DOCSLIB.ORG

IGCC®/IGMA® CERTIFIED PRODUCTS February 2018 Page 15

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
IGCC®/IGMA® CERTIFIED PRODUCTS February 2018 Page 15 IGCC®/IGMA® CERTIFIED PRODUCTS CERTIFICATION FRAME INTERNAL LICENSEE NUMBER CONSTRUCTION SUBSTRATE SPACER DESICCANT SEALANT COMPONENTS GCIA Advantage Glass Corp 4457 BC4/PLLC U/C2 ZS LF PIB/S2 601 West Carboy Road Mount Prospect, IL 60056 847-290-1707 Advantage Glass Corp. IGCC(R)IGMA(R) 2017 AGC Flat Glass (Thailand) PLC. 4432 MC4/ALK U/C3/U MA/MA LF/LF PIB/S2 Yes 200 Moo 1, Suksawad Road Pak Khlong Bang Pla Kod Phra Samut Chedi, Samut Prakan 10290 Thailand 66-2815-5000x1982 AGC/Poma Glass Co. N.A. 2903 BC3/MC1/ZS/IC U/C3/U UT/UT DM/DM HM IC Yes 365 McClurg Road-Suite E 2904 BC3/MC1/ZS/IC U/C3/U US/US DM/DM HM IC Yes Boardman, OH 44512 3705 BC3/MC1/MT/IC U/C3/U FS/FS IB/IB HM IC Yes 330-965-1000 4173 BC3/MC1/IC U/C3 BCS IB BCS IC Yes AGC 61 IGCC®/IGMA® 2017 4268 BC3/MC1/ZS/IC U/C3/U US/US DM/DM RHM IC Yes 4277 BC3/MC1/ZS/IC U/C3/U UT/UT DM/DM RHM IC Yes 4584 BC3/MC1/IC U/C3 BPS IB BPS IC Yes 4654 BC3/MC1/MT/IC U/C3 FS/FS IB/IB HM IC Yes 4655 BC3/MC1/IC U/C3/U BCS/BCS IB/IB BCS IC Yes AGC-Poma Glass Co. N.A. 3981 BC3/MC1/MT/IC U/C3/U FS/FS IB/IB HM IC Yes 480 California Road 3982 BC3/MC1/ZS/IC U/C3/U US/US DM/DM HM IC Quakertown, PA 18951 4093 BC3/MC1/ZS/IC U/C3/U UT/UT DM/DM HM IC 215-538-9424 4094 BC3/MC1/ZS/IC U/C3/U UT/UT DM/DM HM IC Yes AGC 63 IGCC(R)/IGMA(R) 17 4099 BC3/MC1/IC U/C3 BPS IB BPS IC Yes 4236 BC3/MC1/IC U/C3/U BCS/BCS IB/IB BCS IC Yes 4648 BC3/MC1/ZS/IC U/C3/U US/US DM/DM HM IC Yes 4673 BC3/MC1/MT/IC U/C3/U FS/FS IB/IB HM IC Yes 4674 BC3/MC1/IC U/C3 BPS IB BPS IC Yes 4675 BC3/MC1/IC U/C3/U BCS/BCS IB/IB BCS IC Yes Ajiya Safety Glass Sdn Bhd 2871 MC4/PLK U/C2 MA LF PIB/S2 Lot 575, 1 KM Lebuhraya Segamat-Kuantan Segamat, Johor 85000 Malaysia 607-9313133 Ajiya® IGCC®/IGMA® ASTM E2190 2017 Al Abbar Architectural Glass 2977 BC4/ALLC U/U MA LF PIB/S2 Yes Sanaa St., PO Box 1626 Ras Alkhor, Industrial Estate Dubai United Arab Emirates 104-333-1362 Al Abbar IGCC®/IGMA® 2017 February 2018 Page 15 CERTIFICATION FRAME INTERNAL LICENSEE NUMBER CONSTRUCTION SUBSTRATE SPACER DESICCANT SEALANT COMPONENTS GCIA Aldora Aluminum and Glass Products Inc. 2853 BC3/MC1/MT/IC U/C2 FS IB HM IC 7421 E. Spartan Blvd. Charleston, SC 29418-8462 843-552-6377 ALDORA(SC) IGCC(R)/IGMA(R) 17 All Counties Glass 4465 MC4/PLK/IC U/C2 AA LF HM/RHM IC 2020 A East Miner Avenue Stockton, CA 95205 209-888-8720 ACG Stockton IGCC®/IGMA® 2017 Allweather Windows 2539 BC3/MC1/MT/IC U/C2/U FS/FS IB/IB RHM IC Yes 18550, 118A Avenue North West 3938 BC3/MC1/SS/IC U/C2 US DM RHM IC Yes Edmonton, AB T5S 2K7 Canada 780-451-0670 AWW IGCC®/IGMA® E2190 2017 American Insulated Glass Inc. 2962 BC3/MC1/MT/IC U/C2 FS IB HM IC 3965 East Conley Road 4294 BC4/PLLC/IC U/C2 AA LF PIB/S2 IC PO Box 750 Conley, GA 30288 404-361-9154 American Insulated Glass IGCC®/IGMA® 2017 Architectural Glass of North America 3329 BC4/GSLC U/C1/U SS/SS LF/LF PIB/S2 Yes 200 Mountain Road Collingwood, ON L9Y 4V5 Canada 705-444-6654 AGNORA IGCC®/IGMA® E2190 2017 Architectural Glass Products, LLC. 2664 BC4/PLLC U/C2 AA LF PIB/PU2 6200 Maple Avenue 2666 BC4/PLLC U/C2 PHSS LF PIB/PU2 St. Louis, MO 63130 314-725-8088 Architectural Glass Products LLC IGCC®/IGMA® 17 Associated Materials, Inc. - Central 3017 BC3/MC1/ZS/IC U/C3/U UT/UT DM/DM HM IC Yes 3773 State Road 3018 BC3/MC1/MT/IC U/C3/U FS/FS IB/IB HM IC Yes Cuyahoga Falls, OH 44223 3332 BC3/MC1/ZS/IC U/C3/U US/US DM/DM HM IC Yes 330-922-2069 3503 BC3/MC1/ZS/IC U/C3/U US/US DM/DM HM IC Yes AWCC IGCC®/IGMA® + date 3951 BC3/MC1/ZS/IC U/C3/U UT/UT DM/DM HM IC Yes 4081 BC3/MC1/ZS/IC U/C3/U UT/UT DM/DM HM IC Yes 4433 BC3/MC1/MT/IC U/C3/U FS/FS IB/IB HM IC Yes Associated Materials, Inc. - Midwest 1133 BC3/MC1/ZS/IC U/C3/U UT/UT DM/DM HM IC Yes 3820 44th Ave. SW 3171 BC3/MC1/MT/IC U/C3/U FS/FS IB/IB HM IC Yes Cedar Rapids, IA 52401 3481 BC3/MC1/ZS/IC U/C3/U UT/UT DM/DM HM IC Yes 330-922-2069 3519 BC3/MC1/MT/IC U/C3/U FS/FS IB/IB HM IC Yes AWCMW IGCC®/IGMA® + date + Line # 3717 BC3/MC1/ZS/IC U/C3/U US/US DM/DM HM IC Yes 4407 BC3/MC1/ZS/IC U/C3/U US/US DM/DM HM IC Yes 4408 BC3/MC1/ZS/IC U/C3/U UT/UT DM/DM HM IC Yes February 2018 Page 16 CERTIFICATION FRAME INTERNAL LICENSEE NUMBER CONSTRUCTION SUBSTRATE SPACER DESICCANT SEALANT COMPONENTS GCIA Associated Materials, Inc. - Northwest 2587 BC3/MC1/MT/CT/IC U/C3/U FS/FS IB/IB HM IC Yes 2801 78th Avenue East 3034 BC3/MC1/MT/CT/IC U/C3/U FS/FS IB/IB HM IC Yes Fife, WA 98424 3250 BC3/MC1/ZS/IC U/C3/U UT/UT DM/DM RHM/HM IC Yes (425) 481-7101 4091 BC3/MC1/ZS/IC U/C3/U US/US DM/DM RHM/HM IC Yes AWCNW IGCC(R)/IGMA(R) + date 4252 BC3/MC1/ZS/IC U/C3/U UT/UT DM/DM RHM/HM IC Yes 4638 BC3/MC1/ZS/IC U/C3/U US/US DM/DM RHM/HM IC Yes Associated Materials, Inc. - Southeast 2068 BC3/MC1/MT/IC U/C3/U FS/FS IB/IB HM IC Yes 3800 Farmgate Road 3103 BC3/MC1/MT/IC U/C3/U FS/FS IB/IB HM IC Yes Kinston, NC 28501 3199 BC3/MC1/ZS/IC U/C3/U UT/UT DM/DM HM IC Yes 252-527-5050 3702 BC3/MC1/ZS/IC U/C3/U US/US DM/DM HM IC Yes AWCSE IGCC(R)/IGMA(R) + date 3904 BC3/MC1/ZS/IC U/C3/U UT/UT DM/DM HM IC Yes 3905 BC3/MC1/ZS/IC U/C3/U US/US DM/DM HM IC Yes Associated Materials, Inc. - Southwest 2551 BC3/MC1/MT/CT/IC U/C3/U FS/FS IB/IB HM IC Yes 7550 E. 30th St. 4108 BC3/MC1/ZS/IC U/C3/U US/US DM/DM HM IC Yes Yuma, AZ 85365 4308 BC3/MC1/ZS/IC U/C3/U UT/UT DM/DM HM IC Yes 928-344-6500 4309 BC3/MC1/ZS/IC U/C3/U US/US DM/DM HM IC Yes AWCSW IGCC(R)/IGMA(R) + date 4609 BC3/MC1/ZS/IC U/C2/U UT/UT DM/DM HM IC Yes 4610 BC3/MC1/MT/IC U/C2/U FS/FS IB/IB HM IC Yes Avic Sanxin Co., Ltd. 2614 BC4/GSLC U/C2 AA LF PIB/S2 West 3rd Road Road, Xiangshuihe Industrial Zone West DayaBay, Huizhou Guangdong 516083 China 075527633580 Guangdon Avic IGCC®/IGMA® 2017 Beijing Northglass Technologies Co. Ltd 4646 BC4/GSLC U/U MA LF PIB/S2 No. 1 North Road Beijing 100000 China +861082032601 Beijing Wuhua Tianbao Glass Co. 4243 BC4/GSLC U/C2 AA LF PIB/S2 Yes 1 Renli Road Liqiao Town Shunyi District Beijing 101304 China +86-10-69485045 Beijing Wuhuatianbao Glass IGCC®/IGMA® 2017 Berkowitz, J.E. 3458 BC4/PLLC U/C2 SS LF PIB/S2 Yes One Gateway Boulevard 4372 BC3/MC1/MT U/C2 FS IB PIB/S2 Yes PO Box 427 4374 BC4/GSLC U/C2 AA LF PIB/S2 Yes Pedricktown, NJ 08067 856-456-7800 JEB IGCC(R)/IGMA(R) 17 February 2018 Page 17 CERTIFICATION FRAME INTERNAL LICENSEE NUMBER CONSTRUCTION SUBSTRATE SPACER DESICCANT SEALANT COMPONENTS GCIA Blue Star Glass Inc. 4618 BC4/GSLC/IC U/C2 AA LF PIB/S2 IC 2300 US Highway 1 4619 BC4/MC1/IC U/C2 MA LF PIB/S2 IC Building 31 North Brunswick, NJ 08902 732-422-1272 Blue Star IGCC®/IGMA® E2190 2017 BMC (Building Materials & Construction 3693 BC3/MC1/MT/IC U/C2 BPS IB BPS IC Services) 850 White Circle Court PO Box 4237 Marietta, GA 30060 678-819-6163 BMC IGCC(R)IGMA + Date Burhani Glass Factory, LLC 4232 MC4/PLK U/U MA LF PIB/S2 20A St., Ras 71 Khor Ind. Area 1 4233 MC4/PLK U/U SS LF PIB/S2 PO Box 294214 Dubai UAE 971-4-3200-448 BVGLAZING SYSTEMS 3507 BC3/MC1/MT U/C2 FS IB PIB/S2 Yes 131 Caldari Road 4292 BC4/GSLC U/C2 AA LF PIB/S2 Yes Concord, ON L4K 3Z9 4293 BC4/GSLC U/C2 PHSS LF PIB/S2 Yes Canada 4463 BC4/GSLC U/C2 MA LF PIB/S2 Yes 905-738-8600 Allan Window IGCC®/IGMA® 2017 4464 MC4/PLK U/C2 SS LF PIB/S2 Yes Cam Merkezi San.
Load more

Recommended publications
  • Disability Classification System
    CLASSIFICATION SYSTEM FOR STUDENTS WITH A DISABILITY Track & Field (NB: also used for Cross Country where applicable) Current Previous Definition Classification Classification Deaf (Track & Field Events) T/F 01 HI 55db loss on the average at 500, 1000 and 2000Hz in the better Equivalent to Au2 ear Visually Impaired T/F 11 B1 From no light perception at all in either eye, up to and including the ability to perceive light; inability to recognise objects or contours in any direction and at any distance. T/F 12 B2 Ability to recognise objects up to a distance of 2 metres ie below 2/60 and/or visual field of less than five (5) degrees. T/F13 B3 Can recognise contours between 2 and 6 metres away ie 2/60- 6/60 and visual field of more than five (5) degrees and less than twenty (20) degrees. Intellectually Disabled T/F 20 ID Intellectually disabled. The athlete’s intellectual functioning is 75 or below. Limitations in two or more of the following adaptive skill areas; communication, self-care; home living, social skills, community use, self direction, health and safety, functional academics, leisure and work. They must have acquired their condition before age 18. Cerebral Palsy C2 Upper Severe to moderate quadriplegia. Upper extremity events are Wheelchair performed by pushing the wheelchair with one or two arms and the wheelchair propulsion is restricted due to poor control. Upper extremity athletes have limited control of movements, but are able to produce some semblance of throwing motion. T/F 33 C3 Wheelchair Moderate quadriplegia. Fair functional strength and moderate problems in upper extremities and torso.
    [Show full text]
  • 2018 Jessica Uniack Beach to Bay Race Long Beach Yacht Club
    2018 Jessica Uniack Beach to Bay Race Long Beach Yacht Club Results for 2018 Jessica Uniack Beach to Bay Race CFJ Class Sailed: 1, Discards: 0, To count: 1, Entries: 25, Scoring system: Appendix A Class SailNo Club HelmName CrewName R1 Total Nett CFJ HHSF Jack Haliday Nicholas Ridout CFJ HHSF Trae Sanchez Ben Hagadorn CFJ LBYC 7 LBYC Nicky Lech Kai Bramble 1.0 1.0 1.0 CFJ 22 ABYC Nicholas Muller Ulises Lewis 2.0 2.0 2.0 CFJ LBYC 10 LBYC Preston Woodworth Alex Lech 3.0 3.0 3.0 CFJ 43 ABYC Summer Drake Paige Odell 4.0 4.0 4.0 CFJ 23 ABYC Nikhil Stewart Jamarcus Parker 5.0 5.0 5.0 CFJ 42 ABYC Sean colley Thomas Dobson 6.0 6.0 6.0 CFJ 44 ABYC Nicolas Sanchez Nicole Morikawa 7.0 7.0 7.0 CFJ 24 ?? 8.0 8.0 8.0 CFJ 0 HHSF Trae Sanchez Ben H 9.0 9.0 9.0 CFJ LBYC 2 LBYC Kyer Fox Isaure Chalandon 10.0 10.0 10.0 CFJ LBYC 9 LBYC Sawyer Bambam-Moak Katin Cathey 11.0 11.0 11.0 Class SailNo Club HelmName CrewName R1 Total Nett CFJ 46 ABYC Elisabeth Rossbach Troy Davidson 12.0 12.0 12.0 CFJ 00 HHSF Jack Haliday Nicholas 13.0 13.0 13.0 CFJ 41 ABYC Michael Colley Emilia Anctil 14.0 14.0 14.0 CFJ 6161 DPYC Riley Lenthall 15.0 15.0 15.0 CFJ 9PYSF HHYC Jack Busche Nolan Davis 16.0 16.0 16.0 CFJ 1510 DPYC Ryan Brown Colin Sekerka 17.0 17.0 17.0 CFJ 5151 DPYC Christopher Andersen Hunter Laws 18.0 18.0 18.0 CFJ LBYC 3 LBYC Luke Bramble Rio Dumont 19.0 19.0 19.0 CFJ LBYC 5 LBYC Jack Snow Reese Lapham 26.0 DSQ 26.0 26.0 CFJ 6161 DPYC Carsen Lenthall 26.0 DNC 26.0 26.0 CFJ 6161 DPYC Riley Lenthall 26.0 DNC 26.0 26.0 CFJ 5151 DPYC Hunter Laws Christopher Anderson
    [Show full text]
  • Marelli D6C & D5C ATEX Motor Technical Catalogue
    Motors for This catalogue refers to ATEX Motors belonging to Group I Category M2 and Group II Category 2G, 2D, 2GD as described. STANDARDS ® BEARINGS Hazardous Areas The ATEX Motors described in this catalogue are manufactured in accordance with IEC 60034-1-5-6-7-8-9-12-14, IEC 60072-1, EN 50347, EN 60079- D5, D6 SERIES Frame Size (mm) D - end N - end Frame Size Poles B 3 V 1 MarelliMotori 0-1-7, EN 61241-0-1. 71* 6202-2Z 6202-2Z D - end N - end D - end N - end I M2, II 2G, II 2D EUROPEAN DIRECTIVES 355-400 2 6217-C3 6217-C3 6217-C3 7217 B 80* 6204-2Z 6204-2Z Ex d/de I, Ex d/de IIB, Ex tD A21 IP65 Title Directive 90* 6205-2Z 6205-2Z 355 4 NU222-C3 6217-C3 NU222-C3 6217-C3 + 7217 B Equipment and protective system intended for use in potentially explosive atmospheres (ATEX) 94/9/EC 100* 6206-2Z 6206-2Z 400 4 NU222-C3 6222-C3 NU222-C3 6222-C3 + 7222 B Electromagnetic Compatibility (EMC) 2004/108/IEC 112* 6206-2Z 6206-2Z Low Voltage Directive (LVD) 2006/95/EC 132* 6308-2Z 6308-2Z HEADQUARTERS ITALIAN OFFICES Machinery Directive (MD) 98/37/EC 160 - 180M 6310-Z-C3 6209-Z-C3 Marelli Motori S.p.A. Milan CERTIFICATES 180L 6310-Z-C3 6210-Z-C3 Via Sabbionara, 1 Via Cesare Cantù, 29 200 6312-Z-C3 6210-Z-C3 Frame size Number Temperature Limits 36071 Arzignano (VI) Italy 20092 Cinisello Balsamo (MI) Italy 225 6313-Z-C3 6213-Z-C3 71-132 BVI 08 ATEX 0001 -20°C +40°C* 160-315 CESI 02 ATEX 071 -20 C +40 C* 250 6314-Z-C3 6213-Z-C3 (T) +39.0444.479711 (T) +39.02.660.131.66 ° ° These tables describe the bearing types used in standard configurations.
    [Show full text]
  • Framework for In-Field Analyses of Performance and Sub-Technique Selection in Standing Para Cross-Country Skiers
    sensors Article Framework for In-Field Analyses of Performance and Sub-Technique Selection in Standing Para Cross-Country Skiers Camilla H. Carlsen 1,*, Julia Kathrin Baumgart 1, Jan Kocbach 1,2, Pål Haugnes 1 , Evy M. B. Paulussen 1,3 and Øyvind Sandbakk 1 1 Centre for Elite Sports Research, Department of Neuromedicine and Movement Science, Faculty of Medicine and Health Sciences, Norwegian University of Science and Technology, 7491 Trondheim, Norway; [email protected] (J.K.B.); [email protected] (J.K.); [email protected] (P.H.); [email protected] (E.M.B.P.); [email protected] (Ø.S.) 2 NORCE Norwegian Research Centre AS, 5008 Bergen, Norway 3 Faculty of Health, Medicine & Life Sciences, Maastricht University, 6200 MD Maastricht, The Netherlands * Correspondence: [email protected]; Tel.: +47-452-40-788 Abstract: Our aims were to evaluate the feasibility of a framework based on micro-sensor technology for in-field analyses of performance and sub-technique selection in Para cross-country (XC) skiing by using it to compare these parameters between elite standing Para (two men; one woman) and able- bodied (AB) (three men; four women) XC skiers during a classical skiing race. The data from a global navigation satellite system and inertial measurement unit were integrated to compare time loss and selected sub-techniques as a function of speed. Compared to male/female AB skiers, male/female Para skiers displayed 19/14% slower average speed with the largest time loss (65 ± 36/35 ± 6 s/lap) Citation: Carlsen, C.H.; Kathrin found in uphill terrain.
    [Show full text]
  • Design of Control Laws for Flutter Suppression Based on the Aerodynamic Energy Concept and Comparisons with Other Design Methods
    NASA Technical Paper 3056 1990 Design of Control Laws for Flutter Suppression Based on the Aerodynamic Energy Concept and Comparisons With Other Design Methods E. Nissim Ames Research Center Dryden Flight Research Facility Edwards, California National Aeronautics and Space Administration Office of Management Scientific and Technical Information Division CONTENTS SUMMARY INTRODUCTION NOMENCLATURE 2 Abbreviations ............................................... 2 2 Letter and Mathematical Symbols ..................................... Subscripts ................................................. 3 REVIEW OF AERODYNAMIC ENERGY CONCEPT 3 3 General Approach ............................................. Review of Aerodynamic Energy Two-Dimensional Strip Results ..................... 4 Review of Specific Control Laws Obtained Using the Aerodynamic Energy Concept ........... 5 Review of Control Law Synthesis Technique ............................... 6 DAST-ARW1 MODEL 7 Description ................................................. 7 Validation ................................................. 7 DEVELOPMENT AND EVALUATION OF IMPROVED CONTROL LAW SYNTHESIS TECHNIQUE 9 Case 1--Synthesis Technique and Presentation of Results for Systems With No Actuator Dynamics . 9 Case 2----Control Laws Synthesized With Actuator and With Structural Filter ............... 12 Definition of the Form of the Required Control Law ......................... 12 Presentation of Results ........................................ 13 Case 3--Results for Systems With Actuator Only,
    [Show full text]
  • National Classification? 13
    NATIONAL CL ASSIFICATION INFORMATION FOR MULTI CLASS SWIMMERS Version 1.2 2019 PRINCIPAL PARTNER MAJOR PARTNERS CLASSIFICATION PARTNERS Version 1.2 2019 National Swimming Classification Information for Multi Class Swimmers 1 CONTENTS TERMINOLOGY 3 WHAT IS CLASSIFICATION? 4 WHAT IS THE CLASSIFICATION PATHWAY? 4 WHAT ARE THE ELIGIBLE IMPAIRMENTS? 5 CLASSIFICATION SYSTEMS 6 CLASSIFICATION SYSTEM PARTNERS 6 WHAT IS A SPORT CLASS? 7 HOW IS A SPORT CLASS ALLOCATED TO AN ATHLETE? 7 WHAT ARE THE SPORT CLASSES IN MULTI CLASS SWIMMING? 8 SPORT CLASS STATUS 11 CODES OF EXCEPTION 12 HOW DO I CHECK MY NATIONAL CLASSIFICATION? 13 HOW DO I GET A NATIONAL CLASSIFICATION? 13 MORE INFORMATION 14 CONTACT INFORMATION 16 Version 1.2 2019 National Swimming Classification Information for Multi Class Swimmers 2 TERMINOLOGY Assessment Specific clinical procedure conducted during athlete evaluation processes ATG Australian Transplant Games SIA Sport Inclusion Australia BME Benchmark Event CISD The International Committee of Sports for the Deaf Classification Refers to the system of grouping athletes based on impact of impairment Classification Organisations with a responsibility for administering the swimming classification systems in System Partners Australia Deaflympian Representative at Deaflympic Games DPE Daily Performance Environment DSA Deaf Sports Australia Eligibility Criteria Requirements under which athletes are evaluated for a Sport Class Evaluation Process of determining if an athlete meets eligibility criteria for a Sport Class HI Hearing Impairment ICDS International Committee of Sports for the Deaf II Intellectual Impairment Inas International Federation for Sport for Para-athletes with an Intellectual Disability General term that refers to strategic initiatives that address engagement of targeted population Inclusion groups that typically face disadvantage, including people with disability.
    [Show full text]
  • United States Olympic Committee and U.S. Department of Veterans Affairs
    SELECTION STANDARDS United States Olympic Committee and U.S. Department of Veterans Affairs Veteran Monthly Assistance Allowance Program The U.S. Olympic Committee supports Paralympic-eligible military veterans in their efforts to represent the USA at the Paralympic Games and other international sport competitions. Veterans who demonstrate exceptional sport skills and the commitment necessary to pursue elite-level competition are given guidance on securing the training, support, and coaching needed to qualify for Team USA and achieve their Paralympic dreams. Through a partnership between the United States Department of Veterans Affairs and the USOC, the VA National Veterans Sports Programs & Special Events Office provides a monthly assistance allowance for disabled Veterans of the Armed Forces training in a Paralympic sport, as authorized by 38 U.S.C. § 322(d) and section 703 of the Veterans’ Benefits Improvement Act of 2008. Through the program the VA will pay a monthly allowance to a Veteran with a service-connected or non-service-connected disability if the Veteran meets the minimum VA Monthly Assistance Allowance (VMAA) Standard in his/her respective sport and sport class at a recognized competition. Athletes must have established training and competition plans and are responsible for turning in monthly and/or quarterly forms and reports in order to continue receiving the monthly assistance allowance. Additionally, an athlete must be U.S. citizen OR permanent resident to be eligible. Lastly, in order to be eligible for the VMAA athletes must undergo either national or international classification evaluation (and be found Paralympic sport eligible) within six months of being placed on the allowance pay list.
    [Show full text]
  • Para Cycling Information Sheet About the Sport Classification Explained
    Para cycling information sheet About the sport Para cycling is cycling for people with impairments resulting from a health condition (disability). Para athletes with physical impairments either compete on handcycles, tricycles or bicycles, while those with a visual impairment compete on tandems with a sighted ‘pilot’. Para cycling is divided into track and road events, with seven events in total. Classification explained In Para sport classification provides the structure for fair and equitable competition to ensure that winning is determined by skill, fitness, power, endurance, tactical ability and mental focus – the same factors that account for success in sport for able-bodied athletes. The Para sport classification assessment process identifies the eligibility of each Para athlete’s impairment, and groups them into a sport class according to the degree of activity limitation resulting from their impairment. Classification is sport-specific as an eligible impairment affects a Para athlete’s ability to perform in different sports to a different extent. Each Para sport has a different classification system. Standard Classification in detail Para-Cycling sport classes include: Handcycle sport classes H1 – 5: There are five different sport classes for handcycle racing. The lower numbers indicate a more severe activity limitation. Para athletes competing in the H1 classes have a complete loss of trunk and leg function and limited arm function, e.g. as a result of a spinal cord injury. Para athletes in the H4 class have limited or no leg function, but good trunk and arm function. Para cyclists in sport classes H1 – 4 compete in a reclined position. Para cyclists in the H5 sport class sit on their knees because they are able to use their arms and trunk to accelerate the handcycle.
    [Show full text]
  • Downloaded As 2Ibz.Pdb [21] Protein from Research Collaboratory for Structural Bioinformatics (RCSB) Protein Data Bank (PDB)
    molecules Article Search for Novel Lead Inhibitors of Yeast Cytochrome bc1, from Drugbank and COCONUT Ozren Jovi´c* and Tomislav Šmuc Ruder¯ Boškovi´cInstitute, BijeniˇckaCesta 54, 10 000 Zagreb, Croatia; [email protected] * Correspondence: [email protected]; Tel.: +385-1-4561-085 Abstract: In this work we introduce a novel filtering and molecular modeling pipeline based on a fingerprint and descriptor similarity procedure, coupled with molecular docking and molecular dynamics (MD), to select potential novel quoinone outside inhibitors (QoI) of cytochrome bc1 with the aim of determining the same or different chromophores to usual. The study was carried out using the yeast cytochrome bc1 complex with its docked ligand (stigmatellin), using all the fungicides from FRAC code C3 mode of action, 8617 Drugbank compounds and 401,624 COCONUT compounds. The introduced drug repurposing pipeline consists of compound similarity with C3 fungicides and molecular docking (MD) simulations with final QM/MM binding energy determination, while aiming for potential novel chromophores and perserving at least an amide (R1HN(C=O)R2) or ester functional group of almost all up to date C3 fungicides. 3D descriptors used for a similarity test were based on the 280 most stable Padel descriptors. Hit compounds that passed fingerprint and 3D descriptor similarity condition and had either an amide or an ester group were submitted to docking where they further had to satisfy both Chemscore fitness and specific conformation constraints. This rigorous selection resulted in a very limited number of candidates that were forwarded to MD simulations and QM/MM binding affinity estimations by the ORCA DFT program.
    [Show full text]
  • (VA) Veteran Monthly Assistance Allowance for Disabled Veterans
    Revised May 23, 2019 U.S. Department of Veterans Affairs (VA) Veteran Monthly Assistance Allowance for Disabled Veterans Training in Paralympic and Olympic Sports Program (VMAA) In partnership with the United States Olympic Committee and other Olympic and Paralympic entities within the United States, VA supports eligible service and non-service-connected military Veterans in their efforts to represent the USA at the Paralympic Games, Olympic Games and other international sport competitions. The VA Office of National Veterans Sports Programs & Special Events provides a monthly assistance allowance for disabled Veterans training in Paralympic sports, as well as certain disabled Veterans selected for or competing with the national Olympic Team, as authorized by 38 U.S.C. 322(d) and Section 703 of the Veterans’ Benefits Improvement Act of 2008. Through the program, VA will pay a monthly allowance to a Veteran with either a service-connected or non-service-connected disability if the Veteran meets the minimum military standards or higher (i.e. Emerging Athlete or National Team) in his or her respective Paralympic sport at a recognized competition. In addition to making the VMAA standard, an athlete must also be nationally or internationally classified by his or her respective Paralympic sport federation as eligible for Paralympic competition. VA will also pay a monthly allowance to a Veteran with a service-connected disability rated 30 percent or greater by VA who is selected for a national Olympic Team for any month in which the Veteran is competing in any event sanctioned by the National Governing Bodies of the Olympic Sport in the United State, in accordance with P.L.
    [Show full text]
  • Pushbuttons.Pdf
    PushButtons2013Cover.QXD_CircuitBreakers_2006Cover.QXD 10/3/17 2:20 PM Page 1 Altech Corporation 35 Royal Road Flemington, NJ 08822-6000 P 908.806.9400 • F 908.806.9490 www.altechcorp.com Altech Corp.® 255-052013-3M Printed July 2013 AltechAltech CorporationCorporation Since 1984, Altech Corporation has grown to become a leading supplier of automation and industrial control components. Headquartered in Flemington, NJ, Altech has an experienced staff of engineering, manufacturing and sales personnel to provide the highest quality products with superior service. This is the Altech Commitment! Altech 22 and 30mm Push Buttons offer ideal cost-effective solutions for control circuits utilizing both direct and remote management applications. Ease of assembly has been engineered into the design; the only tool necessary for installation is a screwdriver. • LED Indicating Devices • Pilot Lights • Push Button Stations • Push Button Enclosures • UL Recognized • Custom Push Button Assemblies • All Very Competitively Priced Our well trained technical experts welcome the opportunity to answer your technical questions and provide solutions to your automation and control needs. Give us a call or visit www.altechcorp.com. Quality Commitment Altech’s control components meet diverse national and international standards such as UL, NEC, CSA, IEC, VDE and more. Altech provides superior customer service and delivery through Total Quality Management and Continuous Process Improvement. Altech is ISO 9001 approved. We perform these services with honesty and integrity
    [Show full text]
  • A Strategy to Optimize the Generation of Stable Chromobody Cell Lines for Visualization and Quantification of Endogenous Proteins in Living Cells
    Supplementary: A strategy to optimize the generation of stable chromobody cell lines for visualization and quantification of endogenous proteins in living cells Bettina-Maria Keller1, Julia Maier1, Melissa Weldle1, Soeren Segan2, Bjoern Traenkle1, Ulrich Rothbauer1,2* 1 Pharmaceutical Biotechnology, Eberhard Karls University Tuebingen, Germany 2 Natural and Medical Sciences Institute at the University of Tuebingen, Reutlingen, Germany Correspondence: Prof. Dr. Ulrich Rothbauer, Natural and Medical Sciences Institute at the University of Tuebingen Markwiesenstr. 55, 72770 Reutlingen, Germany. E-mail: [email protected] Phone: +49 7121 51530-415 Fax: +49 7121 51530-816 Supplementary information DNA oligo name Sequence, 5’ - 3’ NB-ubi-for ATA TAT CTG CAG GAG TCT GGG GGA GGC TTG GTG CA NB-ubi-rev ATA TAT TCC GGA GGA GAC GGT GAC CTG GGT CCC β-actin-promoter-for GGA ATT AAT ACT GCC TGG CCA CTC CAT G β-actin-promoter-rev TCC GCT AGC TCG GCA AAG GCG AGG C β-actin-promoter-mutPstI-for AGA GCT CCT TGT GCA GGA GCG β-actin-promoter-mutPstI-rev TGG AGG GCA TGG AGT GGC AAVS1-CB-donor-fragment-2-for TAG AGG CGG CAA TTG TTC A AAVS1-CB-donor-fragment-2-rev TGT TGT TAA CTT GTT TAT TGC AGC Seq-AAVS1-CB-donor-1 TAT GGA AAA ACG CCA GCA AC Seq-AAVS1-CB-donor-2 ATG TGG CTC TGG TTC TGG G Seq-AAVS1-CB-donor-3 AGC GGC TCG GCT TCA C Seq-AAVS1-CB-donor-4 CCT TAG ATG TTT TAC TAG CCA GAT genPCR-AAVS1-int-for TCG ACT TCC CTT CTT CCG ATG genPCR-AAVS1-int-rev CTC AGA TTC TGG GAG AGG GTA EF1α-promoter (gBlock® gene TTACCGCCATGCATTAGTTATTAATGGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACAT
    [Show full text]