DOCSLIB.ORG

Supplemental Material.Pdf

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplemental Material.Pdf Supplemental Material ZNF750 Interacts with KLF4 and RCOR1, KDM1A, and CTBP1/2 Chromatin Regulators to Repress Epidermal Progenitor Genes and Induce Differentiation Genes Lisa D. Boxer, Brook Barajas, Shiying Tao, Jiajing Zhang, and Paul Khavari Supplemental Inventory Figure S1. This figure supports Figure 1 and shows the Gene Ontology terms for ZNF750-bound but unaffected genes, the genomic enrichment of ZNF750 ChIP-seq peaks, and the percentage of peaks that contain the ZNF750 motif. Figure S2. This figure supports Figure 2 and shows gene expression changes with depletion of ZNF750-interacting proteins, confirms the knock-down of ZNF750-interacting proteins, and shows the quantification of Ki67 in ZNF750-interacting protein depleted organotypic tissue. Figure S3. This figure supports Figure 3 and shows the quantification of ZNF750 and interacting protein co-IPs, and IPs and Far western blots demonstrating competition between KLF4 and KDM1A for binding to ZNF750. Figure S4. This figure supports Figure 4 and shows the expression of ZNF750 mutant proteins and the effects of full-length or mutant ZNF750 on differentiation in organotypic tissue and on clonogenic growth. Figure S5. This figure supports Figure 5 and shows the effects of mutagenesis of ZNF750 and KLF4 motifs on reporter activity, and the changes in histone marks with depletion of ZNF750 and interacting proteins. Figure S6. This figure supports Figure 6 and shows the changes in mRNA and protein expression of ZNF750-interacting proteins during keratinocyte differentiation, and the expression of ZNF750-interacting proteins with ZNF750 depletion. Table S1. Supports Figure 1 and shows the genomic coordinates of ZNF750 ChIP-seq peaks. Table S2. Supports Figure 5 and shows the genomic coordinates of KLF4 ChIP-seq peaks. Table S3. Supports Figure 5 and shows the genomic coordinates of RCOR1 ChIP-seq peaks. Table S4. Supports Figure 5 and shows the genomic coordinates of KDM1A ChIP-seq peaks. Table S5. Supports Figure 5 and shows the genomic coordinates of KLF4-enriched ChIP-seq peaks. Table S6. Supports Figure 5 and shows the genomic coordinates of KDM1A-enriched ChIP-seq peaks. Supplemental Materials and Methods: This includes information on lentiviral constructs, siRNAs, and primer sequences. Figure S1 A B ) Genomic enrichment of ZNF750 peaks s l GO terms for ZNF750-bound and unaffected genes a v r 2.0 e t Regulation of transcription n i l 1.5 Signal transduction o r t RNA metabolic process n o 1.0 c Cell communication / s k 0.5 Transport a e p Protein modification process 0.0 0 0.0 0.5 1.0 1.5 2.0 5 7 F -0.5 -log10(p-value) N Z ( -1.0 2 g o l TTS Intron Exon 3' UTR Intergenic C PromoterPromoter - TSS - distal f i t o 100 m 0 5 7 80 F N Z g 60 n i n i a t 40 n o c s 20 k a e P 0 % ZNF750-activated ZNF750-repressed Figure S2 A B CTLi ZNF750i CTLi KLF4i ZNF750i RCOR1i CTBP1+2i KDM1Ai KLF4i SSBP1i UBR5i DCAF7i PPP2R1Ai ZNF516i CBX3i TRAF7i ZNF185i RBBP7i ZNF750 KLF4 Knock-down LCE3D LCE3A -Actin -Actin ASPRV1 LOR SPRR2G AZGP1 CTLiRCOR1i CTLi KDM1Ai CRNN FLG RPTN RCOR1 KDM1A KLK6 KPRP SPRR3 CDSN -Actin -Actin AQP9 KCTD4 HOPX LYPD5 CNFN CTLi CTBP1i CTLi CTBP2i KRT80 TMEM86A NLRP10 CTBP1 CTBP2 LCE3B IVL SPRR1A ATP12A -Actin -Actin EGR3 SBSN SPINK5 AGPAT9 OVOL1 ATP10B NDRG2 PRDM1 ETS1 PPARD TGFA C i ALOXE3 e l GRHL1 c i DSG1 60 u 5 e l n ATP2C2 c l u CDCA7 a s n 50 CDC25B 4 l *** a ** DCTPP1 a b s SERPINH1 a 40 r ** RFC5 a * p B 3 FKBP5 * u e s HAUS1 v 30 i e t ZWINT i v i s 2 NPM3 t i o 20 DPP3 s p - MAD2L1 o 7 p MCM6 - 1 6 i 10 ARHGEF3 7 K 6 QDPR i K % RAD51C 0 0 TYMS % CDH3 COL5A2 CTLi CTLi KLF4i LXN KLF4i KDM1Ai RCOR1iKDM1Ai HAUS4 ZNF750i RCOR1i CTBP1/2i ZNF750i CTBP1/2i RPA3 MCM3 IGFBP2 PRKCDBP LGALS1 RFC3 TCEA3 LAMB1 CDKN3 COL7A1 EPCAM MATN2 RBBP8 ECM2 METTL7A VSNL1 WNT3 MMP28 TSPAN1 KRT8 Figure S3 A ZNF750 WB KLF4 WB RCOR1 WB 25 15 10 20 8 10 15 6 10 t 4 t t 5 u u u 5 2 p p p n n n I I I 1.5 1.5 1.0 % % % 1.0 1.0 0.5 0.5 0.5 0.0 0.0 0.0 IgG IgG IgG IgG IgG IgG IgG IgG IgG IgG IgG IgG IgG IgG IgG IgG IgG IgG KLF4 IP KLF4 IP KLF4 IP CTBP1 IP CTBP2 IP CTBP1 IP CTBP2 IP ZNF750 IP RCOR1 IPKDM1A IP CTBP1 IP CTBP2 IP ZNF750 IP RCOR1 IPKDM1A IP ZNF750 IP RCOR1 IPKDM1A IP KDM1A WB CTBP1 WB CTBP2 WB 8 20 8 6 15 6 10 4 4 t t t 5 u u u 2 2 p p p n n n I I I 1.0 1.0 1.5 % % % 1.0 0.5 0.5 0.5 0.0 0.0 0.0 IgG IgG IgG IgG IgG IgG IgG IgG IgG IgG IgG IgG IgG IgG IgG IgG IgG IgG KLF4 IP KLF4 IP KLF4 IP KDM1A IP CTBP1 IP CTBP2 IP KDM1A IP CTBP1 IP CTBP2 IP ZNF750 IP RCOR1 IPKDM1A IP CTBP1 IP CTBP2 IP ZNF750 IP RCOR1 IP ZNF750 IP RCOR1 IP B Inputs ZNF750 IPs Inputs ZNF750 IPs ZNF750 WB KLF4 WB KDM1A WB CTLi KLF4i CTLi KLF4i CTLi KDM1Ai CTLi KDM1Ai 25 3.0 2.5 20 2.5 2.0 ZNF750 t t t 2.0 u u 15 u 1.5 p p p n n n I I I 1.5 % 10 % 1.0 KLF4 % 1.0 5 0.5 0.5 KDM1A 0 0.0 0.0 CTLi CTLi CTLi CTLi KLF4i CTLi KLF4i CTLi KLF4i KDM1Ai KDM1Ai KDM1Ai C g ZNF750 KDM1A blot .25 .12 .06 .03 .016 125 KDM1A KDM1A l a KDM1A + 1X KLF4 n 100 g i KDM1A + 5X KLF4 s KDM1A + 1X KLF4 y l 75 KDM1A + 1X MBP n o KDM1A + 5X MBP A KDM1A + 5X KLF4 1 50 M D K 25 KDM1A + 1X MBP % 0 KDM1A + 5X MBP 0.25 0.12 0.06 0.03 0.015 Anti-KDM1A µg ZNF750 g ZNF750 KLF4 blot .25 .12 .06 .03 .016 150 KLF4 KLF4 l KLF4 + 1X KDM1A a n g KLF4 + 5X KDM1A i s 100 KLF4 + 1X KDM1A y KLF4 + 1X MBP l n o KLF4 + 5X MBP KLF4 + 5X KDM1A 4 F L 50 K KLF4 + 1X MBP % 0 KLF4 + 5X MBP 0.25 0.12 0.06 0.03 0.015 Anti-KLF4 µg ZNF750 Figure S4 A B C 1% ChIP Inputs CTL FL C2H2 PLNLS FLAG IP 8 C2H2+ CTL FL C2H2 PLNLS PLNLS ZNF750 HA 6 C2H2 HA t u PLNLS p n 4 I -Actin % 2 0 FLAG KLF4 RCOR1 KDM1A CTBP1 CTBP2 Western blot D CTL Full-length (HA) C2H2 mutant (HA) PLNLS mutant (HA) i e l i 50 c 2.0 e u l n c * * l u a n LOR s l 40 * a a 1.5 b s a HA a r b p 30 u e DAPI s v 1.0 i t i e s 20 v i t o i p s - o 0.5 7 p 6 10 - i 7 K 6 i % K 0 0.0 Ki67 % FLG CTL CTL Full-length Full-length DAPI C2H2 mutant C2H2 mutant PLNLS mutant PLNLS mutant E CTL Full-length C2H2 mutant PLNLS mutant ** 50 * 2 ** m 40 m 1 30 s e i n 20 o l o C 10 # 0 CTL Full-length C2H2 mutant PLNLS mutant Figure S5 A B C Differentiated keratinocytes Undifferentiated keratinocytes ) n 1.0 o i ** s 80 s 1.50 WT ** * CTL e r WT + ZNF750 + KLF4 p e e ZNF750 + KLF4 x * c c 1.25 e MUT + ZNF750 + KLF4 n n motif mutant 0.5 ** i e e 60 L c Differentiation c s s T 1.00 ** ** e e C n / n i i gene i 0 m m 5 0.75 40 u u 7 reporters L 0.0 L F e e N v 0.50 v i i t Z t ( a l a l 20 2 e e g 0.25 R o R l -0.5 0.00 ZNF750 + + 0 PPL -8kb PKP1 +70kb PPL -8kb PKP1 +70kb KLF4 + RCOR1 + + 1.25 * KDM1A + 8 ** CTL WT ** WT + ZNF750 e ** e ZNF750 motif c c MUT + ZNF750 * n 1.00 ** n mutant e e 6 c c s Progenitor s e e n 0.75 i n gene i m m 4 u u L reporters L 0.50 * e e v i v t i t a l a l 2 e 0.25 e R R 0.00 0 CTLi IgG CTLi IgG HOMER3 -11kb RBBP8 -75kb HOMER3 -11kb RBBP8 -75kb ZNFi IgG ZNFi IgG KLF4i IgG KLF4i IgG RCOR1i IgG RCOR1i IgG LSD1i IgG D LSD1i IgG CTBPi IgG CTBPi IgG ChIP-qPCR CTLi H3K4me1 ChIP-qPCR CTLi H3K27ac 3.0 15 ZNFi H3K27ac IgG H3K27acZNFi H3K4me1 IgG H3K4me1 CTLi CTLi KLF4i H3K27ac KLF4i H3K4me1 RCOZNF750iR1i H3K4me1 ZNF750i RCOR1i H3K27ac 2.5 KLF4i KLF4i LSD1i H3K4me1 * LSD1i H3K27ac RCOR1i RCOR1i CTBPi H3K4me1 CTBPi H3K27ac KDM1Ai * KDM1Ai 2.0 CTBP1/2i 10 CTBP1/2i t t u * u p p n n I 1.5 I % % * * * * 1.0 ** * 5 * * * * * * * * 0.5 0.0 0 PPL -8kb PPL -8kb PKP1 +70kb PKP1 +70kb Gene desert DLX5 +100kb RBBP8 -75kb Gene desert DLX5 +100kb RBBP8 -75kb LAMC1 +37kb LAMC1 +37kb HOMER3 -11kb HOMER3 -11kb Figure S6 A B Day 0 Day 3 n o 80 i 1500 Day 0 s ZNF750 s Day 0 e Day 3 r 1000 Day 3 60 p KLF4 x e 500 M n i K e 40 RCOR1 t P o 3 r R p 2 KDM1A 0 20 y a 1 D CTBP1 / 3 0 0 y CTBP2 a D KLF4 KLF4 CTBP1CTBP2 CTBP1CTBP2 ZNF750 RCOR1KDM1A ZNF750 RCOR1KDM1A Actin C ChIP inputs ZNF750 CTBP1 CTBP2 RCOR1 KDM1A HA-KLF4 Supplemental Figure Legends Figure S1.
Load more

Recommended publications
  • High KDM1A Expression Associated with Decreased CD8+T Cells Reduces the Breast Cancer Survival Rate in Patients with Breast Cancer
    Journal of Clinical Medicine Article High KDM1A Expression Associated with Decreased CD8+T Cells Reduces the Breast Cancer Survival Rate in Patients with Breast Cancer Hyung Suk Kim 1 , Byoung Kwan Son 2 , Mi Jung Kwon 3, Dong-Hoon Kim 4,* and Kyueng-Whan Min 5,* 1 Department of Surgery, Division of Breast Surgery, Hanyang University Guri Hospital, Hanyang University College of Medicine, Guri 11923, Korea; [email protected] 2 Department of Internal Medicine, Eulji Hospital, Eulji University School of Medicine, Seoul 03181, Korea; [email protected] 3 Department of Pathology, Hallym University Sacred Heart Hospital, Hallym University College of Medicine, Anyang 14068, Korea; [email protected] 4 Department of Pathology, Kangbuk Samsung Hospital, Sungkyunkwan University School of Medicine, Seoul 03181, Korea 5 Department of Pathology, Hanyang University Guri Hospital, Hanyang University College of Medicine, Guri 11923, Korea * Correspondence: [email protected] (D.-H.K.); [email protected] (K.-W.M.); Tel.: +82-2-2001-2392 (D.-H.K.); +82-31-560-2346 (K.-W.M.); Fax: +82-2-2001-2398 (D.-H.K.); Fax: +82-2-31-560-2402 (K.-W.M.) Abstract: Background: Lysine-specific demethylase 1A (KDM1A) plays an important role in epige- netic regulation in malignant tumors and promotes cancer invasion and metastasis by blocking the immune response and suppressing cancer surveillance activities. The aim of this study was to analyze Citation: Kim, H.S.; Son, B.K.; Kwon, survival, genetic interaction networks and anticancer immune responses in breast cancer patients M.J.; Kim, D.-H.; Min, K.-W. High with high KDM1A expression and to explore candidate target drugs.
    [Show full text]
  • Multifactorial Erβ and NOTCH1 Control of Squamous Differentiation and Cancer
    Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks, … , Karine Lefort, G. Paolo Dotto J Clin Invest. 2014;124(5):2260-2276. https://doi.org/10.1172/JCI72718. Research Article Oncology Downmodulation or loss-of-function mutations of the gene encoding NOTCH1 are associated with dysfunctional squamous cell differentiation and development of squamous cell carcinoma (SCC) in skin and internal organs. While NOTCH1 receptor activation has been well characterized, little is known about how NOTCH1 gene transcription is regulated. Using bioinformatics and functional screening approaches, we identified several regulators of the NOTCH1 gene in keratinocytes, with the transcription factors DLX5 and EGR3 and estrogen receptor β (ERβ) directly controlling its expression in differentiation. DLX5 and ERG3 are required for RNA polymerase II (PolII) recruitment to the NOTCH1 locus, while ERβ controls NOTCH1 transcription through RNA PolII pause release. Expression of several identified NOTCH1 regulators, including ERβ, is frequently compromised in skin, head and neck, and lung SCCs and SCC-derived cell lines. Furthermore, a keratinocyte ERβ–dependent program of gene expression is subverted in SCCs from various body sites, and there are consistent differences in mutation and gene-expression signatures of head and neck and lung SCCs in female versus male patients. Experimentally increased ERβ expression or treatment with ERβ agonists inhibited proliferation of SCC cells and promoted NOTCH1 expression and squamous differentiation both in vitro and in mouse xenotransplants. Our data identify a link between transcriptional control of NOTCH1 expression and the estrogen response in keratinocytes, with implications for differentiation therapy of squamous cancer. Find the latest version: https://jci.me/72718/pdf Research article Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks,1,2 Paola Ostano,3 Seung-Hee Jo,1,2 Jun Dai,1,2 Spiro Getsios,4 Piotr Dziunycz,5 Günther F.L.
    [Show full text]
  • Neuro-Oncology Advances 1 1(1), 1–14, 2019 | Doi:10.1093/Noajnl/Vdz042 | Advance Access Date 5 November 2019
    applyparastyle "fig//caption/p[1]" parastyle "FigCapt" applyparastyle "fig" parastyle "Figure" Neuro-Oncology Advances 1 1(1), 1–14, 2019 | doi:10.1093/noajnl/vdz042 | Advance Access date 5 November 2019 PELP1 promotes glioblastoma progression by enhancing Wnt/β-catenin signaling Gangadhara R. Sareddy, Uday P. Pratap, Suryavathi Viswanadhapalli, Prabhakar Pitta Venkata, Binoj C. Nair, Samaya Rajeshwari Krishnan, Siyuan Zheng, Andrea R. Gilbert, Andrew J. Brenner, Darrell W. Brann, and Ratna K. Vadlamudi Department of Obstetrics and Gynecology, University of Texas Health San Antonio, San Antonio, Texas (G.R.S., U.P.P., S.V., P.P.V., B.C.N., S.R.K., R.K.V.); Greehey Children’s Cancer Research Institute, University of Texas Health San Antonio, San Antonio, Texas (S.Z.); Department of Pathology and Laboratory Medicine, University of Texas Health San Antonio, San Antonio, Texas (A.R.G.); Hematology & Oncology, University of Texas Health San Antonio, San Antonio, Texas (A.J.B.); Mays Cancer Center, University of Texas Health San Antonio, San Antonio, Texas (G.R.S., S.Z., A.J.B., R.K.V.); Department of Neuroscience and Regenerative Medicine, Medical College of Georgia, Augusta University, Augusta, Georgia (D.W.B.) Correspondence Author: Ratna K. Vadlamudi, Department of Obstetrics and Gynecology, 7703 Floyd Curl Drive, University of Texas Health San Antonio, San Antonio, TX 78229 ([email protected]). Abstract Background: Glioblastoma (GBM) is a deadly neoplasm of the central nervous system. The molecular mechanisms and players that contribute to GBM development is incompletely understood. Methods: The expression of PELP1 in different grades of glioma and normal brain tissues was analyzed using immunohistochemistry on a tumor tissue array.
    [Show full text]
  • ¬LACZ-REPORTER MAPPING of Dlx5/6 EXPRESSION AND
    Received: 26 December 2019 Revised: 10 May 2020 Accepted: 11 May 2020 DOI: 10.1002/cne.24952 RESEARCH ARTICLE LacZ-reporter mapping of Dlx5/6 expression and genoarchitectural analysis of the postnatal mouse prethalamus Luis Puelles1 | Carmen Diaz2 | Thorsten Stühmer3 | José L. Ferran1 | Margaret Martínez-de la Torre1 | John L. R. Rubenstein3 1Department of Human Anatomy and Psychobiology and IMIB-Arrixaca Institute, Abstract University of Murcia, Murcia, Spain We present here a thorough and complete analysis of mouse P0-P140 prethalamic 2 Department of Medical Sciences, School of histogenetic subdivisions and corresponding nuclear derivatives, in the context of Medicine and Institute for Research in Neurological Disabilities, University of Castilla- local tract landmarks. The study used as fundamental material brains from a transgenic La Mancha, Albacete, Spain mouse line that expresses LacZ under the control of an intragenic enhancer of Dlx5 3Nina Ireland Laboratory of Developmental Neurobiology, Department of Psychiatry, and Dlx6 (Dlx5/6-LacZ). Subtle shadings of LacZ signal, jointly with pan-DLX immu- UCSF Medical School, San Francisco, noreaction, and several other ancillary protein or RNA markers, including Calb2 and California Nkx2.2 ISH (for the prethalamic eminence, and derivatives of the rostral zona limitans Correspondence shell domain, respectively) were mapped across the prethalamus. The resulting model Luis Puelles, Department of Human Anatomy and Psychobiology, School of Medicine, of the prethalamic region postulates tetrapartite rostrocaudal and dorsoventral subdi- University of Murcia, Murcia 30071, Spain. visions, as well as a tripartite radial stratification, each cell population showing a char- Email: [email protected] acteristic molecular profile. Some novel nuclei are proposed, and some instances of Carmen Díaz, Department of Medical potential tangential cell migration were noted.
    [Show full text]
  • 4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
    Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4).
    [Show full text]
  • Gene Expression Signature–Based Prognostic Risk Score in Patients with Primary Central Nervous System Lymphoma
    Published OnlineFirst August 20, 2012; DOI: 10.1158/1078-0432.CCR-12-0596 Clinical Cancer Imaging, Diagnosis, Prognosis Research Gene Expression Signature–Based Prognostic Risk Score in Patients with Primary Central Nervous System Lymphoma Atsushi Kawaguchi1, Yasuo Iwadate2, Yoshihiro Komohara3, Masakazu Sano4, Koji Kajiwara5, Naoki Yajima4, Naoto Tsuchiya4, Jumpei Homma4, Hiroshi Aoki4, Tsutomu Kobayashi4, Yuko Sakai7, Hiroaki Hondoh6, Yukihiko Fujii4, Tatsuyuki Kakuma1, and Ryuya Yamanaka7 Abstract Purpose: Better understanding of the underlying biology of primary central nervous system lymphomas (PCNSL) is critical for the development of early detection strategies, molecular markers, and new therapeutics. This study aimed to define genes associated with survival of patients with PCNSL. Experimental Design: Expression profiling was conducted on 32 PCNSLs. A gene classifier was developed using the random survival forests model. On the basis of this, prognosis prediction score (PPS) using immunohistochemical analysis is also developed and validated in another data set with 43 PCNSLs. Results: We identified 23 genes in which expressions were strongly and consistently related to patient survival. A PPS was developed for overall survival (OS) using a univariate Cox model. Survival analyses using the selected 23-gene classifiers revealed a prognostic value for high-dose methotrexate (HD-MTX) and HD- MTX–containing polychemotherapy regimen–treated patients. Patients predicted to have good outcomes by the PPS showed significantly longer survival than those with poor predicted outcomes (P < 0.0001). PPS using immunohistochemical analysis is also significant in test (P ¼ 0.0004) and validation data set (P ¼ 0.0281). The gene-based predictor was an independent prognostic factor in a multivariate model that included clinical risk stratification (P < 0.0001).
    [Show full text]
  • Prognosis Value of RBBP8 Expression in Plasma Cell Myeloma
    Cancer Gene Therapy https://doi.org/10.1038/s41417-018-0069-3 ARTICLE Prognosis value of RBBP8 expression in plasma cell myeloma 1 2 3 4 5 1 1 1 Weilong Zhang ● Ying Song ● Xue He ● Xiaoni Liu ● Ye Zhang ● Zuozhen Yang ● Ping Yang ● Jing Wang ● 1 4 3 4 1 Kai Hu ● Weiyou Liu ● Xiuru Zhang ● Xiaoliang Yuan ● Hongmei Jing Received: 30 July 2018 / Revised: 30 October 2018 / Accepted: 2 November 2018 © The Author(s) 2019. This article is published with open access Abstract Plasma cell myeloma (PCM) secretes monoclonal immunoglobulin (Ig) by clonal plasma cells of abnormal proliferation in the bone marrow. As PCM is incurable, it is necessary to find new biomarkers to predict the prognosis and recurrence of PCM. The relationship between cancer and RBBP8 has not been fully studied. The role of RBBP8 in tumorigenesis remains inconsistent. We described the expression of RBBP8 in the gene expression profile of 1930 PCM samples (1878 PCM patients) from seven independent data sets. We analyzed the relationship between RBBP8 and survival prognosis, recurrence, and treatment response in patients with PCM, and the biological significance of RBBP8 in PCM. The gene expression level of RBBP8 was significantly related to the International staging system (ISS) grade of PCM (P = 0.0012). RBBP8 expression in different molecular subtypes was different (P < 2.2e-16). High RBBP8 expression is associated with 1234567890();,: 1234567890();,: poor survival in PCM (P < 0.0001). High expression of RBBP8 indicates that PCM patients are more likely to relapse (P = 0.0078). The biological significance of RBBP8 in PCM is related to the cell cycle (P < 0.05).
    [Show full text]
  • Proline-, Glutamic Acid-, and Leucine-Rich Protein 1 Mediates
    Proline-, glutamic acid-, and leucine-rich protein 1 PNAS PLUS mediates estrogen rapid signaling and neuroprotection in the brain Gangadhara R. Sareddya,1, Quanguang Zhangb,1, Ruimin Wangb,c, Erin Scottb, Yi Zoud, Jason C. O’Connore,f, Yidong Chend, Yan Dongb, Ratna K. Vadlamudia,2, and Darrell Brannb,g,2 aDepartment of Obstetrics and Gynecology, University of Texas Health Science Center, San Antonio, TX 78229; bDepartment of Neuroscience and Regenerative Medicine, Medical College of Georgia, Georgia Regents University, Augusta, GA 30912; cNeurobiology Institute of Medical Research Center, North China University of Science and Technology, Tangshan, People’s Republic of China 063000; dDepartment of Epidemiology & Biostatistics, University of Texas Health Science Center, San Antonio, TX 78229; eDepartment of Pharmacology, University of Texas Health Science Center, San Antonio, TX 78229; fSouth Texas Veterans Health System, Audie L. Murphy VA Hospital, San Antonio, TX 78229; and gCharlie Norwood Veterans Affairs Medical Center, Augusta, GA 30904 Edited by Bruce S. McEwen, The Rockefeller University, New York, NY, and approved October 1, 2015 (received for review August 21, 2015) 17-β estradiol (E2) has been implicated as neuroprotective in a vari- E2 signaling is thought to be primarily mediated by the classical ety of neurodegenerative disorders. However, the underlying mech- estrogen receptors, estrogen receptor alpha (ERα) and estrogen anism remains unknown. Here, we provide genetic evidence, using receptor beta (ERβ). Both subtypes are expressed in the brain forebrain-specific knockout (FBKO) mice, that proline-, glutamic and have been shown to mediate various neural actions of E2, acid-, and leucine-rich protein 1(PELP1),anestrogenreceptor including neuroprotection (4, 12–14).
    [Show full text]
  • HCC and Cancer Mutated Genes Summarized in the Literature Gene Symbol Gene Name References*
    HCC and cancer mutated genes summarized in the literature Gene symbol Gene name References* A2M Alpha-2-macroglobulin (4) ABL1 c-abl oncogene 1, receptor tyrosine kinase (4,5,22) ACBD7 Acyl-Coenzyme A binding domain containing 7 (23) ACTL6A Actin-like 6A (4,5) ACTL6B Actin-like 6B (4) ACVR1B Activin A receptor, type IB (21,22) ACVR2A Activin A receptor, type IIA (4,21) ADAM10 ADAM metallopeptidase domain 10 (5) ADAMTS9 ADAM metallopeptidase with thrombospondin type 1 motif, 9 (4) ADCY2 Adenylate cyclase 2 (brain) (26) AJUBA Ajuba LIM protein (21) AKAP9 A kinase (PRKA) anchor protein (yotiao) 9 (4) Akt AKT serine/threonine kinase (28) AKT1 v-akt murine thymoma viral oncogene homolog 1 (5,21,22) AKT2 v-akt murine thymoma viral oncogene homolog 2 (4) ALB Albumin (4) ALK Anaplastic lymphoma receptor tyrosine kinase (22) AMPH Amphiphysin (24) ANK3 Ankyrin 3, node of Ranvier (ankyrin G) (4) ANKRD12 Ankyrin repeat domain 12 (4) ANO1 Anoctamin 1, calcium activated chloride channel (4) APC Adenomatous polyposis coli (4,5,21,22,25,28) APOB Apolipoprotein B [including Ag(x) antigen] (4) AR Androgen receptor (5,21-23) ARAP1 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1 (4) ARHGAP35 Rho GTPase activating protein 35 (21) ARID1A AT rich interactive domain 1A (SWI-like) (4,5,21,22,24,25,27,28) ARID1B AT rich interactive domain 1B (SWI1-like) (4,5,22) ARID2 AT rich interactive domain 2 (ARID, RFX-like) (4,5,22,24,25,27,28) ARID4A AT rich interactive domain 4A (RBP1-like) (28) ARID5B AT rich interactive domain 5B (MRF1-like) (21) ASPM Asp (abnormal
    [Show full text]
  • LSD1/KDM1A, a Gate-Keeper of Cancer Stemness and a Promising Therapeutic Target
    Review LSD1/KDM1A, a Gate-Keeper of Cancer Stemness and a Promising Therapeutic Target Panagiotis Karakaidos 1,2,*, John Verigos 1,3 and Angeliki Magklara 1,3,* 1 Institute of Molecular Biology and Biotechnology-Foundation for Research and Technology, Ioannina 45110, Greece 2 Biomedical Research Foundation Academy of Athens, Athens 11527, Greece 3 Department of Clinical Chemistry, Faculty of Medicine, University of Ioannina, Ioannina 45110, Greece * Correspondence: [email protected] (P.K.); [email protected] (A.M.) Received: 25 October 2019; Accepted: 18 November 2019; Published: 20 November 2019 Abstract: A new exciting area in cancer research is the study of cancer stem cells (CSCs) and the translational implications for putative epigenetic therapies targeted against them. Accumulating evidence of the effects of epigenetic modulating agents has revealed their dramatic consequences on cellular reprogramming and, particularly, reversing cancer stemness characteristics, such as self- renewal and chemoresistance. Lysine specific demethylase 1 (LSD1/KDM1A) plays a well- established role in the normal hematopoietic and neuronal stem cells. Overexpression of LSD1 has been documented in a variety of cancers, where the enzyme is, usually, associated with the more aggressive types of the disease. Interestingly, recent studies have implicated LSD1 in the regulation of the pool of CSCs in different leukemias and solid tumors. However, the precise mechanisms that LSD1 uses to mediate its effects on cancer stemness are largely unknown. Herein, we review the literature on LSD1’s role in normal and cancer stem cells, highlighting the analogies of its mode of action in the two biological settings. Given its potential as a pharmacological target, we, also, discuss current advances in the design of novel therapeutic regimes in cancer that incorporate LSD1 inhibitors, as well as their future perspectives.
    [Show full text]
  • Exclusion of Dlx5/6 Expression from the Distal-Most Mandibular Arches Enables BMP-Mediated Specification of the Distal Cap
    Exclusion of Dlx5/6 expression from the distal-most mandibular arches enables BMP-mediated specification of the distal cap Joshua W. Vincentza, Jose J. Casasnovasa, Ralston M. Barnesb, Jianwen Quec, David E. Clouthierd, Jun Wange, and Anthony B. Firullia,1 aRiley Heart Research Center, Herman B. Wells Center for Pediatric Research Division of Pediatric Cardiology, Departments of Anatomy, Biochemistry, and Medical and Molecular Genetics, Indiana University Medical School, Indianapolis, IN 46202; bBiologics Discovery California, Bristol-Myers Squibb, Redwood City, CA 94063; cDepartment of Medicine, Columbia University Medical Center, New York, NY 10032; dDepartment of Craniofacial Biology, University of Colorado Anschutz Medical Campus, Aurora, CO 80108; and eDepartment of Molecular Physiology and Biophysics, Texas Heart Institute, Baylor College of Medicine, Houston, TX 77030 Edited by Clifford J. Tabin, Harvard Medical School, Boston, MA, and approved May 26, 2016 (received for review March 8, 2016) Cranial neural crest cells (crNCCs) migrate from the neural tube to Smads, H2, and GATA2/3 provide positive transcriptional inputs the pharyngeal arches (PAs) of the developing embryo and, sub- that serve to counteract the activity of Dlx proteins, thereby re- sequently, differentiate into bone and connective tissue to form the lieving EDN1-meditated repression. Together, these findings in- mandible. Within the PAs, crNCCs respond to local signaling cues to tegrate the communication between BMP and EDN1 signaling partition into the proximo-distally oriented subdomains that convey that establishes the distal cap of the mandible. positional information to these developing tissues. Here, we show that the distal-most of these subdomains, the distal cap, is marked Results by expression of the transcription factor Hand1 (H1) and gives rise to The H1Cre Lineage Gives Rise to the Lower Incisors, in a HAND Factor- the ectomesenchymal derivatives of the lower incisors.
    [Show full text]
  • Table S1 Primers Used for Genomic DNA Sequencing of K-Ras and TP53
    Table S1 Primers used for genomic DNA sequencing of K-Ras and TP53 Gene, exon Forward primer Reverse primer k-Ras, exon 1 GTTCTAATATAGTCACATTT ACTCATGAAAATGGTCAGAGAAACCTTTAT k-Ras, exon 2 GAAGTAAAAGGTGCACTGTA AACTATAATTACTCCTTAAT TP53, exon 4 AGGACCTGGTCCTCTGAC CTGGGAAGGGACAGAAGA TP53, exon 5 TGACTTTCAACTCTGTCTCCT TCAGTGAGGAATCAGAGGCC TP53, exon 6 CTGGAGAGACGACAGAGGCC CCAGAGACCCCAGTTGCAAAC TP53, exon 7 AAGGCGCACTGGCCTCATCTT CGCCGGAAATGTGATGAGAG TP53, exon 8 TGGTTGGGAGTAGATGGAGCC CACCGCTTCTTGTCCTGCTT TP53, exon 9 GTGGAGGAGACCAAGGGTGCA AGGTAAAACAGTCAAGAAGAA Table S2. Genes in cytogenetic band with recurrent copy number alterations Gains Cytoband Gene Protein name Cytoband Gene Protein name 1 q42.2 KIAA1383 KIAA1383 18 q11.1-11.2 KIAA1772 KIAA1772 establishment of cohesion 1 homolog 1 (S. 1 q42.2 C1orf57 chromosome 1 open reading frame 57 18 q11.1-11.2 ESCO1 cerevisiae) 1 q42.2 PCNXL2 pecanex-like 2 (Drosophila) 18 q11.1-11.2 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 1 q42.2 KIAA1804 mixed lineage kinase 4 18 q11.1-11.2 ABHD3 abhydrolase domain containing 3 11 q13.1 SLC25A45 solute carrier family 25, member 45 18 q11.1-11.2 MIB1 mindbomb homolog 1 (Drosophila) 11 q13.1 FRMD8 FERM domain containing 8 18 q11.1-11.2 GATA6 GATA binding protein 6 11 q13.1 NCRNA00084 non-protein coding RNA 84 18 q11.1-11.2 CTAGE1 cutaneous T-cell lymphoma-associated antigen 1 metastasis associated lung adenocarcinoma 11 q13.1 MALAT1 18 q11.1-11.2 RBBP8 retinoblastoma binding protein 8 transcript 1 (non-protein coding) 20 q13.13 CEBPB CCAAT/enhancer
    [Show full text]