases or their construction from the genome and establishing genomic or other libraries.

Microsatellites applications are most practical in those species which possess a low level of genetic variation among interbreeding populations

(Temnykh et al., 2000; 2001). Meuneir et al. (2001; 2004) suggested that an important aspect of fasciolosis epidemiology is to consider the colonization of existing snail species and genetic variability in the presence of high environmental parasitism pressure. Their study was to compare the genetic diversity in snail samples from Bolivian Altiplano with samples from France, Morocco, Spain and

Portugal. Isolation and identification of markers was done by Trouvé et al. (2000), in which several loci of snails were studied with some variation present.

Hurtrez-Bousses et al. (2001; 2004) isolated six microsatellite markers from

52 sample of F. hepatica from the Bolivian Altiplano, an area with a high fasciolosis rate. The study concluded that five microsatellite loci were polymorphic supporting the Hardy-Weinberg law of random mating. The considerable variability present proposes an interbreeding which is favorable for diversity. Their results showed no genetic differences existed in host species (sheep, cattle and pig).

It was also suggested that species diversity in the liver fluke should be considered while developing treatments and vaccines.

2.5 Cercariae / metacercariae (Infective stages) of Fasciola spp

Infection with Fasciola spp occurs when metacercariae are accidentally ingested along with herbage. The metacercariae excysts in the digestive tract and migrate to peritoneal cavity and the liver where adults mature in the biliary ducts.

The infected hosts release eggs, which are passed in the feces and develop into miracidia after hatching in water, between 2-4 weeks time, depending on temperature (Soliman, 2008). The different developmental stages of the Fasciola life cycle are directly related to environmental temperature, this includes miracidia in eggs and for sporocysts, rediae, and cercariae in snails. Miracidia infect fresh water snails, belonging to the Family Lymnaeidae, after which further development takes place from sporocysts to cercariae within two weeks, depending upon external temperature. The optimal temperature for development of miracidia is 24º-

26ºC, however Fasciola eggs are sensitive and can not survive in dry (desiccated) conditions particularly at higher temperatures (43ºC).

It is believed that the duration of metacercarial survival is inversely related to temperature and directly to the degree of moisture. Al Kubaisee and Altaif

(1989) reported that 27ºC was the optimal temperature required for cercarial development. It was also observed that larval development inside the snail becomes slower at lower temperature and ultimately ceases at <16ºC and as a result only a succession of daughter redial generations are produced. But as soon as the temperature increases to 20ºC the production of cercariae commenced and at an optimum temperature range (25ºC to 27ºC) maximum shedding occurred 46–50

days post infection (Asanji, 1988). Cercarial shedding occurs up to 15 waves

(usually three or fewer) one to eight days apart over a period of up to 50 days

(Dreyfuss and Rondelaud, 1994; 1995; Meunier et al., 2001; 2004).

The number of cercariae shed per snail usually ranges from one hundred to over a thousand. However, encysted cercariae (metacercariae) may survive a few months by attaching to a range of objects near the outer surface of the water body, and desiccation is fatal (Ueno and Yoshihara, 1974; 1975). Some may move with flowing water and are likely to become a contamination source in habitats unsuitable for snail survival (Dreyfuss and Rondelaud, 1997). In addition, metacercariae survival duration is directly proportional to humidity, and inversely proportional to temperature and exposure to sunlight. However, the impact of climatic changes appears to be more pronounced in trematodes and this is basically due to increased cercarial production in connection with environmental changes

(Mas-Coma et al., 2008).

Recently, Mascoma et al. (2009) reviewed the impact of climatic changes on different aspects of trematodiases. The factors taken into consideration were; temperature effects on yield, production, and variability of cercariae, influences of snail size, cercarial quality, duration of their production and host mortality influenced by global-warming. Earlier Boray (1969) in his studies mentioned that construction of dams and the prevailing new irrigation systems facilitated the distribution of Fasciola by generating more water bodies and the propagation of lymnaeid snails which serve as an intermediate host. This phenomenon introduced

the onset of fasciolosis in those regions (semi-arid and arid) of the world where it did not exist before.

Humans are accidental hosts of fasciolosis as they consume infected water or food (Bargues et al., 1996; Mas-Coma, 2004a). This can be easily controlled and prevented by avoiding contaminated water and food (Mas-Coma et al., 1995,

1999c; Mas- Coma, 2004a).

2.6 Snail fauna serving as an intermediate snail host(s)

The intermediate hosts of F. gigantica are tropical fresh water snails living in lucid, torpid or sluggish water with high oxygen content and plentiful aquatic vegetation at the periphery of rivers or lakes where level of water is constant. F. gigantica is transmitted worldwide by snails which cannot be identified on morphological or ecological basis. Irrigated rice fields throughout the humid tropics are most suitable for nurturing Lymnaea auricularia (Kendall, 1954, 1965).

Fresh water snails serve as intermediate hosts for most of the trematode parasites. The most important intermediate host for Fasciola spp is Lymnaeid snails (Bargues et al., 2001). The lifecycle of F. gigantica is essentially similar to that of F. hepatica (Mas-Coma and Bargues, 1997; Graczyk and Fried, 1999).

Fresh water snails other than the genus Lymnaea may also serve as intermediate hosts for many trematode diseases. Indoplanorbis exustus, a planorbid freshwater snail (host for Schistosoma dermatitis) was reported by Vaidya Nagabhushanm

(1978) to be commonly spread in various parts of India and Pakistan. Bellamya

bengalensis, freshwater gastropods serve as intermediate hosts for many blood and liver fluke parasites (Pande, 1935; Malek, 1974; Xiang et al., 1995; Ghobadi and

Farahnak, 2004). Besides fasciolosis, other snail transmitted diseases such as, schistosomiasis, paragonimiosis, clonorchiosis and fasciolopsis are also of national and international public health importance.

Malek (1980, 1985) emphasized that Lymnaeid snails transmitting F. gigantica are distinguishable from those transmitting F. hepatica, both morphologically and as to habitat requirement, while Dreyfuss and Rondeuland

(1997), emphasized the presence of ecological factors affecting snail populations like temperature, light, hydrogen ion concentration (pH), vegetation, depth of water, current of the water, chemical composition of the soil, and competition among snail population.

Malek (1980) and Soulsby (1982) stressed that when certain environmental conditions are changed, species of Fasciola can become adapted to new intermediate hosts as shown in the laboratory trials. He reported that in the Indian

Subcontinent, hosts of F. gigantica are L. auricularia; L .rufescens and L. acuminata. L. rubiginosa and L. natalensis are the hosts in Malaysia and Africa respectively; and the L. cailliaudi is the intermediate host in East Africa. The most important and widespread intermediate host in Europe, Asia, Africa and North

America of F. hepatica is L. truncatula.

Other Lymnaeids are L. euphratic in Iraq and L. auricularia in Oman. L. cailliaudi has been found responsible for transmission of both F. hepatica and F. gigantica (Farag et al., 1998). In Australia L. tomentosa (host of F. hepatica) was shown to be receptive to miracidia of F. gigantica from East Africa, Malaysia and

Indonesia.

Dar et al. (2002; 2003; 2004) reported that several snail species may contribute to the transmission of fasciolosis in Egypt among these are L. truncatula and L. cailliaudi, the main intermediate hosts in water bodies of the Nile Delta.

However, Radix natalensis is the essential intermediate host for F. gigantica based on field and experimental studies, while Galba truncatula was found naturally infected with F. gigantica. The detection of F. gigantica-like larval stages was detected in planorbids as Biomphalaria alexandrina in Egypt (Farag et al., 1993;

Farag and El-Sayad, 1995; Farag et al., 1998; El-Shazly et al., 2002). Results based on the broad information acquired over many decades through studies indicate a clear preference of F. hepatica for Galba and of F. gigantica for Radix

(Bargues et al., 2001; Bargues and Mas-Coma, 2005a)

Considerable work has been carried out on the systematics of mollusks world over; however very little work has been done in Pakistan. Khan and Dastagir

(1971) reported details of gastropod and bivalve fauna of East and West Pakistan but their work was confined to marine mollusks. Tirmizi (1973) also gave a brief taxonomic account of freshwater mollusks of Pakistan, in the Sindh and

Baluchistan region. Khatoon and Ali (1978) conducted a study on systematics of

freshwater mollusks of NWFP and Punjab, describing 16 species of gastropods and bivalves. Akhtar, (1978) reported 10 species of gastropods and 4 species of bivalves from water bodies of Lahore.

Buriro and Chaudhry (1981) investigated the incidence of lymnaeid snails and reported the occurrence of trematode cercariae. They reported five lymnaeid species, Lymnaea acuminate, L. rufescence, L. auricularia, L. luteola, L. amygdalus carrying Fasciola spp infection both in Sindh and Punjab province of

Pakistan. The most recent work conducted in Pakistan is that of Burdi et al. (2008), which were based on the ecology of freshwater gastropods of Indus River and its canals at Kotri barrage Sindh, Pakistan. This study indicated the presence of 7 genera and 10 species of gastropods, in which Bellamya bengalensis was the most dominant species. Existence of a strong positive correlation with temperature and a negative correlation with pH and hardness was also brought to light.

2.7 Coprological studies of fasciolosis

In order to treat and cure fasciolosis, chemotherapy must be initiated and for this purpose it is very important to identify fluke eggs shed with feces and the

FEC for positive diagnosis of the disease. Complete cure can also be achieved through chemotherapy, if timely and precise diagnosis of the infection is done.

The most common method of diagnosing liver fluke infection has been fecal egg counts (Happich and Boray, 1969). Although this procedure has been conducted for the past several decades, it has several drawbacks (Anderson et al.,

1999). F. gigantica infection diagnosed by fecal examination cannot be detected in the earlier stages of infection, and may show false negative rates even in persistent infection due to the presence of eggs in feces, especially in ectopic infection. In order to avoid this it is suggested that large volumes of feces need to be examined which requires a lot of labor, with a chance of misidentification of eggs of other parasites having similar morphology. FEC cannot diagnose ectopic fasciolosis, where development occurs in other tissues instead of liver. These hurdles urge the pathologist to study other diagnostic methods. To determine the prevalence of fasciolosis, feces have to be collected for fecal egg counts or liver examination for presence of liver flukes of infected animals is conducted in abattoirs. Both these techniques are not completely accurate. The fecal egg count method has a low sensitivity range and may give many false negatives results. Sothoeun et al. (2006) reported a 27 percent incidence of fasciolosis in animals with F. gigantica in their livers, though their fecal egg counts gave negative results.

Conceição et al. (2002) evaluated a coprological sedimentation method for quantification of egg shedding in bovine feces. They suggested that an increase in the sample from 10 to 30 g of feces is advisable in order to improve the diagnostic accuracy and sensitivity with this technique. On the other hand Kleiman et al.

(2005) compared the sensitivity and utility of two coprological methods; a standard fecal sedimentation method (FSM) and a modified stool sieving staining method

(FSSM), both currently employed for the diagnosis of Fasciola hepatica infection.

Their results confirmed that the commonly used FSM underestimates the

prevalence and the egg output in cattle and that the FSSM is a more reliable diagnostic method.

A study by Ashrafi et al. (2009) revealed that egg shedding pattern in humans is different than that of animals, also shows the size of F. hepatica eggs is smaller as compared to larger size of F. gigantica eggs whereas egg size in humans stool shows no clear difference. According to their study, direct coprological analysis is the most preferred diagnostic tool (WHO).

2.8 Sero-diagnosis of fasciolosis

Immunoassays have been the most accurate and sensitive tests for investigating fasciolosis. The concentration or presence of antibody in the serum of infected animal can successfully detect F. hepatica as early as 2-4 weeks after infection. This is an advantageous procedure which detects actively metabolizing flukes (Rodriguez-Perez and Hillyer, 1995; Itagaki et al., 1998). The diagnosis of fasciolosis in humans was reported by Espino and Finlay (1994) in which detection was done by estimating coproantigens using an ELISA in sheep experimentally infected with F.gigantica by sandwich ELISA. This technique was compared to an indirect ELISA which demonstrated that sandwich ELISA can also be successful in detecting Fasciola coproantigens even in the presence of immature fluke infections.

Recently diagnosing fasciolosis by immunoassays have been given importance. The ELISA test is simple, reliable and easily automated. Several

attempts have been done to isolate various antigens of Fasciola in order to make diagnosis more sensitive and specific.

Serology has the advantage of being able to indicate infection much earlier

(around 4–5 weeks) than coprological methods (Bürger, 1992; Estuningsih et al.,

2009). Serological techniques that use recombinant antigens have become more prevalent (Levieux, et al., 1992; Cornelissen, et al., 2001), hence antibody detection is most precise and accurate and occurs much earlier, about two weeks post-infection (Santiago and Hillyer, 1988).

A study was performed by (Rachiel, 2002) in which a commercially available ELISA kit was used which analyzed serum from experimentally infected and non-infected large and small ruminants. This test was extremely sensitive and specific, particularly in the case of cattle, with a clear discrimination between negative and positive populations. Thus, liver fluke infection was detectable 7–8 weeks earlier than otherwise possible with traditional, coprological techniques and with higher sensitivity. They further stressed that F. hepatica infection was indicated in the initial stages, using the current parasitological techniques. This will help in the control of fasciolosis, enabling treatment before the disease symptoms appear.

Recently Awad et al. (2009) compared three different F. gigantica antigens which were crude worm antigen (Fg-Cr), excretory-secretory antigen (Fg-ES) and glutathione S- transferase antigen (Fg- GST). These tests assessed the efficiency of

ELISA for the diagnosis of F. gigantica infection in cattle, sheep and donkeys. It was concluded that, Fg-ES Ag had the highest efficiency and could serve as a reliable serodiagnostic test.

Recent work has indicated hope regarding the scenario for development of effective vaccines for the control of fasciolosis. Results presented show it was possible to induce protection levels against F. gigantica in goats using crude and purified antigens and that it not only reduced fluke burdens, but also produced smaller flukes, fewer eggs and less liver pathology. Moreover, these studies demonstrated that a vaccine against F. gigantica in goats could be developed using purified glutathione S- transferase (GST) antigen. This induced significant reductions in fluke burden and fecundity in vaccinated animals, with striking differences in effects observed in different animal species. Gonenc et al. (2004) devised a study in which crude antigen was compared with excretory/secretory antigens for the diagnosis of fasciolosis in small ruminants. Identification of protein bands of Fasciola hepatica crude and excretory/secretory (E/S) antigens were analyzed by Western blotting by SDS-PAGE. This method showed it is possible to find out the specificity and sensitivity in immunodiagnosis of infection in sheep.

Diagnosis of human fasciolosis has been conducted via various serodiagnostic techniques such as immunofluorescent assay (IFA), indirect hemagglutination (IHA), enzyme-linked immunosorbent assay (ELISA) and Dot-

ELISA. Among these ELISA is highly sensitive and specific as compared to IFA

and IHA. The ELISA technique has some shortcomings, like the use of a spectrophotometer, while Dot-ELISA does not require one.

Studies on human fasciolosis conducted by Dalimi et al. (2005) evaluated the partially purified fraction antigen (PPF) of Fasciola gigantica isolates from small ruminants. Efficiency performance of Micro-ELISA and Dot-ELISA was compared, which lead to conclude that the Dot-ELISA technique using PPF antigen has all the qualities of a good immunoassay and can diagnose fasciolosis in humans accurately and efficiently. It is sensitive, specific, rapid and inexpensive.

There are many studies which suggest that a 27- kDa glycoprotein is an immunodominant antigen in adult F gigantica The dot- ELISA was a precise, responsive and simple method for the rapid diagnosis of fasciolosis, chiefly when there was a dearth of complex laboratory tests (Intapan, 2003; Wolstenholme et al.,

2004; De Almeida et al., 2007).

Similarly the process of isolating the 27-kDa glycoprotein of Fasciola gigantica was standardized by Kumar et al. (2008) in which the diagnostic potential of fasciolosis in native buffaloes was evaluated by an immunosorbent assay. Salimi-Bejestani et al. (2004) developed an ELISA for the detection of F. hepatica antibody in the serum of cattle. The diagnostics was also compared and evaluated against a commercially available Bio-X bovine F. hepatica ELISA kit.

Meshgi (2007) conducted a study to compare electrophoretic patterns of somatic and excretory-secretary antigens of F. hepatica and F. gigantica by protein

estimation with SDS-PAGE, the E/S and somatic antigens were prepared by incubation and homogenizing of adult flukes, respectively. The antigens were electrophoresed using SDS-PAGE. E/S proteins of F. hepatica and F. gigantica were compared.

2.9 Present Study

The studies executed in various parts of the world are helpful in understanding fasciolosis in Pakistan. Nevertheless, the epidemiology of fasciolosis is not clear in any areas of Pakistan especially in Potohar region. The existence of widespread water bodies has not only facilitated the development and survival of metacercariae (infective stages) of Fasciola spp., but also provides a basis for the propagation of freshwater snails serving as intermediate host(s). Epidemiological data from other countries will provide guide lines for this study but cannot solve all the problems of disease control, whereas the conclusion drawn from this study will be applicable to the prevailing limited conditions.

This present study is unique in a sense that no such type of study has previously been reported to genetically characterize existing Fasciola spp. based on morphometrical characters especially in Potohar region, Punjab, Pakistan. This study is an important step toward developing effective control strategy based on its occurrence. Furthermore, it may also facilitate the design of effective drugs to control fasciolosis in Potohar region. Confirmation of morphometrical results also is made based on PCR gene specific primers and cloning of ITS-1 and ITS-2 regions of nuclear ribosomal genes and their sequence comparison. The

phylogenetic diversity in Fasciola was also studied by using microsatellite markers. The identification of cercariae / metacercariae of Fasciola spp from herbage samples of Potohar region of Punjab and the snail fauna serving as an intermediate snail host(s) for Fasciola spp were also studied. Finally, an effective method to work out an early diagnosis by indirect ELISA and comparing with routine coprological examination was also taken into consideration.

Chapter 3

MORPHOLOGICAL CHARACTERIZATION AND

IDENTIFICATION OF FASCIOLA SPP IN POTOHAR

REGION, PAKISTAN

3.1. Introduction

This study was carried out in the Parasitology laboratory, Department of

Zoology, Pir Mehr Ali Shah, Arid Agriculture University; Rawalpindi, during

2007-2008.

Morphometrical studies on liver flukes have been conducted for the first time in Pakistan. The purpose of this study was to identify the fluke species responsible for fasciolosis in the Potohar region. The environmental conditions of the study areas are ideal for the survival of the snail intermediate host species which include the presence of numerous water bodies and mild temperature; conditions that encourage the propagation of snails and development of cercariae.

The presence of three types of Fasciola spp have been reported from various studies conducted in different parts of the world. The morphological data of all three was compared with the Fasciola available in Potohar.

Species identification in the present study was done by emphasizing BL,

BW, VS-P, VS-Vit indices and BL/BW ratios as suggested by previous studies

(Valero et al., 2001; Lotfy, et al., 2002 and Ashrafi et al., 2006). Periago et al.

(2008) proposed groups based on low to high range values of the morphometry of

F. hepatica, F. gigantica or Fasciola spp (intermediate/hybrid forms) from Egypt and Iran, whereas, Ashrafi et al. (2006) outlined some useful morphometric descriptions to differentiate between the two fasciolids.

The accuracy of morphometrical studies will prevail if the parasite is a pure species but if there are hybrids overlapping will result and morphometry will not be clear. The parasites used in this study were uniform in size and maturity and were subjected to morphometrical measurements based on twenty parameters. In general the fasciolids can be characterized on according to their morphology by morphometric techniques (Ashrafi et al., 2006), but flukes with intermediate morphological characteristics can cause confusion (Terasaki et al., 1982; Itagaki et al., 2005a).

In the present study emphasis was on the analysis of twenty morphometrical parameters, whose measurements were compared with all three types of Fasciola spp from Iran and Egypt. Past studies have outlined the five morphometrical parameters best used to categorize the three species and these were also taken into account.

The analysis of the results derived from the morphometrical measurements were subjected to SPSS 16.1 and cluster analysis was conducted. An ANOVA was used to find out the importance of the five parameters especially identified in

previous studies as the best differentiating tools. This was also subjected to cluster analysis. The morphometrical results of our Fasciola species indicate that liver fluke specimens from Potohar are not pure F. gigantica or F. hepatica, but an intermediate form of Fasciola spp which apparently looks more like F. gigantica.

Though morphometry is considered as a conventional method and is replaced by molecular methods with advancing research techniques, but it was of utmost importance for us to generate the basic data first and than move ahead.

3.2. Materials and Methods

3.2.1 Study Area Pakistan lies in South Asia East (latitude 30° 00 North and longitude 70º

00 East). The area of Pakistan comprises 803, 940 sq km of total land. The climate of this region is mostly hot and topography is based on vast arid region. Pakistan is surrounded by 1,046 kilometer coastline of the Arabian Sea on the Southern side and is bordered by Afghanistan and Iran in the west, India in the east and China in the far northeast (Figure 3).

The area under study lies in the Northern part of the Punjab province of

Pakistan and comprises of the Potohar region, lying between 32º - 30" N to 34º latitude and from 71º - 45" E to 73º - 45" E longitudes. It is the fifth largest region of Pakistan covering an area of about 13,000 square km comprised of 2.9 percent of the total area and encompassing 5.6 percent of the country's population. Potohar is situated at an elevation of 472.2 to 609.6 meter above sea level lying to the south of Pakistan's majestic northern mountain range (Kala Chitta Range and the

Margalla Hills). The salt range is present on the southern side with the River Indus on the west side and the River Jhelum on the east side.

3.2.2 Topography

Physiographically, Potohar region can be divided into two major units, the hilly area and the plane region. The landscape is comprised of broken topography characterised by twists and turns. The Potohar Plateau is one of the most densely populated areas of Punjab, Pakistan, comprised of Rawalpindi/Islamabad,

Chakwal, Attock and Jehlum districts (Figure 4). This area is barani or rain-fed and is mainly considered as pasture land with its common inhabitants being farmers that generally depend upon raising livestock.

3.2.3 Climate

The climate is typically semi-arid with agriculture being dependent largely on rainfall. Rain-fed areas of Potohar lie in semi-arid to sub-humid zone with hot summers and cold winters. Potohar plateau receives rainfall not only in winter but also large amount of rainfall during summer monsoon.

The range of total annual rainfall in Potohar plateau varies from 900 to

1900 mm, whereas, average annual rainfall is from 380 to 510 mm; being greatest in the northwest and declining in arid areas towards the south west. The mean maximum temperature is 38-40ºC in summer (July-September), while mean minimum temperature fluctuates between 0-1ºC in winter (January-February).

3.2.4 Sample collection

The adult/mature liver flukes used in this study were recovered from adult buffaloes and cattle of either sex, which were brought to slaughter at Sihala slaughterhouse, Rawalpindi during March 2005 to March 2008. This slaughterhouse receives bovines from all over Potohar region. The livers along with gall bladders including the bile duct were examined and the infected livers were removed from the diseased animals. The bile ducts were incised longitudinally through the gall bladder in to the liver and the parasites were removed with the help of fine forceps, taking all necessary precautions to avoid any damage to the parasite. The simplest way to differentiate between the two species is the length and body shape (Kendall, 1965).

Only adult flukes were used for sampling purposes from the collection, these were identified by the presence of numerous eggs in the uterus and characterized as gravid. F. gigantica like adults analyzed were recovered from fluke infected livers of 7 cattle (59 worms) and 12 buffaloes (124 worms). Each worm was washed separately 2-3 times in 0.9 percent saline solution to remove the debris. Fasciola samples were carried to the laboratory and were kept in 70 percent ethyl alcohol and stored at 4ºC for morphometrical study, and frozen at – 80ºC for genomic DNA extraction (molecular study).

Figure 3: Map of Pakistan showing Punjab province.

Punjab Province Potohar region

Figure 4: Map of Punjab showing Potohar region in grey and the study

area in white.

3.2.5 Morphometry

Morphometry was based on adult flukes found in livers of naturally infected adult bovines (cattle and buffaloes) of both sex groups. For a precise study all the flukes were mature and gravid, because previous studies indicated the importance of definitive host, which strongly influences the size of adult flukes and their eggs, especially when they reside in the liver and bile duct (Valero, et al., 2001; 2002;

Periago et al., 2006).

3.2.6 Staining of the flukes

The recovered flukes were thoroughly washed with distilled water to remove debris and contamination. Staining was done according to protocol suggested by Bukhary (1988), with slight modifications in dehydration time which related to thickness of specimen flukes (Appendix # 1).

3.2.7 Measurement techniques and data analyses

All morphological measurements of adults were made according to methods described for Fasciola by Valero et al. (1996, 2005) and Periago et al. (2006,

2008). The stained adult worms were examined under a dissecting microscope and dimensions of the body were assessed using a microscope and calibrated ocular micrometer (OSM-4, Olympus).

3.2.8 Morphometric measurement of adults

All the measurements were recorded in millimeters (mm) and include all the organs and ratios of body parts. The characteristics are described below and in

Figure 5.

3.2.9 Lineal biometric characters:

Length of body (BL), maximum width of body (BW), length of cone (CL), width of cone (CW), diameter of the oral sucker; maximum (OS max), diameter of the oral sucker; minimum (OS min), diameter of the ventral sucker maximum (VS max), diameter of the ventral sucker minimum (VS min), distance between the anterior end of the body and the ventral sucker (A-VS), distance between the oral sucker and the ventral sucker (OS-VS), distance between the ventral sucker and the union of the vitelline glands (VS-Vit), distance between the union of the vitelline glands and the posterior end of the body (Vit -P), distance between the ventral sucker and the posterior end of the body (VS-P), pharynx length (Ph L) and pharynx width (Ph W).

3.2.9.1 Areas:

Body area (BA), oral sucker area (OSA) and ventral sucker area (VSA);

BA was calculated as the product of BLxBW; OSA and VSA were calculated as the product of their diameters.

3.2.9.2 Ratios:

Body length over body width (BL/BW) and oral sucker area over ventral sucker area (OSA/VSA).

Figure 5: Standardized measurements in gravid fasciolid adults: (A) Fasciola

hepatica and (B) Fasciola gigantica (Periago et al., 2006).

Table 1: Table 1:

21.2-52.1 2.10-4.27

1.22-3.53 4.5-9.1 2.58-4.29

Body Length Body Cone Length Cone Oral Sucker Diameter of Diameter of Diameter of Oral Sucker Oral Distance bw Distance Body Width Body Cone Width Cone Diameter of : Comparative morphometric liver: hosted flukes dataof in 0.82±0.01 1.53±0.02 0.58±0.00 1.45±0.02 Pharynx Pharynx Pharynx Pharynx

OS max VS max Ventral Ventral Ventral Ventral OS min 0.36-1.14 VS min Length 0.64-1.25 1.15-2.31 Sucker Sucker 0.36-1.22 1.14-2.04 Width 0.55±0.01 (max) (max) 0.66±0.01 (min) (min) 153 2.76±0.03 5.84±0.09 PhW 2.71±0.05 34.46±0.51 PhL NO. CW BW CL BL BUF-PAK 0.34-1.44

33.89±0.76 Fasciola CAT-PAK 0.58±0.01 0.72±0.03 0.84±0.02 0.69±0.01 6.01±0.17 1.62±0.03 1.52±0.03 2.72±0.09 2.78±0.06 Egypt, extreme values, mean and standard deviat 0.31-1.12 0.31-1.11 20.1-41.3 0.61-1.22 1.12-3.51 1.06-2.01 2.0-3.07 1.12-2.10 0.31-1.08 2.13-3.09 54 4.1-8.99 sp. BOV-IRAN 39.45± 0.57 Fasciola Fasciola 0.47±0.004 0.82±0.01 0.90± 0.01 0.75± 0.01 5.41± 0.07 1.55±0.01 1.48± 0.01 3.21±0.02 3.30± 0.02 0.52-1.01 0.36-0.82 29.97-62.39 0.70-1.03 1.88-3.38 1.14-1.81 1.26-1.86 0.65-0.98 2.73-4.05 2.63-4.15 3.49-9.08 154 sp. BOV-IRAN Fasciola 21.46-36.41 28.84±0.38 0.44±0.01 F.gigantica 0.84±0.01 0.69±0.01 6.01±0.15 1.28±0.02 3.21±0.03 0.77±0.01 1.34±0.03 2.88±0.04 66 0.59-0.93 0.49-0.85 0.26-0.62 0.75-1.03 1.99-3.33 0.93-1.57 2.19-3.69 3.40-10.55 0.95-1.68 2.58-4.13 BOV-IRAN

11.47–30.02 21.76 ± 0.40 4.59–11.38 0.40 ± 0.01 0.76 ± 0.01 0.83 ± 0.01 0.66 ± 0.01 7.22 ± 0.12 1.11 ± 0.01 1.05 ± 0.01 2.53 ± 0.03 3.29 ± 0.04 0.46–0.95 0.36–0.88 0.28–0.57 0.65–0.95 1.70–3.02 0.80–1.24 1.63–3.48 0.90–1.26 2.14–4.13 121

sp. cattle and buffalo from Potohar (Pakistan) and bovines bovines Iranfrom a and (Pakistan) Potohar from buffalo and cattle ion. measurements All in millimetersare (mm). BOV-EGYPT 44.65± 1.15 35.25-48.71 0.50± 0.01 0.84± 0.02 0.95± 0.02 0.79 ±0.01 7.77± 0.29 1.53± 0.03 1.43± 0.02 3.16± 0.11 3.81 ±0.10 6.27-10,14 F.gigantica 0.75-0.94 0.72-0.88 0.45-0.59 0.84-1.05 2.44-3.39 1.26-1.52 2.61 -3.68 1.35-1.67 3.25-4.34 12 F.hepatica BVEYTBOV-EGYPT BOV-EGYPT Fasciola sp. 23.46-45.40 33.88± 33.88± 0.34 5.90-14.04 0.45± 0.45± 0.01 0.84± 0.84± 0.01 0.91± 0.91± 0.01 0.73± 0.73± 0.01 9.70± 9.70± 0.13 1.22± 1.22± 0.01 1.12± 1.12± 0.01 2.62± 2.62± 0.03 3.77± 3.77± 0.03 1.68-3.56 0.62-1.12 0.47-0.95 0.32-0.60 0.75-1.12 2.25 4.04 0.90-1.47 0.97-1.56 2.62-4.59 126 F.hepatica 15.48–28.71 23.73 ± 0.33 ± 23.73 8.21–14.27 0.42 ± 0.01 ± 0.42 0.79 ± 0.01 ± 0.79 0.86 ± 0.01 ± 0.86 0.70 ± 0.01 ± 0.70 10.54 ± 0.15 ± 10.54 1.14 ± 0.01 ± 1.14 1.04 ± 0.01 ± 1.04 2.23 ± 0.04 ± 2.23 3.18 ± 0.04 ± 3.18 82 0.58–1.02 0.45–0.89 0.32–0.55 0.69–1.01 0.82–1.37 1.36–2.98 0.97–1.49 2.05–3.99 2.01–3.52

10.5-29.5

interior end of

Of Vit glands Of VS and union

OSA to VSA VSA to OSA 19.10-44.81 5.00-16.90 body and VS and body Distance bw Distance bw Oral Sucker Oral Distance bw Distance Distance bw Distance Distance bw Distance

end of body of end end of body of end 0.22±0.00 Body Area BL to BW BL to BW OSA/VSA

10.93±0.22 30.71±0.48 6.01±0.09 posteror posteror

0.94-3.36 Vit-Post 1.65±0.04 19.79±0.35 VS-Post BL/BW Ventral Ventral Vit and VS and Sucker Sucker OS-VS VS-Vit 2.35±0.11 0.13-0.33 3.88-8.40 2.05-4.82 0.49-1.66 0.49±0.01 2.3±0.06 A-VS Ratio ratio Area Area OSA VSA 248±.9272±.9217.34±5.03 207.29±9.09 204.87±5.29 BA 18.51-41.60 19.3±0.56 30.37±0.75 11.1±0.33 4.90-16.70 5.78±0.15 0.52±0.03 0.21±0.00 2.42±0.19 1.75±0.08 3.37-8.01 1.71-4.60 0.45-1.16 0.12-0.32 0.91-3.3 10.1-28.0 2.51±0.12 189370 138.49-387.46 108.9-327.08 126.10- 369.00 26.39-54.49 34.08±0.54 8.18-25.46 5.74±0.07 2.31±0.03 0.67±0.01 0.29±0.004 2.60±0.02 1.85±0.02 20.05±0.35 13.96±0.25 3.81-8.41 1.44-3.35 0.43-0.99 0.20-0.46 12.13-32.51 1.16-2.50 113.07-306.74 162.66±4.29 11.61-21.08 18.81-31.30 0.36±0.01 14.80±0.22 23.87±0.31 9.08±0.26 5.42-12.51 3.94±0.12 1.76±0.06 0.58±0.01 2.49±0.03 1.80±0.03 2.60-6.33 0.89-2.60 0.39-0.80 0.17-0.59 1.32-2.55 49.93–281.31 152.31 ± 4.87 6.09–18.03 8.54–24.54 11.91 ± 0.24 17.73 ± 0.34 2.45–12.02 2.24 ± 0.03 1.17 ± 0.01 0.55 ± 0.01 5.81 ± 0.15 0.47 ± 0.01 2.50 ± 0.03 1.84 ± 0.03 1.57–2.79 0.77–1.53 0.26–0.81 0.25–0.65 1.16–2.35

359.20 ±19.05 226.16-475.95 26.04± 0.82 41.02 ±1.21 4.37± 0.17 1.74± 0.06 0.35± 0.02 14.98± 0.81 0.35± 0.02 2.98± 0.08 2.18± 0.08 21.15-30.76 31.01-45.39 9.86-19.72 3.43-5.50 1.34-2.02 0.27-0.53 0.27-0.53 1.63-2.52 137.00-467.20 319.46 319.46 ±5.12 14.39-28.11 20.60-41.11 9.49± 9.49± 0.37 21.10± 21.10± 0.23 30.59 30.59 ±0.33 5.26-15.01 2.61 2.61 ±0.03 1.09± 1.09± 0.01 0.50± 0.50± 0.01 0.50± 0.50± 0.01 3.14± 3.14± 0.03 2.40± 2.40± 0.02 1.86-3.37 0.70-1.81 0.28-0.76 0.28-0.76 1.38-3.16 92.73–303.96 180.92 ± 4.70 ± 180.92 8.07–19.00 12.40–25.08 14.24 ± 0.25 ± 14.24 20.79 ± 0.31 ± 20.79 3.30–10.40 2.27 ± 0.03 ± 2.27 0.94 ± 0.02 ± 0.94 0.49 ± 0.01 ± 0.49 6.55 ± 0.16 ± 6.55 0.53 ± 0.01 ± 0.53 2.78 ± 0.03 ± 2.78 2.07 ± 0.03 ± 2.07 1.65–2.76 0.69–1.61 0.27–0.69 0.25–0.72 1.44–2.62

3.3 Results

The morphometric measurements of Fasciola adult gravid flukes from

Potohar, Pakistan in buffalo and cattle are shown in Table 1, along with average range, mean and standard error. Data is compared to that of F. gigantica, F. hepatica and Fasciola spp from bovines in Iran and Egypt. Previously published studies by Ashrafi et al. (2006) and Periago et al. (2008) are taken as a reference standard for comparison purposes. This comparison was useful as Iran and Pakistan have a common border, while bovines in Iran and Egypt both host pure

F.gigantica, F.hepatica and intermediate Fasciola/Fasciola spp.

The comparison of Pakistani Fasciola was compared to the three types of

Fasciola from Egypt and Iran. It is observed that Pakistani Fasciola resembled the intermediate/Fasciola spp species from Egypt (Figure 6 and Figure 7) and with

Fasciola spp (Figure 8) and F.gigantica from Iran (Figure 9 and Figure 10). This was based on five important morphometrical parameters (BL, BW, BL/BW, VS-

Vit, VS-Post) for species identification as pointed out by many scientists (Valero et al., 2001; Lotfy, et al., 2002 and Ashrafi et al., 2006).

An Analysis of Variance (ANOVA) using MSTATC was concluded to determine if all the species and parameters are the same or different (Table 2). The five parameters that were used are ideal for the purpose of morphological characterization and identification as they are significantly different (P<0.05).

50 45 BL 40 35 30 25 20 Lengh (mm)Lengh 15 10 5 0 Buf- Cat- Fg- Fsp- Fh- Fg- Fsp- Fh- Pak Pak Iran Iran Iran Egypt Egypt Egypt

Figure 6: Body length (BL) of Potohar Fasciola intermedia compared with Fasciola gigantica (Fg), Fasciola hepatica (Fh), Fasciola spp / intermedia (Fsp) of Iran and Egypt.

45 VS-Post 40

25 20

Length (mm) Length 15

0 Buf- Cat- Fg- Fsp- Fh- Fg- Fsp- Fh- Pak Pak Iran Iran Iran Egypt Egypt Egypt

Figure 7: Length range from Ventral Sucker to Posterior end (VS-Post) of Potohar Fasciola intermedia compared with Fasciola gigantica (Fg), Fasciola hepatica (Fh), Fasciola spp / intermedia (Fsp) of Iran nd Egypt.

12 BW 10

Length (mm) Length 4

0 Buf- Cat- Fg-Iran Fsp- Fh-Iran Fg- Fsp- Fh- Pak Pak Iran Egypt Egypt Egypt

Figure 8: Body width (BW) of Potohar Fasciola intermedia compared with Fasciola gigantica (Fg), Fasciola hepatica (Fh), Fasciola spp / intermedia (Fsp) of Iran and Egypt.

7 BL/BW 6

3 Length (mm) Length 2

0 Buf- Cat- Fg- Fsp- Fh- Fg- Fsp- Fh- Pak Pak Iran Iran Iran Egypt Egypt Egypt

Figure 9: Ratio of Body length/Body width (BL/BW) of Potohar Fasciola intermedia compared with Fasciola gigantica (Fg), Fasciola hepatica (Fh), Fasciola spp/ intermedia (Fsp) of Iran and Egypt.

30 VS-Vit 25

Length (mm) Length 10

0 Buf- Cat- Fg- Fsp- Fh- Fg- Fsp- Fh- Pak Pak Iran Iran Iran Egypt Egypt Egypt

Figure 10: Length range from Ventral Sucker to union of Vitelline glands (VS-Vit) of Potohar Fasciola intermedia compared with Fasciola gigantica (Fg), Fasciola hepatica (Fh), Fasciola spp / intermedia (Fsp) of Iran and Egypt.

Cluster analysis (segmentation or taxonomy analysis) was preformed to identify homogeneous subgroups in the fluke population (Table 5, 6). In this case groups are established, analyzed and finally grouping is represented by

Dendogram. SPSS Version 16.1 was used to perform the Cluster analysis by using the hierarchical approach in order to evaluate the relationship and resemblance between the Pakistani Fasciola with the species present in Iran and Egypt. All of the variables were standardized to mean 0, variance 1. This resulted in all the variables being on the same scale and being equally weighted. Initially SPSS computed the squared euclidian distance between the cases for each pair of cases in which the cases represent the different species.

The Proximity table of twenty morphometrical characters (Table 3) shows the distance from one worm species to another species whereas; the Proximity matrix shows similarities by furnishing the distances between the cases. The squared euclidean distance shows the similarity index among all the species.

Table 2: The ANOVA table shows that the P-values of both types (species) and parameters are significantly different (<0.05).

Degrees of Sum of Source Freedom Squares Mean Square F-value P-value

Rep 4 5062.23 1265.558 83.09 0.0000** Type 7 567.38 81.054 5.32 0.0006 ** Error 28 426.48 15.231

Total: 39 6056.09

** Highly significant

Coefficient of Variation= 21.43%

Grand Mean= 18.213, Grand Sum= 728.510, Total Count= 40

Table 3: Proximity matrix of 20 morphometrical parameters between the 8 homogenous groups showing squared euclidean distance. This is a dissimilarity matrix.

Proximity Matrix squared euclidean distance

Case 1: Buf-Pak 2: Cat-Pak 3:Bov-Iran 4:Bov-Iran 5:Bov-Iran 6:Bov-Egypt 7:Bov-Egypt 8:Bov-Egypt Fasciola Fasciola Fg Fsp Fh Fg Fsp Fh

1: Buf-Pak Fasciola 0.000 0.550 3.283 2.640 6.463 7.577 9.155 8.102

2: Cat-Pak Fasciola 0.550 0.000 2.068 2.485 6.926 5.989 8.292 8.055

3: Bov-Iran Fg 3.283 2.068 0.000 2.282 7.076 3.212 5.867 8.043

4: Bov-Iran Fsp 2.640 2.485 2.282 0.000 1.514 6.104 4.304 2.924

5:Bov-Iran Fh 6.463 6.926 7.076 1.514 0.000 10.273 4.368 1.046

6:Bov-Egypt Fg 7.577 5.989 3.212 6.104 10.273 0.000 0.378 8.772

7:Bov-Egypt Fsp 9.155 8.292 5.867 4.304 4.368 3.378 0.000 2.417

8:Bov-Egypt Fh 8.102 8.055 8.043 2.924 1.046 8.772 2.417 0.000

The cluster of all 20 parameters generally show more distances (Table 5) as compared to the distance in clusters represented by the 5 morphometrical indices

(Table 6). The first cluster shows that there exists no difference between the

Fasciola of first two groups which are Pakistani buffalo and cattle, the distance coefficient being 0.550 (20 parameters) and 0.007 (5 parameters) respectively.

Taking into consideration the Squared Euclidean Distance of five morphometrical indices, (Table 4) the next most similar cluster is of F.gigantica and Fasciola spp of Iran and Egypt (0.192, 0.615 and 1.11, 1.41) respectively. Whereas the maximum squared Euclidean Distance is with F. hepatica of Iran (2.31) and Egypt

(2.61). Similarly, when twenty morphometrical indices were compared, the distances became further, showing the importance of the five selected parameters as a good differentiating tool. Moreover this comparison reveals that there is a closer relationship among all the three types of Fasciola species of Iran and the

Pakistani liver fluke, as compared to flukes in Egypt (Table 3).

In agglomerative clustering Euclidean distance is used to measure the similarity between two items In this study this distance occurs between Pakistani buffalo and cattle showing that they are one species (Tables 3, and Table 4). In agglomerative hierarchical clustering each case represents a group of Fasciola which is initially considered a cluster.

Table 4: Proximity matrix of 5 (BL, BW, BL/BW, VS-Vit, VS-Post) morphometrical parameters between the 8 homogenous groups showing Squared Euclidean Distance. This is a dissimilarity matrix.

______Proximity Matrix squared euclidean distance ______

Case 1:Buf-Pak 2-Cat-Pak 3:Bov-Iran 4:Bov-Iran 5:Bov-Iran 6:Bov-Egypt 7:Bov-Egypt 8:Bov-Egypt Fasciola Fasciola Fg Fsp Fh Fg Fsp Fh ______1:Buf-Pak Fasciola 0.000 0.007 0.192 0.615 2.319 1.111 1.414 2.611

2:Cat-Pak Fasciola 0.007 0.000 0.200 0.516 2.125 1.090 1.272 2.392

3:Bov-Iran Fg 0.192 0.200 0 .000 1.075 3.212 0.674 1.718 3.478

4:Bov-Iran Fsp 0.615 0.516 1.075 0.000 0.595 2.193 0.974 1.122

5:Bov-Iran Fh 2.319 2.125 3.212 0.595 0 .000 4.331 1.415 0.477

6:Bov-Egypt Fg 1.111 1.090 0.674 2.193 4.331 0 .000 1.258 3.733

7:Bov-Egypt Fsp 1.414 1.272 1.718 0.974 1.415 1.258 0.000 0.749

8:Bov-Egypt Fh 2.611 2.392 3.478 1.122 0.477 3.733 0.749 0.000 ______

adding more cases to existing clusters and creating new clusters, or combining clusters to get to the desired final effect. The proximity/distance/agglomeration coefficient in the "Coefficients" column indicates that the smallest coefficient

(0.007) exists in Pakistani buffalo and cattle, showing great similarity amongst these Fasciola. The next closest to Pakistani Fasciola is the Iranian Fasciola

(F.gigantica = 0.192). The maximum coefficient value is between the clusters of

F.hepatica of Iran (2.170) and F.gigantica in Egypt (1.267) as shown in Table 6.

Dendogram displays essentially the same information that is found in the agglomeration schedule but in graphic form. The larger agglomeration coefficient corresponds with a longer line in the dendrogram showing between-groups. The average distance of all individuals in one cluster to another is shown by average linkage methods. This is represented horizontally, with each row on the Y axis, representing a group having one type of Fasciola while the proximity coefficients are a rescaled version of X axis. Those groups having high similarity are close together (Figure 11 and 12).

The dendrogram and Agglomeration Schedule (Figure 12) tells us that in 1st stage, case 1 (Buf-Pak) is joined with case 2(Cat-Pak) and at next stage case 3 (Fg-

Iran) is joined with them. Next at stage 3 the case 5 (Fh-Iran) is joined with case 8

(Fh-Egypt) and at 5 stage case 5(Fh-Iran) is again joined with case 7 (Fsp-Egypt).

Table 5: Agglomeration Schedule of 20 morphometrical characters of homogenous groups (1=Buf-Pak, 2=Cat-Pak, 3=Bov-Iran-Fg, 4=Bov-Iran Fsp,

5=Bov-Iran-Fh, 6=Bov-Egypt-Fg, 7=Bov-Egypt-Fsp, 8=Bov-Egypt-Fh)

Cluster Combined

Stage Cluster 1 Cluster 2 Coefficients

1 1 2 .550

2 5 8 1.046

3 4 5 2.219

4 1 3 2.676

5 6 7 3.378

6 1 4 5.786

7 1 6 6.361

Table 6: Agglomeration Schedule of 5 (BL, BW, BL/BW, VS-Vit, VS-Post)

morphometrical characters of 8 homogenous groups (1=Buf-Pak,

2=Cat-Pak, 3=Bov-Iran-Fg, 4=Bov-Iran Fsp, 5=Bov-Iran-Fh,

6=Bov-Egypt-Fg, 7=Bov-Egypt-Fsp, 8=Bov-Egypt-Fh)

Cluster Combined

Stage Cluster 1 Cluster 2 Coefficients

1 1 2 .007

2 1 3 .196

3 5 8 .477

4 1 4 .735

5 5 7 1.082

6 1 6 1.267

7 1 5 2.170

Figure 11: Dendrogram using Average Linkage (Between Groups) based on

20 morphometrical parameters among 8 groups.

(Rescaled Distance Cluster Combine)

Figure 12: Dendrogram using Average Linkage (Between Groups) based on 5

morphometrical parameters among 8 groups

(Rescaled Distance Cluster Combine)

3.4 Discussion

The present study shows that the morphometry of Fasciola hosted in cattle and buffalo are the same and most of the morphometrical measurements are seen to overlap. Previous studies also indicate the same results; in fact, many recent studies do not segregate the host animal but list buffalo and cattle as bovines (Ashrafi et al., 2006; Periago et al., 2008). Earlier studies suggest conflicting data on the size of the liver fluke hosted in different animals, with infrequent explanation signifying that flukes from cattle are larger than those from sheep, but no valid conclusion has yet been finalized (Panaccio and Trudgett, 1999). Whereas the results of some studies concluded that the flukes in sheep grow faster, more uniformly and reach a larger size as compared to cattle (Valero et al., 2001). Previous studies (Sahba et al., 1972; Valero et al., 2001; Lotfy et al., 2002; Mas-Coma et al., 2005; Ashrafi et al., 2006) indicated that morphometric patterns are dependent upon the host species, whereas Ghavami et al. (2009) showed that flukes isolated from sheep are larger than those of cattle, maybe because sheep show low resistance, whereas cattle show medium resistance to the parasite. Maybe morphometric differences of body parts of fasciolids can be influenced by intensity of infection, host species, age and immune response from previous exposure to infection. Furthermore, fixing and mounting of specimens may affect some parameters. These observations may be helpful in explaining why the flukes in buffalo were slightly longer and broader in buffaloes as compared to cattle. Fasciolosis is less prevalent in the latter.

The main difference between F. gigantica and F. hepatica is the larger size of the former, in addition to an elongated body. Other differences include the shape

of the posterior end which may narrow. Earlier studies outlined by Cobbold (1855) and Varma (1953) show the presence of numerous secondary intestinal ramifications in F.gigantica. It was emphasized that external morphology, especially the size and shape of the body are helpful in identification. Nevertheless, many authors agree that it is very difficult to achieve a precise classification as many variations exist in their morphological characteristics (Kimura et al., 1984).

Species identification in the present study was done by emphasizing BL,

BW, VS-P, VS-Vit indices and BL/BW ratios as suggested by previous studies

(Valero et al., 2001; Lotfy, et al., 2002 and Ashrafi et al., 2006). Periago et al.

(2008) proposed groups based on maximum and minimum values of the morphological measurements of F. hepatica, F. gigantica or Fasciola sp.

(intermediate/hybrid forms) for populations from Egypt and Iran, whereas, Ashrafi et al. (2006) outlined some useful morphometric descriptions for the specific differentiation of the two species. The basis of grouping was initially performed according to BL/ BW, and, secondarily, according to VS-P. The application of these criteria to Pakistani Fasciola shows that BL/ BW is 3.88-8.40 (F. gigantica like) and VS-P ranges from 19.10-44.81 (F. hepatica like). When the two adult species were compared in Egypt by Valero et al. (2006), results show that all the values of morphometrical measurements applied to liver fluke adults overlapped, except VS-P serving as a functional instrument for the species differentiation.

Moreover, VS-Vit is also considered as an important index of species classification and considering this criterion the Fasciola from Potohar (10.5-29.5) resembles

Fasciola spp. Whereas BL and BW of Pakistani Fasciola resemble the Egyptian and Iranian Fasciola spp and F. hepatica.

Morphometric indices in this study consisted of twenty different parameters based upon lineal biometric characters, areas and ratios. Out of these; nine parameters (BL, VS min and max, Ph W, OS-VS, BA, OSA, VSA and BL/BW) resemble F.gigantica, five parameters (BW, OS min, max, Ph W, A-VS) resemble

F.hepatica and six parameters (CL, CW, VS-Vit, VS-Post and OSA/VSA) resemble Fasciola spp.

In order to attain maximum precision in this morphometric study, the liver flukes used were isolated from naturally infected large ruminants and were of the same size and maturity, possessing gravid uteri (Periago et al., 2006). In the present study, all the worms were similar to F. gigantica, especially in their length and shape as suggested by many scientists, but some consider patterns of the reproductive organs and intestines as a differentiating factor also, but the natural branching shape of these structures makes this characteristic inconvenient

(Watanabe 1962; Bergeon and Laurent 1970). Many morphometric studies have been carried out but none have emphasized on the comparison of both species

(Srimuzipo et al., 2000). Nevertheless, differentiating between fasciolids in areas where both species overlap is quite intricate and different soft ware packages have been used for analyzing morphometrical parameters.

The main morphometrical indicators as well as the five morphometric descriptions for differentiating between Fasciola species indicated that liver fluke specimens from Potohar are not pure F. gigantica or F. hepatica, but an intermediate form, which apparently looks more like F. gigantica.

Due to the presence of intra-species morphometric differences and significant overlaps of these indices between the two species, it is emphasized that morphometric measurements alone are insufficient for differential diagnosis of the fasciolid species. Therefore, it was necessary to confirm the existing species with the help of genetic markers, and for this purpose a further study was under taken to support and confirm the morphometrical findings.

Chapter 4

Identification and characterization of Fasciola using PCR based

gene specific primers of the ribosomal DNA internal transcribed spacer (r DNA ITS-1 and ITS-2) regions and Phylogenetic diversity

in Fasciola using microsatellite markers

4.1 Introduction

The importance of molecular work lies in the fact that it is precise and authentic and gives quick results once a protocol is established. Genomic studies were very useful to explore the epidemiology, genetic variation and diagnosis of fasciolids (Mas-Coma et al., 2005). Identification and characterization of Fasciola spp in Potohar was done for the first time in Pakistan. This study followed the morphometry of Fasciola in Potohar which was morphologically identified as

Fasciola gigantica like intermediate species. This molecular study of Fasciola was divided into two parts which were the use of gene specific and micro-satellite markers.

Molecular identification was based on PCR gene specific primers and cloning of the internal transcribed spacer (ITS-1 and ITS-2) and their sequence comparison. The phylogenetic diversity in Fasciola was also studied by using six microsatellite markers. The ITS markers were popularly used in molecular systematics world over in different organisms for determining out species origin and classification, whereas microsatellites investigate genetic diversity present in

an organism. The presence of diversity in the genome of an organism ensures its successful survival and makes it adaptable to the prevailing environment. The considerable variability present proposes interbreeding which is favorable for diversity

The results derived from application of genetic markers were analyzed by various bioinformatics software (BLAST; CLUSTAL) and phylogenetic analysis represented by Cladograms (BIONJ) which concluded that the Fasciola species prevalent in Potohar region is an intermediate or hybrid with more resemblance to

F.gigantica then F.hepatica. The Fasciola spp in Potohar shows a close similarity with Fasciola isolates of China, India, Egypt, Iran and Vietnam. The amplification of six microsatellite markers shows that two markers out of six did not show polymorphism (null alleles), whereas four markers were polymorphic and one marker gave two alleles showing presence of genetic diversity in Potohar Fasciola.

4.2 Materials and Methods

This study was conducted out at the National Institute for Genomics and

Advanced Biotechnology (NIGAB), National Agricultural Research Center

(NARC), Islamabad during 2007-09.

4.2.1 Sample collection

Adult Fasciola were collected during 2005-2008 from the liver of infected bovine hosts (cattle and buffaloes) that were brought for slaughter to Sihala slaughter House, Rawalpindi. Only those host bovines which belonged to the

Potohar region were examined for infestation (Table 7). Flukes were then brought to the laboratory and were divided in two groups. The flukes which were to be used for genomic DNA extraction were stored in 90% ethanol at 4°C, whereas some were stored for longer term at -80°C, as frozen fluke's aid DNA extraction. The genomic DNA extracted was used for molecular characterization as well as to assess origin and genetic diversity,

4.2.2 Extraction of Genomic DNA

Ten cattle and buffalo were selected and from each cattle host, twenty flukes and from each buffalo thirty flukes were used for DNA extraction and amplification of FG ITS-1, 2 and FH ITS-1, 2. Genomic DNA for microsatellite markers was extracted from fifty flukes hosted in buffalo and cattle (Table 7). The genomic DNA was extracted from complete individual specimens and also from the apical portion of the fluke according to the method described by Semyenova et al. (2003), with slight modifications (Appendix # 2).

The DNA quality was checked on a DNA nanophotometer (IMPLEMEN) initially and then on 1% agarose gel. An aliquot (10 µl) of each amplicon was examined in (0.5 M) TAE buffer stained with ethidium bromide (Appendix # 3).

The best concentrations were further used as templates for amplification of genetic markers as well as micro-satellite markers. DNA samples were eluted into 50 µl

H2O and stored at -20º C, until further use.

4.2.3 Genetic markers r DNA ITS-1, ITS-2

Genetic markers included the complete sequences of nuclear first and second internal transcribed ribosomal spacer (ITS-1, ITS-2). These are considered as useful markers for distinguishing between F. gigantica and F. hepatica. ITS-2 is more commonly used, as it is considered a more dependable marker (Itagaki and

Tsutsumi, 1998; Agatsuma et al., 2000; Lin et al., 2007; Le et al., 2008). This region has its importance for being highly conserved in both species (Hillis and

Dixon, 1991).

4.2.4 PCR amplification for Genetic markers (rDNA ITS-1 ITS-2)

Polymerase chain reaction was used to amplify the complete ITS-1 and

ITS-2 genetic markers. Four pairs of primers were designed (Appendix # 4) two each from the known sequences of Fasciola gigantica and Fasciola hepatica. The primers were custom synthesized (MBI-Fermentas) using the information in NCBI data base (Table 8).

Table 7: Sample codes, host species and geographical origins of the

Fasciola samples used for genomic DNA extraction and amplification of ITS

markers and SSR

Host Geographical No. of Parasite samples Codes species location flukes

PK-FH-B-ITS-2 NI Buffalo Potohar, Pakistan 30 PK-FH-C-ITS-2 N2 Cattle Potohar, Pakistan 20

PK-FG-B-ITS-1 N3 Buffalo Potohar, Pakistan 30

PK-FG-C-ITS-1 N4 Cattle Potohar, Pakistan 20

PK-FG-B-ITS-2 N5 Buffalo Potohar, Pakistan 30

PK-FG-C-ITS-2 N6 Cattle Potohar, Pakistan 20

SSR-B-1-6 N7 Buffalo Potohar, Pakistan 50

SSR-C-1-6 N8 Cattle Potohar, Pakistan 50

Table 8: Primers pairs used for amplification of Fasciola ITS markers

with Gene bank accession Numbers.

Gene Bank

Primer Pair Accession No.

FG-ITS -1 F: GCG ACC TGA AAA TCT ACT CTT ACA CAA GCG EF612472

FG-ITS -1 R: GAC GTA CGT ATG GTC AAA GAC CAG GTT

FG- ITS -2 F: GCT TAT AAA CTA TCA CGA CGC CCC AC EF612484

FG-ITS -2 R: GAA GAC AGA CCA CGA AGG GTA CCG TC

FH-ITS-1F: CTA CTC TCA CAC AAG CGA TAC ACG EF612469

FH-ITS-1R: GTA CGT ATG GTC AAA GAC CAG GG

FH-ITS-2 F: GCT TAT AAA CTA TCA CGA CGC CC EF612481

FH-ITS-2 R: GAA GAC AGA CCA CGA AGG G

PCR amplification of FG ITS-1, 2 and FH ITS-1, 2 was carried out in a final volume of 50 ul and the following reaction conditions were used to amplify the desired genes with specific primer pairs.

Reagents Quantity used Final concentration

Template DNA 2 µl 50ng dNTP's (10mM) 1 µl 0.2mM

Buffer (10X) 5 µl 1.0 X

MgCl2 (25mM) 3 µl 1.5 mM

Primer 1 (forward) 1 µl 25 ng/ µl

Primer 2 (reverse) 1 µl 25ng/ µl

Taq polymerase (5U/μl) 0.5 µl 2.5U

Demonized d.d.H2O 36.5 µl

Total volume 50 µl

Samples without DNA were used in all PCR reactions as negative controls.

4.2.5 PCR Profile for FG ITS-1 and FH ITS-1

PCR optimization for FG ITS-1 and FH ITS-1 was done accordingly:

Denaturation Initial denaturation temp 95 0C Time 1 min Initial denaturation temp 55 0C 1 Cycle Time 2 min Initial denaturation temp 74 0C Time 1.30 min

Annealing Denaturation temp 95 0C Time 0.5 min Annealing temp 55 0C 30 Cycles Time 0.5 min Extension temp 74 0C Time 1.30 min

Final Extension Extension Temp 72 0C 1 Cycle Time 7 min

Stand by temperature 4 0C

Lid temperature 105 0C

Amplification was preformed on Veriti 96 wells Thermal Cycler (Applied Biosystems).

4.2.6 PCR Profile for FG ITS-2 and FH ITS-2

PCR optimization for FG ITS-2 and FH ITS-2 was done accordingly:

Denaturation Initial denaturation temp 95 0C Time 2 min 1 Cycle

Annealing Denaturation temp 94 0C Time 1min Annealing temp 38 0C Time 1min 35 Cycles Annealing temp 45 0C Time 1min Extension temp 72 0C Time 2 min

Extension Extension Temp 72 0C 1 Cycle Time 10 min

Stand by temperature 4 0C

Lid temperature 105 0C

Amplification was preformed on Veriti 96 wells Thermal Cycler (Applied

Biosystems).

4.2.7 Gel Electrophoresis

The amplified products of PCR (FG ITS-1, 2 and FH ITS-2) were analyzed by electrophoresis (Appendix # 4 ) on 1% agarose gel using standard 1kb DNA marker (Appendix # 6 ).

4.2.8 PCR Purification Cloning and Sequencing

The PCR products of FG-ITS1, FG-ITS 2 and FH-ITS2 from the six representative hosts were purified using QIA quick Purification kit (QIAGEN), according to the manufacturer's instructions. Direct sequencing of PCR products was done using PCR primers as sequencing primers. The ITS-1, ITS-2 PCR products were cloned in TA cloning vector using TA cloning kit (Invitrogen,

USA). The cloned samples were sent for sequencing to Macrogen, Korea.

Sequencing was done several times in order to ensure accuracy.

4.2.9 Phylogenetic analysis

Sequences obtained from Pakistani Fasciola spp were analyzed using Bio-

Edit software and aligned with published sequences ITS-1, ITS-2 rDNA belonging to Fasciola spp acquired from the NCBI nucleotide database by using accession numbers collected from relevant literature. The sequences were divided into three groups; namely FG ITS1, FG ITS2, and FH ITS2. All the acquired sequences were in Pearson format. Only those sample sequences were taken which were complete and were high scoring blast sequences, while only resembling marker sequences were taken from different areas of the world and used for comparison.

4.2.9.1 Sequence Alignments

The alignments were constructed using CLUSTALW (Thompson et al.,

1994), TCoffee (Notredame et al., 2000) and MUSCLE (Edgar, 2004). A comparison was done between progressive alignments and iterative alignments.

The alignments considered in this exercise were of MUSCLE which works iteratively. MUSCLE was run on full mode which is slow but more accurate.

4.2.10 Data analysis

4.2.10.1 Blocks curation

Alignments are edited to produce significant results using only the information which is relevant. In this process, the gaps between alignments and the regions which are identical are all discarded and blocks of relevant regions are joined together. This was done using G-blocks (Castresana, 2000; Talavera and

Castresana, 2007). The program was run on default settings.

4.2.10.2 Tree Construction

The trees were constructed using two different approaches. BioNJ

(Gascuel, 1997) was used to construct the tree according to neighbour joining method. Bootstrap value of 1000 was used. Any branch having a less bootstrap value in the result was collapsed. The second approach used was Bayesian methods. MRBAYES 3.0 (Huelsenbeck and Ronquist, 2001; Ronquist and

Huelsenbeck, 2003) was used for analysis of the data. MRBAYES and BioNJ were integrated in a workflow using Phylogeny (Dereeper et al., 2008).

4.2.10.3 Tree Rendering and Visualization

All the trees constructed were rendered and visualized in TreeDyn

(Chevenet et al., 2006).

4.2.11 Microsatellite markers/Simple Sequence Repeats (SSR)

The DNA quality was checked on a DNA nanophotometer (IMPLEMEN) initially and then on 3% agarose gel/metaphor gel (for high resolution). An aliquot

(10 µl) of each amplicon was examined in (0.5 M) TBE buffer stained with ethidium bromide (Appendix # 5).

Six known microsatellite markers or simple sequence repeats (SSR) of

Fasciola hepatica were used in this study which were already identified and characterized according to the Estoup and Martin method (Hurtrez-Bousses et al.,

2004).

4.2.12 Development of microsatellite primers

Estoup and Martin (1996) devised a method in which Sau 3A enzyme completely digested DNA of F. hepatica. A genomic library (3185 clones) was constructed with fragments ranging from 300bp to 900 bp. The clones were

screened for 10 nucleotide sequences of (CA) and (GA), after detection of the positive clones by an anti-Dig labeling kit (Roche Diagnostics). Finally electrophoresis in 4% polyacrylamide gel (8 m urea) was used to observe positive clones.

Five sequences that presented microsatellite pattern and suitable flanking regions were retained. Whereas one sequence which presented a suitable microsatellite and already published in GenBank was also used (EMBL Accession no. FH222CBP). Microsatellite primer pairs were custom synthesized from MBI

Fermentas. Primers were defined for six sequences as given in Table 9.

Table 9: Accession No's of markers used with sequence, annealing

temperature T a (ºC), the alleles amplified and their allele size with base pair

ranges.

Allele

Locus Acc. No. Repeat array Primary sequences (5'->3') T a(ºC) Alleles size (bp)

FH1 AJ508374 (TC)9 F:TTGGATTAGGTCGTTTCG 50 ------

R:CACCAAACCTCTGTTATG

FH15 AJ508371 (GT)5AC(GTAT)2GCAT F:TTCTTCAAGCCGAATTGC 48 1 229-243

(GTAT)2(GT)2CT(GT)9 R:AATTGTTGTGCTGAAACTGG

FH23 AJ508372 (GTTT)4(GT)8CT(GT)6CT F:AGCACCAGGAAAATTGAG 48 ------

(GT)7(GGT)4(GT)6AA(GT)3 R:GCGAATTAATACAGCAAACC

FH25 AJ508373 (AC)8 F:TAGCGGTTTTGACTCTAC 51 1 276-282

R:GATTCGGTTAGGATGTTG

FH26/1 AJ508370 (CA)5 F:TGCATGTAGAAGTAACGG 45 2 122-136

R:AATAGATTCACAGGTGTGAC

FH222CBP AJ003821 (CA)7 F:GTGGATCCCCACTGTGAGAC 50 1 146-176

R:TGTCCAACTGCATGAACCAT

4.2.13 PCR microsatellite amplification

The genomic DNA extracted from fresh flukes was used as templates for

PCR amplification, which was carried out in a final volume of 20 ul and the following reaction conditions were used to amplify the desired genes with specific primer pairs.

Reagents Quantity used Final concentration

Template DNA 2 μl (50-100 ng) dNTPs (10mM) 0.5 μl

Buffer (10X) 2.5 μl (1.0 X)

MgCl2 (25mM) 1.5 μl (1.5 mM)

Primer 1 (forward) 0.5 μl 25 ng

Primer 2 (reverse) 1 μl 25ng

Taq polymerase (5U/μl) 0.5 μl (2.5U)

Deionized d.d.H2O 36.5 μl

Total volume 50 μl

Samples without DNA were used in all PCR reactions as negative controls.

Amplification was preformed on Veriti 96 wells Thermal Cycler (Applied

Biosystems).

4.2.14 PCR Profile

PCR optimization was done accordingly; it was same for all primers except for a change in the annealing temperature (Table 8)

Denaturation

Initial denaturation temp 94 0C 1 Cycle

Time 4 min

Annealing

Denaturation temp 94 0C

Time 0.5min

Annealing temp 45-55 0C 30 Cycles

Time 0.5min

Extension temp 720C

Time 0.5 min

Extension

Extension Temp 720C 1 Cycle

Time 10 min

Stand by temperature 40C

Lid temperature 1050C

Samples without DNA were used in all PCR reactions as negative controls.

PCR was preformed on Veriti 96 wells Thermal Cycler (Applied Biosystems).

4.2.16 Gel Electrophoresis

The amplified products of PCR were analyzed by electrophoresis

(Appendix #5) on 3% agarose gel using standard 1kb DNA marker (Appendix # 6).

4.3 Results

In the present study, Fasciola samples from cattle and buffalo from different locations in Potohar region (Pakistan) were compared with other Fasciola species from different large ruminant hosts from different geographical locations and also with Human Fasciola from Vietnam. The PCR products of FG ITS-1

(391 bp) and FG ITS-2 (323 bp) were subjected to direct sequencing and were also cloned in TA cloning vector (MBI, Fermentas) for sequencing .The PCR products for FHITS-2 (327 bp) were processed similarly.

The FG ITS-1 rDNA of Pakistani Fasciola were compared with known sequences of other Fasciola gigantica obtained from GenBank. The BLAST hit results are shown in Table 10 and indicated maximum similarity of Pakistani

Fasciola with Fasciola, from buffalo in China, with only two nucleotide differences. A four nucleotide difference also existed with isolates from Asia

(Indonesia, India, Japan, South Korea, Thailand, Vietnam) and Africa (Egypt,

Nigeria, Kenya, Burkina Faso and Zambia). The phylogenetic tree constructed by

Bayesian method support the blast results by showing similarity between FG ITS1

(Pakistan) and the FG ITS1 species in China, India and South Korea (Figure 13).

Table: 10 Comparison of FG ITS-1 of Fasciola spp hosted in bovines (present study) with F. gigantica from different geographical locations. The variable positions with the country and accession number are also specified.

VARIABLE POSITIONS FG ITS 1 COUNTRY ACCESSION NO

39 43 172 383

T T G T PAKISTAN PRESENT STUDY AJ628043, AJ628425, C T T T CHINA AJ628426 C C T C EGYPT EF612470, EF612401 C C T C INDIA EF027104 C C T C INDONESIA AB207143 C C T C VIETNAM AB385613, AB385614 C C T C JAPAN AB207146 C C T C THAILAND AB207144 C C T C S.KOREA AB211238 BURKINA C C T C FASO AJ853848 C C T C ZAMBIA AB207142 C C T C NIGERIA AM900371 EF612472, AJ628427, C C T C KENYA AJ628428

When FG ITS-2 rDNA sequences were compared with F.gigantica species

(Table 11), the blast results showed similarity, with a two nucleotide difference

(isolates from China) and a three nucleotide difference (isolates from Egypt,

Indonesia, India, Japan, Nigeria and Vietnam). A four nucleotide difference was present in isolates of F. gigantica (Burkina Faso, Zambia and Kenya). A

Phylogenetic tree was constructed using the Bayesian method (Figure 14) and

Cladogram indicated that FG ITS2 found in Pakistan is unique from the FG ITS2 found in other locations.

Figure 13: Phylogenetic tree of FG ITS-1 constructed by Bayesian methods showing similarity of FG ITS1 (Pakistan) with the FG ITS1 species in India, South Korea, and China. Accession no. with country and Fasciola type is also given. Fg: Fasciola gigantica, Fh: Fasciola hepatica and Fas sp: Fasciola species/intermediate. Numbers in red on tree branches show the branch support values in percentage

Table 11: Comparison of the FG ITS-2 of Fasciola spp hosted in bovines (present study) with F. gigantica from different geographical locations. The variable positions along with its country and accession numbers are also specified.

VARIABLE POSITION FG ITS 2 COUNTRY ACCESSION NO

105 301 306 323 A G G A PAKISTAN PRESENT STUDY EU260079, AJ557511, G T G A CHINA AJ557569 DQ383512, EF612482, G T T A EGYPT EF612483 G T T A INDIA EF027103 AB010977, AB207149, G T T A INDONESIA AB260080 AB207152, AB010979, G T T A JAPAN AB207151 EU260057, EU260059, G T T A VIETNAM EU260060 EU260072, EU260075, G T T A EU260076 EU260078, EU260061, G T T A EU260063 EU260070, EU260074, G T T A EU260077 G T T A NIGERIA AM900371 BURKINA G T T G FASO AJ853848 G T T G KENYA EF612484 G T T G ZAMBIA AB010976

ITS-1 marker for F.hepatica could not be amplified, whereas, the ITS-2 marker was amplified successfully. The BLAST hit results shown in Table 12, describe that our FH ITS-2 from cattle and buffalo were found to be less similar with F. hepatica from various hosts, but more similar with Fasciola species.

Maximum similarity existed between Vietnamese Fasciola hepatica in humans, with only one nucleotide difference. The other isolates showed a variable relationship with six nucleotide difference. The same relationship is also shown in the phylogenetic tree (Figure 15). Phylogeny suggests that the closest neighbours of Pakistani FH ITS2 are Vietnam and Iran.

The gel picture of the Potohar species of Fasciola in cattle and buffaloe show the same band pairs, showing no difference in the two ruminants, hence considering them as bovines (Figure 16 and Figure 17).

Figure 14: Phylogenetic tree of FG ITS-2 constructed using Bayesian methods indicates that FG ITS2 found in Pakistan is unique from the FG ITS2 found at other places. Accession no. with country and Fasciola type is also given. Fg: Fasciola gigantica, Fh: Fasciola hepatica and Fas sp: Fasciola species/intermediate. Numbers in red on tree branches show the branch support values in percentages

Table 12: Comparison of the FH ITS-2 of Fasciola spp hosted in bovines (present study) with Fasciola hepatica from different geographical locations. The variable positions along with its country and accession number are specified.

VARIABLE POSITIONS FH ITS2 COUNTRY ACCESSION NO

167 230 236 243 294 311

C T T C A C PAKISTAN PRESENT PAPER EU260059, EU260060, C T T C A T VIETNAM EU260069 T C C T G T IRAN EF612481 T C C T G T EGYPT EF612479-80 T C C T G T CHINA AJ557568, AJ557570 T C C T G T JAPAN AB010978, AB207150 T C C T G T FRANCE AJ557567 T C C T G T SPAIN AJ272053, AM709498-99 T C C T G T SPAIN AM709609-16, AM709618 T C C T G T SPAIN AM709619, AM709643-49 T C C T G T SPAIN EU391412-24, AM707030 AM709500, AM709617, T C C T G T SPAIN AM709620 T C C T G T URUGUAY AB010974 T C C T G T AUSTRALIA EU260058, AB207148 T C C T G T NIGER AM900370

Figure 15: Phylogenetic tree of FH ITS2 constructed using Bayesian analysis suggests that the closest neighbours of FH ITS2 in Pakistan are Vietnam and Iran. Accession no. with country and Fasciola type is also given. Fg: Fasciola gigantica, Fh: Fasciola hepatica and Fas sp:Fasciola species/intermediate. Numbers in red on tree branches show the branch support values in percentages.

Figure 16: PCR amplification of FG ITS1 and FG ITS 2

391 bp bands confirms the presence of FG ITS-1 region in buffalo and cattle 329 bp bands confirms the presence of FG ITS-2 region in buffalo and cattle

Lane 1 and 10: 1 kb DNA marker Lane 2-4: amplified product of FG ITS-1 Buffalo Lane 5- 7: amplified product of FG ITS-I Cattle Lane 9 and 18: Negative control

Lane 11-13: amplified product of FG ITS-2 Buffalo Lane 14- 16: amplified product of FG ITS-2 Cattle

Figure 17: PCR amplification of FH ITS 2

330 bp 330 bp bands confirms the presence of FG ITS-2 region in buffalo and cattle

Lane 1: 1 kb DNA marker Lane 2-5: amplified product of FH ITS-2 Buffalo Lane 6-9: amplified product of FH ITS-2 Cattle Lane 10: negative control

100

4.3.1 Allele Scoring and Data Analysis of SSR's

The size of the most intensively amplified band was examined according to its electrophoretic mobility standardized against a 500 bp ladder (MBI, Fermentas).

The distance travelled by each band depends upon the molecular weight marker.

The amplified products from the microsatellite analyses were qualitatively scored and presence and absence of each marker allele-genotype combination was found out.

Considerable variability was observed among different genotypes of

Fasciola spp in Potohar region, Pakistan. There was no genetic difference in bands of the definitive host species (cattle and buffalo) and that is why they are considered collectively as bovine (Figure 16 and Figure 17).

Six microsatellite markers were used on forty Fasciola specimens from

Potohar region bovines. Two markers did not show polymorphism, whereas four were polymorphic (Table 9).

101

1 2 3 4 5 6 7 8 9 10

Figure 18: Amplification profile of marker 2 (AJ508371) on 10 bovine

genotypes showing 229-243 bp range.

M 1 2 3 4 5 6 7 8 9 10

Figure 19: Amplification profile of marker 4 (AJ508373) on 10 bovine

genotypes showing 276-282 bp range.

102

1 234 567 8910

Figure 20: Amplification profile of marker 5 (AJ508370) on 10 bovine

genotypes ranging from 122-136 base pairs.

M 12345 6 7 8 9 10

Figure 21: Amplification profile of marker 6 (AJ003821) on 10 bovine

genotypes showing 146-176 bp range

103

The allele size range of polymorphic markers was 122-282. Only a single allele was amplified for three markers, whereas in marker with accession number

AJ508370 had two alleles amplified (Figure 20). This was also observed in

F.hepatica from the Bolivian Altiplano (Hurtrez-Bousses et al., 2004). The size of the allele in marker 2 (AJ508371) ranges from 229-243 (Figure 18) and marker 4

(AJ508373) ranges from 276-282 (Figure 19) while marker 5(AJ508370) and 6

(AJ003821) exhibit a size range of 122-136 and 146-176 (Figure 20 and 21), respectively.

The number of alleles per locus generated by each marker varied from 1 to

2 with an average of 1.2 alleles per locus. The overall size of the amplified product varied from 122bp (M-5) to 282bp (M-4).

4.4 Discussion

A study of this kind was conducted for the first time in Pakistan with the major purpose of identifying and characterizing the existing Fasciola species in

Potohar region. This was done by comparing sequences of ITS-1 and ITS-2 rDNA of Pakistani Fasciola with Fasciola species from other geographical locations, and especially in neighboring Asian countries. Another objective was to investigate species of origin and its diversion or resemblance with ancestors. Phylogenetic analysis was preformed using nuclear ITS-1, ITS-2 sequences in a number of individual worms, from buffalo and cattle and their comparison with available identified sequences in the NCBI data bank.

104

Phylogenetic analysis of FG ITS-1, ITS-2 and FH ITS-2 was carried out using nucleotide sequences with two separate and independent methods; Neighbor joining, and Bayesian methods for precision. The phylogeny, represented by

Cladograms, was constructed with Bayesian methods. Significant number of bootstrapping was done on the data set and all show significant results. The branch support values are calculated with a standard deviation of 0.2. The data set was filtered for repeating sequences. The difference between lengths of different species was not very large within the data set.

The sequences of ITS-1 and ITS-2 rDNA are present between the 18S,

5.8S, and 28S coding regions. These markers have been successfully used for diagnosis (Kostadinova et al., 2003; Tandon et al., 2007; Prasad et al., 2008). The

ITS-2 sequences have been used more frequently for molecular identification of flukes as compared to any other marker (Adlard et al. 1993; Huang et al. 2004). It has highly repeatable and conserved sequences and is therefore particularly useful in molecular studies (Prasad et al., 2008).

The Pakistani ITS-1 and ITS-2 sequences of Fasciola from cattle and buffalo, when compared with each other were exactly the same. FG ITS-1 resembled FG ITS-1 (F.gigantica) present in China, India and Egypt. The

Cladograms showed that Pakistani FG ITS-2 isolates to had very little ancestral relationship with the other isolates, suggesting that the isolates of FG ITS2 found in Pakistan are different from the ones already characterized in different regions of the world, and thus are unique these results are supported by strong branch support

105

values. Whereas, the BLAST results show a resemblance of Pakistani FG ITS-2 to be unique with resemblance to F. gigantica isolates from China, Egypt, India,

Indonesia, Japan, Nigeria and Japan.

The FH ITS2 Bayesian tree shows Pakistani FH ITS2 to be present on the same cluster as F. gigantica from Vietnam. The parent cluster is shared with F. gigantica species from Vietnam and F. hepatica species from Iran. Branch support values of 100 suggest significant results. In the master cluster containing FH ITS2 from Pakistan, Fasciola isolates from Iran, Vietnam, Spain, and Uruguay are also grouped together. FH ITS-2 shows common roots with FG species from many countries in this phylogenetic analysis. Therefore, phylogeny suggested that there might be a possible presence of hybrid species between F. gigantica and F. hepatica in Pakistan as reported in some other regions of the world.

The isolates of F.hepatica from around the world are not very similar to the

Pakistani Fasciola, except for the Iranian and Vietnamese F.hepatica. The

Vietnamese isolate which shows a very close resemblance, is actually a hybrid/introgressed form, existing in humans. Le et al. (2008) showed the existence of hybrid and/or introgressed liver flukes which possess genetic material from both the species; this phenomenon was observed especially in humans living in

Vietnam. Therefore it is concluded that Fasciola species inhabiting the Potohar region does not resemble any pure species but is an intermediate species, more closely related to F.gigantica as compared to F.hepatica.

106

A BLAST similarity search was conducted on sequence-based identification in the databases. This determined several experimental and taxonomic limitations. In addition to the identification of unknown ITS sequences based on these approaches, phylogeny studies must be performed to attain valuable results for determining closely related species. Phylogeny supports the BLAST results (Holder and Lewis, 2003). Considering these findings, a phylogenetic analysis was carried out by various distance methods and character methods like

Neighbor joining method and Bayesian analysis. Results exhibited that topology is similar among the trees obtained. Though both methods were used in this study, the representation of phylogenetic trees was by Cladograms using Bayesian method.

Molecular techniques are capable of assessing epidemiologic genetic disparity of parasitic organisms (Mas-Coma et al., 2005). If the disease agent in an area is not specified there may be problems to control its spread (Soliman, 2008).

Lymnaeids may constitute excellent markers of disease, because of the strong relationship between the lymnaeid vector species and parasite transmission. These are useful for differentiating between various human fasciolosis scenarios and patterns, hence acting as determinants for the design of appropriate control strategies. Moreover, genetic studies, like comparison of mitochondrial and nuclear

DNA sequences of liver flukes in modern breeds along with their probable wild and domestic ancestors combined with available historical and archaeological data has greatly helped in understanding the present distribution of F. hepatica, F. gigantica, their genotypes and their phenotypically intermediate or genetically hybrid forms (Bruford et al., 2003; Hernandez Fernandez and Vrba, 2005).

107

In the present study, buffalo and cattle have the same base pairs and similar sequences. The primary sequence analysis and ITS sequences comparison with bovine liver flukes in various geographical regions indicate a high species-specific homogeneity and a close relationship between the Fasciola residing in Potohar and

F. gigantica from Asia and Africa and F. hepatica from Vietnam and Iran. The similarity of BLAST results of Pakistani Fasciola with Fasciola of the other geographical isolates supports the similarity to F.gigantica but it is not a pure species. The findings of this study are in accordance with studies conducted in

Japan, Korea, China, Iran, Vietnam and Egypt indicating that an ‘intermediate’

Fasciola species exists, which is most likely a hybrid of the two species, as both

FG ITS-2 and FH ITS-2 were amplified easily reconfirming that the former is a better marker for species identification (Ashrafi et al., 2006; Le et al., 2008;

Periago et al., 2008) and that this region is highly conserved in both species.

Comprehensive studies (Mascoma et al., 2005) indicated that although F. gigantica mainly occurs in tropical zones and F. hepatica mainly in temperate areas, the distribution of both overlap in some subtropical areas.

The findings of this study are further enhanced by examining the genetic variability in Fasciola spp from different host species and in diverse geographical locations (highlands and lowlands) in Pakistan and by using additional molecular markers like mitochondrial DNA sequences. The incidence of fasciolosis in humans in rural areas of Lahore (Pakistan) has already been reported by Qureshi et al. (2005), therefore it is of importance to confirm the prevalent species. It will be an interesting aspect to carry out further studies which will highlight the genetic

108

variability of human Fasciola prevalent in our region. It is essential that parasite isolates should be accurately identified for effective diagnosis, treatment and control. Mascoma et al. (2009) recommends a combination of ITS-2 and one mtDNA marker for the characterization of each fluke specimen to detect hybrid flukes. Mitochondrial DNA markers such as cox1 and 16S may be used for (i) comparison of close species within the same genus, and (ii) to differentiate populations and highlight deviation between the two species of this genus. It is also important to analyze genetic exchange between populations within the same species.

In order to control fasciolosis it is important to implement effective interventions. For this purpose, an understanding of molecular epidemiology would help (Mascoma et al., 2009), and due to the existing heterogeneity in parasites it is suggested that convenient, simplified and uniform control measures recommended for one area or country may not be sufficient elsewhere. The World Health

Organization has recognized this problem and consequently implemented these measures as different pilot strategies in each of the initially selected countries of

Peru, Bolivia, Egypt and Vietnam (WHO, 2007). The great impact of the disease on individuals as well as on human communities lays emphasis on the need for fast action to help affected people. The existing situation demands that appropriate markers should be established which are able to distinguish each type of transmission pattern of fasciolosis and its epidemiological scenario, this would facilitate in designing an applicable general protocol for animal and human control, specific for that area. These markers may primarily include genetic markers of

109

different species and strains of both liver flukes and lymnaeid vectors, combined with associated climatic-physiographic indicators.

More recently studies on prevalence and species identification have been extensively conducted in different parts of the world using molecular methods.

ITS-1 and ITS-2 sequences of flukes from Japan, Korea, China, Spain, India and

Turkey were characterized to differentiate between F. hepatica and F. gigantica

(Hashimoto et al., 1997; Itagaki and Tsutsumi, 1998; Agatsuma et al., 2000; Huang et al., 2004; Semyenova et al., 2005; Alasaad et al., 2007; Prasad et al., 2008,

2009; Erensoy et al., 2009).

It is not possible to differentiate between the two species on the basis of clinical, pathological, or immunological findings and morphologically their eggs are very similar (Lotfy and Hillyer, 2003). The specific differentiation of species can only be made by either a morphological study of adult flukes or by molecular tools (Ashrafi et al., 2006; Periago, 2008). Intermediate characters can create misunderstanding, especially in areas, where both species prevail and can interbreed giving hybrids (Lotfy and Hiller, 2003). Therefore, molecular techniques based on genomics are very valuable for species identification, epidemiological and diagnostic tools as well as for research on genetic variation of the parasitic organism (Mas-Coma et al., 2005).

Previous molecular systematic studies of Platyhelminthes showed that the sequences of the internal transcribed spacers (ITS-1 and ITS-2) of ribosomal DNA

110

provide reliable genetic markers for characterization of species (Mas-Coma et al.,

2008 b).

Microsatellites are versatile molecular markers, particularly for population analysis, but have limitations. Microsatellites developed for particular species can often be applied to closely related species; therefore we used them for this study.

Molecular biology has been applied not only for the diagnosis of parasitic and infectious disease but also to provide information on genetic background of disease resistance and genotyping of pathogens. This has also contributed in production of therapeutic protein, gene therapy and development of vaccines.

Microsatellites have been used to examine genetic variation in

Cryptosporidium (Feng et al., 2000; Caccio et al., 2001) and the population structures of African Anopheles gambiae (Lehmann et al., 1996), Toxoplasma gondii (Ajzenberg et al., 2002) and ticks and mites (Navajas and Fenton, 2000).

There is not much work done on microsatellites for liver flukes. Although diversity has been studied with the help of complete genomes and their phylogeny there is lack of data on SSR's

We have explored the genetic diversity and origin of our Fasciola species by using ITS spacers; in addition, we have used microsatellite markers to further assess diversity. Prospects of disease management by chemotherapy, or by vaccine development are a difficult task as polymorphism indicates diversity, and there is a possibility that some variants may not be identified by the host immune system.

111

Future plans are to improve this study by working on more Fasciola spp from different regions to get the polymorphic alleles sequenced in order to design new

SSR markers

In Pakistan earlier studies on fasciolosis were on disease prevalence in bovines (Maqbool et al., 2002; Iqbal et al., 2007; Sheikh et al., 2007; Khan et al.,

2009) and in humans (Qureshi et al., 2005). In this study, we identified the

Pakistani Fasciola spp in bovines for the first time by using genetic markers of rDNA, hence establishing a molecular tool for identification. This work is unique regarding the fact that so far no such study has been reported which genetically identifies the existing species of Fasciola in Potohar region of Pakistan. Extensive water bodies facilitate the development and survival of Fasciola spp. in snails and where livestock co-exist, it is a constraint to the farmer's ability to earn their livelihood which contributes significantly to the national economy.

112

Chapter 5

Sero-prevalence of fasciolosis in bovines grazed in Potohar region,

Pakistan by applying an indirect ELISA technique

5.1 Introduction

Coprological examinations are commonly used for diagnosing fasciolosis in animals and humans. Coprology has its limitations in specificity and is unreliable, laborious and time consuming besides being unable to diagnose infection in the early stages. Coprology combined with serology becomes more efficient.

Therefore, considering these limitations it is important to use an efficient immunodiagnostic test which has the capability to identify the infection in its earliest stages. Keeping this in mind an indirect ELISA was developed in this study for the identification of Fasciola infection in Potohar. The antigen used in this

ELISA was the (ES) excretory secretory antigen exclusively derived from the liver fluke isolates from bovines grazing in Potohar region. Although there is a commercially available ELISA kit for F.hepatica, there is none for F.gigantica.

Since the Fasciola spp recovered from Potohar area were identified by morphological and molecular techniques as an intermediate species, it was appropriate to develop an ELISA specifically designed for this Fasciola. The diagnostic results were clear in showing that immunodiagnosis is specific and has the quality of diagnosing infection in its earliest stages as compared to coprology.

113

This observation has also been reported by other studies (Reichel, 2002; Intapan et al., 2003; Estuningsih et al., 2009; Awad et al., 2009).

The results were analyzed by SPSS 16.1 and were evaluated by the Chi

Square test and proportion of positive animals.

5.2 Materials and Methods

The animal population consisted of buffalo and cattle reared in public and private farms in the different areas of Potohar. The random sampling was done once. A total of 200 blood and corresponding fecal samples were collected and examined for fasciolosis.

5.2.1 Animal Age

The age of the animals was determined from records maintained at the farm. Animals were characterized into different groups based on breed, sex and age for the purpose of analysis.

5.2.2 Animal breeds

In this study, buffalo (Neeli Ravi) and cattle breeds (Table 13 and 14) were evaluated for fasciolosis.

114

5.2.3 Animal data Information

Data on animal characteristics (weight, age, sex, breed and origin) was recorded and used to investigate the relationship of the above parameters with prevalence of the parasite.

5.2.4 Parasitological Protocols /Techniques

Fecal samples were collected directly from the rectum of each animal, and put in new properly labeled plastic bags. Samples were brought for to the laboratory in the Department of Zoology at PMAS, University of Arid Agriculture,

Rawalpindi, for coprological examination based on fecal egg count (FEC). The investigation was conducted as soon as possible, but for over night, samples were stored at 4ºC.

5.2.4.1 Coprology

In this study Zinc sulphate was used as floating medium and the average number of eggs per gram in feces (EPG) was counted by using a modified

McMaster technique (Kelley, 1974; Soulsby, 1982; Thienpont et al., 1986; MAFF,

1986; Urquhart et al., 1988).

5.2.4.2 Zinc Sulphate (ZnSO4) Sedimentation method

Analysis was carried out on the collected fecal samples as described in

(Appendix #7).

115

5.2.4.3 McMaster egg counting technique

A sample of the fecal mixture was then immediately run into one chamber of the McMaster slide with the help of pasture pipette and after further a mixing second sample of mixture was taken and run in to the second chamber of slide. The slide was then examined under the microscope and eggs were identified and counted in both grids of the McMaster slide. The EPG was calculated by multiplying total number of eggs in two grids by 50.

5.2.4.4 Identification of Fasciola eggs

Identification of Fasciola eggs was preformed with the help of identification keys as suggested by Soulsby (1982) and MAFF (1986). The

McMaster technique (MAFF) is widely used, but sometimes modified according to the parasites being investigated.

5.2.4.5 Serology

Blood samples were taken from the jugular vein of the animals with the help of Precision-Glide multiple sample needle BD in 4 ml Z serum clot activator vacutainers (Greiner Bio-One GmbH) and were left at room temperature for an hour so that sera can be separated easily. Blood was centrifuged at 3000 rpm for 15 minutes to separate sera. The serum was stored in 1.5 ml eppendorfs at -20º C till further analysis for antibody detection.

116

5.2.4.6 Enzyme Linked Immunosorbent Assay (ELISA)

Serum IgG-antibodies specific for Fasciola spp antigens were detected after developing a specific indirect ELISA assay for the species existing in our region. We had identified the liver fluke in our study as Fasciola spp, an intermediate breed resembling more with F. gigantica and less with F. hepatica.

Although a commercially available ELISA kit for the immunodiagnosis of F. hepatica was present there was no ELISA kit for the immunodiagnosis of F. gigantica. Since our species was phenotypically and genetically identified, it was preferable to isolate ES antigens from the flukes present in our region and to design our own indirect ELISA assay for accuracy and specificity in immunodiagnosis.

5.2.4.7 Fasciola Excretory Secretory (ES) Antigen preparation

Adult Fasciola spp were obtained from bovine livers and washed repeatedly (3-5 times) in 0.01 M PBS, pH 7.4. The worms were then incubated for

6 hours at 37°C, where one worm / 5 ml in 0.01 M PBS at a pH 7.4 were used.

After incubation, the worms were removed and the supernatant fluid (PBS + ES) was collected and subjected to a high-speed centrifugation (12,000 rpm) for one hour at 4°C. The supernatant was separated and designated as ES antigen. The antigen was aliquoted and stored at –70°C until used.

The protein content of the ES antigen was measured by the Bradford assay

(Bradford, 1976). This assay is based on the use of a Reagent that consists of a

Blue dye which changes to a brown color when in contact with proteins. The

117

antigen represented by protein binds to this and changes the original red-brown color to blue and hence creating a change in light absorbance properties of the dye which is measured with spectrophotometer at a wavelength of 595 nm. In order to establish a correlation between absorbance values and known amounts of protein, a series of protein standards were prepared, which comprised of dilutions of a protein solution of known concentration. In this case Bovine serum albumin (BSA) was used. A convenient standard curve can be made by using BSA with varying concentrations, where each concentrations was measured spectrophotometrically and a standard curve was plotted. Protein standards were prepared in the same buffer in which the samples were to be assayed.

5.2.4.8 Procedure

The ELISA was performed on 96 well micro-titration plates, whose odd columns were coated with specific Fasciola spp antigens and even columns were used to control the specificity of the test. Therefore, the samples and controls were assayed together simultaneously with one well coated with antigen and other well was not.

The antigen was diluted in coating buffer (carbonate buffer) at its optimal dilution (4 g/ml). The ELISA was conducted according to the protocol described in

Appendix # 8.

118

5.3 Results

5.3.1 Animal information

A total of 200 serum and fecal samples from 83 buffaloes and 117 cattle were analyzed for infection by indirect ELISA and McMaster fecal egg count techniques.

The bovines included in the present study are summarized in Tables 13 and 14.

5.3.2 Seroprevalence

An indirect ELISA was performed on 200 blood samples of bovines (83 buffalo and 117 cattle). The positive results in the ELISA showed presence of infection; whereas negative results showed absence of infection in the samples.

5.3.3 Species wise seroprevalence

Seroprevalence was 60 per cent (50/83) in buffalo and 50 per cent (58/117) in cattle (Figure 22). The difference is borderline of being significant (P = 0.136, χ2

= 2.225) as P > 0.05 at 1 degree level of freedom.

5.3.4 Breed wise seroprevalence

Seroprevalence for the different breeds of cattle show that there is a significant difference between (P = 0.004, χ2 = 17.143) as (P< 0.05), so it was concluded that in cattle there was a high significant difference in breed susceptibility to fasciolosis infection. Achai breed (12/15) and Red Sindhi calves

(8/10) were most susceptible to infestation (Table 16). Since there was only one breed of buffalo (Neeli Ravi), serodiagnosis of fasciolosis was compared in two locations, the results show that there is no significance between buffaloes in

119

different locations and infection (Table 15). The Nili Ravi reared at NARC was more susceptible to infection (23/33), than those brought for slaughtering (27/50).

Considering the overall fasciolosis infection in bovines, infection is highly significant (χ2 = 21.499, P= 0.003) at 7 degree of freedom (Figure 23).

5.3.5 Age wise seroprevalence

The relationship between age and seroprevalence of fasciolosis in buffalo and cattle indicates that there was a highly significant relationship between age and fasciolosis in the Neeli Ravi present at the two locations (P = 0.003, χ2 = 11.368) and also among the various cattle breeds (P= 0.002, χ2 = 12.171). The probability was P< 0.05 with 2 degree of freedoms (Table 17 and Table 18), respectively.

Results are shown in Figure 24, where susceptibility was highest in young, 1-5 year old bovines. This could possibly be attributed to the fact that immunity against diseases increases with age, and consequently fasciolosis would decrease with age.

5.3.6 Sex wise seroprevalence

The number of males included in the present study was less than females, as female animals are preferably reared on farms and kept in large numbers due to their higher economic value. Moreover, bovines brought for slaughtering were also females. Seroprevalence was greater in male buffaloes, where relationship is strong

(P = 0.039, χ2 = 4.269). Seroprevalence with respect to sex in cattle (P = 0.016, χ2 =

5.757) was also significant. Sex wise seroprevalence of fasciolosis in buffalo and cattle is given in Table 19 and Table 20 respectively. Overall relationship between seroprevalence and sex of bovines is shown in Figure 25.

120

Table 13: Neeli Ravi buffaloes of two different locations examined for

fasciolosis

No. of Buffalo

Breed/Location Male Female Total

Nili Ravi (Private Farms) 6 27 33

Nili Ravi (Public Farms) 0 50 50

Total 6 77 83

Table 14: Different breeds and sex of cattle examined for fasciolosis

No. of Cattle

Breeds Male Female Total

Red Sindhi 9 25 34

Achai 0 15 15

Calves 8 2 10

Cross (Jersey x Sahiwal) 0 17 17

Jersey 0 12 12

Desi breed 0 29 29

Total 17 100 117

121

Table 15: Seroprevalence of fasciolosis in buffalo (Nili Ravi) with respect

to location

Breeds Private Farms Public Farms Total Nili Ravi

Animals examined 33 50 83

Infected 23 27 50

Non infected 10 23 33

Seroprevalence (%) 70 54 60

χ2= 2.0, P = 0.35 NS

NS Non-significant

Table 16: Relationship between different breeds of cattle and

seroprevalence of fasciolosis

Breeds Red Achai Cross Jersey Calves Desi Total Sindhi Local

Animals examined 34 15 17 12 10 29 117

Infected 17 12 9 5 8 7 58

Non infected 17 3 8 7 2 22 59

Seroprevalence (%) 50 80 53 42 80 24 50

χ2 = 17.14, P = 0.0042 **

** Highly significant

122

Table 17: Relationship between age groups of buffalo and seroprevalence

of fasciolosis

Age (years) <1-5 >5-10 > 10 yrs Total Animals examined 14 19 50 83

Infected 14 9 27 50

Non-infected 0 10 23 33

Seroprevalence (%) 100 47 54 60

χ2= 11.36, P= 0.003 **

** Highly significant

Table 18: Relationship between age groups of cattle and seroprevalence

of fasciolosis

Age (years) < 5 >5-10 >10 yrs Total

Animals examined 10 78 29 117

Infected 8 43 7 58

Non-infected 2 35 22 59

Seroprevalence (%) 80 55 24 50

χ2 = 12.17, P = 0.002 **

** Highly significant

123

Table 19: Relationship between different sex groups of buffalo and

seroprevalence of fasciolosis

Sex Male Female Total

Animals examined 6 77 83

Infected 6 44 50

Non-infected 0 33 33

Seroprevalence (%) 100 57 60

χ2 = 4.269, P = 0.039 *

* Significant

Table 20: Relationship between different sex groups of cattle and

seroprevalence of fasciolosis

Sex Male Female Total

Animals examined 17 100 117

Infected 13 45 58

Non-infected 4 55 59

Seroprevalence (%) 76 45 50

χ2 = 5.757, P = 0.016 *

* Significant

124

50 )

40 FEC 30 SEROPREVALENCE

INFECTION (% INFECTION 20

0 Buffalo Cattle BOVINES

Figure 22: Prevalence of fasciolosis in bovines as shown by FEC and ELISA.

FEC 100 S EROP REVALENCE 90 80 70 ) 60 50 40 INFECTION (% INFECTION 30 20 10 0 R.Sindhi Achai Exp Cross Jersey Desi N.Ravi N.Ravi calves Breed (S.H) (NARC) BREEDS OF BOVINES

Figure 23: Prevalence of fasciolosis in bovine breeds as shown by FEC and

ELISA.

125

120

100 FEC

) 80 SEROPREVALENCE

INFECTION (% INFECTION 40

0 < 1-5 yrs > 5 - 10 yrs < 10 yrs AGE OF BOVINES

Figure 24: Prevalence of fasciolosis in different age groups of bovine as

by FEC and ELISA.

100 90 80

) 70 60 FEC 50 SEROPREVALENCE 40

INFECTION (% INFECTION 30 20 10 0 Male Female SEX OF BOVINES

Figure 25: Prevalence of fasciolosis in different sexes of bovine as shown

by FEC and ELISA.

126

5.3.7 Coprology (Fecal egg count)

Fecal samples of 83 buffalo and 117 cattle were examined for Fasciola eggs. The number of positive samples obtained from buffaloes (44/83) was higher than that from cattle (43/117), representing of 53 and 37 percent, respectively.

5.3.8 FEC Species wise

There was a significant (P< 0.05) difference in FEC between bovine species

(P = 0.022, χ2 = 5.223). Figure 22 shows the distribution pattern of FEC between two species. This supports that buffaloes may be more susceptible to infection compared to cattle, as they reside in closer proximity to water bodies and hence are in contact more with the intermediate fresh water snails.

5.3.9 FEC Breed wise

There was a significant difference in FEC between breeds of bovines (P <

0.05) and (P = 0.009, χ2 = 18.695), with the minimum and maximum mean FEC

50-1600, respectively. Figure 23 shows the breed specific distribution of bovine fasciolosis as depicted by FEC. The FEC of Neeli Ravi from the two locations had an infection which did not depend upon the location of buffalo, χ2 = 0.2, P =0.68

(Table 21). While in case of cattle breeds the infection was breed dependent, χ2 =

13.753, P =0.017 (Table 22) and the highest infection was found in Achai (9/15) and in young exp calves (7/10). The minimum mean FEC in cattle was 50, while the highest was 1000, whereas in buffalo FEC ranged from 0-1600.

127

5.3.10 FEC Age wise

Buffalo and cattle were also divided in three age groups and the differences in buffalo were highly significant (P = 0.002, χ2 = 12.609) as shown in Table 23.

The distribution pattern of bovine fasciolosis in different age groups according to

FEC is shown in Figure 24. There was a significant difference in FEC with cattle age (P = 0.007, χ2 = 9.805). The age group below 5 years (8/10) had the highest

FEC as compared to other two age groups (Table 24).

5.3.11 FEC Sex wise

As already mentioned the number of males was far less than females, there is significance between sex of animal and prevalence of fasciolosis in case of cattle

(P = 0.010, χ2 = 6.686) as males were more prone to infection than females, while in buffalo (P = 0.122, χ2 = 2.387) results were non significant (Tables 25 and 26).

Whereas Figure 25 shows the overall sex specific distribution pattern of bovine fasciolosis in cattle and buffalo.

A comparison of the prevalence of fasciolosis in buffalo and cattle by fecal egg count and proportion of positive animals by indirect ELISA test with respect to age, breed and sex is described in Table 27, 28 and 29 respectively.

128

Table 21: Fecal egg count of fasciolosis in buffalo (Nili Ravi) with respect to

location

Breeds Private Farms Public Farms Total Nili Ravi

Animals examined 33 50 83

Infected 19 25 40

Non infected 14 25 43

Fecal egg count (%) 58 50 48

χ2 = 0.2, P =0.68 NS

NS Non-significant

Table 22: Relationship between different breeds of cattle and fecal egg

count in fasciolosis

Breeds Red Achai Cross Jersey Calves Desi Total Sindhi Local

Animals examined 34 15 17 12 10 29 117

Infected 13 9 6 3 7 5 43

Non infected 21 6 11 9 3 24 74

Fecal egg count (%) 38 60 35 42 25 17 37

χ2 = 13.753, P = 0.017 *

* Significant

129

Table 23: Relationship between age groups of buffalo and fecal egg count

in fasciolosis

Age (years) <1-5 yrs >5-10 yrs > 10 yrs Total

Animals examined 14 19 50 83

Infected 13 6 25 44

Non-infected 1 13 25 39

Fecal egg count (%) 93 32 50 53

χ2=12.609, P= 0.002 **

** Highly significant

Table 24: Relationship between age groups of cattle and fecal egg count in

fasciolosis

Age (years) < 1-5 yrs >5-10 yrs >10 yrs Total

Animals examined 10 78 29 117

Infected 7 31 5 43

Non-infected 3 47 24 74

Fecal egg count (%) 70 40 17 37

χ2 = 9.805, P = 0.007 **

** Highly significant

130

Table 25: Relationship between different sex groups of buffalo and fecal

egg count in fasciolosis

------

Sex Male Female Total

Animals examined 6 77 83

Infected 5 39 44

Non-infected 1 38 39

Fecal egg count (%) 83 51 53

χ2 = 2.387, P = 0.122 NS

NS Non-significant

Table 26: Relationship between different sex groups of cattle and fecal egg

count in fasciolosis

Sex Male Female Total

Animals examined 17 100 117

Infected 11 32 43

Non-infected 6 68 74

Fecal egg count (%) 65 22 37

χ2 = 6.686, P = 0.010 *

* Significant

131

Table 27: Prevalence of fasciolosis in buffalo and cattle by fecal analysis

and Proportion of positive animals by indirect ELISA test and

related to age

Animals/age Fecal analysis (Mean ± SE) ELISA (Mean ± SE)

Buffalo/ years

< 1-5 92.85± 6.30 100 ± 0.00

>5-10 31.57 ± 9.42 47.37 ± 10.12

<10 50.0 ± 4.48 54.0 ± 4.47

Cattle/ years

< 1-5 70.0 ± 13.91 80.0 ± 12.14

> 5-10 39.74 ± 3.21 55.12 ± 3.26

< 10 17.24 ± 6.10 24.13 ± 6.91

132

Table 28: Prevalence of fasciolosis in buffalo and cattle by fecal analysis and

Proportion of positive animals by indirect ELISA test related to

breed

Animals/breed Fecal analysis (Mean ± SE) ELISA (Mean ± SE)

BUFFALO

Neeli Ravi 54.00 ± 1.20 62.00 ± 1.40

CATTLE

Red Sindhi 38.23 ± 7.04 50.00 ± 7.25

Achai 60.00 ± 1.40 80.00 ± 9.65

Cross (JerseyxSahiwal) 35.29 ± 10.74 52.94 ± 11.23

Jersey 25.00 ± 11.89 41.67 ± 13.53

R.S Calves 70.00 ± 13.91 80.00 ± 12.14

Desi local 17.24 ± 6.10 24.14 ± 6.92

133

Table 29: Prevalence of fasciolosis in buffalo and cattle by fecal analysis and

Proportion of positive animals by indirect ELISA test related to sex

Animals/sex Fecal analysis (Mean ± SE) ELISA (Mean ± SE)

BUFFALO

Male 83.30 ± 14.80 100±0.00

Female 50.60 ± 1.54 57.14 ±1.52

CATTLE

Male 64.70 ± 10.74 72.20 ± 9.73

Female 32.32 ± 1.78 46.47 ± 1.97

134

5.4 Discussion

The commonly used concentration methods involved in coprology for detection of parasite infection are; sedimentation, flotation or a combination of the two. The difference lying in their principle is the use of a solution with an appropriate specific gravity (SG) which helps the eggs to separate from their fecal debris, so that identification and quantitative analysis can be performed easily and accurately. In sedimentation the SG of the solution is less than the SG of the parasite eggs, and allows them to sediment and settle at the bottom. This technique is commonly used for the detection of cysts, trophozoite and trematode eggs. Most trematode eggs are relatively large and heavy and his technique concentrates them in the sediment. On the other hand in the flotation method SG of the solution is greater than SG of the eggs, enabling the eggs to float on the surface of the flotation solution. This is preferable for detecting nematode eggs. Both methods can be preformed simply or with a centrifugation technique. A combination of the two is also used, involving centrifugal flotation and centrifugal sedimentation. The basic disadvantage of sedimentation technique is that examination of the sediment is often difficult due to the presence of excessive fecal debris that may mask the presence of the parasites. The basic disadvantage of flotation technique is that not all eggs and cysts float in the flotation procedures.

Liver flukes have particularly heavy eggs and so do not float on water; therefore, it is necessary to use a sedimentation technique and liquids of high density for the flotation technique. According to Boray (1969), the sedimentation is the most sensitive among coprological techniques to detect Fasciola hepatica eggs.

135

Subsequently, Mezo et al. (1997) used a modified McMaster technique to detect and quantify F. hepatica egg shed in bovine feces. Garcia (2001) suggested that the sedimentation concentration method should be used; because the eggs operculated and they will not float using the zinc sulfate flotation concentration method. When any detergent is added to the samples the sensitivity increases, but the increased amount of sediment obstructs in counting of the feces and is unwanted. It was concluded by Happich and Boray (1969), that the sedimentation technique is more suitable for quantitative diagnosis, particularly when detection of light infections is required (Foreyt, 1989).

In this study ZnSO4 solution was considered as an effective and most desirable solution for screening combined with the centrifugation procedure as was suggested in other studies (Zajac et al., 2002). Though, the salt/sugar solution gives the best results due to its high specific gravity but unfortunately, solutions with the highest specific gravities effectively distort and destroy parasite eggs and cysts more rapidly than solutions of lower specific gravity, and there is debris to obscure view of parasites. This solution has been recommended as an effective flotation solution for recovery of eggs because it produces less distortion of cysts than other solutions of higher specific gravity (Kirkpatrick and Greive, 1987; Zajac, 1994).

Another disadvantage of most salt solutions is that they dry very quickly, crystallizing on slides and obscuring observation (Anh et al., 2008). It was determined by Dryden et al. (2005) that the centrifugation technique was more efficient in recovering parasite eggs and oocysts than the commercial passive flotation assay.

136

In order to treat fasciolosis, chemotherapy should be initiated in a timely manner. Moreover, it is very important that an early, rapid and accurate diagnosis of the infection be made. In the present study, both coprological examination and immunodiagnosis were applied for estimation of infection. The conventional method of diagnosis of liver fluke infection was traditionally based on presence of eggs in feces (Boray, 1985). Fecal examination has its limitations and the sensitivity varies with the amount of fecal sample being used and the chance of misidentification of eggs of other parasites having similar morphology (Hillyer,

1997; Anderson et al., 1999). Conducting fecal screening in the early stages of infection is not beneficial as eggs are usually shed in feces until about three months after infection and immature liver flukes are in the liver besides this infection due to fasciola residing elsewhere, besides the liver which makes it difficult to detect

(Soulsby, 1982).

Therefore, this study emphasized on the evaluation an indirect ELISA for diagnosis of bovine fasciolosis in Potohar region. ELISA has become a commonly used diagnostic test because it is easily automated with high precision. Fasciola ES antigens used in this assay were isolated from fresh flukes recovered from bovines grazing in Potohar, Pakistan.

Early diagnosis of fasciolosis using antibody detection tests, especially during the prepatent period makes ELISA practical for curbing the negative impact

137

of infection on productivity and hence to avert huge economic losses (Fagbemi et al., 1997; Sanchez-Andrade et al., 2000).

In the present study ELISA detected early infection as compared to the fecal analyses. This is was due to the fact that in seroprevalence antibodies against

Fasciola antigen are formed within 2 weeks and specific serum antibody titer indicates the animal to be positive. In contrast fecal analysis by egg detection is not possible until after 8-12 weeks post infection, so ELISA early detection is preferred

(Zimmerman et al., 1982; Clery et al., 1996; Hillyer, 1997; O’Neill et al., 1998;

Bossaert et al., 2000).

The higher infection level rate in buffalo may be due to grazing in wet areas generally close to soil leading to maximum exposure to acquire infection from the snails serving as intermediate host for Fasciola as in such areas the metacercariae are usually encysted on the vegetation as well as floating in the water.

Preston and Allonby (1979) reported significant breed difference for F. hepatica infection. They reported that it may be due to natural resistance, such that some breeds can mount a better resistance then others. The present study showed mixed results of infection difference between the breeds of cattle buffaloes studied.

The age is also an important factor among large ruminants. In the present study prevalence of infection was higher in younger bovines (below 5 years) than older ones (above 5 years), to the contrary some studies have reported an increased

138

prevalence of infection in buffalo and cattle with advancing age (Chaudhry et al.,

1994, Maqbool et al., 1994, 2002).

The present study shows a higher infection rate in males as compared to females, may be due to the large number of female as compared the males, which are kept for the breeding purpose and let loose freely to graze on pasture (Bedarkar et al., 2000). Whereas Aal et al. (1999) and Maqbool et al. (2002) reported that infection rate was almost equal in both sexes.

In Pakistan prevalence of fasciolosis by both the species in bovines was previously been reported to be 25.46 percent (Khan et al, 2009), 14.71 percent

(Maqbool et al., 2002), 10.48 percent (Sahar, 1996), 17.68 percent (Chaudhry and

Niaz, 1984) and 23.97 percent (Masud and Majid, 1984). This study reported the highest incidence to date (55 percent). One plausible reason for the high infection rate may be the inability of farmers to treat the disease due to lack of local available drugs (Jabbar et al., 2006). If a certain drug is frequently used for a longer time with wrong doses than resistance against fasciolicides is likely to develop (Boray, 1990; Fairweather and Boray, 1999). It was reported that the prevalence of fasciolosis was high in water logged areas and many biotic factors had a strong influence (Claxton et al., 1997; Rangel-Ruiz et al., 1999; Phiri et al.,

2000b; 2005a, 2006 and Moazzeni, 2006). The problem of fascioliasis has been diagnosed in all areas of the Punjab but is a main problem in low lying, swampy areas where the intermediate snail hosts occur and the Potohar region is comprised of rain fed areas with rainfall in winter as well as large amounts of rainfall during

139

summer monsoon (Shahzada and Azmat, 2009, Shahzada et al., 2009). The prevalence along the Jehlum River is probably the highest with 70 percent infection

(Chaudhry et al., 1994). Control of fasciolosis is important as it is one of the main constraints in development of a profitable livestock industry.

140

Chapter 6

Availability of cercariae / metacercariae (Infective stages) of

Fasciola spp on herbage, with special reference to freshwater snail

fauna of Potohar region, Pakistan.

6.1 Introduction

Lymnaeid snails, intermediate hosts of Fasciola spp, play a very vital role in the epidemiology of fasciolosis, which has been well-documented in various parts of the world (Dreyfuss and Rondelaud, 1997). Cercariae released from the snail, encysts as metacercariae on aquatic plants. Ruminants acquire infection by ingesting cercariae/metacercariae while grazing. Within the intermediate host, development of Fasciola is influenced by many biotic and a biotic factors. There is a well defined relationship between the volume of the intermediate host body and the number of rediae and cercariae recovered (Soliman, 2008).

This study revealed that more cercariae of F. gigantica were recovered from the L. acuminata than from Gyraulus convexiusculus during the study period.

The plant species that had the greatest metacercarial deposition was Hydrilla and

Najas, compared to Vallisenaria. Overall the two plants had equivalent number of metacercariae but the availability varied monthly, with the highest for Hydrilla in

July, August and September, and for Najas in August. The results were analyzed by ANOVA and the Duncan multiple range test (DMRT) was used to show the significance within the months.

141

This study will help in outlining the seasonal fluctuation of metacercariae in and around contaminated water bodies of Barani region and will also be helpful in predicting future occurrence of Fasciola spp infection.

6.2 Materials and Methods

6.2.1 Study Sites

In this study two water bodies, located 100 Km apart, Rawal dam reservoir and Khairimurat reservoir were selected, which are located on the northern side of

Punjab.

6.2.2 Snail Collection

Newly hatched freshwater snails, Gyraulus convexiusculus and Lymnaea acuminata, were collected in polythene bags in March, 2008 from Rawal dam reservoir and Khairimurat dam reservoir. Snails were transported to the

Parasitology laboratory, Department of Zoology, Pir Mehr Ali Shah, Arid

Agriculture University, Rawalpindi, for identification.

142

6.2.3 Snail identification

Identification was based on shell morphology and snail soft parts as suggested by Sanjeeda and Rashid (1978); Khatoon and Ali (1978); Nazneen and

Begum (1990) and Burdi et al. (2008).

6.2.4 Vegetation type

Aquatic vegetation found in the study sites was Hydrilla spp, Najas spp and

Vallisenaria spp (Plate 1). These are generally large, erected plants mostly having long narrow leaves (reed).

6.2.5 Experimental design

This study was conducted from April to September, 2008. Thirty freshwater snails of each species Gyraulus convexiusculus (Plate 2) and Lymnaea acuminata

(Plate 3) were selected for this experimental trial. They were placed and maintained on the banks of the two sites within a net in such a way that water flowed easily by the retained snails. Fasciola contaminated feces from buffaloes were placed near the snails in such a way to facilitate infection. In addition, bile containing Fasciola eggs from slaughtered buffaloes were also used to ensure infection.

Every two months, ten snails (five from each species), were brought to the laboratory for recovery of cercaria. Simultaneously, vegetation growing nearby was also collected for the recovery of metacercaria.

143

6.2.5.1 Identification and Isolation

The snails collected were placed in a rearing aquarium in order to keep them alive. Cercarial shedding was induced by exposing snails to sunlight for 2 hrs on a daily basis (Frandsen and Christensen, 1984). Cercaria were collected and placed on a slide, covered and examined under a stereomicroscope at a magnification of 40X and identified according to their gross morphological characteristics, swimming behavior and resting position (Vignoles et al., 2002;

Scweizer et al., 2003). Snails were then dissected by removing the shell to uncover any left over cercaria, as described by Coelho and Lima (2003).

6.2.5.2 Physicochemical characteristics of water

The physicochemical characteristics of water were analyzed bimonthly to monitor the prevailing limnological conditions. Water temperature, pH and

Dissolved Oxygen (DO), were measured with the help of the Hatch Kit method.

144

Hydrilla Vallisenaria

Najas

Plate 1: Aquatic plants selected for isolation of metacercariae consist of

Hydrilla spp, Vallisenaria spp and Najas spp.

145

Plate 2: Gyraulus convexiusculus snail species selected for trial

Plate 3: Lymnaea acuminata snail species selected for trial

146

6.2.5.3 Statistical Analyses

ANOVA was used to determine the significance in relationship of cercaria recovered between the two snail species and the number of metacercariae deposited amongst the aquatic plants. MS Excel was used for a graphical presentation of the results. Difference were considered significant when P<0.05. Bar graphs showing percentage of recovery of cercaria from freshwater snails and metacercariae of

Fasciola present on the aquatic plants.

6.2.5.4 Exposure to Fasciola infection

The snails placed in the study site were newly hatched juveniles with no previous exposure to Fasciola. The exposure was carried out during the period of

March-July 2009. Source of infection was fecal material from buffaloes naturally infected with Fasciola and bile (Fasciola eggs) from infected animals brought for slaughtering.

6.2.6 Cercariae and Metacercariae collection

Metacercariae were picked from the aquatic plants, and cercariae were isolated from the snails by removing the soft body of the snail from the snails shell and making a slight cut in the intestinal area and squeezing initiated cercarial recovery. The development of cercaria inside the snail was initiated and enhanced by keeping the snails under a light bulb and exposing them over night.

147

6.3 Results

There was no significant relationship (P>0.05) between the different months and cercaria development in snails, but there was a significant relationship

(P< 0.05) between infection and the different months (Table 30). The Duncan multiple range test (DMRT) was conducted to show the significant relationship within the months. Figure 26 shows July, August and September to be more important for fasciolosis transmission as compared to June.

The number of metacercaria was significantly different (P<0.05) by months, however, no significant difference (P>0.05) was observed amongst aquatic plants

(Table 31). August, September and July were more important for fasciolosis transmission compared to May, June and April respectively (Figure 27).

In this study five species of fresh water snails have been identified based on their shell morphological characteristics, by considering shell sculpture, color and shape difference. The order of their dominance is Lymnaea acuminata, Bellamaya bengalensis, Gyraulus convexiusculus, Indoplanorbis exustus and Physa acuta. It was further observed that Lymnaea acuminata and Indoplanorbis exustus are predominant species in Rawal Lake than that of Khairi Murat water reservoir.

However reverse trend was observed in case of Bellamaya bengalensis

(viviparous), Gyraulus convexiusculus and Physa acuta (Figure 28).

148

Table 30: ANOVA showing the relationship between cercarial recoveries

from snail's in different months with respect to fasciolosis

ANOVA SS Df MS F P-value

Rows 10.453 1 10.453 3.602 0.116 NS

Columns 136.520 5 27.304 9.410 0.013 *

Error 14.506 5 2.901

Total 161.480 11

NS Non-Significant (P>0.05)

* Significant (P<0.05)

149

14 Lymnaea acuminata Gyraulus convexiusculus

a 10

Mean number of Cercari of number Mean 4

0 April May June July Aug Sep

Figure 26: Relationship between infection in snails and monthly

recovery of cercariae

150

Table 31: ANOVA showing the relationship between metacercarial recoveries

from the aquatic plants in different months with respect to

fasciolosis

ANOVA SS Df MS F P-value

Rows 0.776 2 0.388 0.044 0.956 NS

Columns 403.637 5 80.727 9.273 0.001* *

Error 87.051 10 8.705

Total 491.465 17

NS Non-significant (P>0.05)

** Highly significant (P<0.05)

151

25 Najas spp. Hydrilla spp. Vallisenaria a 20

5 Mean Number of Metacercari of Number Mean

0 April May June July Aug Sep

Figure 27: Relationship between infection in aquatic plants and

monthly recovery of metacercariae.

152

Kharimurat reservoir 80 Rawal dam reservoir

30 Prevalence (%)

0 Gyraulus Indoplanorbius Physa acuta Bellamya Lymnaea convexiusculus exustus bengalensis acuminate Sites

Figure 28: Prevalence of fresh water snails at Kharimurat and Rawal dam water bodies.

153

6.4 Discussion

The maximum number of cercariae of Fasciola spp was recovered from L. acuminata and Gyraulus convexiusculus in the months of September and July

2009, respectively. Over all more cercariae of Fasciola were recovered from L. acuminata than from Gyraulus convexiusculus during the whole study period. The aquatic plants observed in both the water bodies of the study sites belong to the category of hydrophytes. Plants that are submerged floating (Najas) and rooted submerged (Hydrilla and Vallisenaria). The former group consists of plants that are found mostly below the water surface and die as soon as they are exposed. The latter group hydrophytes remain completely submerged in water. These plants were seen to encourage metacercarial deposition and the plant species most successful for metacercarial deposition were Hydrilla and Najas as compared to Vallisenaria.

The same was observed by El-Shinnawy et al. 2000, that aquatic weed (floating, submerged, ditch-bank and emerged) create serious problems in irrigation canals and open drains as well as lakes. Hydrophytes not only provide surface area for the deposition of cercaria but a suitable environment for their viability, until they are ingested by the final host.

Freshwater snails

The predominance of different snails in different water bodies may be due to prevailing abiotic factors affecting distribution pattern of fresh water snails.

Previous studies indicate that water temperature and pH are important limiting factors dictating the abundance of fresh water snail fauna, as both the factors facilitate the development and survival of snails (Ollerenshaw 1958, Yilma, 1985).

154

It has also been found that diversity of fresh water snails of Pakistan is least known in Asia, as few studies have been done on the identification of fresh water snail

(Khatoon and Ali, 1978; Begum and Rizvi, 1988). Gyraulus convexiusculus and

Indoplanorbis exustus were previously reported as a single genus Planorbis based on their shell sinistral shape. The results revealed that Gyraulus convexiusculus was found at both water bodies, these findings are in consistence with Khatoon and

Ali (1978). However, Indoplanorbis exustus was widely distributed in different parts of sub-continent and this snail also serves as an intermediate host especially in schistosomiasis. The identification of the members of Physidae family is very different due to their small sizes. The predominant snail falling in this family was

Physa acuta. Previous information on the systematics reveals that Heterostropha, integra virgata are identified as Physa acuta (Dillon et al., 2002; Wethington,

2004). This species was first time identified by Begum and Rizvi (1988) in Karachi and is consistent with Khatoon and Ali (1978).

Bellamya bengalensis is also known as a viviparous snail as the female gives birth to young ones instead of eggs. These young hatch in a specialized marsupium of female mantle cavity. It was also described as Paludina bengalensis

(Lamarck, 1822), Vivipara bengalensis (Preston, 1915, Satyamurti, 1960). This snail specie also known as Viviparous contectus, is commonly distributed throughout south-east Asia. Previously it was also confirmed by Solem (1979) and

Begum and Rizvi (1988) in various parts of the world.

155

In Potohar region four different species of Lymnaea have been identified

(Afshan, 2009). However in these study sites Lymnaea acuminata was recovered from both sites. Lymnaea acuminata f. rufescence was reported as Lymnaea acuminata (Preston, 1915; Rao et al., 1980 and Goel and Srivasta, 1980). However, our finding is not consistent with Khatoon and Ali (1988) as they identify Lymnaea acuminata f. rufescence as a separate species. Based on the results of present study it has been recommended that comprehensive study should be initiated to work out snail diversity in Potohar region. It was observed that limnological factors and age of the water bodies affects distribution pattern of freshwater snails directly and indirectly. Such studies will definitely be helpful in identifying potential intermediate hosts involved in the life cycle of many digenetic trematodes.

Cercariae and metacercariae

Various ecological factors, including season water temperature, pH,

Oxygen are very valuable on emerging of cercariae from snails and their release inside water resources where are made available to first hosts (Farahnak et al.,

2006). The rate of development and survival of snails was highest during summer season. It was noted that majority of the snails were active during summer as compared to winter. Similar observations were observed by Salih et al (1981) that the role of development of Lymnaea auricularia was accelerated as temperature increased. Furthermore cercarial production was also high at temperature between

10° and 30°C. It can be inferred that summer season is ideally suitable to rear freshwater snails to investigate host-parasite interactions. The occurrence of

156

fasciolosis is not an outcome; in fact disease prevalence may vary enormously from year to year. This is might be due interaction between the Fasciola spp., its intermediate snail host and the climatic conditions. This finding is consistent with

Ollerenshaw (1971) as temperature below 10°C does not facilitate the life cycle of fasciolosis outside the snails host.

It was observed that Fasciola eggs are deposited on the herbage throughout the year and continuous hatching occurs. Therefore, development of Fasciola spp in Potohar region is generally possible from April to late October. In snails infection occurs from May to October as result mature infective (cercariae) are made available before October and give rise to fasciolosis in late summer and autumn. The cercariae remain on the herbage throughout winter and inflict acute form of fasciolosis due to massive invasion of young Fasciola. It was also observed that snails infected after August may resume their development in late spring of the following year and thus gives rise to infection in late summer and autumn. Therefore, in Potohar region there are two possible summers of fasciolosis one is a result of over wintering of metacercariae, which survive on herbage during winter; while other due to possibility of a higher number of Fasciola eggs, responsible for summer infection of snail. In fact in winter, the grass or almost the entire herbage present in snail habitats could result in heavy fasciolosis then that of the infection in summer, during which less cercariae are available due to active grass growth. Similar observations were also made by Khan et al. (2009) who mentions that the winter season is most favorable for transmission of fasciolosis in central Punjab and that high prevalence might be associated with conducive agro-

157

ecological conditions for development, spread and maturity of parasitic life cycle stages (Rowcliffe and Ollerenshaw, 1960; Thomas, 1883 a,b). These studies demonstrated that temperature ranging from 23-26oC is pre-requisite for egg formation and maturation (Rowcliffe and Ollerenshaw, 1960; Thomas, 1883 a) and growth in snails (Kendall, 1954). However, 90% humidity also facilitates embryonation (Andrews, 1999) followed by emergence of miracidium from eggs due to increased activity of cilia (Thomas, 1883a, b) and escape of cercariae from snails (Alicata, 1938; Dixon, 1966). The results of the present study indicate that fasciolosis is prevalent throughout the year in Potohar region. A similar finding was also reported by Maqbool et al. (2002) in central Punjab.

In Pakistan there are ten agro-ecological zones based on temperature, type of vegetation, topography of land and amount of rainfall received. Therefore, it is necessary to know about agro-ecological distribution of fasciolosis in relation to the freshwater snail intermediate host. This will help to devise effective control of fasciolosis. This study will possibly help determine seasonal fluctuation of cercariae shedding in and around contaminated water bodies of Potohar region.

This may also help in predicting future occurrence of Fasciola infection. This study has also initiated the rearing of Lymnaea. The findings of these investigations have provided a basic knowledge pertaining to the prevalence and seasonality of

Fasciola. Keeping in view the importance of fresh water snails and their role in the dissemination of digenetic trematodes infection in domesticated animals it has been recommended that host-parasite relationship should be worked out by designing host specific experimental trials with reference to Fasciola spp.

158

Chapter 7

GENERAL DISCUSSION

The results of this study revealed that in Potohar region, fasciolid forms of adults looked like Fasciola species and described as an intermediate form. These findings are in agreement with Ashrafi et al. (2006) and Periago et al. (2008) who reported intermediate forms of fasciolids in Iran and Egypt based on standard measurements. This is the first time that such a morphological investigation has been carried out in the northern part of Punjab province, Pakistan. Results compared data from two standard populations where geographically both species do not co- exist and with fasciolid population from geographical areas where both species co-exist. Results show that the morphological characteristics like body roundness, body length over body width and the distance between the ventral sucker and posterior end of the body provide useful tools for examining internal intra-specific morphological diversity in Fasciola adults. These morphological markers could be applied to specimens from geographical areas where both fasciolid species coexist.

Phenotypic variation present in free living species occurs when they come from different geographical locations or when pronounced changes occur in their environment (Periago et al., 2008). The hybridization phenomenon is known in other trematode species such as schistosome species. Previous studies (Webster and

Southgate, 2003; Fan and Lin et al., 2005) experimentally demonstrated that there are no reproductive isolation between schistosome species belonging to same group

159

Therefore the presence of different morphological types in fasciolids may suggest the likelihood of some degree of hybridization between F. hepatica and F. gigantica. Therefore "intermediate" forms have biological requirements in common that characterize different biological aspects of their epidemiology and transmission, which may help establish appropriate fasciolosis control measures.

The present investigation also suggests that simple morphological measurements may be enough to morphologically characterize fasciolids, especially in areas where intermediate forms exist. However, there are many variations in morphological characteristics which make it difficult to distinguish fasciolid species. Therefore, simple traditional microscopic measurements may be insufficient (Ashrafi et al., 2006). Morphometric differences of fasciolid body parts may be influenced by host species, age, immune status and/or previous exposure and intensity of infection (Ghavami et al., 2009). In such circumstances, a rapid molecular essay may provide sufficient information for identification of fasciolid species.

One of the major aims of the present study was to apply molecular tools for studying fasciolosis epidemiology in Potohar region. Previous work indicated that the application of molecular systematics provided a better framework for studying parasitic parasitology and epidemiology (Monis, 1999). Previously, many species have been described within the genus Fasciola, but F. hepatica and F. gigantica have been recognized to commonly parasitize animals and human beings

(Mascoma et al., 2005). Comparison of IT-S sequences of Potohar Fasciola species

160

with that of Fasciola hepatica and Fasciola gigantica revealed "intermediate

Fasciola", however the sequence variations was not related to geographical origins and particular host species.

It was also observed that no differences existed in the micro-satellite marker bands of definite hosts. Results showed that two out of six markers did not show polymorphism as compared to the other four markers, where polymorphism was indicated. Phylogenetic investigation has significance as it helps to understand the basis and important structure of the parasite and its biological and epidemiological aspects in species in (Traub et. al., 2005). The variation exhibited by Fasciola species in the Potohar region might be due to biotic and abiotic factors that determine the fitness of Fasciola spp. A previous study indicated that there was an overlapping pattern of Fasciola gigantica and Fasciola hepatica, which has generated the basis of a long running controversy on the taxonomic nature of the

Fasciola spp especially in Japan, Taiwan, Philippines and Korea where a wide range of morphological types has been identified. Under these circumstances, morphological studies based on ITS-1, ITS-2 sequence have provided useful information about the taxonomic status of Fasciola (Itagaki and Tsutsumi, 1998).

The results of our study indicate that the Fasciola reported in Potohar region resembles that reported in China, India, Iran and Vietnam. However, since our

Fasciola is a hybrid or an intermediate species, it is suggested that mitochondrial markers should be used to confirm them, as it will provide a more accurate picture of the genetic diversity of Fasciola spp.

In the present study ELISA was used for diagnosis of fasciolosis along with coprological examination. Serological diagnosis by ELISA has an advantage of

161

being able to detect infection much earlier (around third week) as compared to coprology. Furthermore, the drawback of FEC is few eggs due to low level of infection (Happich and Boray, 1969). All previous studies on the prevalence of fasciolosis were carried out by using conventional coprological techniques mostly through fecal analysis. Results show that ELISA was found to be more sensitive to infection as compared to fecal analysis. This might be due to the fact that antibodies against Fasciola are formed within two weeks post infection. These findings are consistent with Zimmerman et al. (1982) and Munguia-Xochitna et al.

(2007), as they reported that ELISA gave excellent results for the early diagnosis of fasciolosis. Furthermore, there was a significant breed differences in the acquisition of fasciolosis, which is in agreement with that of Preston and Allonby (1979). This might reflect that some breeds acquire resistance to parasitic infection due to natural adaptation in Fasciola endemic areas.

Knowledge of the population dynamics of Fasciola spp and their snail intermediate host is of importance to build comprehensive control programs. The results of present study indicated that the fresh water snail fauna was widely distributed in the summer rainy season compared to the winter season. Similar findings were reported by Brown (1980) who had reported different type of snails in the summer season. This is probably due to the favorable agro climatic conditions such as; water temperature, water pH and aquatic vegetation. Water temperature and pH are vital factors that facilitate the development of snails and cercariae (Ollerenshaw, 1958; Yilma, 1985).

162

Fresh water snail epidemiology is not very well known in Pakistan. In the present study it is observed that Gyraulus convexiusculus, Indoplanorbis exustus,

Bellamya bengalensis and Lymnaea acuminata were the most dominant species inhabiting fresh water bodies of Potohar region. A Previous study showed that the epidemiology of fasciolosis is dependent on the ecology of its intermediate host; mainly the snails of genus Lymnaea (Urquhart et al., 1996; Torgerson and Claxton,

1999). Therefore the present malacological findings provide baseline information about snail species that may act as an intermediate host for fasciolosis in Potohar region, Pakistan. It is well known that the molluscan population of an area depicts the prevalence and intensity of trematode infections (Chao et al., 1993; Toledo et al., 1998).

7.1 Outcome of Study

 Morphological identification and characterization conclude that the liver

fluke species in our study area, the Potohar region is not a pure breed F.

gigantica or F. hepatica but a hybrid form or intermediate with more

resemblance to Fasciola gigantica than to F. hepatica. Such a species is

referred to as Fasciola spp.

 Molecular identification using r DNA internal transcribed spacer 1 and 2

characterizes Fasciola spp in Potohar to be an intermediate/ hybrid

resembling more with F.gigantica.

 It was also concluded that Fasciola spp in cattle and buffalo are genetically

similar, as both hosts' posses Fasciola with the same number of base pairs

163

in their internal transcribed spacers as proved by gel electrophoresis and

sequencing.

 Phylogeny links the origin of the Fasciola in Potohar with Fasciola in

China, Vietnam, Iran and Egypt. The Fasciola in these countries are closely

related and serve as a point of origin.

 The microsatellite markers used show polymorphism and therefore indicate

presence of diversity in Fasciola spp in this region.

 The diagnostic tool established was species specific, based on the ES

antigen of the proteins derived from the species present in the study area

and therefore effectively capable of early detection of fasciolosis. This

diagnostic tool can be used for early infection detection in bovines

of other areas as well.

 Immunodiagnosis (ELISA) results exhibit that seroprevalence of fasciolosis

can be detected much earlier as compared to coprology and detection of

disease in its earliest stages of infection prompts timely treatment.

 Overall seroprevalence of fasciolosis in bovines was seen to be 55 percent

in Potohar area and it was seen to be breed, age and sex related. Fasciolosis

was more prevalent in buffaloes than cattle.

164

 Availability of snail fauna in the selected study sites was considered as a

potential threat for treatment of fasciolosis. Seasonal cercarial recovery

highlights July, August and September as maximum infection period.

7.2 Suggestions and Recommendations

 Based on this study it is suggested that identification and molecular

characterization of Fasciola should be carried out in different agro-

ecological regions of Pakistan, as there are reports of species variation in

highlands and lowlands. Since we have confirmed the presence of an

intermediate Fasciola spp, morphologically and molecularly, it is suggested

that further molecular work should be conducted by using Mt DNA markers

to confirm hybrids in the Potohar region.

 Similar sero-epidemiological studies in other parts of Pakistan may also be

initiated by applying ELISA. The study can be also be modified to observe

the influence of seasons on fasciolosis.

 Although not part of this study, GIS technique should be incorporated to

map risk areas of fasciolosis which will aid in control of the intermediate

host.

 Humans, which serve as an accidental host of fasciolosis, may also be

investigated for infection as there are recent reports by WHO that suggests

humans are prone to high risk of infection in those areas where cattle

raising is intense.

165

 SSR markers amplified in this study can be sequenced and deposited in the

gene bank so that more microsatellite markers can be synthesized to explore

the genetic diversity.

 Diversity of other freshwater snails should also be checked for their

potential role as an intermediate host(s) for fasciolosis/or other trematode

parasites.

166

SUMMARY

Fasciolosis is an economically important disease of domestic livestock and is caused by Fasciola spp commonly known as the liver fluke. This affects productivity of large ruminant’s world over by causing loss in body weight, decreased milk and beef production and decreased fertility in cattle. In ruminants, transmission is through contaminated herbage with snails serving as a suitable intermediate host. Fasciola is absent in areas where agro-ecological conditions are unfavorable for the development of snails. In Pakistan, epidemiological information about fasciolosis is scarce especially in Potohar rain-fed areas. The distribution pattern of snails and the epidemiological knowledge of fasciolosis are necessary because cattle raising is of major importance not only to the subsistence farmer but to the national economy. The present study identified the Fasciola spp as the species prevalent in Potohar region by morphometrical measurements and genetic characterization. The polymerase chain reaction (PCR) technique was used to analyze molecular identification and characterization by using specific gene primers, cloning of the Internal Transcribed Spacer (ITS) regions of ribosomal gene and their sequence comparison. Genetical variation and diversity was also investigated with the help by using microsatellite molecular markers. The distribution pattern of fasciolosis in two different zones of Potohar region,

(Khairimurat and Rawal dams) was also assessed. Monthly availability of cercariae/ metacercariae (infective stages) of Fasciola spp from herbage samples of

Potohar areas was also identified with its relation to cercarial/metacercarial availability in different months. The snail fauna serving as a possible intermediate

167

host of Fasciola spp was identified and Lymnaea acuminata and Gyraulus convexiusculus were noted as a potential threat for spread of fasciolosis. Diagnosis of Fasciola infection from bovines was determined by coprological and serological assay (i ELISA). The seroprevalence of fasciolosis in buffaloes and cattle was 60 percent and 50 percent respectively. Whereas coprology indicated was 53 percent and 37 percent respectively.

The findings of this study not only provide knowledge pertaining to the prevalence and seasonality of Fasciola infecting large ruminants in different zones of Potohar region, but also identified the species as a hybrid and not a pure one.

Previously work done in Pakistan was mostly based on fascioliasis and its relation with seasonal prevalence, efficacy of different anthelmintics treatment and on assessing liver damage of buffaloes with fasciolosis.

The results of this study may help devise strategically timed anthelmintic treatment along with some forms of pasture management. This only prevents or delays re-infection after treatment. These findings will be used to assess the risk of fasciolosis by providing sufficient basis for prevention and control. This will enhance the well being and productivity in large ruminants grazing in Potohar region.

168

LITERATURE CITED

Aal, A. A., A. M. Abou Eisha and M. W. El-sheary. 1999. Prevalence of fascioliasis

among man and animals in Ismalia province. Assuit. Vet. Med. J., 41: 141-152

Adlard, R. D., S. C. Barker, D. Blair and T. H. Cribb. 1993. Comparison of the second

internal transcribed spacer (ribosomal DNA) from populations and species of

Fasciolidae (Digenea). Int. J. Parasitol., 23: 423–425.

Adnan, S. and A. H. Khan. 2009. Effective Rainfall for Irrigated Agriculture Plains of

Pakistan. Pak. J. Meteor., 6 (11): 61-72.

Adnan, S., R. Mahmood and A. Hayat Khan. 2009. Water Balance Conditions in Rain fed

Areas of Potohar and Balochistan Plateau during 1931-08. W. App. Sci. J., 7 (2):

162-169.

Afshan, K. 2009. Immunoiagonosis of Fasciola hepatica in small ruminants of Potohar

region. M. Phil Thesis, PMAS-Arid Agriculture University, Rawalpindi. 56-77.

Afzal, H., M.Z. Khan and M. Arshad. 1995. An out break of Fasciolosis at a sheep farm.

Pak. Vet. J., 15 (4): 202.

Afzal, M., M.Q. Khan and M. Hussain. 1997. An outbreak of acute Fasciolosis in goats.

Pak. Vet. J., 17: 154-155.

169

Agatsuma, T., Y. Arakawa, M. Iwagami, Y. Honzako, U. Cahyaningsih, S.Y. Kang and

S.J. Hong. 2000. Molecular evidence of natural hybridization between Fasciola

hepatica and F. gigantica. Parasitol. Int., 49: 231–238.

Ajzenberga, D., A. Ban˜ulsb, M. Tibayrencb and M. Laure Darde. 2002. Microsatellite

analysis of Toxoplasma gondii shows considerable polymorphism structured into

two main clonal groups. Int. J. Parasitol., 32: 27–38.

Akhtar, S. 1978. On a collection of Freshwater Molluscs from Lahore. Biologia., 24: 437-

447.

Alasaad, S., C. Q. Huang, Q.Y. Li, J. E. Granados, C. Garcıa-Romero and J. M. Perez.

2007. Characterization of Fasciola samples from different host species and

geographical localities in Spain by sequences of internal transcribed spacers of

rDNA. Parasitol. Res., 101: 1245–1250.

Alicata, J.E. 1938. Observations on the life histoy of Fasciola gigantica, the common liver

fluke of cattle in Hawaii, and the intermediate host, Fossaria ollula. Bulletin No 80

of the Hawaii Agricultural Experimental Station, Honolulu, pp1-22.

Al-Kubaisee, R. Y. and K. I. Altaif. 1989. Comparative studies of sheep and buffalo

isolates of F. gigantica in the intermediate host L. auricularia. Res. Vet. Sci., 47:

273-274.

170

Anderson, N., T. T. Luong, N. G. Vo, K.L. Bui, P. M. Smooker and T.W. Spithill. 1999.

The sensitivity and specificity of two methods for detecting Fasciola infections in

cattle. Vet. Parasitol., 83: 15–24.

Anderson, P.H., J.G. Matthews, S. Berrett, P. J. Brush and D. S. Patterson. 1981. Changes

in plasma enzyme activities and other blood components in response to acute and

chronic liver damage in cattle. Res. Vet. Sci., 31: 1-4.

Andrews, S.J. 1999. The Life Cycle of Fasciola hepatica, in: Dalton J.P. (Ed.), CAB

International, Oxon., pp. 1–29.

Anh, N. T. L., N. T. Phuong, G. H. Ha, L. T.Thu, M. V. Johansen, D. K. Murrell and S. M.

Thamsborg. 2008. Evaluation of techniques for detection of small trematode eggs

in feces of domestic animals. Vet. Parasitol., 156 (3-4): 346-349.

Anwar, M. and A. Q. Chaudhri. 1984. Incidence of fascioliasis in sheep and goats of

Faisalabad. Pak. Vet. J., 4: 35-36.

Asanji, M .F. 1988. Haemonchosis in sheep and goats in Sierra Leone. J. Helminthol., 62

(3):243-9.

Ashrafi, K., M. A. Valero, M. Panova, M.V. Periago, J. Massoud and S. Mas-Coma. 2006.

Phenotypic analysis of adults of Fasciola hepatica, Fasciola gigantica and

intermediate forms from the endemic region of Gilan, Iran. Parasitol. Int., 55: 249–

260.

171

Aslam, M., M. Nawaz and M. S. Khan. 2002. Comparative performance of some cattle

breeds under barani conditions of Pakistan. Int. J. Agri. Biol., 4: 565-567

Aspock, H., H. Auer and O. Picher. 1999. Parasites and parasitic diseases in prehistoric

human populations in Central Europe. Helminthologia, 36: 139–145.

Awad, W. S., A. K. Ibrahim and F.A. Salib. 2009. Using indirect ELISA to assess different

antigens for the serodiagnosis of Fasciola gigantica infection in cattle, sheep and

donkeys. Res. Vet. Sci., 86: 466–471.

Baig, M., A. Beja-Pereira, R. Mohammad, K. Kulkarni, S. Farah and G. Luikart. 2005.

Phylogeography and origin of Indian domestic cattle. Curr. Sci., 89: 38–40.

Bargues, M. D., M. Vigo, P. Horak, J. Dvorak, R. A. Patzner and J.P. Pointier. 2001.

European Lymnaeidae (Mollusca: Gastropoda), intermediate hosts of

trematodiases, based on nuclear ribosomal DNA ITS-2 sequences. Infect. Genet.

Evol., 1: 85–107.

Bargues, M.D., and S. Mas-Coma. 2005a. Reviewing lymnaeid vectors of fascioliasis by

ribosomal DNA sequence analyses. J. Helminthol., 79: 257–267.

Bargues, M.D., P. Horak, R. A. Patzner, J.P. Pointier, M. Jackiewicz and C. Meier-Brook.

2003. Insights into the relationships of Palaearctic and Nearctic lymnaeids

(Mollusca: Gastropoda) by rDNA ITS-2 sequencing and phylogeny of Stagnicoline

intermediate host species of Fasciola hepatica. Parasite, 10: 243–255.

172

Bedarkar, S. N., B.W. Narladkar and P. D .Deshpande. 2000. Prevalence of snail borne

fluke infections in ruminants of Marathwada region. J. Parasitol., 77:751-754.

Begum, F. and S. N. Rizvi. 1988. Study of invertebrate macro-fauna of Layari River in

Karachi with special reference to molluscan fauna. Ph.D. Thesis, Karachi

University.

Behm, C. A. and N. C. Sangster. 1999. Pathology, patho-physiology and clinical aspects.

In: Dalton, J.P. (Ed.), Fasciolosis. CAB International Publishing, Wallingford., pp.

185–224.

Bell, R. B. 2005. Liver fluke: Unseen but expensive. Beef, 22 July.

Bergeon, P and M. Laurent. 1970. Difference entre la morphologie testiculaire de Fasciola

hepatica et Fasciola gigantica. Rev. Elev. Med. Vet. Pays Trop., 23: 223-227

Bilal, M. Q., M. Suleman and A. Raziq. 2006. Buffalo: Black gold of Pakistan Livestock

Research for Rural Development, 18: 9.

Boray, J.C. 1969. "Experimental fascioliasis in Australia". Adv. Parasitol., 7: 95–210.

Boray, J.C. 1997. Chemotherapy of infections with Fasciolidae. In: Immunology,

Pathobiology and Control of Fasciolosis, ed. J.C. Boray., pp. 83–97. Rahway, New

Jersey: MSD AGVET.

173

Boray, J.C. 1999. Liver Fluke Disease in Sheep and Cattle. Agfact AO.9.5.7, second ed.

revised by G.W. Hutchinson, S. Love. NSW, Agriculture.

Boray, J.C. 1990. Drug resistance in Fasciola hepatica. In: Boray, J.C., Martin, P.J.,

Roush, R.T. (Eds.), Round Table Conference of the VIIth ICOPA on Resistance of

Parasites to Antiparasitic Drugs, Paris, p. 51–57.

Boray, J.C., R. Jackson and M.B. Strong. 1985. Chemoprophylaxis of fascioliasis with

triclabendazole. New Zealand.

Borror, D.J. 1971. Dictionary of Word Roots and Combining Forms. Mayfield Publishing

Company, Palo Alto, CA. p.134.

Bossaert, K, E, Jacquinet, J. Saunders, F. Farnir and B. Losson. 2000. Cell-mediated

immune response in calves to single-dose, trickle, and challenge infections with

Fasciola hepatica. Vet. Parasitol., 88(1-2):17-34.

Bouchet, F., S. Harter and M. Le Bailly. 2003. The state of the art of palaeo-parasitological

research in the old World. Mem. Inst. Oswaldo Cruz., 98 (Suppl. 1): 95–101.

Bowles, J., D. Blair and D.P. McManus. 1995. A molecular phylogeny of the human

schistosomes. Mol. Phylogenet. Evol., 4: 103–109.

174

Bradford, M. 1976. A Rapid and Sensitive Method for the Quantitation of Microgram

Quantities of Protein Utilizing the Principle of Protein-Dye Binding. Anal.

Biochem., 72:248-254.

Brown, D. 1994. Freshwater Snails of Africa and Their Medical Importance. Second ed.

Taylor & Francis Ltd, London, United Kingdom.

Bruford, M. W., D. J. Cheesman, T. Coote, H. A. A. Green, S. A. Haines, C. O'Ryan and

T. Williams. 1996. Microsatellites and their application to conservation genetics. In

Molecular genetic approaches in conservation (ed. T. B. Smith and R. K. Wayne),

Oxford University Press, p. 278-297.

Bruford, M.W., D.G. Bradley and G. Luikart. 2003. DNA markers reveal the complexity

of livestock domestication. Nat. Rev. Genet., 4: 900–910.

Bukhary, S. H. Z. 1988. Immunotaxino studies in F. hepatica. M. Phil Thesis, QAU,

Islamabad.

Bürger, R.. and R. Lande. 1994. on the distribution of the mean and variance of a

quantitative trait under mutation-selection-drift balance. Genetics, 138: 901-912.

Burdi, G. H., W. A. Baloch, F. Begum, A. N. Soomro and M. Y. Khuhawar. 2008.

Ecological studies on freshwater gastropods (snails) of Indus River and its canals at

Kotri barrage Sindh, Pakistan. Sindh, Univ. Res. J., 40 (2): 37-40.

175

Buriro, S. N., M. S. Phulan and B. M. Junejo. 1984. Epizootiology of fascioliasis in

livestock in Sind. Pak. Vet. J., 4(1): 29-30.

Castresana, J. 2000. Selection of conserved blocks from multiple alignments for their use

in phylogenetic analysis. Mol. Bio. Evo., 17: 540-552

Chao, D., L. C. Wang and T. C. Huang. 1993. Prevalence of larval helminths in fresh

water snails of Kinmen Islands. J. Helminthol., 67: 259-264.

Chaudhry, A. H. and M. Niaz. 1984. Liver fluke a constant threat to livestock

development. Pak. Vet. J., 4: 42-43.

Chen, M. G. and K. E. Mott. 1990. Progress in assessment of morbidity due to Fasciola

hepatica infection: a review of recent literature. Trop. Dis. Bull., 87: R1–R38.

Chen, S. Y., Z.Y. Duan, T. Sha, J. Xiangyu, S.F. Wu, and Y.P. Zhang. 2006. Origin,

genetic diversity, and population structure of Chinese domestic sheep. Gene, 376:

216–223.

Chevenet, F., C. Brun, A. L. Banuls, B. Jacq and R. Christen. 2006. TreeDyn: towards

dynamic graphics and annotations for analyses of trees. BMC Bioinformatics, 7:

439.

176

Chistiakov, D.A, K.V. Savost'anov, R.I. Turakulov, I. A. Efremov and L. M. Demurov.

2006. Genetic analysis and functional evaluation of the C/T (-318) and A/G (-1661)

polymorphisms of the CTLA-4 gene in patients affected with Graves' disease. Clin.

Immunol., 118(2-3): 233-42.

Clarkson, M. J. 1989. The cost of liver fluke infection and its control in sheep. Proceedings

of Second International Congress for Sheep Veterinarians, Palmerston North, New

Zealand, 358-365.

Claxton, J. R., H. Zambrano, P. Ortiz, C. Amorós, , E. Delgado, E. Escurra and M. J.

Clarkson. 1997. The epidemiology of fasciolosis in the inter-Andean valley of

Cajamarca, Peru. Parasitol. Int., 46: 281-288.

Clery, D., P. Torgerson and G. Mulcahy. 1996. Immune responses of chronically infected

adult cattle to Fasciola hepatica. Vet. Parasitol., 62, 71-82.

Cobbold, T.S. 1855. Description of a new trematode worm (Fasciola gigantica).

Edinbourg, 2: 262–266.

Coelho, L. H. L. and W. S. Lima. 2003. Population dynamics of Lymnaea columella and

its natural infection by F. hepatica in State of Minas Gerais, Brazil. J. Helminth.,

77: 7-10.

177

Conceicao, M. A., R. M. Durao, I. H. Costa and J. M. da Costa. 2002. Evaluation of a

simple sedimentation method (modified McMaster) for diagnosis of bovine

fasciolosis. Vet. Parasitol., 105: 337-343.

Cornelissen, J. B. W. J., C. P. H. Gaasenbeek, F. H. M. Borgsteede, W. G. Holland, M. M.

Harmsen and W. J. A. Boersma. 2001. Early immunodiagnosis of fasciolosis in

ruminants using recombinant Fasciola hepatica cathepsin L-like protease. Int. J.

Parasitol., 31: 728–737.

Dalimi, A and M. Jabarvand. 2005. Fasciola hepatica in the human eye: A case report.

Trans. R. Soc.Trop. Med. Hyg., 99: 798-800.

Daniel, R. and S. Mitchell. 2002. Fasciolosis in Cattle and Sheep. Vet. Rec., 17: (7) 151-

219.

Dar, Y., P. Vignoles, D. Rondelaud and G. Dreyfuss. 2004. Larval productivity of F.

gigantica in two lymnaeid snails. J. Helminth., 78(3): 215-218.

Dar, Y., P. Vignoles, D. Rondelaud and G. Dreyfuss. 2002. F. gigantica: the growth and

larval productivity of redial generations in the snail L. truncatula. Parasitol. Res.,

88(4): 364-367.

Dar, Y., P. Vignoles, D. Rondelaud and G. Dreyfuss. 2003. F. gigantica: larval

productivity of three different miracidial isolates in the snail L. truncatula. J.

Helminth., 77(1): 11-14.

178

Dargie, J. D. 1986. The impact on production and mechanisms of pathogenesis of

trematode infections in cattle and sheep. In: Howell, M.J. (Ed.) Parasitology - Quo

Vadit, Canberra, Australia., 453-463.

Dereeper, A., V. Guignon, G. Blanc, S. Audic, S. Buffet, F. Chevenet, J. F. Dufayard, S.

Guindon, V. Lefort, M. Lescot, J. M. Claverie, and O. Gascuel. 2008. Phylogeny.

In: robust phylogenetic analysis for the non-specialist. Nucleic Acids Res., 1: 36.

Despommier, D. D. and J. W. Karapelou. 1987. Parasite Life Cycles, Springer-Verlag,

New York. Development of vaccines against Fasciola hepatica. CAB

International, Oxon, 1999., 377–410.

Dillon, R. T., J. A. R. Wethington, J. M. Rhett, and T. P. Smith. 2002. Populations of the

European freshwater pulmonate Physa acuta are not reproductively isolated from

American Physa heterostropha or Physa integra. Invertebrate Biology, 121(3):

226-234.

Dittmar, K and W. R. Teegen. 2006. The presence of Fasciola hepatica (Liver-fluke) in

humans and cattle from a 4,500 Year old archaeological site in the Saale-Unstrut

Valley, Germany Mem. Inst. Oswaldo Cruz, Rio de Janeiro., suppl.1 (98).

Dittmar, K. and W.R. Teegen. 2003. The presence of Fasciola hepatica (liver-fluke) in

humans and cattle from a 4,500 year old archaeological site in the Saale-Unstrut

valley, Germany. Mem. Inst. Oswaldo Cruz., 98 Suppl 1: 141-143.

179

Dixon, K. E. 1966. The physiology of excystment of the metacercariae of Fasciola

hepatica L. Parasitol., 56: 431-458.

Dommelier, S., S. Bentrad, F. Bouchet, J.C. Paicheler and P. Pétrequin.1998. Parasitoses

liées à l'alimentation chez les populations du site néolithique de Chalain (Jura,

France). Anthropozoologica, 27: 41-49.

Doyle, J. J. 1973. The relationship between the duration of a primary infection and the

subsequent development of an acquired resistance to experimental infections with

Fasciola hepatica in calves. Res. Vet. Sci., 14: 97-103.

Dreyfuss, G and D. Rondelaud. 1994. Fasciola hepatica: a study of the shedding of

cercariae from Lymnaea truncatula raised under constant conditions of temperature

and photoperiod. Parasite, 1(4): 401-4.

Dreyfuss, G. and D. Rondelaud. 1995. Comparative studies on the productivity of F.

gigantica and F. hepatica sporocysts in L. tomentosa died after a cercarial shedding

or without emission. Parasitol. Res., 81: 531-536.

Dreyfuss, G. and D. Rondelaud. 1997. F. gigantica and F. hepatica: comparative studies

of some characteristics of Fasciola infection in L. truncatula infected by either of

the two trematodes. Vet. Res., 28: 123-130.

180

Dryden, M. W., P. A. Payne, R. Ridley and V. Smith. 2005. Comparison of Common

Fecal Flotation Techniques for the Recovery of Parasite Eggs and Oocysts. Vet.

Therapeutics, 6 (1): 15-28.

Dubinský, P. 1993. Trematódy a trematodózy. In: Jurášek, V., Dubinský, P. a kolektív,

Veterinárna parazitológia. Príroda a.s., Bratislava., 158–187. (in Slovakian)

Duménigo, B. E., A. M. Espino, C. M. Finlay, M. Mezo. 2000. "Kinetics of antibody-

based antigen detection in serum and faeces of sheep experimentally infected with

Fasciola hepatica a". Vet. Parasitol., 89 (1-2): 153–61.

Dunn, A. M. 1978. Veterinary Helminthology. 2nd Ed. Butler and Tanner, Ltd. London,

UK., 15-159.

Edgar, R. C. 2004. MUSCLE: multiple sequence alignment with high accuracy and high

throughput. Nucleic Acids Research, 32(5): 1792-97.

El-shazly, A. M., A. E. Handousagabr, A. T. Morsyramadan, and T. A. Morsy. 2002.

Evaluation of two serological tests in diagnosis of human cases of biliary and

ectopic fascioliasis. J. Egypt Soc. Parasitol., 32: 79-90.

El-Shinnawy, I.A., E. M. Abdel-Meguid, M. M. Nour Eldin and M. F. Bakry. 2000. Impact

of Aswan high dam on the aquatic weed ecosystem, Cairo University, Egypt,

ICEHM, 534-541.

181

Erensoy, A., S. Kuk, and M. Ozden. 2009. Genetic identification of Fasciola hepatica by

ITS-2 sequence of nuclear ribosomal DNA in Turkey. Parasitol. Res., 105: 407-

412.

Espino, A. M and C. M. Finlay. 1994. Sandwich enzyme-linked immunosorbent assay for

detection of excretory secretory antigens in humans with fascioliasis. J. Clin.

Microbiol., 32: 190–193.

Esteban, J. G., A. Flores, R. Angles and S. Mas-Coma. 1999. High endemicity of human

fascioliasis between lake Titicaca and La Paz valley, Bolivia, Trans. R. Soc. Trop.

Med. Hyg., 93: 151–156.

Esteban, J.G., M.D. Bargues and S. Mas-Coma. 1998. Geographical distribution, diagnosis

and treatment of human fascioliasis: a review. Res. Rev. Parasitol., 58: 13–42.

Estoup A and O.Martin.1996. Marqueurs microsatellites: isolement à l’aide de sondes non-

radioactives, caractérisation et mise au point. Protocols available at the address:

http:// www.inapg.inra.fr/dsa/microsat/microsat.htm.

Estuningsih E, T. Spithill, H .Raadsma, R. Law, G .Adiwinata, E .Meeusen and D.

Piedrafita. 2009. Development and application of a fecal antigen diagnostic

sandwich ELISA for estimating prevalence of Fasciola gigantica in cattle in

central Java, Indonesia. J. Parasitol., 95(2):450-5.

182

Fagbemi, B. O., O. A. Aderibigbe and E. E. Guobadia. 1997. The use of monoclonal

antibody for the immunodiagnosis of Fasciola gigantica infection in cattle. Vet.

Parasitol., 69 (3-4): 231-40.

Fairweather, I., and J. C. Boray. 1999. Fasciolicides: efficacy, actions, resistance and its

management. Vet. J., 158 (2): 81–112.

Fan, P.C and L.H Lin. 2005. Hybridization of Schistosoma mansoni and Schistosoma

japonicum in mice. Southeast Asian J. Trop. Med. Public Health, 36: 89–96.

Farag, H.F. and E.l. Sayad. 1995. Biomphalaria alexandrina naturally infected with

Fasciola gigantica in Egypt. Trans. R. Soc. Trop. Med. Hyg., 89: 36.

Farag, H. F., A. Salem, S. S. Khalil and A. Farahat. 1993. Studies on human fascioliasis in

Egypt. 1- Seasonality of transmission. J. Egypt. Soc. Parasitol., 23: 331–340.

Farag, M. A, A. al-Sukayran, K. S. Mazloum and A. M. al-Bukomy. 1998. Epizootics of

bovine ephemeral fever on dairy farms in Saudi Arabia. Rev. Sci. Tech., 17(3):

713-22.

Farahnak, A., R. Valfaie-Darian and I. Mobedi. 2006. A faunistic survey of cercariae from

freshwater snails: Melanopsis spp. And their role in disease transmission. Iranian J.

Publ. Health, 35 (4): 70-74.

183

Foreyt, W. J. and A.C. Todd. 1976. Liver flukes in cattle. Prevalence, distribution, and

experimental treatment. Vet. Med. Small Anim. Clin., 71: 816-822.

Foreyt, W.J and A. C.Todd. 1976. Effects of six fasciolicides against Fascioloides magna

In white-tailed deer. J. Wildlife Dis., 12(3):361-6.

Foreyt, W.J. and A.C. Todd. 1982. The role of liver fluke in infertility in beef cattle. In:

Proceedings of the American Association of Bovine Practitioners, April, 99-103.

Foreyt, W. J. 1989. Diagnostic parasitology. Vet. Clin. North Am. Small Anim. Pract.,

19(5): 979-1000.

Frandsen, F. and N. de Christensen. 1984. An introductory guide to the identification of

cercariae from African freshwater snails with special reference to cercariae of

medical and veterinary importance. Acta. Tropica., 41: 181-202.

Garcia, L. S. 2001. Diagnostic Medical Parasitology, 4th Ed., ASM Press, Washington,

DC.

Gascuel, O. 1997. BIONJ: an improved version of the NJ algorithm based on a simple

model of sequence data. Mol. Bio. Evo., 14: 685-695.

Gasser, R.B. and N. B. Chilton. 1995. Characterization of Taeniid Cestode species by

PCR-RFLP of ITS-2 ribosomal DNA. Acta. Trop., 59: 31–40

184

Ghavami, M., B. P. Rahim, A. Haniloo and S.N. Mosavinasab. 2009. Genotypic and

Phenotypic Analysis of Fasciola Isolates Iranian J. Parasitol., 4 (3): 61-70.

Ghobadi, H. and A. Farahnak. 2004. A faunistic survey on the cercariae of Bellamaya

(Viviparus) bengalensis snails and their zoonotic importance. Iranian J. Publ.

Health, 33: 38-42.

Goel, H. C. and C. P. Srivastava. 1980. Freshwater snails of Gwalior (M. P). J. Bombay.

Nat. Hist. Soc., 77(2): 215-222.

Gonenc, B., H. Sarimehmetoúlu and F. Kircali. 2004. Comparison of Crude and

Excretory/Secretory Antigens for the Diagnosis of Fasciola hepatica in Sheep by

Western Blotting. Turk. J. Vet. Anim. Sci., 28: 943-949.

GOP. 2009. Economic survey of Pakistan, 2009 Economic Affair Division, Government

of Pakistan, Islamabad.

Graczyk, T.K. and B. Fried. 1999. Development of Fasciola hepatica in the intermediate

host. In: Dalton (Ed.), Fasciolosis, CAB International Publishing, Wallingford,

United Kingdom, 31–46.

Gupta, P. K and R. K. Varshney. 2000. The development and use of microsatellite markers

for genetic analysis and plant breeding with emphasis on bread wheat. Euphytica,

113:163–185.

185

Gur-Arie, R, C. J. Cohen , Y. Eitan , L, Shelef, E. M. Hallerman and Y. Kashi. 2000.

Simple sequence repeats in Escherichia coli: abundance, distribution, composition,

and polymorphism. Genome Res., 10 (1): 62-71.

Hamada, H., M. G. Petrino and T. Kakunaga. 1982. A novel repeated element with Z-

DNA-forming potential is widely found in evolutionarily diverse eukaryotic

genomes. Proc. Natl. Acad. Sci. USA., 79: 6465–6469.

Happich, F. A. and J. C. Boray. 1969. Quantitative diagnosis of chronic fasciolosis:

Comparative studies on quantitative faecal examinations for chronic Fasciola

hepatica infection in sheep. Australian Vet., 45: 326-328

Haridy, F. M., B. B. Ibrahim, T. A. Morsy and I. M. El- Sharkawy. 1999. Fascioliasis : an

increasing zoonotic disease in Egypt. J. Egypt. Soc. Parasitol., 29: 35-48.

Haroun, E.T. and G. V. Hillyer. 1986. "Resistance to fascioliasis--a review". Vet.

Parasitol., 20 (1-3): 63–93.

Haseeb, A. N., A. M. el-Shazly, M. A. Arafa and A. T. Morsy. 2002. A review on

fascioliasis in Egypt. J. Egypt Soc. Parasitol., 32: 317–354.

Hashimoto, K. T., C. Watanobe, C. X. Liu, I. Init, D. Blair, S. Ohnishi, and T. Agatsuma.

1997. Mitochondrial DNA and nuclear DNA indicate that the Japanese Fasciola

species is F. gigantica. Parasitol. Res., 83: 220–225.

186

Hashmi, H.A and M. A. Muneer. 1981. Subclinical mastitis in buffaloes at Lahore.

Pak.Vet. J., 1(4): 164.

Hayat, C. S., Z. Iqbal, B. Hayat and M. Nisar Khan. 1986. Studies on the seasonal

prevalence of fasciolosis and lungworm disease in sheep at Faisalabad. Pak.Vet. J.,

6 (3): 131.

Hernandez Fernandez, M. and E. S. Vrba. 2005. A complete estimate of the phylogenetic

relationships in Ruminantia: A dated species-level supertree of the extant

ruminants. Biol. Rev., 80: 269–302.

Hillis, D.M. and M.T. Dixon. 1991. Ribosomal DNA: molecular evolution and

phylogenetic inference. Q. Rev. Biol., 66: 411– 453.

Hillyer, G. V. and W. Apt. 1997. Food-borne trematode infections in the Americas,

Parasitol. Today, 13: 87–88.

Hillyer, G.V. 1988. "Fascioliasis and fasciolopsiasis." in A. Turano; Balows, Albert; M.

Ohashi. Laboratory diagnosis of infectious diseases: principles and practices. 1:

Bacterial, mycotic, and parasitic diseases. Berlin: Springer-Verlag., 856– 62.

Hillyer, G.V. 1999. "Immunodiagnosis of human and animal fasciolosis." in Dalton J. P:

Fasciolosis. Wallingford, Oxon, UK: CABI Pub. 435–447.

187

Holder, M. and P. O. Lewis. 2003. Phylogeny estimation: Traditional and Bayesian

approaches. Nat. Rev. Genet., 4: 275.

Hope-Cowerdy, M. J., K. L. Strickland, A. Conway and B. J. Crowe. 1977. Production

effects of liver fluke in cattle. In: The effects of infection on live weight gain, feed

intake and food conversion efficacy in beef cattle. Brit. Vet. J., 133: 145-149.

Huang, W. Y., B. He, C. R. Wang and X. Q. Zhou. 2004. Characterization of Fasciola

species from Mainland China by ITS-2 ribosomal DNA sequence. Vet. Parasitol.,

120: 75–83.

Huelsenbeck, J. P. and F. Ronquist. 2001. MR BAYES: Bayesian inference of phylogeny.

Bioinformatics, 17: 754-755.

Hurtrez-Boussès, S., C. Meunier, P . Durand and F. Renaud. 2001. Dynamics of host–

parasite interactions: the example of population biology of the liver fluke (Fasciola

hepatica). Microbes and Infection, 3: 841–849.

Hurtrez-Bousses, S., P. Durand, R. Jabbour-Zahab, J. F. Guegan, C. Meunier, M. D.

Bargues, S. Mas-Coma and F. Renaud. 2004. Isolation and characterization of

microsatellite markers in the liver fluke (Fasciola hepatica). Mol. Ecol. Notes, 4:

689-690.

188

Ibarra, F., Y. Vera and H. Quiroz. 2004. Determination of the effective dose of an

experimental fasciolicide in naturally and experimentally infected cattle. Vet.

Parasitol., 120 (1-2): 65–74.

Intapan, P. M, W. Maleewong , S. Nateeworanart, C. Wongkham, V. Pipitgool,V.

Sukolapong and S. Sangmaneedet. 2003. Immunodiagnosis of human fascioliasis

using an antigen of Fasciola gigantica adult worm with the molecular mass of 27

kDa by a dot-ELISA. Southeast Asian J. Trop. Med. Public Health, 34 (4): 713-7.

Iqbal, M. U., M. S. Sajid, A. Hussain and M. K. Khan. 2007. Prevalence of Helminth

Infections in Dairy Animals of Nestle Milk Collection Areas of Punjab (Pakistan)

VIII World Buffalo Congress Ital. J. Anim. Sci., 6 (2): 935-938.

Ishii, Y., F. Nakamura-Uchiyama and Y. Nawa. 2002. A Praziquantel ineffective

fascioliasis case successfully treated with triclabendazole. Parasitol. Int., 51: 205–

209.

Itagaki, T. and K. I. Tsutsumi. 1998. Triploid form of Fasciola in Japan: genetic

relationships between Fasciola hepatica and Fasciola gigantica determined by

ITS-2 sequence of nuclear rDNA. Int. J. Parasitol., 28: 777–781.

Itagaki, T., K. I. Tsutsumi, K. Ito and Y. Tsutsumi. 1998. Taxonomic status of the

Japanese triploid forms of Fasciola: comparison of mitochondrial ND1 and COI

sequences with F. hepatica and F. gigantica. J. Parasitol., 84: 445– 448.

189

Itagaki, T., M . Kikawa, K. Sakaguchi, K. Terasaki, T. Shibahara and K. Fukuda. 2005b.

Molecular characterization of parthenogenic Fasciola sp in Korea on the basis of

DNA sequences of ribosomal ITS1 and mitochondrial NDI gene. J. Vet. Med. Sci.,

67: 1115-1118.

Itagaki, T., M. Kikawa, K. Sakaguchi, J. Shimo, K. Terasaki, T. Shibahara and K. Fukuda.

2005a. Genetic characterization of parthenogenic Fasciola sp. in Japan on the basis

of the sequences of ribosomal and mitochondrial DNA. Parasitol., 131: 679–685.

Itagaki, T., M. Kikawa, K. Terasaki, T. Shibahara and K. Fukuda. 2005b. Molecular

characterization of parthenogenic Fasciola sp. in Korea on the basis of DNA

sequence of ribosomal ITS1 and mitochondrial NDI gene. J. Vet. Med. Sci., 67:

1115–1118.

Jabbar, A., Z. Iqbal, D. Kerboeuf, G. Muhammad, M. N. Khan and M. Affaq. 2006.

Anthelmintic resistance. The state of play revisited. Life Sci., 79: 2413–2431.

Jousson, O., P. Bartoli and J. Pawlowski. 1998a. Use of the ITS rDNA for elucidation of

some life-cycles of Mesometridae (Trematoda, Digenea). Int. J. Parasitol., 28(9):

1403-11.

Jousson, O., P. Bartoli and J. Pawlowski. 1998b. Molecular phylogeny of Mesometridae

(Trematoda, Digenea) with its relation to morphological changes in parasites.

Parasite, 5(4): 365-9.

190

Jousson, O., P. Bartoli, L. Zaninetti and J. Pawlowski. 1998. Use of the ITS rDNA for

elucidation of some life-cycles of Mesometridae (Trematoda, Digenea). Int. J.

Parasitol., 28: 1403–1411.

Kelly, W. R. 1974. Veterinary Clinical Diagnosis. 2nd Ed. Balliere Tindall Company,

London.

Kendall, S. B. 1954. Fasciolosis in Pakistan. Ann. Trop. Med. Parasitol., 48: 307-313

Kendall, S.B. 1965. Relationships between the species of Fasciola and the molluscan

hosts. Adv. Parasitol., 3: 59–98.

Khan, M. D. and S. G. Dastagir. 1971. On the Mollusca, Gastropoda fauna of Pak. Rec.

Zool. Survey. Pak., 1: 17-130.

Khan, M. K., M. S. Sajid, M. N. Khan, Z. Iqbal and M. U. Iqbal. 2009. Bovine fasciolosis:

Prevalence, effects of treatment on productivity and cost benefit analysis in five

districts of Punjab, Pakistan. Res. Vet. Sci., 87: 70-75.

Khan, M. K., M.S. Sajid, M. N. Khan and Z. Iqbal. 2009. Bovine fasciolosis: Prevalence,

effects of treatment on productivity and cost benefit analysis in five districts of

Punjab Pakistan, Res. Vet. Sci., 24: 239-246.

Khan, M. Q., A. H. Cheema and M.A. Chisti. 1991. Fasciolosis in Rawalpindi/Islamabad

area. Pak. Vet. J., 11(3): 147

191

Khan, M. S. 2003. Azi-Kheli buffalo – an important genetic resource. Buffalo Newsletter,

18: 3.

Khatoon, S and S. R. Ali. 1978. Freshwater Mollusks of Pak. Bull. Hydrobiol. Res. Ser., 1:

518-525.

Kirkpatrick, C. E. and R. B. Grieve. 1987. Giardiasis., In: Parasitic infections. Vet. Clin.

North Am. Sm. Anim. Pract., Philadelphia: W.B. Saunders, 17: 1377-1387.

Kimura, S., A. Shimizuand and J. Kawano. 1984. Morphological observation on liver fluke

detected from naturally infected Carabaos in the Philippines. Scientific Report of

the Faculty of Agriculture, Kobe University 18: 353-357.

Kleiman, F., S. Pietrokovsky, S. Gil and C. Wisnivesky-Colli. 2005. Comparison of two

coprological methods for the veterinary diagnosis of fasciolosis. Arq. Bras. Med.

Vet. Zootec., 57 (2): 181-185

Kostadinova, A., E. A. Herniou, J. Barrett, and D. T. Littlewood. 2003 Phylogenetic

relationships of Echinostoma rudolphi, 1809 (Digenea: Echinostomatidae) and

related genera re-assessed via DNA and morphological analysis. Syst. Parasitol.,

54: 159–176.

Kumar, N., S. Ghosh and S. C. Gupta. 2008. .Detection of Fasciola gigantica infection in

buffaloes by enzyme-linked immunosorbent assay. Parasitol. Res., 104: 155–161.

192

Lamarck J.B.P.A. 1822. Mollusques In: Histoire Naturelle des Animaux sans vertebres.

Paris, 101.

Le, T. H., N. V. De, T. Agatsuma, T. G. T. Nguyen, Q. D. Nguyen, D. P. McManus, and

D. Blair. 2008. Human fascioliasis and the presence of hybrid/introgressed forms

of Fasciola hepatica and Fasciola gigantica in Vietnam. Int. J. Parasitol., 38: 725–

730.

Lee, C. G., G. L. Zimmerman and J. K. Bishop. 1992. Host influence on the banding

profiles of whole-body protein and excretory-secretory product of Fasciola

hepatica (Trematoda) by isoelectric focusing. Vet. Parasitol., 41: 57-68.

Lehmann, T., W. A. Hawley, and F. H. Collins. 1996. An evaluation of evolutionary

constraints on microsatellite loci using null alleles. Genetics, 144: 1155–1163.

Leon-Regagnon, V. D. R. Brooks and G Pérez-Ponce de León. 1999. Differentiation of

Mexican species of Haematoloechus looss, 1899 (Digenea: Plagiorchiformes):

molecular and morphological evidence. J. Parasitol., 85(5): 935-46.

Levieux, D., A. Levieux, C. Mage and A. Venien. 1992. Early immunodiagnosis of bovine

fascioliasis using the specific antigen f2 in a passive hemagglutination test. Vet.

Parasitol., 44: 77–86.

Lin, R.Q., S. J. Dong, K. Nie, C. R. Wang, H. Q. Song, A. X. Li, W. Y. Huang and X. Q.

Zhu. 2007. Sequence analysis of the first internal transcribed spacer of rDNA

193

supports the existence of the intermediate Fasciola between F. hepatica and F.

gigantica in mainland China. Parasitol. Res., 101: 813–818.

Lotfy, W. M. and G. V. Hillyer. 2003. Fasciola species in Egypt. Exp. Pathol. Parasitol., 6:

9–22.

Lotfy, W.M., H. N. El-Morshedy, M. A. El-Hoda, M. M. El-Tawila, E. A. Omar and H. F.

Farag. 2002. Identification of the Egyptian species of Fasciola. Vet. Parasitol., 103:

323–332.

Lotfy, W.M., S. V. Brant, R.J. DeJong, T. H. Le, A. Demiaszkiewicz, R. P. Rajapakse, V.

B. Perera, J. R. Laursen and E. S. Loker. 2008. Evolutionary origins,

diversification, and biogeography of liver flukes (Digenea, Fasciolidae). Am. J.

Trop. Med. Hyg., 79: 248–255.

Luton, K., D. Walker and D. Blair. 1992. Comparisons of ribosomal internal transcribed

spacers from two congeneric species of flukes (Platyhelminthes: Trematoda:

Digenea). Mol. Biochem. Parasitol., 56: 323–328.

MAFF. 1986. Manual of veterinary parasitological laboratory Techniques. Ministry of

Agriculture, Fisheries and Food, Reference book, 418.

Mage, C., J. Loisel and P. Bonnand. 1989. Infeststion par Fasciola hepatica et fecondite en

elevage laitier. Rev. Med. Vet., 140: 929-931.

194

Malek, E. A. 1974. Medical and Economic Malacology, Academic Press. 68-69.

Malek, E. A. 1980. Snail-Transmitted Parasitic Diseases, vol 2. Boca Raton, FL: CRC

Press

Malek, E.A. 1985. Snail Hosts of Schistosomiasis and Other Snail-Transmitted Diseases in

Tropical America: A Manual. Pan American Health Organization, Washington.

Malik, M. A. R. 1984. Incidence of fasciolosis amongst livestock in Sargodha division.

Pak. Vet. J., 4: 60-61

Malone, J. B. 1986. Fascioliasis and cestodiasis in cattle. Vet. Clin. N. Am. Food Ani.

Pract., 2: 261-275.

Malone, J.B., A.F. Loyacano, D.A. Armstrong and L.F. Archbald. 1982. Bovine

fascioliasis: economic impact and control in gulf coast cattle based on seasonal

transmission. Bov. Pract., 17: 126-133.

Maqbool, A., C. S. Hayat, T. Akhtar and H. A. Hashmi. 2002. Epidemiology of fasciolosis

in buffaloes under different managemental conditions. Veter. Arhiv., 72(4): 221-

228.

Maqbool, A., M. J. Arshad, F. Mahmood and A. Hussain. 1994. Epidemiology and

chemotherapy of fascioliasis in buffaloes. Assiut. Vet. Med. J., 30: 115–123.

195

Maqbool, M. and M. Irfan. 1983. Effect of different fasciolicides against fascioliasis in

buffaloes. Pak. Vet. J., 3: 70-72.

Marcilla, A., M. D. Bargues and S. Mas-Coma. 2002. A PCR-RFLP assay for the

distinction between Fasciola hepatica and F. gigantica. Mol. Cell. Prob., 16: 327–

333.

Markell, E. K. and M. Voge. 1999. Medical Parasitology, eighth ed. Saunders Company

Publication, 185–188.

Martínez-Moreno, A, F. J. Martínez-Moreno, I. Acosta, P. N. Gutiérrez, C. Becerra and S.

Hernández. 1997. Humoral and cellular immune responses to experimental

Fasciola hepatica infections in goats. Parasitol. Res., 83 (7): 680–6.

Mas-Coma, S. 2004a. Human fascioliasis: Epidemiological patterns in human endemic

areas of South America, Africa and Asia. Southeast Asian J. Trop. Med. Publ.

Health., 35 (Suppl. 1): 1–11.

Mas-Coma, S. and M. D. Bargues. 1997. Human liver flukes: A review. Res. Rev.

Parasitol., 57: 145–218.

Mas-Coma, S., I. R. Funatsu and M. D. Bargues. 2001. Fasciola hepatica and lymnaeid

snails occurring at very high altitude in South America. Parasitol., 123: 115–1127.

196

Mas-Coma, S., J. G. Esteban and M. D. Bargues. 1999. Epidemiology of human

fascioliasis: a review and proposed new classification. Bull. W.H.O. 77: 340–346.

Mas-Coma, S., M. A. Valero and M. D. Bargues. 2008 b. Climate change effects on

trematodiases, with emphasis on zoonotic fascioliasis and schistosomiasis. Vet.

Parasitol., doi:10.1016/ j.vetpar.2009.03.024.

Mas-Coma, S., M. A. Valero and M. D. Bargues. 2009. Fasciola, Lymnaeids and Human

Fascioliasis, with a Global Overview on Disease Transmission, Epidemiology,

Evolutionary Genetics, Molecular Epidemiology and Control. Adv. Parasitol.,

Mas-Coma, S., M. D. Bargues and M. A. Valero. 2005. Fascioliasis and other plant-borne

trematode zoonoses. Int. J. Parasitol., 35: 1255–1278.

Mas-Coma, S., M.D. Barguest and J. G. Esteban. 1999. Human Fasciolosis. In: Fasciolosis

(Dalton, J.P. ed.). CABI publishing, Walling ford, UK. pp. 411-434.

Mas-Coma, S., R. Angles, J. G. Esteban, M. D. Bargues, P. Buchon and M. Franken.

1999c. The Northern Bolivian Altiplano: A region highly endemic for human

fascioliasis. Trop. Med. Int. Health, 4: 454–467.

Mas-Coma, S., R. Angles, W. Strauss, J. G. Esteban, J. A. Oviedo and P. Buchon. 1995.

Human fasciolosis in Bolivia: a general analysis and a critical review of existing

data. Res. Rev. Parasitol., 55: 73–93.

197

Masud, F. S. and A. Majid. 1984. Incidence of fascioliasis in buffaloes and cattle of

Multan division. Pak. Vet. J., 4: 33-34.

McCarthy J., T. A. Moore. 2000. Emerging helminth zoonoses, Int. J. Parasitol., 30: 1351–

1360.

Meshgi, B., and S. H. Hosseini. 2007. Evaluation of different antigens in western blotting

technique for the diagnosis of sheep haemonchosis. Iranian J. Parasitol., 2 (4): 12-16.

Metzgar, D., E. Thomas, C. Davis, D. Field and C. Wills. 2000. The microsatellites of

Escherichia coli: rapidly evolving repetitive DNAs in a non-pathogenic

prokaryote. Mol. Microbiol., 39(1): 183-90.

Meunier, C, C. Tirard, S. Hurtrez-Bousses, P. Durand, M.D. Bargues, S. Mas-Coma, J. P.

Pointier, J. Jourdane and F. Renaud. 2001. Lack of molluscan host diversity and the

transmission of an emerging parasitic disease in Bolivia. Mol. Ecol., 10: 1333–1340.

Meunier, C, S. Hurtrez-Bousses, P. Durand, D, Rondelaud and F. Renaud. 2004. Small

effective population sizes in a widespread selfing species, Lymnaea truncatula

(Gastropoda: Pulmonata). Mol. Eco., 13, 2535–2543. Blackwell Publishing Ltd.

Mezo, M., J. M. Correia, P. Diez-Baños, P. Morrondo and M.L Sampaio. 1997. Estudio de

la respuesta anticuerpo en bovinos infectados experimentalmente com Fasciola

hepatica.V. Congresso Ibérico de Parasitologia, Évora, 1997. Acta Parasitológica

Portuguesa, 4: 1-2.

198

Milligen, F. J, J. B. Cornelissen and B. A Bokhout. 1998. Location of induction and

expression of protective immunity against Fasciola hepatica at the gut level: a

study using an ex vivo infection model with ligated gut segments. J. Parasitol.,

84(4): 771-776.

Mitchell, G.B., L. Maris, M. A. Bonniwell. 1998. Triclabendazole-resistant liver fluke in

Scottish sheep. Vet. Rec., 143 (14): 399.

Moll, L., C. P. Gaasenbeek, P. Vellema and F. H. J. Borgsteede. 2000. Resistance of

Fasciola hepatica against triclabendazole in cattle and sheep in the Netherlands.

Vet. Parasitol., 91 (1-2): 153–8.

Munguia-Xochihua, J. A., F. I. Velarde, A. D. Watty, N. M. Cristino and H. Q. Romero.

2007. Prevalence of Fasciola hepatica (ELISA and fecal analysis) in ruminants

from a semi-desert area in the northwest of Mexico. Parasitol. Res., 101: 127-130.

Naseer, Ahmed. 1984. Fasciolosis in Baluchistan. Pak. Vet. J., 4(1): 44.

Navajas, M. and B. Fenton. 2000. The application of molecular markers in the study of

diversity in acarology: a review. Exp. Appl. Acarol., 24: 751–774.

Nazneen, S. and F. Begum. 1990. Systematic study of some freshwater gastropods of

Sindh. Biologia., 36.

199

Njau, B. C., O. B. Kasali, R. G. Scholtens and N. Akalework. 1989. The Influence of

watering practice on Vet. Res. Commun., 3 (1): 67-74.

Notredame, C., D. G. Higgin and J. Heringa. 2000. T-Coffee: A novel method for fast and

accurate multiple sequence alignment. J. Mol. Biol., 302(1): 205-17.

O’Brien, D. J. 1998. Fasciolosis: a threat to livestock. Irish Vet. J., 51: 539–541.

Okewole, E. A., G. A. T. Ogundipe, J. O. Adejinmi and A. O. Olaniyan. 2000. Clinical

Evaluation of three Chemo prophylactic Regimes against Ovine Helminthosis in a

Fasciola Endemin Farm in Ibadan, Nigeria. Israel J. Vet. Med., 56 (1):15-28.

Ollerenshaw, C. B. 1971. Some observation on the epidemiology of fascioliasis in relation

to the timing of molluscicide applications in the control of the disease. Vet. Rec.,

88: 152-164.

Ollerenshaw, C. B. 1958. Climate and liver fluke. Agriculture (London), 65: 231-252.

O'Neill S.M., M. Parkinson, W. Strauss, R. Angles and J. P. Dalton. 1998.

"Immunodiagnosis of Fasciola hepatica infection (fascioliasis) in a human

population in the Bolivian Altiplano using purified cathepsin L cysteine

proteinase". Am. J. Trop. Med. Hyg., 58 (4): 417–23.

Overend, D.J. and F. L. Bowen. 1995. Resistance of Fasciola hepatica to triclabendazole.

Aust. Vet. J., 72 (7): 275–6.

200

Panaccio, M. and A. Trudgett. 1999. Molecular biology. In: Dalton, J.P. (Ed.), Fasciolosis.

CABI Publishing, Wallingford, Oxon, UK, (Chapter 14) 449–464.

Pande, P. G. 1935. Acute paramphistomiasis of cattle in Assam. A preliminary report.

Indian, J. Vet. Sci. Ani. Hus., 5: 364-75.

Periago, M. V., M. A. Valero, M. El-Sayed, K. Ashrafi, A. ElWakeel, M. Y. Mohamed, M.

Desquesnes, F. Curtale and S. Mas-Coma. 2008. First phenotypic description of

Fasciola hepatica/Fasciola gigantica intermediate forms from the human endemic

area of the Nile Delta, Egypt. Infect. Genet. Evol., 8: 51–58.

Periago, M.V., M. A. Valero, M. Panova and S. Mas-Coma. 2006. Phenotypic comparison

of allopatric populations of Fasciola hepatica and Fasciola gigantica from

European and African bovines using a computer image analysis system (CIAS).

Parasitol. Res., 99: 368–378.

Phiri I. K., A. M. Phiri and L. J. Harrison. 2006. Serum antibody isotype responses of

Fasciola-infected sheep and cattle to excretory and secretory products of Fasciola

species. Vet. Parasitol., 141 (3-4): 234–42.

Phiri, A. M., I. K. Phiri, C. S. Sikasunge and J. Monrad. 2005a. Prevalence of Fasciolosis

in Zambian cattle observed at selected abattoirs with emphasis on age, sex and

origin. J. Vet. Med., 52: 414-416.

201

Phiri, A.M., I.K. Phiri, S. Siziya, C.S. Sikasunge, M. Chembensofu and J. Monrad. 2005b.

Seasonal pattern of bovine fasciolosis in the Kafue and Zambezi catchment areas of

Zambia. Vet. Parasitol., 134, 87–92.

Prasad, P. K., V. Tandon, D. K. Biswal, L. Goswami and A. Chatterjee. 2009. Use of

sequence motifs as barcodes and secondary structures of Internal Transcribed

spacer 2 (ITS2, rDNA) for identification of the Indian liver fluke, Fasciola

(Trematoda:Fasciolidae) Bioinform., 3(7): 314-320.

Prasad, P. K., V. Tandon, D. K. Biswal, L. Goswami and A. Chatterjee. 2008. Molecular

identification of the Indian liver fluke, Fasciola (Trematoda: Fasciolidae) based on

the ribosomal internal transcribed spacer regions. Parasitol. Res., 103(6): 1247-55.

Preston, H. B. 1915. The fauna of British India including Ceylon and Burma. Tailor and

Francis Publisher, London.

Preston, J. M. and E. W. Allonby. 1979. Liver fluke infection in sheep. Res. Vet. Sci.,

26:134-139.

Qureshi, W. A., A. Tanveer, S. A. Qureshi, A. Maqbool, T. G. Gill and S. A. Ali. 2005.

Epidemiology of human Fasciolosis in rural areas of Lahore. Punjab Univ. J. Zool.,

20 (2): 159-168.

Rao, S. N. V., A. K. Das and S. C. Mitra. 1980. On freshwater molluscs of Andaman and

Nicobar Islands. Rec. Zool. Surv. India, 77: 215-245.

202

Ramajo, V., A. Oleaga, P. Casanueva, G. V. Hillyer and A. Muro. 2001. Vaccination of

sheep against Fasciola hepatica with homologous fatty acid binding proteins. Vet.

Parasitol., 97 (1):35-46.

Randell, W.F. and R.E. Bradley. 1980. Effects of hexachlorethane on the milk yields of

dairy cows in north Florida infected with Fasciola hepatica. Am. J. Vet. Res., 41:

262-263.

Rangel-Ruiz, L. J., R. Marquez-Izaquierdo and G. Bravo-Nogueira. 1999. Bovine

fascioliosis in Tabasco. Mexico Vet. Parasitol., 81: 119–127.

Reichel, M. P. 2002. Performance characteristic of an enzyme linked immunosorbent assay

for the detection of liver fluke (Fasciola hepatica) infection in sheep and cattle.

Vet. Parasitol., 87: 337-342.

Reinhard, E.G., 1957. Landmarks of parasitology. I. The discovery of the life cycle of the

liver fluke. Exp. Parasitol., 6: 208-232.

Robert, J.A., E. Estuningsih, E. Wiedosari and T. W. Spithill. 1997. Acquisition of

resistance against Fasciola gigantica by Indonesian thin tail sheep. Vet. Parasitol.,

73 (3-4): 215–24.

Rodríguez-Pérez, J and G, V. Hillyer. 1995. Detection of excretory-secretory circulating

antigens in sheep infected with Fasciola hepatica and with Schistosoma mansoni

and F. hepatica. Vet. Parasitol., 56(1-3): 57-66.

203

Rolfe, P., P. Young, J. Loughlin and S. Jagoe. 1997. Liver Fluke in Dairy Cattle. NSW,

Agnote DAI/32, NSW, Agriculture.

Rondelaud, D., G. Dreyfuss, B. Bouteilleand and M. L. Dardé. 2000. Changes in human

fasciolosis in a temperate area: about some observations over a 28-year period in

central France, Parasitol. Res., 86: 753–757.

Ronquist, F. and J. P. Huelsenbeck. 2003. MRBAYES 3: Bayesian phylogenetic inference

under mixed models. Bioinform., 19: 1572-1574.

Rose, J. G. 1970. The economics of Fasciola hepatica infection in cattle. Br. Vet. J., 126:

13-15.

Roseby, F. B. 1970. The effect of fasciolosis on the wool production of merino sheep.

Aust. Vet. J., 46: 361–36.

Rossignol, J. F., H. Abaza and H. Friedman. 1998. Successful treatment of human

fascioliasis with nitazoxanide. Trans. R. Soc. Trop. Med. Hyg., 92 (1): 103–4.

Rowcliffe, S. A and C. B. Ollerenshaw. 1960. Observations on the bionomics of the eggs

of Fasciola hepatica. Ann. Trop. Med. Parasitol., 54: 172-181.

Rudd, S. 2003. Expressed sequence tags: alternative or complement to whole genome

sequences. Trends Plant Sci., 8(7): 3 21-9

204

Sahar, R. 1996. A study on the epidemiological aspects of fascioliasis in buffaloes in

Lahore district. M. Sc. Thesis, College of Veterinary Sciences, Lahore.

Sahba, G.H., F. Arfaa, I. Farahmandian, and H. Jalali. 1972. Animal fascioliasis in

Khuzestan, South western Iran J. Parasitol., 58(4): 712-716.

Salam M. M., A. Maqbool, A. Naureen and M. Lateef. 2009. Comparison of different

diagnostic techniques against Fasciolosis in Buffaloes. Vet. World, 2(4): 129-132.

Saleem, M. E., M. S. Mian, A. Rabbani and M. Afzal. 1986. A study on incidence,

chemotherapy and blood picture in ovine fasciolosis. Pak. Vet. J., 1(4): 157.

Salih, T., O. Al-Habbib, W. Al-Habbib, S. Al-zako and T. Ali. 1981. The effects of

constant and changing temperatures on the development of eggs of the freshwater

snail Lymnaea auricularia (L.). J. Thermal. Biology, 6: 379-388.

Salimi-Bejestani, M. R, J. W. McGarry, S. Felstead, P. Ortiz , A. Akca and D. J. Williams.

2004. Development of an antibody-detection ELISA for Fasciola hepatica and its

evaluation against a commercially available test. Res. Vet. Sci., 8(2):177-81.

Sanchez-Andrade, R., A. Paz-Silva, J. Suarez, R. Panadero, P. Diez-Banos and P.

Morrondo. 2000. Use of a sandwich-enzyme linked Immunosorbent assay (SEA)

for the diagnosis of natural Fasciola hepatica infection in cattle from Galicia (NW

Spain). Vet. Parasitol., 93: 39-46.

205

Sanjeeda, K. and S. A. Rashid. 1978. Fresh water molluscs of Pakistan. Bull. Hydrobiol.

Res., 24: 518-525.

Santiago, N. and G. V. Hillyer. 1988. Antibody profiles by EITB and ELISA of cattle and

sheep infected with Fasclola hepatica. J. Parasitol., 74: 810-818.

Satyamurti, S. T. 1960. The land and freshwater mollusca. Bull. Madras. Govt. Mus. New.

Ser., 6(4): 1-174.

Savioli L., L. Chitsulo and A. Montresor. 1999. New opportunities for the control of

fascioliasis. Bull. World Health Organ, 77 (4): 300.

Schweizer, G., U. Braun, P. Deplazes and P. R. Torgerson. 2005. Estimating the financial

losses due to bovine fasciolosis in Switzerland. Vet. Rec., 157: 188-193.

Semyenova, S. K., E. V. Morozova, G. G. Chrisanfova, A. M. Asatrian, S. O. Movsessian

and A. P. Ryskov. 2003. RAPD variability in genetic diversity in two populations

of liver fluke, Fasciola hepatica. Acta Parasitol., 48 (2): 1230-2821.

Semyenova, S.K., E. V. Morozova, A. V. Vasilyev, V. V Gorokhov and A.S., Moskvin, S.

O. Movsessyan and A. P. Ryskov. 2005. Polymorphism of internal transcribed

spacer 2 (ITS-2) sequences and genetic relationships between Fasciola hepatica

and F. gigantica. Acta Parasitol., 50: 240-243.

206

Semyenova, S.K., E. V. Morozova, G. C. Chrisanfova, V. Gorokhov, A. Arkhipov and A.

S. Moskvin. 2006. Genetic differentiation in eastern European and western Asian

populations of the liver fluke, Fasciola hepatica, as revealed by mitochondrial

nad1 and cox1 genes. J. Parasitol., 92: 525–530.

Shah, S. 1994. Text book of animal husbandry. National Book Foundation, Islamabad.

Sheikh, A. A., N. Gill, M. M. Khan and F. M. Bilqees. 2007. Biochemical Changes in the

Livers of Bovines Naturally infected with Fasciola gigantica. Pakistan J. Bio. Sci.,

10(16): 2756-2759.

Sheikh, S. A. 1984. Fascioliasis (liverfluke Infestation) in the Punjab. Pakistan Vet. J., 4:

28.

Sinclair, K.B. 1962. Observations on the clinical pathology of ovine fascioliasis. Brit. Vet.

J., 118: 37–53.

Solem, A. 1979. Some mollusks from Afghanistan. Fieldiana, Zoology, new series, no. 1,

89.

Soliman, M. F. M. 2008. Epidemiological review of human and animal fascioliasis in

Egypt. J. Infect. Dev. Countries., 2(3): 182-189.

207

Sothoeun, S., H. Davun and B. Copeman. 2006. Abattoir study on Fasciola gigantica in

Cambodian cattle. Trop. Anim. Health Prod., 38(2): 113-5.

Soulsby, E. J. L. 1982. Helminth, Arthropod and Protozoa of Domestic Animals. 7th Ed.

Baillere, London, Uk. pp. 809.

Spithill, T. W. and J. P. Dalton. 1998. Progress in development of liver fluke vaccines.

Parasitol. Today, 14 (6): 224-228.

Spithill, T. W., P. M. Smooker and D. B. Copeman. 1999. Fasciola gigantica:

epidemiology, control, immunology and molecular biology. Fasciolosis.

Wallingford, Oxon, UK: CABI Pub. pp. 465–525.

Srimuzipo P, C. Komalamisra , W. Choochote , A. Jitpakdi, P. Vanichthanakorn, P. Keha ,

D. Riyong , K. Sukontasan, N. Komalamisra, K. Sukontasan and P.

Tippawangkosol. 2000. Comparative morphometry, morphology of egg and adult

surface topography under light and scanning electron microscopies, and metaphase

karyotype among three size-races of Fasciola gigantica in Thailand. Southeast

Asian J. Trop. Med. Public Health, 31(2): 366-73.

Sykes, A.R., A. R. Coop and M. G. Robinson. 1980. Chronic subclinical ovine fascioliasis:

plasma glutamate dehydrogenase, gamma glutamyl transpeptidase and aspartate

aminotransferase activities and their significance as diagnostic aids. Res. Vet. Sci.,

28: 71–78.

208

Taira, N., H. Yoshifuji and J. C. Boray. 1997. Zoonotic potential of infection with

Fasciola spp. by consumption of freshly prepared raw liver containing immature

flukes. Int. J. Parasitol., 27: 775–779.

Talavera, G. and J. Castresana. 2007. Improvement of phylogenies after removing

divergent and ambiguously aligned blocks from protein sequence alignments.

Systematic Biology, 56: 564-577.

Tandon. V., P. K. Prasad, A. Chatterjee and P.T. Bhutia. 2007. Surface fine topography

and PCR-based determination of metacercaria of Paragonimus sp. from edible

crabs in Arunachal Pradesh, Northeast India. Parasitol. Res., 102: 21–28.

Tasawar, Z., U. Minir, C. S. Hayat and M. H. Lashari. 2007. The prevalence of Fasciola

hepatica in goats around Multan. Pak. Vet. J., 27(1): 5-7.

Temnykh, S., G. Declerck, A. Lukashova, L. Lipovich and S. Cartinhour. 2001.

Computational and experimental analysis of microsatellites in rice (Oryza sativa

L.): frequency, length variation, transposon associations, and genetic marker

potential. Gen. Res. 11: 1441–1452.

Temnykh, S., W. D. Park, N. Ayres, S. Cartinhour, N. Hauck, L. Lipovich, Y.G. Cho, T.

Ishii and S.R. McCouch. 2000. Mapping and genome organization of microsatellite

sequences in rice (Oryza sativa L.). Theor. Appl. Genet., 100: 697-712.

209

Terasaki, K., H. Akahane, S. Habe and N. Moriyama. 1982. The geographical distribution

of common liver flukes (the genus Fasciola) with normal and abnormal

spermatogenesis. Japan J. Vet. Sci., 44: 223– 231.

Terasaki, K., Y. Noda, T. Shibahara and T. Itagaki. 2000. Morphological comparisons and

hypotheses on the origin of polyploids in parthenogenetic Fasciola sp. J. Parasitol.,

86: 724–729

Thienpont, D., F. Rochette and O. F. J. Vanparijs. 1986. Diagnosing Helminthiasis by

coprological examination. Janssen Research foundation, Beerese, Belgium.

Thomas, A.P. 1883a. The natural history of the liver fluke and the prevention of rot. J.

Roy. Agr. Soc. Engl., 19: 276-305.

Thomas, A.P. 1883b. The life history of liver-fluke (Fasciola hepatica). Quarterly J.

Microscopical Science, 23: 99-133.

Thompson, J. D., D. G. Higgins and T. J. Gibson. 1994. CLUSTAL W: improving the

sensitivity of progressive multiple sequence alignments through sequence

weighting, position specific gap penalties and weight matrix choice. Nucl. Acids

Res., 2: 4673-4680.

Tirmizi, F. 1973. Taxonomy of Freshwater Mollusca. M. Sc. Thesis, Karachi University.

210

Toledo, R., C. Munoz-Antoli, M. Perez and J. G. Esteban. 1998. Larval trematode

infections in fresh water gastropods from the Albufera Natural Park in Spain. J.

Helminthol., 72: 79-82.

Torgerson, P. and J. Claxton. 1999. Epidemiology and control. in Dalton. Fasciolosis.

Wallingford, Oxon, UK: CABI Pub. pp. 113–49.

Tóth, G., Z. Gáspári, J. Jurka. 2000. Microsatellites in different eukaryotic genomes:

survey and analysis. Gen. Res., 10(7):967-81.

Traub, R. J., P.T. Monisb and I. D. Robertsona. 2005. Molecular epidemiology: A

multidisciplinary approach to understanding parasitic zoonoses. Int. J. Parasitol.,

35: 1295–1307.

Trouve, S., L. Degen, C. Meunier, C. Tirard, S. Hurtrez-Bousses and P. Durand. 2000.

Microsatellites in the hermaphroditic snail, Lymnaea truncatula, intermediate host

of the liver fluke, Fasciola hepatica. Mol. Ecol., 9: 1662–1663.

Turnpenny, P and S. Ellard .2005. Emery's Elements of Medical Genetics. 12th Edition.

Elsevier Churchill Livingstone, Edinburgh, UK.

Ueno, H. and S. Yoshihara. 1974. Vertical distribution of Fasciola gigantica

metacercariae on stems of rice plant grown in a water pot. Natl. Inst. Anim. Health,

14: 54-60.

211

Ueno, H., R. Arandia, G. Morales and G. Medina. 1975. Fascioliasis of livestock and snail

host for Fasciola in the Altiplano region of Bolivia. Natl. Inst. Anim. Health Q.,

15: 61–67.

Urquhart, G. M., J. Armour, J. L. Duncan, A. M. Dunn and F. W. Jennings. 1996.

Veterinary Parasitology 2nd Ed. Oxford, Longman Scientific and technical press,

UK. 100-109.

Urquhart, G. M., J. Armour, J. L. Duncan, A. M. Dunn and F.W. Jennings. 1988.

Veterinary Parasitology. 2nd Ed. ELBS., Longman, U.K.

Vaidya, D. P. and R. Nagabhushanam. 1978. Laboratory studies on the direct effect of

temperature on the freshwater vector snail, Indoplanorbis exustus (Deshyes).

Hydrobiologia, 61(3): 267-271.

Valero, M. A., M. Panova and S. Mas-Coma. 2001a. Developmental differences in the

uterus of Fasciola hepatica between livestock liver fluke populations from

Bolivian highland and European lowlands. Parasitol., Res. 87, 337– 342.

Valero, M. A., N. A. Darce, M. Panova and S. Mas-Coma. 2001b. Relationships between

host species and morphometric patterns in Fasciola hepatica adults and eggs from

the Northern Bolivian Altiplano hyperendemic region. Vet. Parasitol., 102, 85–100.

212

Valero, M. A., M. Panova and S. Mas-Coma. 2005. Phenotypic analysis of adults and eggs

of Fasciola hepatica by computer image analysis system. J. Helminthol., 79: 217–

225.

Valero, M. A., I. Perez-Crespo, M. V. Periago, M. Khoubbane and S. Mas-Coma. 2009.

Fluke egg characteristics for the diagnosis of human and animal fascioliasis by

Fasciola hepatica and F. gigantica in human endemic areas. Acta Trop.

doi:10.1016/j.actatropica.2009.04.005.

Valero, M.A., M. D. Marcos and S. Mas-Coma. 1996. A mathematical model for the

ontogeny of Fasciola hepatica in the definitive host. Res. Rev. Parasitol., 56: 13–

20.

Valero, M.A., M. De Renzi, M. Panova, M.A. Garcia-Bodelon, M.V. Periago, D. Ordoñez

and S. Mas- Coma. 2006b. Crowding effect on adult growth, pre-patent period and

egg shedding of Fasciola hepatica. Parasitol., 133: 453-463.

Valero, M.A., M. Panova, A. M. Comes, R. Fons and S. Mas-Coma. 2002. Patterns in size

and shedding of Fasciola hepatica eggs by naturally and experimentally infected

murid rodents. J. Parasitol., 88: 308–313.

Van Milligen, F. J., J. B. Cornelissen, I. M. Hendriks, C. P. Gaasenbeek and B. A.

Bokhout. 1998. Protection of Fasciola hepatica in the gut mucosa of immune rats

is associated with infiltrates of eosinophils, IgG1 and IgG2a antibodies around the

parasites. Parasite Immunol., 20: 285-292.

213

Varma, A.K. 1953. On Fasciola indica N sp with some observations on Fasciola hepatica

and Fasciola gigantica. J. Helminth., 27: 185–198.

Varshney, R. K, T. Thiel, N. Stein, P. Langridge and G, Graner. 2002. In silico analysis on

frequency and distribution of microsatellites in ESTs of some cereal species. Cell

Mol. Biol. Lett., 7: 537-546

Varshney, R.K., N. Stein, A. Graner. 2004. Transferability and comparative mapping of

barley microsatellite markers into wheat. Annu. Wheat Newsl., 50: 38-39.

Vaughan J. L., J.A. Charles and J.C. Boray. 1997. Fasciola hepatica infection in farmed

emus (Dromaius novaehollandiae), Aust. Vet. J., 75: 811–813.

Watanabe, S. 1962. Fascioliasis of ruminants in Japan. Bull. Off. Int. Epizoot., 58: 313–

322.

Webster, B. L. and V.R. Southgate. 2003. Compatibility of Schistosoma haematobium, S.

intercalatum and their hybrids with Bulinus truncatus and B. forskalii. Parasitol.,

127: 231–242.

Wethington, A. R. 2004. Phylogeny, taxonomy, and evolution of reproductive isolation in

Physa (Pulmonata: Physidae). Ph.D. Dissertation, University of Alabama,

Tuscaloosa.

WHO. 1995. Control of food borne Trematode infections. Technical Report Series 849, 61.

214

WHO. 2007. Report of the WHO Informal Meeting on use of triclabendazole in

fascioliasis control. World Health Organization, Headquarters Geneva, 17-18

October 2006 (WHO/CDS/NTD/PCT/2007.1).

WHO. 2008. Fact sheet on fascioliasis. In: Action against Worms, World Health

Organization, Headquarters Geneva (December 2007), Newsletter, 10: 1-8.

Wolstenholme, A., I. Fairweather, R. Prichard, G. H. S. Von and N. Sangster. 2004. Drug

resistance in veterinary parasites. Trends Parasitol., 20: 469–476.

Yamaguti, S. 1958. Systema Helminthum. The Digenetic Trematodes. Interscience, New

York., 1(1): 839–841.

Yilma, J. and J. B. Malone. 1998. A geographical information System forecast model for

strategic control of fasciolosis in Ethiopia. Vet. Parasitol., 78 (2): 103-127.

Yilma, J. 1985. Study on Ovine fasciolosis and other Helminth Parasites at Holeta DVM

Thesis, Addis Ababa University, Debre Zeit, Ethiopia., 45.

Zajac, A. M. 1994. Fecal examination in the diagnosis of parasitism. In: Vet. Clin.

Parasitol., 6th Ed. Ames, Iowa: Iowa State Univ. Press, 3-16.

Zajac, A. M., J. Johnson, and S. E. King. 2002. Evaluation of the Importance of

Centrifugation as a Component of Zinc Sulfate Fecal Flotation Examinations. J.

Am. Anim. Hosp. Assoc., 38: 221-224.

215

Zimmerman, G. L., L. W. Jen, J. E. Cerro, K. L. Farnsworth and R. B. Wescott. 1982.

Diagnosis of Fasciola hepatica in sheep by an enzyme linked immunosorbent

assay. Am. J. Vet. Res., 43: 2097-2100.

216

APPENDICES Appendix # 1

Staining of the flukes

1. The flukes were kept in 70 percent alcohol overnight and adjusted

flat between two microscopic glass slides, but without cover glass

pressure to avoid distortion.

2. They were later removed from between the slides and placed for

three to four hours in Gower's aceto-carmine stain, which is used

specifically for Platyhelminthes.

3. Flukes were again washed with distilled water and passed through

30 percent, 50 percent and 70 percent ethanol for 15-30 minutes

depending upon the size and thickness of the specimen.

4. If destaining of the fluke is required then 70 percent acidic alcohol

is used.

5. Flukes were passed through 70 percent, 90 percent and absolute

alcohol for complete dehydration, approximately for 5-10 minutes.

6. Flukes were than transferred and passed through a mixture of equal

volume of xylene and absolute alcohol.

7. The flukes were kept in pure xylene for 1-2 minute.

8. Shift to clove oil for the same period.

9. Finally the flukes were mounted in neutral Canada balsam and

slides were examined for morphometric measurements.

217

Preparation of stain

Gower's carmine stain was prepared by the following method.

Acetic acid (45%) 100 ml

Carmine 10 g

Acidified carmine (prepared) 1 g

Potassium alum 10 g

Distilled water 200 ml

Crystal of thymol only one

Procedure

10 g of carmine was dissolved in 100 ml of acetic acid (45 percent) by heating, allowed to come to boil, cooled and then filtered. Residue left over the filter paper was dried and obtained as acidified carmine. 10 g of the prepared acidified carmine and 10 g of potassium alum were dissolved in 200 ml of distilled water by heating and then filtered. A crystal of Thymol was added to prevent mould growth.

218

Appendix # 2

DNA Extraction

1. Frozen worms were individually homogenized in liquid nitrogen, in

0.5 ml Extraction buffer (0.5M Tris-HCl, pH 8.0, 5Mm EDTA, 1x

SSC).

2. The pestle was rinsed with 1 ml 20% (SDS) Sodium dodecyl

sulphate and 25 ul proteinase k (10 mg/ml).

3. This mixture was incubated at 55 ºC for 2 hrs.

4. Then extracted with equal volume of phenol-chloroform chilled

solution by centrifugation for 30 minutes at 4ºC at 13,000 rpm.

5. The supernatant solution was adjusted to 1/10th volume of 0.3 M

Sodium acetate and precipitated at -20ºC, overnight, with twice the

volume of chilled iso-Propanol solution.

6. DNA was pelleted by centrifuging at 13,000 rpm for 5 minutes at

4ºC, rinsed with 70% chilled ethanol, dried and finally resuspended

in 50 ul double distilled water.

7. RNAse treatment was done by adding 1 ul (10mg/ul) to above,

following an incubation of 1 hr at 37ºC.

8. 2ul of this was used in a PCR reaction of 50 ul.

219

1. Extraction buffer

0.05M Tris-HCl

5mM EDTA

1 x SSC

Adjusted at PH 8.0

Procedure:

10 ml of 0.5 M Tris-HCl is dissolved in 100 ml of dd H20 (5 ml)

1 ml of 0.5 M EDTA is dissolved in 100 ml of dd H20 (0.5 ml)

5 ml 20 x SSC is dissolved in 100 ml of dd H20 (2.5 ml)

Dissolve the above amount in 42 ml of dd H20 to make 50 ml of extraction buffer.

2. 20% (SDS) Sodium dodecyl sulphate

Dissolve 20 gm of SDS in 100 ml of dd H20.

3. Proteinase k (10 mg/ml)

4. Phenol-chloroform solution 1:1

Take 50 ml of chloroform and 50 ml of phenol solution. Chloroform solution is prepared by taking 1 ml of isoamyl alcohol and 24 ml of chloroform.

5. 0.3 M Sodium acetate

6. Iso-Propanol solution

7. 70 % Ethanol

Take 70 ml ethanol and 30 ml dd H2O

8. RNAse (10 mg/ml)

9. Ethidium bromide

10. Taq polymerase

220

11. dNTP's

12. MgCl2

All these used in PCR amplification were obtained from MBI Fermentas

221

Appendix # 3

Primer designing (principles)

1. Determination of particular restriction sites on vector as well as in the primers.

2. Confirmation that same restriction site is not present within the coding region of the target gene.

3. Primers should not be complementary to each other in order to avoid primer dimer formation

4. Primers should not contain less than 50% GC content.

5. Annealing temperature of primers should be considered

222

Appendix # 4

Agarose Gel Electrophoresis

DNA fragments were separated by electrophoresis on 1% (w/v) agarose gels in 0.5 X TAE buffer containing ethidium bromide (10 mg/ml). Fragment sizes were estimated by comparison with Fermentas 1kb DNA ladder. Fermentas 6 X

DNA loading dye was used.

Gel Preparation:

1. a. 1% agarose gel

Dissolve 1 gm of agarose in 100 ml of 0.5 TAE.

b.1.5 % agarose gel

Dissolve 1.5 gm of agarose in 100 ml of 0.5 TAE.

c. 2.5 % agarose gel

Dissolve 2.5 gm of agarose in 100 ml of 0.5 TAE.

2. 0.5 M TAE buffer

To prepare Stock solution (50 x TAE)

Tris base: 242 gm

Glacial acetic acid: 57.1 gm

0.5 M EDTA: 50 ml

Dissolve the above in 1000 ml of dd H20.

To prepare Working solution (0.5 x TAE) used to run Gel.

Take 10 ml of stock solution (50 x TAE) add 990 ml of dd H20 to make 1000 ml.

223

50X Tris-acetate EDTA buffer (TAE):

Tris base 242 gm

Glacial acetic acid 57.1 ml

0.5 M EDTA (pH 8.0) 100 ml

Make up the final volume with distilled water to 1000 ml.

6X Gel Loading Buffer

1. Bromophenol blue 0.25% (w/v)

2. Xylene cyanol FF. 0.25% (w/v)

3. Glycerol 30.0% (v/v)

Dissolve in distilled water.

Composition of 5X stock of TBE (Tris Borate EDTA) Buffer.

Components Mol. Wt. Quantity

Tris Base 121.3 54.0g

Boric Acid 61.83 27.5g

0.5M EDTA (pH 8.0) 372.24 20ml

ddH2O 1000ml (final volume)

The pH of the EDTA adjusted to 8.0 by adding pellets of sodium hydroxide

(NaOH). Final conc. 1.0mM.

Buffer stored at room temperature.

224

Appendix # 5

Agarose Gel Electrophoresis for SSR

Composition of 5X stock of TBE (Tris Borate EDTA) Buffer.

Components Mol. Wt. Quantity

Tris Base 121.3 54.0g

Boric Acid 61.83 27.5g

0.5M EDTA (pH 8.0) 372.24 20ml ddH2O 1000ml (final volume)

Buffer stored at room temperature.

3 % metaphor gel

Dissolve 3 gm of gel in 100 ml of 0.5 TBE.

225

Appendix # 6

DNA Ladder 1Kb: Used as marker

DNA Ladder

The genetic ruler 1kb DNA Ladder (Catalogue # SMO313, Lot: 00018968,

Concentration: 0.1g/ml) for SSR by Fermentas was used for sizing and approximate quantification of wide range double stranded DNA fragments on agarose gel. The ladder was premixed with 6X Loading dye solution for direct loading on gel.

226

Appendix # 7

ZnSO4 Sedimentation method Procedure

For each fresh sample 3 g of feces was weighed out and taken in the small plastic beaker. The fecal pellets were then mashed and 42 ml of water was added in it and feces were homogenized with the help of an electric blender (Tissue Tearor, model 985370, Biospec Products, Inc.) The homogenized mixture was then strained through wire mesh screen and left over debris was discarded. The strained fluid was then poured in the centrifuge tube up to 10 mm of the top and was centrifuged at 1500 rpm for 10 minutes and supernatant was discarded. The tube agitated until the sediment was loosened and Zinc Sulphate was added to the same level as before. The tube was inverted five to six times for thoroughly mixing the contents of the tube.

Preparation and Recipes of Reagents

Coprological Analysis

ZnSO4 solution

385 gm granular Zinc Sulphate was dissolved in 1,000 ml of distilled water and then filtered and stored at room temperature

227

Appendix # 8

Serological Analysis

Indirect Enzyme Linked Immunosorbent Assay (ELISA).

Preparation of Reagents:

96 well-flat bottom micro-titer plates (Linbro, Flow Laboratories, Connecticut,

USA).

a) 0.01 M phosphate-buffered saline solution, pH 7.4 (PBS).

- KH2PO4 0.19 g

- Na2HPO4 1.58 g

- NaCl 8.00 g

- Dist. Water to 1000 ml

b) Washing buffer, 0.01 M PBS, pH 7.4 containing 0.05% Tween-20

(PBS-T).

c) Coating buffer, 0.05 M carbonate buffer, pH 9.6

- Na2CO3 1.59 g

- NaHCO3 2.93 g

- Dist. Water to 1000 ml

Mix well and adjust pH at 9.6.

d) Blocking buffer, 0.1% bovine serum albumin (BSA) in coating

buffer.

e) Serum diluent, PBS-T.

f) Conjugate, Horseradish peroxidase

conjugated rabbit anti-

228

bovine IgG (whole

molecule) (Sigma

Immunochemicals).

The conjugates were used

at a concentration of

1:2000. g) Citrate / Phosphate buffer, pH 5.0

A. Citric acid 2.10 g / 100

ml dist. Water.

B. Na2HPO4-12 H2O 7.16 g / 100

ml dist. Water

A = 24.3 ml + B = 25.7 ml in 50 ml dist.

Water. h) Substrate buffer, citrate / phosphate buffer, pH 5.0

with 3.9 mM H2O2. i) Substrate, ortho-phenylenediamine (Sigma Immunochemicals) at a

concentration of 340 µg / ml substrate buffer. j) Sera, from cattle and buffaloes and sera from non-infected bovine (as

control). k) Antigens, Fasciola gigantica ES antigen is used at an optimal

concentration of 4 µg / ml coating buffer.

229

Bradford Reagent - Bradford reagent can be made by dissolving 100 mg

Coomassie Blue G-250 in 50 ml 95% ethanol, adding 100 ml 85% (w/v) phosphoric acid to this solution and diluting the mixture to 1 liter with water.

Bovine serum albumin (BSA) (1 mg/ml)

1mg BSA was dissolved in 1ml PBS solution and stored at 4º C in 1 ml aliquots for quick use. The standard was dissolved in the buffer similar to that the unknown.

230

Appendix # 9

Procedure of ELISA

1. Each well was filled with 200 ml of the corresponding antigen

concentration and then the plates were incubated overnight at 4°C.

2. The plates were washed 3 times with PBS-T 0.05% to get rid of excess

unbound antigen and the remaining free binding sites are then blocked with

BSA for blocking buffer (200 ul / well) and kept for one hour.

3. The plates are then washed 3 times with PBS-T 0.05%.

4. The sera are added to the plates (100 ul / well) and incubated at 37°C for 90

minutes.

5. The plates are then washed 3 times with PBS-T 0.05% and 100 ul / well of

the conjugate (1:2000 dilution in PBS-T 0.05%) are added to all wells and

incubated at 37°C for one hour.

6. After incubation, the plates are washed 5 times with PBS-T and twice with

substrate buffer; substrate is added at l00 ul / well and incubated for 5

minutes at room temperature.

7. The reaction with yellowish coloration was stopped by adding l00 ul / well

of 1 M H2SO4 and was read using ELISA-reader at 490 nm.

8. A positive serum sample was defined as having an optical density (O.D.)

value greater than the mean O.D. value for the non-infected controls plus

two times the standard deviation (SD) (cut off value).

9. The results were expressed as positive or negative.

231