Integrating multiple criteria for the characterization of Psammotettix populations in European cereal fields. Isabelle Abt, M Derlink, Romain Mabon, M Virant-Doberlet, Emmanuel Jacquot

To cite this version:

Isabelle Abt, M Derlink, Romain Mabon, M Virant-Doberlet, Emmanuel Jacquot. Integrating multiple criteria for the characterization of Psammotettix populations in European cereal fields.. Bulletin of Entomological Research, Cambridge University Press (CUP), 2017, 108 (2), pp.1-18. ￿10.1017/S0007485317000669￿. ￿hal-01606620￿

HAL Id: hal-01606620 https://hal.archives-ouvertes.fr/hal-01606620 Submitted on 26 May 2020

HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. https://www.cambridge.org/core/terms Downloaded from Version postprint † 36 48 E-mail: 62 99 4 00(33) Phone: correspondence for *Author © Research Entomological of Bulletin hs w uhr otiueeulyt h work. the to equally contribute authors two These abig nvriyPes2017 Press University Cambridge Bulletin ofEntomological Research, 108 (2),185-202. , DOI:10.1017/S0007485317000669 Abt, I.,Derlink, M.,Mabon, R.,Virant-Doberlet, M., Jacquot, E.(2018). Integrating multiple https://www.cambridge.org/core [email protected] criteria for thecharacterization ofPsammotettix populations inEuropean cerealfields. volus in species syntopic third the Slovenia, with together se- occurred COI sometimes to compared France, and in individuals fields some for the cytochrome obtained mitochondrial of was the quences of gene sequence (COI) mor- nt indivi- I and 442 collected oxydase behaviour a mating the addition, in of In used analyses. characterization signals phometric the vibrational of step, recordings first agroecological included the at duals determined In grassland been has criteria. from females and multiple comparison, males using a of identity as Species Slovenia. and, West in France interface in fields barley and n/raitcprmtr otlkl nlec h iehsoyof history life biotic local the The influence study. likely previous a most in parameters measured abiotic those to and/or similar very were study this in genus studied the WDV/ We from the understood. leafhoppers to poorly linked by still parameters plant The to Cicadellidae). plant from yohoeoyaeI irtoa signals vibrational wheat I, oxydase of Cytochrome epidemiology the Keywords: into insight an providing of for structure disease. dwarf population re- crucial on together, is information Taken detailed virus-free. leafhoppers more were that Slovenia was show in fields sults cereal collected in leafhoppers collected while individuals viruliferous 14.9%, of proportion the and hoppers, Acpe 9Jn 2017) June 19 (Accepted eilgclaeti the is agent aetiological apsitrainld alage,F338Mnplir France: Montpellier, F-34398 Baillarguet, de international Campus ainlIsiueo ilg NB,Ve (NIB), Biology of Institute National ..ByrCoSine 6reJa ai Leclair Marie Jean rue 16 CropScience, A.S./Bayer .Abt I. ee 9 France: 09, Cedex h ha wr ies saogtems aaigdsae ncras Its cereals. in diseases damaging most the among is disease dwarf wheat The 1 NACrdSpgoMnplir M 8 GI ia AA-54K, TA Cirad BGPI, 385 UMR Montpellier, INRA-Cirad-SupAgro . h eprlprmtr fthe of parameters temporal The . ouain nErpa eelfields cereal European in populations https://doi.org/10.1017/S0007485317000669 nertn utpeciei o the for criteria multiple Integrating 1,2 hrceiainof characterization † . smoetxalienus Psammotettix CIRAD DIC/DSI-INFODOC .Derlink M. , ae1o 8doi:10.1017/S0007485317000669 18 of 1 Page , Psammotettix smoetxalienus Psammotettix Comment citer cedocument: 3 eateto raim n cssesResearch, Ecosystems and Organisms of Department ha wr virus dwarf Wheat efopr vial npbi aaae.I h cereal the In databases. public in available leafhoppers n .Jacquot E. and , on 3

† , 31 Jul2017 at10:14:41 .Mabon R. , ha wr virus dwarf Wheat smoetxconfinis Psammotettix .alienus P. Abstract Psammotettix a h otnmru pce;hwvr it however, species; numerous most the was Psammotettix WV,wihi xlsvl transmitted exclusively is which (WDV), č aPt11 00Lulaa Slovenia Ljubljana, 1000 111, Pot na od a eifce ydfeetptoeso hc the which of pathogens different animal by and infected human both be for can crops important food, most the of one Beanland, viruses of vectors (Hogenhaut important most the among are Cicadellidae, aecligsn htwr measured were that song calling male Psammotettix efopr,hmpea net rmtefamily the from insects hemipteran Leafhoppers, , subjectto theCambridgeCore termsofuse,available at 1,2 omnt was community 1 opoercmeasurements, morphometric , * niiul olce nwheat in collected individuals .Virant-Doberlet M. , Psammotettix 2008 hl ntegasad in grasslands the in while , tal. et – Psammotettix htcuepatdsae.Cras worldwide Cereals, diseases. plant cause that ) S916 96 Lyon 69266 90106, CS , 2008 Introduction Psammotettix n htpams(enru & (Weintraub phytoplasmas and ) ahsse are pathosystem smoetxhel- Psammotettix Psammotettix (Hemiptera, 2 ae S. Bayer leaf- 3 https://www.cambridge.org/core/terms Downloaded from Version postprint dniiainof identification nti eu scalnigee o rie xet.Indeed, experts. trained for of even challenging assignment is genus this in (Vilbaste, (Tishechkin, characters, of morphological aedeagus delimitation of variability high to due wr ies WD,dsrbdfrtefrttm nte16sin 1960s the awheat( in time first the for described (WDD), disease dwarf (Vacke, cereals cultivated in symptoms lowing Report, genus the into ing virus dwarf Wheat 2 sdaantti ies sbsdo h s fchemicals of use the observation on an consequently, of based and is vectors, leafhopper disease against strategy this protection against main the used currently the molecules, to antiviral absence the Due of and described. WDD against properly sources resistance not genetic of often lack are studies WDV in in Jacquot, (reviewed literature & Abt the in documented poorly still is system different struc- the of about ture understanding insufficient the current following our fields, that likely of is observation it general However, sprays. insecticide to opooy(idran&Niedringhaus, & (Biedermann possible. morphology not currently is Psammotettix characters morphological on based endsrbdi igerpr ob bet rnmtWDV transmit to able be vector to report WDV single (Ekzayez a main in the described been be to reported (Zhang been has (Dahlbom) WDV. transmit numerous efficiently the to capability of the Vasarainen, out two & only (Raatikainen that Areno, grassland & in Lindblad and fields genus Deltocephalinae) the from leafhop- by plant pers to plant from transmitted barley. exclusively and is wheat WDV in issues sanitary (Vacke, important most Republic the among Socialist Czechoslovak former the eso h genus the mem- distinguish of to used easily bers entomologists be agricultural can characteristics and logical medical for as at (Bortolus, well is but as systematists, etholo- organisms for pathologists, gists biologists, only of population not ecologists, diversity interest for of also the centre the of organ- in studied present Description the on itself. knowledge current ism the identifi- (iv) the accurate and (iii) and cation; identified, collection be the to between samples delay acceptable man- of pest number ecology, the (biodiversity, study (ii) the agement); of fac- aims several the on (i) : depends tors approach(es) choice appropriate The most basic the typing. from of molecular organisms, to of observations characteristics morphological specific the and eral crops. cereal cultivated in- in of WDD use against adapting the treatments minimize secticide in to order advantageous in strategies be management pest would knowledge Such cultivated in areas. present actually are vectors WDV whether certain determine accurately are to technicians able field that important is it chemicals, of use cessive ex- prevent To treatments. insecticide unwarranted to lead often Psammotettix hr r ifrn lentv ehd odsrb h gen- the describe to methods alternative different are There Bulletin ofEntomological Research, 108 (2),185-202. , DOI:10.1017/S0007485317000669 Abt, I.,Derlink, M.,Mabon, R.,Virant-Doberlet, M., Jacquot, E.(2018). Integrating multiple https://www.cambridge.org/core Psammotettix 2012 criteria for thecharacterization ofPsammotettix populations inEuropean cerealfields. tal et rtcmaestivum Triticum tal., et Psammotettix 1982 2008 ., )i h aslaeto wrig otigadyel- and mottling dwarfing, of agent causal the is )) pce r dniidpiaiyo aegenital male on primarily identified are species 1999 2010 2015 2011 el Giustina, Della ; Psammotettix Schlick-Steiner ; niiul nacra il omnyleads commonly field cereal a in individuals Psammotettix – WV eldsrbdvrlseisbelong- species viral well-described a (WDV, Mastrevirus .T mrv h cuayo species of accuracy the improve To ). )and Psammotettix n,i atclr efoprseisused species leafhopper particular, in and, ) oatciscscmol on ncereal in found commonly insects holartic .Hwvr h WDV/ the However, ). 2002 omnte n bu h fiinyof efficiency the about and communities Psammotettix Psammotettix . Psammotettix pce nWVtasiso,may transmission, WDV in species https://doi.org/10.1017/S0007485317000669 smoetxprovincialis Psammotettix .S a,i a endemonstrated been has it far, So ). . il oae ntewsenpr of part western the in located field L.) Psammotettix ypsadfmlst species to females and nymphs ftefamily the of pce sotnntreliable not often is species . tal., et CIRAD DIC/DSI-INFODOC 1989 niiul,morphometric individuals, Hmpea Cicadellidae, (Hemiptera, Psammotettix rmohrleafhoppers other from efopr ntecereal the in leafhoppers ,seisidentification species ), Comment citer cedocument: 2010 pce nodrt as- to order in species smoetxalienus Psammotettix Psammotettix Geminiviridae .Wiemorpho- While ). 1972 2009 pce have species Rbu)has (Ribaut) .Tewheat The ). ;however, ); , on 1961

patho- 31 Jul2017 at10:14:41 (ICTV 1973 ,is ), .Abt I. ; tal. et iie ubro niiul n pce ape in sampled species (Kamitani, Korea and al. et and individuals Japan of Canada, number to applied limited far so been 2016 oso 68h 4ad2° o a n ih,respectively) night, and (F day leafhoppers for field-collected 20°C and the 24 where h; 16/8 of per- bag iods day/night RH; cellophane (40% chamber temperature-controlled microperforated the a one and by wheat ( covered (one trans- plantlets and individually cereal was barley) stage insect two-leaf of each on collection field, ferred the the after differ- in Immediately at min fields. leafhoppers 1 the for in use its locations after ent net sweep the in observed ectly 11 fields, n ofitn eut,epcal o hs ikdt h role the to linked information those the for contradictory of especially of to results, taxonomy conflicting lead and complex could the This de- to questionable. poorly due are and, pathosystem) Psammotettix authors dwarf by wheat scribed on (e.g. studies Consequently, rv h ult ftxnmcdt,adsc prahis approach delimiting for such method (Schlick-Steiner and reliable species most data, the taxonomic considered of im- generally should quality individuals the unassigned prove to descrip- applied the into processes data) tion ecological and behavioural morphological, several (biological, molecular, Integrating information taxonomic sequences). of COI sources (i.e. and analyses aedeagus) molecular and (body measurements morphometric data, etduigasepnti rnhcra ilsi ueand in 2 June locations fields, in different (15 fields at South cereal done the French was Sampling in 2013. net September sweep a using lected anando hi otpat ni hydied. they until plants host their on maintained iehsoyadvrlfru ttso il-olce indivi- field-collected the of assign status reliably To viruliferous duals. and history life (Alexander interface agroecological of structure tal. Yeates sensu et approach (iterative criteria multiple used we cies, (Tishechkin, in publications only few described were communication sexual during hoppers by emitted signals vibrational databases, lic (Bluemel (COI) I oxydase 2014 cytochrome poly- the the of or as communication morphism such sexual approaches, in used other signals with vibrational combined be can parameters a/ih eid f1/ )adue nteexperiments. the in used and two-leaf and h) RH 16/8 the 40% of night, At periods the during day/night cham- h. day/20°C growth 16/8 the the during in (24°C of transferred insects. ber were period plants at and young vermiculite. light/dark the chamber stage, viruses containing a temperature-controlled a with tubes both in 24°C plastic for grown in were plants Plants sown host were as Seeds used were Henry, i.1 fig. ntepeetsuy epoieteifraino the on information the provide we study, present the In dl efopr rmtegenus the from leafhoppers Adult wheat spring the experiments, all In , subjectto theCambridgeCore termsofuse,available at , has barcode DNA of analysis phylogenetic Moreover, ). .Acrigt u nweg n aaaalbei pub- in available data and knowledge our to According ). , 2015 .Sc niiulraigsseswr rnfre to transferred were systems rearing individual Such ). Psammotettix 2011 2002 – 0iscsfed fFac ( France of insects/field) 50 n i o nld single a include not did and ) ,icuigeooy irtoa communication vibrational ecology, including ), n h barley the and ) Psammotettix pce n hi sinett pce soften is species to assignment their and species Psammotettix aeil n methods and Materials pce nteeieilg fWDD. of epidemiology the in species lnsadinsects and Plants – 9iscsfed n nteNrh(19 North the in and insects/field) 49 tal., et Psammotettix ouain ntecra ilsand fields cereal the in populations Psammotettix v Express cv. 2010 niiul sdi published in used individuals 1999 ). , tal. et 2000 al 1 table nytieadwt a with and twice only Psammotettix v Sunstar cv. , (Sadeghi , 2011 0 .alienus P. 2014 2014 efopr ospe- to leafhoppers .Iscswr dir- were Insects ). niiul)were individuals) Psammotettix Gwiazdowski ; ,a ela on as well as ), Derlink ; tal. et Psds& (Posadas specimen. eecol- were , 2000 tal. et tal et leaf- ., ) ,

https://doi.org/10.1017/S0007485317000669 .

Version postprint https://www.cambridge.org/core/terms

, subject to the Cambridge Core terms of use, available at available use, of terms Core Cambridge the to subject , 10:14:41 at 2017 Jul 31 on , DIC/DSI-INFODOC CIRAD . https://www.cambridge.org/core from Downloaded hi olcint hi death. their to collection their 4 3 2 1 coordinates GPS location Field Region collection of Date Country 2014. and 2013 in out carried surveys field during Slovenia and France in collected Leafhoppers 1. Table rsn npoeisi eotdbtenbrackets. between reported is progenies in present rneJn 03Ad oxN4°121E23.4 . (2 3 0.5 2 / 4 0 2°38.643 43°11.291/E N Moux Aude 2013 June France lvnaAg 04RviaRvia(il 1 °832E39.7 41 .100/0 / 0 0 1.71 14 24 3°99.272 5°08.322/E N #1) (field Ravnica Ravnica 2014 Aug. Slovenia T o tested. not NT, h ubr(b n h rprin()o eae bet a g()t rdc rgn ne niiulraigcniin sdt ananleafhop maintain to used conditions rearing individual under progeny field. a produce the individuals) egg(s)/to viruliferous in lay to of collected able females (proportion females of leafhoppers of (P) males/number individual proportion o the of from range and extracted number the (Nb) acids number to obtained, The was nucleic corresponds progeny ratio total single sex using a presented out than more The carried When assay) location. (PCR sampling each detection for Viral indicated is females gravid by produced progenies of size mean The Bulletin of Entomological Research, 108 (2), 185-202. ,DOI : 10.1017/S0007485317000669 Abt, I.,Derlink, M., Mabon, R.,Virant-Doberlet, M., Jacquot, E. (2018). Integrating multiple criteria forthe characterization of Psammotettix populations in European cereal fields. et 03HueVlir escN4°468E45.8 .7101 0 4 0.14 1 0.57 7 4 4°54.484 48°04.618/E N sec le Villiers Haute 2013 Sept. at-ArgeN4°425E12.7 243102 NT 3 0.25 (2 11.66 (1 3.75 1 0.85 0.38 17 10 3 0.55 0.88 4 20 26 12 11 23 1°29.875 43°24.275/E N 3°51.400 43°40.182/E N 1°40.780 43°26.667/E N L. le Montferrier Villenouvelle Auragne Herault Garonne Haute- an ilese iuN4°905E45.8 93 .12 .495 (2 9.52 0.74 23 0.61 31 19 4°54.484 48°39.095/E N lieu en Villiers Marne ueFnansN4°303E44.0 02 .11 .885 (2 8.52 0.68 19 0.71 28 20 4°42.804 48°13.053/E N Fontaines Aube on vyN4°618E31.6 93 .12 .451 (1 5.15 0.64 20 0.61 31 19 3°15.063 48°16.138/E N Evry Yonne nr acael tL 70.2/ °7652 006 . .3(2 4.33 0.1 3 (1 5.68 (1 6.4 0.53 0.18 0.66 16 5 30 0.66 0.63 20 30 27 1°47.655 47°03.922/E N 20 17 L. St chapelle La 2°39.352 47°27.541/E N 2°53.832 47°35.040/E N sauldre Indre sur Vailly P. en Dammarie Cher Loiret Comment citercedocument : iusvvsN4°353E23.2 . . . (5 7.5 0.8 4 0.2 5 1 2°38.123 43°13.563/E N vives Aigues ilsvr 31.3/ °31303/206 NT (2 5.5 0.28 1 2 0.66 (1 16 (1 15 2 0.85 0.85 0.9 6 18 / 7 0.42 1.2 3 6 7 20 0 1°41.258 43°20.656/E N 3 24 2°03.103 43°13.834/E N 2°18.889 43°12.056/E N 2°32.132 43°12.155/E N Lagarde l sur Payra Villasavary Carcassonne Marseillette e aelsN4°230E34.9 .3000NT (1 5 0 0.55 (1 4.57 0 15 1 0 0.44 9 0.33 27 0.33 3 12 9 1 3°53.406 43°42.870/E N 3 3°48.497 43°42.390/E N 3°48.497 43°42.390/E N Assas Matelles Les Fesc du Gély St afansN4°810E35.4 1715 .74(1 4 (1 14 0.57 0.5 4 5 1.57 0.4 7 10 11 4 3°52.444 43°48.140/E N 3°52.223 43°46.889/E N Valflaunes T. de Mathieu St re 80.8/ °6111 106 805 .2(1 8.22 0.58 (1 3.33 18 0.21 (1 6.07 6 0.61 0.46 14 0.72 31 0.66 29 19 30 21 4°56.191 48°04.488/E N 20 5°07.121 48°13.839/E N 4°58.439 48°23.510/E N Orges Vraincourt Blaise sur Vaux tMri eB 82.3/ °02841 .6504 . (2 5.8 (1 6.75 0.45 0.57 5 16 0.36 0.75 11 28 4 21 3°40.288 48°25.932/E N 4°05.960 48°12.140/E N B. de Marlin St Villenereuill ue noh 81.0/ °2531 205 705 .9(1 5.29 0.53 17 0.56 32 18 3°52.533 48°15.306/E N othe en Bucey anc fed#)N50.0/ °0531 407 .69(5 9 0.16 4 (1 6.13 (1 6.76 0.52 (1 0.71 6.27 0.59 15 0.35 17 24 11 0.72 0.69 17 0.61 29 29 4°00.593 5°09.102/E 31 N 21 20 #2) (field Ravnica 19 3°42.674 47°45.948/E N 3°27.338 47°59.177/E N 3°13.591 47°55.877/E N Chitry Looze Sepeaux noxN4°778E23.5 61 .6641.9 6 0.06 (2 4.69 (3 7.07 1 0.45 0.47 13 14 1 0.72 0.66 16 29 30 16 21 20 2°32.859 46°57.748/E N 2°35.260 47°07.541/E N 2°17.269 46°58.336/E N Annoix Caprais St Brecy

’ esN4°562E15.7 NT 0 1 1 1 1 1 1°52.774 43°15.672/E N hers oa 9 0 .03404 .9(2 7.29 0.48 334 0.70 700 492 : Total aeFml Ratio Female Male olce insects Collected 3 bP Nb Gravid . 4 esaiei h aoaoyfrom laboratory the in alive pers h ubro individuals of number the f Progenies – – – – )NT 4) – – 4 NT 24) – )NT 6) 4 0 14) – – – – 4 NT NT 34) 65) 3 NT 33) 0 NT 10) – )NT 9) – – – – – – – – 0 0 10) – – – – – – 7 0 17) – – – 5 NT 15) – 2 NT 12) 2 0 22) 9 0 2 2 19) 8) 15) 8 0 18) 0 8.2 20) 6 20 16) 5 4 15) 8 16.3 14.3 10.4 18) 16) 11) 0 14.3 10) 10 19) 5 34 26.5 15) 11) 50) 6 NT 26) 1 WDV

2

hrceiainof Characterization populations Psammotettix 3 https://www.cambridge.org/core/terms Downloaded from Version postprint uolblnIG a iue ncroaebfe 1 mM (15 buffer carbonate im- in (rabbit Na diluted reagent was serological IgG) sand- munoglobulin The antibody procedures. double ELISA in used wich was Germany) (DSMZ, WDV o SExcel. MS for edtoso h rvdr.Wlso irtteplates microtitre of Wells providers. the of mendations rgn rdcdb ahgai eaewsrecorded was female gravid each by ( produced progeny morphometric, of characterization the for leafhoppers field-collected the to applied process the parameters. biological of and representation serological molecular, Schematic 1. Fig. 4 ySoeingai eae eentitoue nthe XLSTAT in with statistically were analysed the introduced populations leafhopper with not the associated of characteristics Data were procedure. produced females maintenance progenies long-term gravid the Slovenian However, above. by sta- described viruliferous as and status tus) gravid (sex, 2014 characterized August and lets in Slovenia West ( in interface agroecological at oe o h rsneo gsadlra.Tesz fteF the of size The larvae. moni- and eggs daily of were presence female the a for with tored collection, systems field after rearing day 30th individual the tools to 15th ELISA) the From below). assay, (see immunosorbent (enzyme-linked sero- ap- or using logical PCR) determined reaction, chain was (polymerase WDV molecular transmit propriate to ability their leafhoppers and field-collected Niedringhaus, the of WDV) & for (viruliferous (Biedermann status abdomen the 2009 of part the at apical differences morphological to according determined was niiulraigsseswsdtrie sn ELISA using determined Adams, was & systems (Clark rearing individual evdi 6 tao n trdat stored and ethanol analysis. 96% the in of served insect last the of ( until died maintenance lineage month (long-term each systems repeated insects was rearing of lineages) new transfer to Such lineages. old main- as from to rearing stock system) leafhopper rearing individual the per new female tain one to of (progeny transferred systems were larvae) mainly al 1 table al 1 table 2 nei h aoaoyfclte,tesxo olce insects collected of sex the facilities, laboratory the in Once h rsneo D nwetadbre lnsue in used plants barley and wheat in WDV of presence The dl efopr (F leafhoppers Adult CO n e aiswr eemnd( determined were ratios sex and ) Bulletin ofEntomological Research, 108 (2),185-202. , DOI:10.1017/S0007485317000669 Abt, I.,Derlink, M.,Mabon, R.,Virant-Doberlet, M., Jacquot, E.(2018). Integrating multiple eeto fWVi ln ise sn ELISA using tissues plant in WDV of Detection https://www.cambridge.org/core 3 .Teeiscswr niiulytaserdt plant- to transferred individually were insects These ). .Atrte3t a,poeis(olo leafhoppers, of (pool progenies day, 30th the After ). criteria for thecharacterization ofPsammotettix populations inEuropean cerealfields. 5m NaHCO mM 35 , i.1 fig. 1977 .Da efopr eeidvdal con- individually were leafhoppers Dead ). . .Plcoa nieu asdagainst raised antiserum Polyclonal ). ® https://doi.org/10.1017/S0007485317000669 0 eeas olce rmgrassland from collected also were ) 3 otae(disf,Prs France) Paris, (Addinsoft, software H=96 codn oterecom- the to according 9.6) = pH , . CIRAD DIC/DSI-INFODOC Comment citer cedocument: al 1 table − 0Cutlfurther until 20°C .Tesanitary The ). , on

31 Jul2017 at10:14:41 .Abt I. 1 tal. et ih10µ fpntohnlpopae( gml mg (1 filled p-nitrophenyl-phosphate and of washed were wells. µl wells 100 plate in with 37°C, at added incubation h were 3 buffer), After 0.2% (conjugate with ovalbumine supplemented (w/v) buffer grinding in recommendations odgetrta h OD the than greater fold rel,acv. a Briefly, obnea 0 mwsrcre o ahwl sn a using OD the well when WDV considered each of was sample detection Scientific, tested for positive Fisher in A Thermo recorded USA). ab- Massachusetts, the FC, h, was Waltham, 2 (Multiskan to nm reader min 405 30 microplate for at dark the incuba- in sorbance After temperature 9.8). = room pH at diethanolamine, tion N, (1 buffer substrate KH hshts ojgtd,dltdacrigt manufacturer to according diluted conjugated), overnight IgG phosphatase (rabbit antibody secondary wells a coated of µl the 100 in Then, 4°C. incubated at then were sap plant the of pres- microliters Hundred the buffer). (grinding in poly- 40T vinylpyrrolidone (w/v) ground 2% with supplemented were ml) (0.5 buffer g) PBS-T of (±0.5 ence samples Leaf buffer). (PBS-T samples. lcdo lnltadrcrig atdbten1 and 15 between lasted recordings and plantlet a on placed card USA). pro Arizona, sound Phoenix, Edit ZS Software, Cool (Syntillium 2 and software USA) 2.0 Audigy California, Blaster Milpitas, a Labs, Sound in (Creative stored a were Signals using a reflectance. computer increase from to plat- the order below Germany) in stem the form on Waldbronn, placed tape vibrometer reflective GmbH, of laser piece small Polytec a 100, with registered (PDV a were with escaping. covered signals from was leafhoppers Vibrational prevent platform to paper vial plastic the transparent above plant, the plant surrounding the paper with and covered was tri- hole custom-made a The of pod. opening circular the into positioned (Derlink was earlier described set-up perimental MNC,8m Na mM (137 8 buffer PBS NaCl, with ELISA times the mM three of washed di- were step of plates µl each 100 protocol, Between with antiserum. 37°C at polyclonal h luted 3 coated were Maxisorp) (NUNC, orcr irtoa inl,asnl efoprwas leafhopper single a signals, vibrational record To orecord To 2 PO , subjectto theCambridgeCore termsofuse,available at 4 H=74 upeetdwt .5 vv we 20 Tween (v/v) 0.05% with supplemented 7.4) = pH , Sunstar Psammotettix eodn fvbainlsignals vibrational of Recording ha lnltgoigi lsi tube plastic a in growing plantlet wheat 2 HPO 405 irtoa inl,w sda ex- an used we signals, vibrational au bandfrhatycontrol healthy for obtained value 4 ,12H 2 O,2.7mMKCl,1.5mM 405 − tal., et au stwo- is value 1 iue in diluted ) – alkaline 2016 ’ ). s https://www.cambridge.org/core/terms Downloaded from Version postprint inlsgasaepoie sSplmnaymaterial. Supplementary as provided are signals tional iiul 2 ae n 1fmls rdcdb females by produced F two females) and 11 time, collection and at gravid males (25 dividuals n 2fmls olce uigfedsres 6vri F virgin 36 surveys, field during collected females) 12 and seblw.Fryfv irlte fcl alwere centrifuged then NaCl 5000 was at plate mix- M The the 5 homogenized. and gently fractions µl was cold ture 152 the of containing well each microlitres to procedures added Forty-five measurement morphometric below). in (see used was water deionized it in until h 2 for at twice stored washed then was well plate, the of first bottom the mi- the of at deep-wells left clean body, a insect The in plate. transferred crotitration were (1800 fractions µl step 152 centrifugation the short a After aoaoyuigml n eaefo F from female the and in male condition (Derlink controlled using under laboratory out carried experiments 0mn oidc inlig eae eesiuae with of stimulated signals were calling females male signalling, pre-recorded induce To min. 60 n .%SS(/) upeetdwt lo proteinase EDTA of mM µl 20 2 ml NaCl, with mg (20 supplemented mM 400 K (w/v)) 7.5, SDS TNES = of pH 0.5% at µl and Tris, dried 150 with mM and (50 filled plate was buffer microtitration trans- well sterile individually Each a temperature. ethanol, room of 70% wells ethanol, in on h 96% ferred 2 in for rehydrated stored were Insects, procedure. non-destructive eeaddt ahwl.Atr2 i at ethanol min absolute 20 cold After of well. µl each 500 to added and were plate deep-wells new a in confinis etiue (5000 centrifuged hrceitc,ie us ri uainadpletanrepeti- train (Derlink pulse time and tion duration train pulse i.e. characteristics, of characteristics sex-specific reso- and Psammotettix 16-bit species- and Phoenix, KHz describe and 48 Software, To of lution. rate (Syntrillium USA) sampling the software (Cornel York, at USA) 2.0 Arizona, 1.4 New pro Raven Ithaca, Edit Cool using Ornithology, analysed vi- of Recorded Laboratory were recording. the signals of point vibrational brational the emitted naturally at of registered level stimula- exciter signals the of to amplitude vibration adjusted The card program. was sound 2.0 tion a mentioned pro Edit above Cool of the the via and dri- head computer Denmark) the Naerum, from a Kjaer, ven & diam- into Büel in 4810, mm type (4 firmly (Minishaker rod metal screwed cm 5 a eter) of tip conical fore the with hyaline brated and morphology Niedringhaus, & body (Biedermann wings gross to according done of while below), determination (see preliminary morphology aedeagus to of according mined identity col- our Species at found sites. were lecting species these of males since recordings, are u o 6lahpes(8F (58 leafhoppers been 96 has for signals out recorded of carried analysis complete the (Derlink however, trains pulse repeated of bout al a while et form, as or song sequence defined characteristic we a with pulses (Broughton, of duration group finite of 1963 sound of parcel homogenous oa uli cd eeetatdfo efopr sn a using leafhoppers from extracted were acids nucleic Total inl fmr hn30idvdashv enrecorded; been have individuals 300 than more of Signals ., o-etutv N xrcinpoeueapidto applied procedure extraction DNA Non-destructive ,pletanwsdfnda on ossigo a of consisting sound a as defined was train pulse ), Bulletin ofEntomological Research, 108 (2),185-202. , DOI:10.1017/S0007485317000669 Abt, I.,Derlink, M.,Mabon, R.,Virant-Doberlet, M., Jacquot, E.(2018). Integrating multiple 2016 https://www.cambridge.org/core g criteria for thecharacterization ofPsammotettix populations inEuropean cerealfields. and tal et o 0mna °.Tespraat eetransferred were supernatants The 4°C. at min 10 for ). ., − smoetxhelvolus Psammotettix irtoa og,w eemndbsctemporal basic determined we songs, vibrational 1 2016 − .Tepaewsicbtdoengta 55°C. at overnight incubated was plate The ). 0Ci h rsneo 0 lo 6 ethanol 96% of µl 200 of presence the in 20°C g tal et )( )) t4C o 0mn h uentnswere supernatants The min. 10 for 4°C) at als2 tables ., . https://doi.org/10.1017/S0007485317000669 2016 leafhoppers .Plewsdfnda unitary a as defined was Pulse ). and .helvolus P. . CIRAD DIC/DSI-INFODOC .confinis P. 3 .Terpeettv vibra- representative The ). ae rmorlbayof library our from taken 2 niiul rmmating from individuals 2009 0 .alienus P. Comment citer cedocument: niiul 4 males (46 individuals g − .Patse a vi- was stem Plant ). ae a initially was males hrceiainof Characterization o i t20°C), at min 2 for 0C h lt was plate the 80°C, ae a deter- was males 1 , Psammotettix populations , on

31 Jul2017 at10:14:41 1 in- Psammotettix rmdifferent from ACTGACATCTTTACGATGC 1 018 03.30 4.69 20 23 1 1 1.84 30 0.34 27 1 1 shown. are deviations standard with Means analysed. N 51B S-70 helvolus P. helvolus P. confinis P. alienus P. alienus P. SplmnaytbeS) hlgntctes constructed trees, Phylogenetic S1). 52 table and (Supplementary females (18 leafhoppers 70 males, of sequences cleotide (Biomatters 10.1.2 version by software produced Ltd.). Geneious ana- were using were products data lysed Sequence PCR (Germany). Operon (COI) MWG sequences nt-long Eurofins 708 nucleotide and the The bromide illumination. of ethidium UV with and stained under 72°C electrophor- gel, observed min by at agarose 1 analysed performed 1.5% were for was in products 50°C step esis PCR extension The s, 30 min. final 10 for A for s. 94°C 90 of for cycles 72°C 35 by followed of µM 150 AJ311031), MgCl No: mM 3 accession dNTP, GenBank to according e × 0 Mlo ohtefradpie F (5 WFb primer forward the both of nMol 200 buf- 1×, flexi green fer GoTaq USA), Wisconsin, Madison, (Promega, eBn ceso o J101 n h ees primer reverse the and (5 AJ311031) WRb No: accession GenBank mlfe yPRuigteLO40adHO18primer HCO2198 and LCO1490 (Folmer the the pair using Simultaneously, PCR with min. by ended 10 from run amplified for The gene min. 72°C COI 1 for at mitochondrial for 94°C step 72°C and at incubation min an 1 cycles for 35 94°C. 60°C cycler s, for at thermal 30 Biometra min Germany) 5 a Goettingen, for in cycled heated (Biometra, were was reactions mixture the The Then, µl. 50 of final a volume to water RNAse/DNAse-free with adjusted and hopper al .Caatrzto of Characterization 2. Table lx ufr1,20n fec rmr 5 Mo NPand dNTP of µM 150 primer, each MgCl of mM nM 3 200 1×, buffer flexi 3 tln eino h D eoe orsodn to corresponding A genome, procedure. WDV PCR the 3 a of the using region checked nt-long 935 was leafhoppers from h rsneo lo oa efoprDAetat . of U 1.5 extract, DNA leafhopper GoTaq total of the µl 2 of presence the idb C sn . fteGoTaq the of U 1.5 using PCR by fied 3 the and 0µ trl ae n trdat stored in and resuspended water were sterile pellets µl 50 dried Lastly, (GeneVac UK). concentrator ethanol Ipswich, Duo 70% Mivac Ltd., the of using µl 30°C 250 at dried with and washed were wells and discarded ubro niiul analysed; individuals of number , hlgntcte o h O eewsbitfo nu- from built was gene COI the for tree phylogenetic A h rsneo D ntettlncecaisextracts acids nucleic total the in WDV of presence The , subjectto theCambridgeCore termsofuse,available at ′ n fteca rti ee h hr ne-ei region inter-genic short the gene, protein coat the of end mlfcto,sqecn n oeua analysis molecular and sequencing Amplification, al 3 table populations ′ - ae 36100 .15 1 .2±0.45 ± 1.12 517 0.10 ± 1.31 53 205 0.01 ± 0.07 19 641 0.06 ± 0.45 53 250 19 males females 1744 ′ eae 775 .821 36.12 11 2 1.98 ± 7.58 17 3 females ae 0 .4±00 0 .1±0.09 ± 0.41 100 5 0.01 ± 0.04 106 5 males n fterpiaegns(e/eA,wsampli- was (Rep/RepA), genes replicase the of end ae 42301 .11 5 .4±0.09 ± 0.54 257 14 0.01 ± 0.14 293 14 males ® 2 GGAAAGACTTCCTGGGCAAG h itr a umte o9° o min 5 for 94°C to submitted was mixture The . tal., et olce ntefed n 6CIsequences COI 26 and fields the in collected ) lx oyeae(rmg) oa green GoTaq (Promega), polymerase flexi Psammotettix Nn 2 1994 lo uli cd xrce rmaleaf- a from extracted acids nucleic of µl 2 , .PRratoswr are u in out carried were reactions PCR ). Psammotettix (s) duration train Pulse pce eree rmGenBank from retrieved species 829 Psammotettix − -3 0Cutlused. until 20°C ′ ubracrigto according number , n oa ubro signals of number total , p aln songs. calling sp. Nn ® lx polymerase flexi niiul was individuals 1725 -3 ie(s) time repetition train Pulse ′ number , ′ - 809 CC 5

https://doi.org/10.1017/S0007485317000669 .

Version postprint https://www.cambridge.org/core/terms

, subject to the Cambridge Core terms of use, available at available use, of terms Core Cambridge the to subject , 10:14:41 at 2017 Jul 31 on , DIC/DSI-INFODOC CIRAD . https://www.cambridge.org/core from Downloaded 7CFF.HrutAssF F F S Assas Assas Assas F Hérault S Hérault F F Hérault S F Hérault Fr. Fr. Hérault Vraincourt lieu en F M F Villiers Fr. Hérault Marne B. Haute sur F F Marne Vaux 190A Haute Fr. B. F sur Marne Vaux 170C Haute Fr. F Marne 170B Haute Fr. F Fr. Vraincourt F 169A Fr. Marne Vraincourt F Haute 104H Fr. F Marne Orges F lieu Haute 104G en Fr. Villiers F Marne F Haute 104 Marne F Haute F Fr. 15 F S Fr. 57 M F Fr. 49 Haute M Carcassone F Fr. 134 F Carcassone M Haute M 108 Carcassone F Cher 117 Fr. Carcassone F 34 Carcassone Aude M Fr. F Carcassone Aude F Fr. 65A Aude Carcassone F F Aude Fr. M Marseillette F Aude 51B Fr. Marseillette M F Aude Fr. 524 Marseillette M F 35A Aude Fr. F M Marseillette Fr. 34C Aude Marseillette M F Fr. 31E Aude Marseillette M F Fr. 31C M Aude Marseillette F Carcassone 31B Fr. F Aude M 30I F Marseillette Aude Fr. M 30E Aude Fr. F Carcassone M 28A Aude Fr. F Carcassone M Aude Carcassone 27A Fr. M Carcassone F 20A Aude Fr. M Carcassone 15H Fr. Aude M F Marseillette Fr. 15C Aude M othe F en Aude Bucey Fr. 12K F F Aude S 11A Fr. M F Aude Villenereuill 34G Fr. M Aude Fr. Villenereuill 15B Fr. F Aube Villenereuill 33A F Fr. Aube Villenereuill 34Gc F Fr. Aube 30G F Fr. Aube 30B F Fr. Aube 30A M Fr. Aube 20E M Fr. 261 M Fr. 217 M Fr. 212 M 209 M 207 189 7 r éal otere u e F lez F sur Montferrier lez F sur Montferrier lez sur Montferrier Hérault S Hérault Hérault Fr. Hérault Fr. M Fr. M 97H M Fr. 97D M 93A 188G aeSxCutyRgo il oainTp ol aeBdAdMlVbNm e onr einFedlcto yeCl.dt o e o Vib Mol Aed Bod date Coll. Type location Field Region Country Sex Name Vib F Mol Aed Bod Fontaines date Coll. Type Aube location Field Fr. M Region 69Aa Country Sex Name data. available of type and leafhoppers studied of Origin 3. Table Bulletin of Entomological Research, 108 (2), 185-202. ,DOI : 10.1017/S0007485317000669 Abt, I.,Derlink, M., Mabon, R.,Virant-Doberlet, M., Jacquot, E. (2018). Integrating multiple criteria forthe characterization of Psammotettix populations in European cereal fields. Garonne Garonne ilnuel F F Villenouvelle Auragne t t t t t t ahe eT F F T. de Mathieu T. de Mathieu F F Fesc du Gely Fesc du Gely F Caprais F B. de Martin Comment citercedocument : rgnDescription Origin

0 0 2 1 1 1 1 1 1 1 1 1 1 0 0 0 0 0 0 0 0 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 1 1 1 1 0 0 0 0 ue21 -9FSo anc anc F F F Ravnica F Ravnica F F Ravnica F F Ravnica Ravnica Ravnica Ravnica F Slo. Ravnica Ravnica Ravnica F Chitry Slo. Ravnica F Ravnica F Looze Slo. Yonne M Slo. S-09 Chitry Yonne M S-07 Slo. Slo. M Chitry Y Yonne F S-03 Looze M Fr. M Y Yonne S-02 N Fr. Y Yonne S-01 F F N Y Fr. F A F Y N F Y Looze Fr. 394 F M N Y F Y N Fr. Sepeaux 347 M Yonne Y Y Y Sepeaux N F 400 / M Yonne Y Y N Sepeaux 389 Yonne N Y Y Evry Y 370 2013 Fr. N Y June Yonne Y Evry N 2013 / Yonne N June Fr. M Y N 2013 Evry / Fr. Yonne N June M Y 2013 / N June 360 Fr. M Yonne Y 2013 / Fr. June 326 M Y Y 2013 / Fr. June 319 M Y Y 2013 June 308 Fr. M Y Y Y 2013 June 299 M Y Y 2013 June 286 Y Y Y 2013 June 284 Y N Y 2013 Y June Y Y 2013 Y N September Y Y 2013 Y September Y N 2013 Y September Y 2013 Y September N 2013 Y September 2013 Y September 2013 September ue21 -1MSo anc anc F F F F Ravnica F Ravnica Ravnica Ravnica Ravnica F Ravnica Ravnica F Slo. Ravnica Ravnica F Slo. Ravnica M Ravnica F Slo. Ravnica Ravnica F F Slo. S-71 Ravnica F Ravnica Slo. S-70 Ravnica F Y Ravnica Slo. S-69 F Ravnica Y Ravnica Slo. F S-68 N M Ravnica Y S-67 F Slo. M N Y S-66 F Slo. Y N M Y S-65 Ravnica F Slo. Y N M Y Ravnica N Ravnica S-64 F Y Y Y M Ravnica N Ravnica S-63 F N Y Y Ravnica N Ravnica S-62 F Y Y Slo. Y Ravnica N F 2013 Ravnica / F N June Slo. Y M N Ravnica 2013 Ravnica / N June Slo. F M Y Ravnica 2013 Ravnica / N S-61 June Slo. M Ravnica Y Ravnica 2013 Ravnica / S-60 June Slo. Ravnica M Y Y Ravnica 2013 F / S-59 June Ravnica Slo. M Y Y F 2013 F S-58 Ravnica June Slo. Y M Y Y 2013 F Slo. June S-57 Slo. Y M Y Ravnica 2013 F June S-56 / M Y M Ravnica Ravnica Slo. Y Ravnica 2013 F June S-50 / Y Ravnica F Ravnica Y Ravnica 2013 S-46 Y June S-48 / F Y F Ravnica Y Ravnica 2013 Y September Slo. / Y Y Ravnica Y Ravnica S-45 2013 F Y September Slo. Slo. Y Y Ravnica M F Ravnica 2013 Y September Slo. Y Ravnica Y Y Y Ravnica M F F 2013 S-34 Y September Slo. Ravnica Y M F Ravnica 2013 S-32 Y N Y September Slo. S-41 Y Ravnica M Ravnica Y 2013 Slo. S-24 Y September Ravnica Ravnica M Y N Y 2013 Slo. / S-22 Y September N Ravnica Ravnica F Y 2013 S-20 September Slo. N Ravnica F Y Y Y Slo. S-17 Y N M Y 2013 Slo. S-16 Y June N Y F Y N Slo. S-15 Y N F Y N 2013 S-13 N Y June N F Y N 2013 S-12 Y September N Y N 2013 S-11 Y June N Y N 2013 Y June N Y N 2013 Y June N N 2013 Y June N N 2013 Y June N 2013 Y June N 2013 June N 2013 June 2013 June 2013 June 2013 June 1 rgnDescription Origin 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 uut21 N N Y Y Y Y Y Y Y Y N Y Y N Y Y Y Y Y N N 2014 Y August Y Y Y 2014 Y August Y N Y 2014 August Y Y N Y 2014 Y August Y Y N 2014 Y August Y Y Y 2014 Y August N Y 2014 Y August Y Y Y 2014 N August Y 2014 N August Y Y Y 2014 August Y Y 2014 N August Y N 2014 August Y N Y 2014 / August Y N / Y N Y 2014 Y August Y Y Y Y Y N Y 2014 Y August Y N Y 2014 Y August Y N Y 2014 Y August Y N Y 2014 / August Y N Y 2014 / August Y Y Y 2014 Y August Y Y Y 2014 / August Y Y Y 2014 / August Y Y Y 2014 / August Y Y Y 2014 / August Y Y Y 2014 N August Y Y Y 2014 Y August Y Y 2014 Y August Y Y Y 2014 N August Y Y 2014 August Y Y Y Y 2014 August N Y N 2014 August / Y Y 2014 August / Y 2014 Y Y August Y Y Y 2013 Y September Y N Y 2013 Y September Y Y Y 2013 Y September N Y Y 2013 Y September Y Y 2013 Y Y September Y Y Y 2013 Y September Y N 2013 Y September Y Y 2013 Y September N 2013 Y September Y 2013 Y September 2013 Y September 2013 September uut21 Y Y Y Y Y N N Y N / Y Y / Y Y / Y 2014 / August Y 2014 August Y 2014 August 2014 August 2014 August

1

.Abt I. tal. et 6 https://www.cambridge.org/core/terms Downloaded from Version postprint Bulletin ofEntomological Research, 108 (2),185-202. , DOI:10.1017/S0007485317000669 Abt, I.,Derlink, M.,Mabon, R.,Virant-Doberlet, M., Jacquot, E.(2018). Integrating multiple https://www.cambridge.org/core criteria for thecharacterization ofPsammotettix populations inEuropean cerealfields.

Table 3. (Cont.)

Origin Description1 Origin Description1 .

https://doi.org/10.1017/S0007485317000669 Name Sex Country Region Field location Type Coll. date Bod Aed Mol Vib Name Sex Country Region Field location Type Coll. date Bod Aed Mol Vib t 190C M Fr. Hérault S Mathieu de T. F1 June 2013 N Y N Y S-73 M Slo. Ravnica Ravnica F0 August 2014 Y N Y Y t 190E M Fr. Hérault S Mathieu de T. F1 June 2013 N Y N Y S-74 M Slo. Ravnica Ravnica F0 August 2014 Y N Y Y t 190F M Fr. Hérault S Mathieu de T. F1 June 2013 N Y N Y S-75 M Slo. Ravnica Ravnica F0 August 2014 Y Y Y Y . CIRAD DIC/DSI-INFODOC 267 M Fr. Yonne Evry F0 September 2013 Y Y Y Y S-76 M Slo. Ravnica Ravnica F0 August 2014 Y N Y Y 268 M Fr. Yonne Evry F0 September 2013 Y Y Y Y S-78 M Slo. Ravnica Ravnica F0 August 2014 Y N N Y

Comment citer cedocument: 271 M Fr. Yonne Evry F0 September 2013 Y Y Y Y S-79 M Slo. Ravnica Ravnica F0 August 2014 Y N N Y

1 Each individual was characterized (Y for ‘yes’) or not (N for ‘no’) using vibrational data (Vib), morphometric measurement procedures (Bod: measure of parts of leafhopper’s body; Aed: measure of the male’s of Characterization aedeagus) and molecular approach (Mol: COI sequencing procedure). M, male; F, female; Fr., France; Slo., Slovenia. F0,F1 and F2 correspond to field-collected insects, progenies obtained from gravid females collected during field surveys and progenies resulting from mating obtained during experiments (Derlink et al., 2016), respectively. , on

31 Jul2017 at10:14:41 Psammotettix ye eedn yRvrin321( eeomn Core Development (R 3.2.1 version R by Team, done ana- were morphometric and All S1 lyses respectively. figs females, with and Supplementary males associated the for ob- S2 in characters of shown are ranges morphometric groups The acoustic of profile. values acoustic on the tained based to performed according was groups (LDA) analysis discriminant linear ihpbihddaig (Tishechkin, drawings published with (Rasband, ( characters size aedeagus various of measurements Morphometric (Zeiss). Niedringhaus, ai aefrtxnotnrfre oi h ieaueat literature the in to referred often taxon striatus Psammotettix for name valid Wilson u ne h bv etoe rnclrstereomicroscope. trinocular ( males 68 mentioned from aedeagus of above pictures Digitalized the under carried se- was was dissection out aedeagus abdomen the the and of body segment the last from parated The glycerol. of drop transferred a and temperature washed to room was in at body min dried sclerotized 5 water, remaining deionized for in The immersion KOH. by M dissolved 1.8 was hot tissue soft the after- wards and temperature room at min 2 for dried were leafhoppers 0,br-nlnt:1000adrno ed 385 and 13.825) frequency: seed: subsampling random (Guindon heated PHYML and 0.2, the 100.000 1.100.000, using temp: length: chain length: burn-in 200, heated (chain 4, fol- settings the chain: with MCMC model substitution lowing nucleotide Ronquist, HKY85 & the (Huelsenbeck with method MrBayes the using ewe ape ils(agn rm0t 0,6t 4ad0to 0 and 74 to 6 100, to 0 from (ranging collection. fields sampled heterogeneous of between was time females gravid the of of proportion at and the However, females 46 (North gravid 63, of (i.e. 2013 respectively) proportions 11%, the illustrating September larvae pro- respectively, in 2212 France), Slovenia), duced of collected (West of females 2014 August the and (South France) of out 2013 individuals June four conditions, and rearing 234 our 96, Under la- analyses. the for to facilities transferred boratory and systems rearing individual in placed ai eso fPanasis of ( version characters size basic body ( various males) measured 52 We and females of (30 pictures individuals Digitalized 82 (Huvitz). to camera digital connected HC-30MU (Huvitz) the HVZ-S0645T0 stereomicroscope culare trino- the under placed were Leafhoppers ethanol. 96% in stored lvna 12lahpes(9 ae n 0 eae;sex females; 700 and males (492 ratio leafhoppers 1192 Slovenia, anduigteLM0 irsoe(es)adZEN and (Zeiss) microscope LSM700 the using tained U8821 a sda ugopt ottetree. the root to outgroup sequences. as used COI was EU981892.1) aligned from Macrosteles obtained Nei, & were (Tamura (Biomatters), Nei and Tamura 1993 the with methods Joining ial,gnrladau opooyhsbe compared been has morphology aedeagus general Finally, ( characters body female and male compared We niiul sdfrmrhmti esrmnswere measurements morphometric for used Individuals rmte3 ilsvstdi 03i rneadi 04in 2014 in and France in 2013 in visited fields 36 the From , subjectto theCambridgeCore termsofuse,available at mlmne noGniu otaevrin10.1.2 version software Geneious into implemented ) (m/f) 2010 populations tal. et .)hv encletd( collected been have 0.7) = opoercmaueet fleafhoppers of measurements Morphometric hrceitc ffedcletdleafhoppers field-collected of Characteristics 2006 ). i.2B fig. O eune(eBn ceso number: accession (GenBank sequence COI ( 2015 ). 2009 nconsidering in ) eedn yuigIae software ImageJ using by done were ) .Truhu h ae,w follow we paper, the Throughout ). (Linnaeus). © otae(ir kpol) Male skopWorld). (Micro software Results tal. et , 2010 .alienus P. al 1 table n h Neighbour- the and ) 1999 al 3 table i.2A fig. idran& Biedermann ; al 3 table ,immediately ), Dhbm the (Dahlbom) eetaken. were ) sn soft using ) © al 4 table )wereob- software 2001 .A ). 7 ) https://www.cambridge.org/core/terms Downloaded from Version postprint ftemitnnepro.Acrigt h aiaystatus sanitary the F to the According of period. maintenance the of nSpebr21 n rm7 F 79 from and 2013 September in opouegnrtoso avedrn eido 470 of F period gravid progeny the a the by of during size produced the initially between larvae correlation obvious of able No were days. generations lineages Three produce 114.58). ± to (SD 46 days mainten- lineage 170.74 (from a was of died duration ance population Mean year). the a than of more to insect days rearing last individual the new until a of progeny on transfers progeny monthly ( a system of on larvae based and maintenance adults long-term introduced a been have in females of 35 progenies) of of progenies size the (e.g. of leafhoppers, effect biology possible the the on test status To viruliferous lifespan. the whole its persist for and vector moulting the at in lost not are particles viral plants, fected 2010 ( variation between-field import- ant an with (France) 2013 September for in 14.9% collected insects was the facil- leafhoppers laboratory viruliferous of the proportion in The all leafhoppers ities. rearing to for applied used was plants procedure the ELISA Moreover, 2014. August sastreigteWVsqec eepromdo the F on 818 from performed extracted PCR were acids plant, sequence nucleic host total WDV to WDV the transmit targeting to assays ability their and insects larvae hatching. the after reason days undetermined few an died for but status, highlighting plant, gravid host their their on eggs lay to able were 2013) June h ag 2 range the a rdcddrn h aneac rcdr slinearly ( is correlated procedure positively maintenance and the during lar- produced of number vae the However, observed. was maintenance term F August respectively, and 2014, 2013 September 2013, June in sampled fields in 16% of characterization Morphological 2. Fig. 8 hl h te iegswr soitdwt h rsneof presence the with associated were lineages other the while ( insects 65 to up F some reached Moreover, populations other while rpgtv anrb t efoprvco (Zhang vector leafhopper its by manner propagative illustrated). (not WDV with suc- plants to inoculate able cessfully were leafhoppers viruliferous all that showed sults re- ELISA WDV-free. were Slovenia in collected leafhoppers the iiul.Sm F Some dividuals. esrd(B, measured Psammotettix alienus 0 rvdfmlswr ihyvral ewe h olce in- collected the between variable highly were females gravid ogtifrainaottesntr ttso h collected the of status sanitary the about information get To D sdsrbdt etasitdi essetnon- persistent a in transmitted be to described is WDV .Ti en htoc curddrn edn nin- on feeding during acquired once that means This ). Bulletin ofEntomological Research, 108 (2),185-202. , DOI:10.1017/S0007485317000669 Abt, I.,Derlink, M.,Mabon, R.,Virant-Doberlet, M., Jacquot, E.(2018). Integrating multiple et n 54( #524 and left) , https://www.cambridge.org/core criteria for thecharacterization ofPsammotettix populations inEuropean cerealfields. 0 i.1 fig. eae,2 u fte3 iegswr virus-free were lineages 35 the of out 28 females, – 3F 33 aegntla()wr isce ntepeec fptsimhdoie bevduigteLM0 irsoeand microscope LSM700 the using observed hydroxide, potassium of presence the in dissected were (B) genitalia male i – and n ihtosicue nteZEN the in included tools with ) 1 1 0 al 1 table niiul,adtedrto ftelong- the of duration the and individuals, al 5 table rgne nlddol igeindividuals single only included progenies eae eg 49 o eae olce in collected females for 24/96 (e.g. females smoetxconfinis Psammotettix . https://doi.org/10.1017/S0007485317000669 .Szso h rgne rdcdby produced progenies the of Sizes ). .Ti rcs a ple neach on applied was process This ). N al 1 table 35; = . CIRAD DIC/DSI-INFODOC .Bsdo C diagnostic, PCR on Based ). 0 r 0 2 eae,wihvre in varied which females, .0)wt h length the with 0.706) = niiul ape in sampled individuals Comment citer cedocument: Psammotettix 0 right). , niiul sampled individuals © otae(es) itrsi illustrate B in Pictures (Zeiss). software oy()admale and (A) body , on al 1 table

31 Jul2017 at10:14:41 tal et .Abt I. ). ., tal. et a erlal soitdwith associated reliably be can risrpae ihlne eeiintm (Derlink time repetition longer 2016 with repeated ( of trains time song repetition calling train pulse Female and duration train in pulse song calling male ( Tishechkin to to according signed be, can that songs ( the tern with songs in calling fields emitted cereal the France from collected leafhoppers of majority great ( and time duration repetition train train pulse pulse in substantially ( differed and trains teristics pulse repeated regularly and of pattern basic same mte ogpletan ( trains ( pulse long time emitted repetition repeated trains shorter pulse longer with of composed songs calling duced ul.I oprsnwith species comparison In ously. main helvolus three P. was fields Slovenian by in lected composed leaf- a including community of presence the revealed hopper Slovenia in collected hoppers ( time repetition trains pulse pulse longer frequency-modulated and longer, by sequence. characterized with stimulation is associated the with in reliably comparison included be In song not calling could male song any this of emission characterized previously any calling to emitted Psammotettix correspond not #51B) did (individual that France song in collected female as assigned confinis P. egho h ogtr aneac ( maintenance long-term the of length ntenme flra rdcd( produced effect no larvae had of corre- WDV the number in of the used presence plant on host The last procedures. the by in sponding shown virus as the maintenance of long-term detection whole the during WDV aedeagus irtoa inl rdcdby produced signals Vibrational codn oeitn nomto (Derlink information existing to According the of variations were signals vibrational registered All h nlsso irtoa inl eitrdfo h leaf- the from registered signals vibrational of analysis The , subjectto theCambridgeCore termsofuse,available at 4 )( .Vbainlsnshdseis n e-pcfccharac- sex-specific and species- had songs Vibrational ). is3a figs i.4a fig. eddntoti eodn htcudb clearly be could that recording a obtain not did we , B.Dfeetprso h oywr esrd(A, measured were body the of parts Different (B). .alienus P. .confinis P. aentbe,t u nweg,dsrbdprevi- described knowledge, our to been, not have .confinis P. and , pce-pcfcvbainlsn ( song vibrational species-specific al 2 table 4a aedeagus and .Hwvr oemlseitdcalling emitted males some However, ). .alienus P. ( i.3b fig. .Det h o ubro collected of number low the to Due ). .confinis P. .confinis P. .alienus P. eaecligsn.Hwvr one However, song. calling female i.4b fig. .alienus P. is3 figs rmlahpes#4( #34 leafhoppers from .I oprsnwith comparison In ). .helvolus P. i.3c fig. eaecligsn,ti song this song, calling female , .helvolus P. al 2 table Psammotettix and h hr anseiscol- species main third The . scaatrzdb shorter by characterized is al 2 table sfre ylne pulse longer by formed is ae of males , , P 4 al 2 table .alienus P. P , irtoa inl of signals Vibrational . .Wiefml replies female While ). 0.587). = ). al 2 table .0)ado the on and 0.106) = aecligsong calling male 1999 ,wiefemales while ), tal. et .helvolus P. ). eprlpat- temporal i.4c fig. leafhoppers ,ceryas- clearly ), Psammotettix , .alienus P. 2016 al 2 table .The ). is3 figs tal et ,the ), a pro- – h ). ). ., ,

https://doi.org/10.1017/S0007485317000669 .

Version postprint https://www.cambridge.org/core/terms

, subject to the Cambridge Core terms of use, available at available use, of terms Core Cambridge the to subject , 10:14:41 at 2017 Jul 31 on , DIC/DSI-INFODOC CIRAD . https://www.cambridge.org/core from Downloaded Male body. leafhopper female and male the of parts different of Measurement 4. Table -240 .403 .904 .507 .7S7 .403 .405 .308 .22.90 2.76 2.94 2.51 0.82 2.51 0.76 3.13 0.82 2.63 0.77 2.77 0.89 2.86 0.71 2.52 0.74 0.80 2.45 0.99 0.75 0.93 0.54 2.70 0.43 0.79 0.87 2.87 0.69 3.47 0.42 0.97 0.76 0.60 3.1 0.82 3.5 0.51 0.68 0.78 0.54 0.88 0.55 0.76 0.87 3.39 0.81 0.51 3.39 0.56 0.84 3.4 3.13 0.66 3.09 0.72 0.77 0.53 0.82 0.65 3.18 0.82 0.40 0.72 0.94 0.54 0.48 3.29 3.33 0.62 3.18 0.96 0.68 0.55 0.81 0.89 0.96 0.51 0.34 0.61 3.14 2.98 0.75 0.52 0.81 0.83 0.40 0.75 0.56 0.41 3.27 0.92 0.57 3.43 0.79 1.02 0.96 0.47 0.49 0.42 0.33 0.48 0.50 3.21 0.30 0.78 0.56 0.99 0.53 0.59 0.38 0.55 0.33 0.30 0.61 2.86 1.12 0.8 0.8 2.97 0.44 0.78 3.05 0.91 0.5 0.49 0.60 0.29 0.79 0.36 0.37 0.65 4.02 0.89 2.87 0.33 0.68 0.92 0.84 0.51 0.48 0.61 0.32 0.36 0.37 0.56 3.79 1 2.68 3.5 0.28 0.71 0.30 0.62 0.79 2.85 0.52 0.52 0.40 3.74 0.36 0.35 S-66 3.91 2.74 0.32 0.75 0.59 0.92 0.41 0.77 0.51 0.42 0.97 0.61 0.34 3.54 0.24 S-65 3.90 0.52 2.44 0.44 0.77 0.95 0.8 0.82 0.40 0.51 0.53 1 0.57 0.34 3.68 0.40 S-63 3.78 1.03 3.39 3.27 0.59 2.80 0.37 0.74 0.85 3.24 0.64 0.44 0.56 0.79 0.34 3.21 0.38 0.38 0.42 S-62 4.17 0.77 0.5 2.77 0.72 0.83 0.30 0.50 0.56 0.32 3.21 0.25 0.42 S-61 3.93 0.38 0.85 0.58 S-70 3.01 0.53 0.74 0.83 0.49 0.33 0.55 0.35 3.86 0.53 0.43 S-59 0.92 3.73 0.26 S-69 3.37 0.52 0.55 0.78 0.93 0.49 0.83 0.42 0.84 0.55 0.38 0.36 3.32 0.31 S-58 3.62 0.79 0.36 S-68 2.74 1.06 0.73 0.93 3.45 0.33 0.53 0.91 0.54 0.57 0.38 0.33 S-57 3.34 3.51 S-67 2.75 0.71 0.43 0.85 0.51 3.31 0.49 0.34 0.61 0.59 0.30 0.33 S-56 3.43 S-45 0.42 2.39 0.64 0.82 0.46 0.48 3.11 0.56 0.32 0.64 0.25 0.6 0.45 S-50 3.15 S-41 1.01 0.68 2.72 1.02 0.34 0.63 0.74 0.53 0.91 0.39 0.49 0.48 0.56 0.32 S-48 3.55 3.45 S-17 0.53 2.68 0.70 0.75 0.43 0.3 0.54 S-16 0.38 0.38 S-46 3.55 3.41 0.57 0.38 2.45 0.71 0.34 S-13 0.87 0.44 0.47 4.22 0.34 S-12 3.23 0.34 S-34 3.87 0.56 0.76 0.39 0.41 0.37 0.81 3.27 0.50 0.53 0.34 0.54 0.55 0.36 3.82 S-11 0.30 S-32 3.29 0.75 4.09 0.45 4.25 0.62 0.83 0.46 0.75 0.59 0.59 0.24 0.34 S-24 3.37 3.38 0.97 0.46 S-09 0.51 0.8 0.55 0.94 0.35 4.11 0.34 0.37 0.34 S-22 3.45 0.75 0.48 34G 3.23 0.31 0.58 0.95 0.33 0.53 0.35 0.28 3.79 S-20 0.32 2.97 0.93 0.42 0.64 0.62 394 0.47 3.28 0.77 0.57 0.40 0.49 0.33 0.56 S-15 3.41 0.37 0.43 0.3 0.33 0.75 0.94 4.16 104 15 2.9 0.26 0.51 S-07 3.34 0.36 4.04 0.3 0.42 0.47 3.29 0.5 S-03 3.37 0.71 3.11 0.35 0.9 0.49 347 3.96 3.67 0.38 3.98 4.03 0.37 0.33 170C 0.55 S-02 0.72 0.28 0.81 0.45 0.38 3.22 0.8 0.4 3.95 0.26 S-01 0.39 3.44 0.31 0.89 0.39 0.48 0.74 0.4 0.99 4.04 170B 3.57 400 0.76 0.36 0.45 169A 0.48 0.35 0.88 4.05 3.85 0.52 3.21 389 0.91 104H 0.54 0.36 0.41 104G 3.12 0.33 0.32 3.9 0.49 0.33 370 0.76 0.6 3.48 3.43 0.33 4.19 3.05 0.75 0.34 3.95 0.5 57 360 0.92 0.5 0.31 0.73 0.32 0.73 0.87 3.57 0.59 326 3.23 0.48 51B 0.36 0.35 3.94 0.83 0.45 4.12 319 4.01 0.35 0.73 0.9 0.54 3.95 0.39 4.03 49 3.3 0.44 0.54 308 0.31 0.48 34Gc 0.29 0.9 3.97 30G 3.02 299 0.74 0.32 0.48 3.21 0.5 0.38 4.1 0.48 286 3.54 0.71 0.93 0.33 0.73 0.25 0.5 3.88 284 0.88 0.52 30A 0.5 30B 0.8 0.32 0.98 3.94 20E 271 0.5 0.47 0.55 3.38 0.34 2.76 0.94 4.08 268 3.28 0.4 0.55 0.27 0.72 0.37 0.72 3.8 267 0.5 0.54 0.36 0.7 0.37 0.95 3.94 0.87 261 0.55 0.32 0.33 0.98 3.94 212 0.5 0.5 0.35 0.36 3.71 0.56 209 0.56 0.54 0.38 3.89 0.56 207 0.25 0.32 4.27 189 0.22 0.51 0.36 134 0.48 4.14 3.44 108 3.98 169Aa 117 34 Bulletin of Entomological Research, 108 (2), 185-202. ,DOI : 10.1017/S0007485317000669 Abt, I.,Derlink, M., Mabon, R.,Virant-Doberlet, M., Jacquot, E. (2018). Integrating multiple criteria forthe characterization of Psammotettix populations in European cereal fields. bdfg h g f e d c b a gh abcdef opoercmeasurements Morphometric Comment citercedocument : 1

Female opoercmeasurements Morphometric 1

Continued

hrceiainof Characterization populations Psammotettix 9 https://www.cambridge.org/core/terms Downloaded from Version postprint 10 Bulletin ofEntomological Research, 108 (2),185-202. , DOI:10.1017/S0007485317000669 Abt, I.,Derlink, M.,Mabon, R.,Virant-Doberlet, M., Jacquot, E.(2018). Integrating multiple https://www.cambridge.org/core criteria for thecharacterization ofPsammotettix populations inEuropean cerealfields. Table 4. (Cont.) Morphometric measurements1 Morphometric measurements1 Male abcdef ghFemale a b c d e f g h

. S-71 3.40 0.32 0.36 0.53 0.45 0.76 0.68 2.72 Mean ± SD 3.71 ± 0.33 0.36 ± 0.06 0.33 ± 0.04 0.54 ± 0.04 0.48 ± 0.04 0.88 ± 0.07 0.73 ± 0.04 3.02 ± 0.32 https://doi.org/10.1017/S0007485317000669 for males S-73 3.32 0.29 0.35 0.63 0.47 0.84 0.71 2.68 S-74 3.43 0.34 0.35 0.56 0.43 0.77 0.72 2.74 Mean ± SD 3.74 ± 0.33 0.37 ± 0.06 0.35 ± 0.06 0.59 ± 0.05 0.51 ± 0.05 0.93 ± 0.09 0.78 ± 0.06 3.02 ± 0.32 .

CIRAD DIC/DSI-INFODOC S-75 3.18 0.30 0.36 0.51 0.42 0.75 0.73 2.52 for females S-76 3.20 0.28 0.37 0.60 0.44 0.80 0.71 2.55 Comment citer cedocument: S-78 3.31 0.26 0.35 0.57 0.48 0.84 0.73 2.70 P value 0.65 0.46 0.09 <0.0001 <0.001 <0.01 <0.001 0.87 S-79 3.25 0.33 0.34 0.52 0.40 0.71 0.70 2.58 (males vs. females)2

1The measures associated to the different parts of the leafhopper’s body (a–h, see fig. 2a) are listed in mm. 2

, on Wilcoxon rank-sum test implemented in R version 3.2.1.

31 Jul2017 at10:14:41 .Abt I. tal. et hnfmls(o-aaercWloo aksmtest, rank-sum Wilcoxon (non-parametric P females than ee ae #5,#2,#-2 S3,#-6 S6 n #S-64) and #S-60 #S-56, the #S-34, to #S-32, #524, (#65A, males seven y,adtesz fteson( spoon the of size the and ly), the to assigned step first the in microscope, ‘ the aede- under of collected inspection gus males preliminary after 61 were, study other present and the in similar very is 1758)) (Linnaeus, 1868), (e.g. (Kirschbaum, species some of ae nvbainlsgas( signals assignment species vibrational with on corresponded based that groups defined of males codn otegorpia origin. geographical the to according and parameters in difference statistical showed characters ml aitoso h eemndvle.Telnt and length The ( values. shaft the determined of width the the of were variations spoon) small the the of of ( width characteristics measured and morphological (length and characters shaft, aedeagus several pers, between morphology aedeagus in tions within ogrrptto ie( time repetition longer with comparison nus in- In song sequence. stimulation calling the male in any cluded with associated reliably be not not pattern could ( song previously unique a described by emitted characterized #S-70) song individual vibrational female area, One (Ravnica emit- reply. Slovenia stop female with in may perceives collected male overlapped he live when reply since trains, artefact, pulse female ting an which be may in song duet male a of structure S7 ( #S-70 divided clearly characters head body the of eight females of be- on size based difference the LDA S1). main being (Fig. males the Slovenian and origin, French geographical tween the to cording ( the length and females, wings 30 2a and the fig. determined males 52 were and (i.e. head/pronotom leafhoppers body the 82 for of the asso- parts of specific characters of length morphometric size the eight with insects, ciated these of character- istics morphological the describe better To laboratory. the to nlddi h tmlto eune( sequence stimulation the in included ciemmeso h iaoopafmle (Biedermann de- families accurately cicadomorpha to Niedringhaus, the & used of be abdomen members can the of scribe pygofer), part tergits and apical and ovipositor the wings and (e.g. spots) the thyridia anten- of (e.g. (e.g. cells head habitus apical the of pronotum, characteristics nae, specific to body the egh(i.S) oee,LAas split shaft also aedeagus LDA as However, well S1). as (Fig. length, length wing and body smaller had 17,3.3±37 n 1.7±2.7µ,respectively. µm, 25.97 ± 111.67 and 3.70 ± 35.63 21.78, ± iia to similar 0.01). < Psammotettix eegsgnrlmrhlg nbe h sinetof assignment the enabled morphology general Aedeagus D ae n1 oyadadau hrcesgrouped characters aedeagus and body 14 on based LDA ifrn opooia aaees rmdsrpinof description from parameters, morphological Different nti og us riswr hre n eetdwith repeated and shorter were trains pulse song, this in , ‘ , subjectto theCambridgeCore termsofuse,available at g ’ .Wiemlsadfmlsddntdfe nterbody their in differ not did females and males While ). .confinis P. opooia hrceitc fautleafhoppers adult of characteristics Morphological i.5b fig. ( .alienus P. i.2a fig. i.2a fig. .alienus P. .alienus P. .alienus P. i.2b fig. ,wihsoe ae eei eea narrower general in were males showed which ), n i.S) oee,i i lc eae#51B female place did it However, S2). fig. and and eu fe bevto fec niiulin individual each of observation after genus ru n i o separate not did and group pce.Hwvr aegntlmorphology genital male However, species. 2009 , al 4 table al 6 table and ’ .notatus P. and ru.T cuaeyeaut h varia- the evaluate accurately To group. .TeF The ). .alienus P. i.2b fig. al 2 table i.4d fig. .helvolus P. , a .helvolus P. .Hwvr a aasoe very showed data raw However, ). , b , i.2b fig. parameters , c ). 0 Mlca,19)and 1896) (Melichar, .Teeiso fti song this of emission The ). and efopr eealassigned all were leafhoppers i.5a fig. Dhbm 1850), (Dahlbom, swl ssprtdfemale separated as well as , parameter , h ,tecmaio fother of comparison the ), notodsic,well- distinct, two into .Mlsof Males ). .alienus P. i.4b fig. .alienus P. i and .alienus P. ,teresulting the ), m als3 tables n lk leafhop- -like ee122.00 were ) respective- , .helvolus P. .helvolus P. .striatus P. ae ac- males ‘ ... d females ’ .alie- P. and , ,the ), ‘ e ’ , ‘ 4 f ’ , https://www.cambridge.org/core/terms Downloaded from Version postprint orsodn waveform. of corresponding songs helvolus calling alienus Male Psammotettix 3. Fig. (2 7.9 ± 14.1 (2 1.83 ± 5.0 28 7 3 F 2 the of Size 1 lineages of Nb P Virus-free 2013. Viruliferous in collected females leafhopper leafhopper gravid of 35 status using Sanitary produced lineages the with associated Data 5. Table smldi ohFac n Slovenia), of and France presence both the in suggested (sampled data morphometric cie mn the among scribed l efopr 51. . 07±5. 7. 114.6 ± 170.7 54.0 ± 60.7 8.0 ± 12.3 35 shown. are deviation standard and Mean leafhoppers All rnhcra ils mn efopr nlddi this sequence in insects, these included of description leafhoppers the complete among To work. fields) cereal French and fields) cereal French Kruskal days. in Duration F of Number au vrlfru s virus-free) vs. (viruliferous value oeua hrceiaino niiul sn O data COI using individuals of characterization Molecular ecito fidvdasuigvbainlsgasand signals vibrational using individuals of Description Bulletin ofEntomological Research, 108 (2),185-202. , DOI:10.1017/S0007485317000669 Abt, I.,Derlink, M.,Mabon, R.,Virant-Doberlet, M., Jacquot, E.(2018). Integrating multiple o ahsga,tesetormi hw bv the above shown is spectrogram the signal, each For . https://www.cambridge.org/core criteria for thecharacterization ofPsammotettix populations inEuropean cerealfields. – alsrn etipeetdi n ftepcae fteXSA software. XLSTAT the of packages the of one in implemented test rank Wallis 1 niiul nteprogeny. the in individuals (b) , Psammotettix . https://doi.org/10.1017/S0007485317000669 smoetxconfinis Psammotettix .alienus P. . Psammotettix 3 CIRAD DIC/DSI-INFODOC mi pce olce in collected species (main niiul ape in sampled individuals Comment citer cedocument: .helvolus P. hrceiainof Characterization (c) , efopr.(a) leafhoppers. Psammotettix .confinis P. , on ntde- (not

31 Jul2017 at10:14:41 0010160.587 0.106 <0.001 Psammotettix – – 0 smoetxalienus Psammotettix i.4 eaecligsnsof songs calling Female 4. Fig. inl h pcrga ssonaoetecorresponding each the For above stimulation. pulse shown playback (M) is male in overlaps spectrogram used waveform. signal the song (F) male signal, female in (b) trains In S70. female 3 61±5. (3 54.2 ± (1 66.1 51.4 ± 38.9 33) 8) progeny , subjectto theCambridgeCore termsofuse,available at populations 1 bo avepoue aneac duration Maintenance produced larvae of Nb (b) , smoetxhelvolus Psammotettix – – 1)177±125(72 122.5 ± 187.7 (46 70.8 ± 143.0 217) 143) Psammotettix c eae5B (d) 51B, female (c) , efopr.(a) leafhoppers. – – 241) 470) 11 2 https://www.cambridge.org/core/terms Downloaded from Version postprint 2 1 aedeagus. of Measurement 6. Table 12 Leafhopper rmtetable. the from h esrsascae otedfeetprso h leafhopper the of parts different with Leafhoppers the to associated measures The Bulletin ofEntomological Research, 108 (2),185-202. , DOI:10.1017/S0007485317000669 Abt, I.,Derlink, M.,Mabon, R.,Virant-Doberlet, M., Jacquot, E.(2018). Integrating multiple https://www.cambridge.org/core criteria for thecharacterization ofPsammotettix populations inEuropean cerealfields. 2 en120 17 3.2±1.6196 93 7.8±1.3116 59 56 3.70 ± 35.63 25.97 ± 111.67 17.93 ± 173.38 19.34 ± 149.63 16.76 ± 234.12 21.78 ± 122.00 Mean 9A195 5.9104 8.2198 35.29 139.80 181.62 140.46 258.09 109.56 190A 8G8.9296 1.0131 2.536.55 126.05 173.10 116.50 209.62 80.79 188G 9C115 3.9179 6.1105 34.38 130.53 160.31 127.94 236.69 101.54 190C 9E9.8290 2.0179 2.835.11 127.48 167.94 126.10 229.01 98.48 190E aedeagus 9F9.1296 1.2168 3.231.80 138.32 166.89 115.52 229.61 90.21 190F -6137 4.9145 9.0162 38.13 39.38 36.88 37.50 45.00 41.88 146.28 33.75 105.00 85.63 93.75 146.25 108.13 190.00 86.26 164.38 179.38 169.38 189.38 182.50 144.52 131.25 148.56 175.27 169.70 135.94 158.04 246.89 133.56 223.75 238.13 240.63 253.13 251.88 103.75 197.50 125.63 144.38 S-66 145.63 S-65 98.13 S-59 123.75 S-57 114.38 S-24 28.13 38.13 S-22 42.50 S-15 39.45 33.13 108.75 28.75 31.41 105 134.41 28.76 93.75 52.56 123.75 107.02 94.00 183.80 182.50 73.77 157.51 162.11 109.57 144.46 164.43 163.92 142.44 156.91 171.36 171.56 221.05 135.38 235.21 148.86 253.84 145.79 235.08 194.08 96.25 218.28 219.48 110.00 204.30 140 S-75 159.39 S-63 155 S-62 117.50 S-61 122.73 S-58 123.14 S-20 S-03 S-02 5 0.2271 3.5101 2.340.39 125.43 170.14 131.45 237.19 106.62 15H 7 16 2.0192 7.9103 32.66 150.37 179.59 119.22 229.40 81.62 97H 7 0.2240 4.2152 5.137.50 37.72 36.01 151.21 173.50 106.67 34.57 34.36 195.23 37.44 163.71 187.34 97.13 72.54 141.22 38.67 127.52 129.18 149.20 188.38 34.49 167.94 254.03 115.98 185.51 263.34 226.05 155.42 123.52 160.39 109.62 182.99 160.06 101.39 116.00 97D 93A 219.98 35A 165.59 217.61 172.30 245.81 128.68 130.85 142.75 267.20 120.62 28A 27A 20A 239.35 144.33 11A 110.52 33A 2 0.4291 2.5137 2.330.94 125.43 153.79 120.35 219.15 102.24 12K 5 4.3255 6.7151 21 37.72 82.16 175.13 162.47 225.56 143.33 15C 4 76 4.4136 0.3186 32.98 37.72 158.69 97.22 204.53 184.35 133.62 155.28 242.64 224.57 77.67 129.05 34C 31C 1 82 3.6105 8.6168 33.10 31.65 33.13 136.86 113.47 130.70 183.16 188.52 180.05 29.38 130.55 147.15 135.68 138.13 234.56 228.41 245.01 160.01 88.24 98.54 31E 106.25 31B 113.93 30E 234.40 92.80 15B 0 3.1227 5.8114 1.836.25 35.01 37.63 40.01 35.27 35.00 110.58 35.63 77.37 38.13 108.97 84.65 34.38 37.01 101.12 36.88 64.38 181.41 38.13 156.88 165.27 38.76 120.79 179.00 38.13 112.65 192.91 83.76 38.98 144.36 37.83 95.66 160.63 156.38 96.38 171.25 37.21 169.11 32.50 86.88 196.97 155.12 34.38 82.37 185.18 177.36 116.16 177.75 142.79 82.50 181.06 165.83 242.75 128.13 150.39 194.52 225.63 126.25 187.50 167.11 242.29 99.38 174.97 169.95 239.70 164.98 182.13 217.99 189.37 168.56 208.91 135.01 251.25 172.57 171.63 149.38 201.88 180.55 256.25 123.09 400 175.00 167.99 249.37 149.90 389 161.38 233.19 142.93 370 166.78 243.71 149.38 326 95.63 154.84 239.49 319 161.25 233.13 130.63 308 156.22 228.64 147.70 299 245.91 154.64 284 221.15 148.19 271 251.15 139.38 268 261.25 152.60 267 234.38 147.90 261 120.17 212 137.00 209 117.65 207 107.5 189 129.45 134 108 117 1 4.8268 6.7118 75 35.00 97.50 171.88 164.97 236.88 141.88 217 0 1.5293 4.6110 3.533.17 136.55 191.07 147.86 249.38 116.55 30I 4125206 6.3112 0.038.13 107.50 161.25 168.13 230.63 142.5 34 0.7175 1.3181 39 23.75 83.94 108.13 113.73 187.52 102.57 A . https://doi.org/10.1017/S0007485317000669 orsodn to corresponding ijklmn . CIRAD DIC/DSI-INFODOC Comment citer cedocument: smoetxconfinis Psammotettix , on

31 Jul2017 at10:14:41 .Abt I. ’ s ie 54 6A S3,#-4 S5,#-0ad#-4 aebe excluded been have #S-64) and #S-60 #S-56, #S-34, #S-32, #65A, #524, (i.e. aedeagus opoercmeasurements Morphometric tal. et ( i , subjectto theCambridgeCore termsofuse,available at – n see , i.2b fig. r itdin listed are ) 1 μ m. https://www.cambridge.org/core/terms Downloaded from Version postprint lg n irtoa inl,mls#5,#2,#-2 #S-34, #S-32, #524, #65A, males from signals, vibrational sequence and COI ology nt-long 442 the Macrosteles using se- constructed trees were identical phylogenetic ( and with inference data the (Bayesian Individuals from removed were analysis. quences phylogenetic of sequence nu- for to long corresponding 442-nt and 117 A leafhopper cleotides each list. for sample available the COI, in included Rubinoff, and & Roux (Le se- leafhopper COI from the The parameters. into from standard implemented quence with algorithm software the Geneious using performed was long ( nt individuals 614 to 70 up for of available sequence a each was data, procedure for cleaning sequence the raw obtained of to end applied was of the At region fragment leafhoppers. tested barcoding the DNA of the amplified within An nt out. ±700 carried were analyses triangle. white S70, female triangle; black 51B; helvolus Psammotettix circles; for black characters France, morphometric from eight (b) of and females morphometric 14 males (a) of for (LDA) analysis characters discriminant Linear 5. Fig. rmWs lvna( Slovenia West ( from South from pers Bulletin ofEntomological Research, 108 (2),185-202. , DOI:10.1017/S0007485317000669 Abt, I.,Derlink, M.,Mabon, R.,Virant-Doberlet, M., Jacquot, E.(2018). Integrating multiple https://www.cambridge.org/core criteria for thecharacterization ofPsammotettix populations inEuropean cerealfields. Psammotettix oro h re sepce rmadau morph- aedeagus from expected As tree. the root to – Psammotettix 5 fthe of 558 arsee quadrilineatus Macrosteles N )adNrh( North and 5) = rmSoei,baksurs b female (b) squares. black Slovenia, from i.6 fig. N . efopr.(,b) (a, leafhoppers. https://doi.org/10.1017/S0007485317000669 2009 9.Aineto hs sequences these of Alignment 39). = Macrosteles .alienus P. n egbu-onn fg S3)) (fig. Neighbour-Joining and ) p (Gwiazdowski sp. eertivdfo Genbank from retrieved were ) . CIRAD DIC/DSI-INFODOC al 3 table rmSoei,ge circles; grey Slovenia, from O eune a used was sequence, COI Comment citer cedocument: N 6 fFac and France of 26) = nldn leafhop- including ) hrceiainof Characterization smoetxalienus Psammotettix slt J124LCO isolate tal., et 2015 , on

31 Jul2017 at10:14:41 and ) Psammotettix gopA.W eental ooti h eunefrtefe- the branch the for that sequence own revealed the also its results obtain Our to on #51B. able male placed not were was We #S70 A). (group female The Slovenia. in ( eune rmlahpescletdi rneadin males Gwiazdowski ( by contains and described initially which France CNC#HEM403450, group, in this with collected Surprisingly, leafhoppers Slovenia. from sequences ( surveys our during collected individuals niiul(N#E437)dsrbd codn to according species. described, Gwiazdowski (CNC#HEM403476) individual the from separated well is which eti erdcina es ni h i-uuni a in mid-autumn the until least involve- at their reproduction leafhoppers, adult in of ment lifetime the to according in (Manurung period) Germany winter of Saxony-Anhalt, beginning until (the crops December sown of week newly third in the caught be can adults Areno, However, son. & (Lindblad temperatures in 2002 August decreasing adults of late with activity biological during declines that reported performed been surveys has It the Slovenia. in grav- of females few process, only collect id mating to surprising the was biotic It of leafhoppers. studied local efficiency the that char- including biological acteristics, suggesting impacted strongly females parameters and abiotic and/or gravid ratio sex of locations, field proportion between identified involved cor- actively obvious was no year, relation However, progenies. the their of of that production times indicated the these in 48%) at = females are, begin- gravid the insects of and these (rate spring of autumn end of the gravid ning at of surveyed presence fields in The females period. regions, spring-to-autumn growing the during cereal French en- Psammotettix the of account into complete conditions Taking months. 2 a vironmental about adult is the egg of to of egg day duration from seventh the the after occur stage, 20°C to of reported temperature been average has an at days 50 (Manurung about egg from of is, hatch adult, generation eggs each to first of duration The the increase. and day spring early the in of duration the tempera- and the ture when occurs eggs overwintering of development Gwiazdowski tenuens eelgoigsao,i a ayt ac aeadfemale and male genus catch the to of easy leafhoppers was adult it management season, growing pest cereal current adapt of to epidemiology needed, the into strategies. if insight and, an information providing WDD Such was for congeners. it crucial field, other is cereal with the syntopically in collected found species dominant the was nti td aebe sindi he rus( groups three in assigned been have study this in 2015 ,BadC,wihd o orsodt the to correspond not do which C), and B A, pce ( species the of member a (reported be Bioug05847-g02 to with and S-67) sampled and individuals (S-48 Slovenia two in with together #S-64 and #S-60 #S-56, N 2015 9 nlddidvdasblnigto belonging individuals included 19) = uigfedsrescridota ifrn eid fthe of periods different at out carried surveys field During although that show study present the of Results , subjectto theCambridgeCore termsofuse,available at n htalidvdasdedrn h odwne sea- winter cold the during die individuals all that and ) omdagopta hudb osdrdthe considered be should that group a formed ) samme fthe of member a as ) .alienus P. , populations i.6 fig. .lividellus P. tal et .Te6 other 61 The ). efopr a opeeu ofu iecycles life four to up complete can leafhoppers tal et tal. et ., lk eegsicue h leafhopper the includes aedeagus -like 2005 .( ( , 2015 2015 .confinis P. .beirnei P. .A h eudto n is g laying egg first and fecundation the As ). Discussion .TegopBicue oto the of most included B group The ). ,t eamme fthe of member a be to ), Psammotettix .confinis P. pce yGwiazdowski by species and Psammotettix .lividellus P. .lapponicus P. Psammotettix tal et efopr included leafhoppers N .helvolus P. ., pce.GopC Group species. 1 n contains and 41) = ld,cnan an contains clade, .attenuens P. 2005 h embryonic The . .dentatus P. i.6 fig. suggesting, ) .lividellus P. tde by studied .confinis P. iecycle life .alienus P. collected groups , , clade, .at- P. tal. et tal. et 13 , https://www.cambridge.org/core/terms Downloaded from Version postprint urd at o eea aswes(Brault days/weeks several in for ac- replicate once vectors, lasts not of status do quired, viruliferous the particles (ii) (i) and vectors that: their indicates Slovenia, This manner. in that Psammotettix mentioned a be fields. in wheat the also in resulting reduced, should this Psammotettix in already It observed females be study. gravid can of rate summer lower-than-expected leafhoppers of late activity biological in the and conditions are weather generations (Schiemenz, leafhopper year per in two-to-three produced temperatures cold only to autumn, sea- warm spring from early transition of locations rapid beginning a delayed and in a son period, temperature-dependent, winter cold is a with leafhoppers biol- the of As ogy Germany. like environment Northern-European of (number distance genetic relative the represents bar from scale sequences The COI bold. branches. in the presented on are study reported this are from Males nodes nucleotide). method 73 MrBayes per using the substitutions constructed was for sequence tree COI Phylogenetic obtained Macrosteles tree. sequences. probability the (COI) root I to Oxydase outgroup Cytochrome Ronquist, of & as (Huelsenbeck nucleotides used 442 was EU981892.1) of alignment number: from accession obtained (GenBank tree Phylogenetic 6. Fig. 14 itdi tlc ceso ubr r itdi al 1 h HM (Guindon PHYML The S1. table in listed are numbers Accession italic. in listed lutae rae re A h eegso hsslahpesaeilsrtdin illustrated are leafhoppers theses the on brackets of the between of presented are members aedeagus tree be ML to The from described values maximum bootstrap been (A) on tree, have based MrBayes tree CNC#HEM403450 the tree. phylogenetic to a similar MrBayes construct topology to a illustrated alignment has the tree ML to the applied As was likelihood. software Geneious into implemented model substitution h D secuieytasitdfo ln opatby plant to plant from transmitted exclusively is WDV The Bulletin ofEntomological Research, 108 (2),185-202. , DOI:10.1017/S0007485317000669 Abt, I.,Derlink, M.,Mabon, R.,Virant-Doberlet, M., Jacquot, E.(2018). Integrating multiple https://www.cambridge.org/core criteria for thecharacterization ofPsammotettix populations inEuropean cerealfields. efoprvcosi essetnon-replicative persistent a in vectors leafhopper niiul eecletdi rsln n not and grassland in collected were individuals . https://doi.org/10.1017/S0007485317000669 2001 mlmne noGniu otae(imtes ihteHY5ncetd usiuinmdl Posterior model. substitution nucleotide HKY85 the with (Biomatters) software Geneious into implemented ) 1969 . CIRAD DIC/DSI-INFODOC .Soei a continental has Slovenia ). Comment citer cedocument: tal et , on .,

31 Jul2017 at10:14:41 2010 smoetxconfinis Psammotettix .Abt I. ; tal. et ape.WVhsbe eotdi ueosEuropean Italy numerous countries in neighbouring (Conti, Slovenian reported including been countries French has & for study WDV (Abt this respectively samples. in described 6.14%, leafhoppers and viruliferous re- of 3.94 was 13.05, cereals in in Jacquot, WDV be of to prevalence ported mean 2010, and (Manurung region 2009 year to region to field, year to that field and from showed varies data WDV epidemiological of sur- prevalence dwarf the Wheat an in plants is area. infected field veyed of a proportion in the sampled Consequently, of insects overestimation life. viruliferous their of during proportion the infected) and in- (healthy the caught. hosts by being visited host(s) prior of sect status sanitary the reflects hopper Kvarnheden (Schubert , subjectto theCambridgeCore termsofuse,available at tal. et 1994 2015 tal et n othe to and , 2010 ,Hnay(Bisztray Hungary ), tal., et ,wihi nbodareetwt h 14.9% the with agreement broad in is which ), ., 2014 ehd ihteT9 Tmr Nei, & (Tamura TN93 the with methods ) i.3 fig. 2016 smoetxlivedillus Psammotettix .Atog all Although ). B h netCCHM046and CNC#HEM403476 insect The (B) . Psammotettix .Tu,tedtcino D naleaf- a in WDV of detection the Thus, ). Psammotettix tal et ., eree rmGnakare Genbank from retrieved tal. et Psammotettix 2004 dlsvstnumerous visit adults , .I rnei 2008, in France In ). pce,respectively. species, 1989 n Austria and ) leafhoppers 1993 ) https://www.cambridge.org/core/terms Downloaded from Version postprint Rmn,1965), (Remane, ensis ne otoldconditions. produced controlled respectively) under 2, and in 1 generations are for males/females results Guglielmino by These reported ratios males. &Virla( sex of the prevalence with agreement sex i.e. local broad fields) surveyed 1, 39 above the of ratio out (four some with in lations male) per females 1.42 i.e. 3), = 0.2; maximum = (minimum 0.7 light = ratio sex a (mean females indicate of preponderance Data generations. leafhopper overlapping and ous numer- France with periods for to September correspond which and Slovenia), for June August (i.e. times collection the at es- locations as sampled considered the Consequently, in be proportions male/female the can facilities. of data timates our laboratory from calculated the ratios sex in the fields, randomly individuals, in of transfer sampled the after proced- performed size This abdomen. was the ure of similar part apical the of of observations by collected are of sex females the Niedringhaus, and & males (Biedermann 1850), (Dalhbom, nodosus helvolus P. alienus P. mxmm=4 dlsm adults 43 = (maximum Osanlsn 94) oee,frohrseisbelonging including genus, species this the other to for However, 1974)). (Ossiannilsson, e rvdfml ma ieo F of size larvae (mean of tens female few of gravid production labora- mean the per a in leafhoppers allow maintain facilities to tory work this in used tions eg eprtr)adboi paths pce)parameters abiotic species) both host by Rensburg, (plant determined (Van biotic be and to temperature) described (e.g. been has males oeo h F the of some gemn ihpeiu eot sz fpoeisi the in progenies of in (size is 1 reports conditions range previous experimental with our agreement under of observed fecundity The females 50). = maximum 2, = minimum pig)tecaatrsiso h rdcdprogeny produced the of off- characteristics of (number (Delpuech quantitatively the and/or ratio) has springs) sex It the hatching. qualitatively of alter after (bias can hours mating inter-specific few that reported died been that progenies of duced populations several of Psammotettix maintenance long-term successful (Manurung areas barley ginatus licola (e.g. the males of than bigger species are insect some the sex- of For including characteristics body. morphological parameters or several size by dependent achieved be can males extinction early progenies. the leafhopper for some explanation pre- of other at have not standardized, do was we procedure sent, rearing our of Since mating fields. inter-specific of quence Mavri & nawetfedi h ot-ato h onr (Vir country the WDV of North-East symptoms 2016 the disease surveyed in field exhibiting in wheat the plants a virus-free, in few in in were detected 2014 been Slovenia in has West study in our grassland for collected randomly et e asatrhthn fF of hatching after days few death h ubro gspoue yagai efoprfe- leafhopper gravid a by produced eggs of number The o ayisc pce,teietfcto fmlsadfe- and males of identification the species, insect many For Bulletin ofEntomological Research, 108 (2),185-202. , DOI:10.1017/S0007485317000669 Mtuua 1908),(Matsumura, Cri,1837), (Curtis, Abt, I.,Derlink, M.,Mabon, R.,Virant-Doberlet, M., Jacquot, E.(2018). Integrating multiple https://www.cambridge.org/core Rbu,1925), (Ribaut, Wge,1941), (Wagner, criteria for thecharacterization ofPsammotettix populations inEuropean cerealfields. – č 1997 Dhbm 1850), (Dahlbom, 0)adwt o eko ouaindensity population of peak low with and 100) Ple Krcbu,1868), (Kirschbaum, tal et oeo h il-olce rvdfmlspro- females gravid field-collected the of some , o two for ) š 0 ko, ., il-olce rvdfmlsmyb conse- a be may females gravid field-collected .angulatus P. 1982 2010 2017 .pallidinervis P. Psammotettix Okoth ; .Tu,i a ugs httesudden the that suggest may it Thus, ). .notatus P. ). .alienus P. . https://doi.org/10.1017/S0007485317000669 .unciger P. .putoni P. − tal et 2 .cephalotes P. .nardeti P. .maritimus P. oioe rmsl-onwinter self-sown from monitored ) Te,1899), (Then, ., tal et .excises P. 2004 2009 Mlca,19)and 1896) (Melichar, eeain 4/0ad59/49 and (47/60 generations . Psammotettix CIRAD DIC/DSI-INFODOC efopr a determined was leafhoppers Rbu,1938), (Ribaut, Dlbm 1850), (Dalhbom, ., Te,19)and 1898) (Then, Psammotettix , 1987 1 .Tecaatrzto of characterization The ). Rln,1965), (Relane, 2005 rgne rdcdby produced progenies HrihShfe,1835),(Herrich-Schäffer, Comment citer cedocument: Pri,1857), (Perris, Mtuua 1906), (Matsumura, 1 .poecilus P. .Teraigcondi- rearing The ). .I diint the to addition In ). hrceiainof Characterization ouain 7.29; = populations Psammotettix eu,females genus, .inexpectatus P. Psammotettix curn in occurring Fo,1861), (Flor, .kolosvar- P. .albomar- P. šč , on .confinis P. .dubius P. kMarn ek

.sabu- P. 31 Jul2017 at10:14:41 popu- P. Psammotettix aaeeso aecligsn of song calling male of parameters al et rsn n rvos(Derlink previous and present signals vibrational sex-specific and species- (Heady of emission the 2013 oesol o eue (Wilson used be not should fore striatus 2000 rmseiesrfre oas to referred specimens from opeeoelpwt aaeespeiul trbtdto attributed of previously parameters males with overlap complete ones accurate (Schlick-Steiner most species the delimit are to characters behavioural general, genus ro- necessary the data. provide morphometric to to bustness order in individuals countries include different should from these studies together, future Taken that species. indicate three results other the of females rated of analysis comprehensive that this Moreover, Psammotettix grasslands. of cal presence the confirm of to alienus possible mor- characterization and it gene made COI data the The phometric of sequence signals, species. vibrational of ings wrong the Psammotettix to assigned characters, morphological gus otteve fteeatosta eod of records that authors these of view the port ulcdtbss n hrfr,tecnlsv resolution conclusive to the attributed therefore, individuals whether and databases, public (Kamitani, study barcoding one in cluded n ie.Hwvr tas hwdta oeindividuals some Gwiazdowski that by showed study previous also the it in economic included However, sites. direct ing four of have presence the firmed can vectors identifying er- consequences. taxonomic in species since particular, reliable in rors for genus, need this the in identification highlights result this However, alienus P. oei h D rnfri h pig(b Jacquot, important & (Abt an spring play the in to transfer virus likely WDV the the are transmit in nymphs role to particular, able in are and, nymphs) and females Fartmann, (males, & Borchard male the (Tishechkin, of observation gus, the carried far through so exclusively been has out genus this within identification species to dis- emitted which within #51B, song, female vibrational tinct the on placed based characters analysis body LDA differences although geographic Moreover, revealed species. also between analysis LDA vibrational in by signals identified initially individuals of characters gus with cally variable highly be to appears form (Tishechkin, aedeagus Moreover, fwetcostruhtasiso fwetbu dwarf blue wheat of transmission (Zhang through phytoplasma crops wheat of ain r omni uemcletos(Bluemel collections museum in common are genus cations the from leafhoppers the previous- in highlighted ly been has It identified. correctly not were .alienus P. u eut ndvriyo irtoa aln og nthe in songs calling vibrational of diversity on results Our oeua prahue ntepeetsuycerycon- clearly study present the in used approach Molecular hl e eemnto of determination sex While , subjectto theCambridgeCore termsofuse,available at ., .confinis P. .Mtn eaiu nlahpesi soitdwith associated is leafhoppers in behaviour Mating ). .Rcnl,i a ensgetdta h ocp of concept the that suggested been has it Recently, ). 2008 nbt rnhwetfed n lvna agroecologi- Slovenian and fields wheat French both in Psammotettix populations L)snuRbu 12,15)i roeu n there- and erroneous is 1952) (1925, Ribaut sensu (L.) tal et .alienus P. .striatus P. Bluemel ; . ihntepeetsuywsntpossible. not was study present the within 1999 ., smoetxalienus Psammotettix niiul sn,a hw nti ok record- work, this in shown as using, individuals pce rsn ntesree ra revealed areas surveyed the in present species and 1986 n,teeoe ae xlsvl naedea- on exclusively based therefore, and, ) 1999 .helvolus P. utemr,cmiigbd n aedea- and body combining Furthermore, . Gillham, ; ofr rvososrain ht in that, observations previous confirm tal. et tal et idran&Niedringhaus, & Biedermann ; Lnau,15)(Tishechkin, 1758) (Linnaeus, , ., 2014 2012 Psammotettix 2014 niiul eefudsyntopi- found were individuals .alienus P. Psammotettix 1992 Psammotettix .Hwvr l individuals all However, ). .striatus P. ;Li tal., et tal. et .Cmaio ftemporal of Comparison ). scniee eiu pest serious a considered is Tishechkin, ; tal et .striatus P. .alienus P. tal et Aphrodes , 2015 2016 ru,i lal sepa- clearly it group, ., ., pce torcollet- our at species r o vial in available not are 2014 2010 n u aasup- data our and ) tde hw a shows studies ) ae a lobe also can males dlsi reliable, is adults 2011 htmisidentifi- that bandi the in obtained .Atog in- Although ). .striatus P. Henry ; orsodto correspond ,sequences ), 2000 tal. et ’ aedea- s Percy ; ( 2015 tal et tal. et 2015 1999 2009 refer 15 P. P. ). ., ) , ; , https://www.cambridge.org/core/terms Downloaded from Version postprint Foottit lxne,HM,Muk .. htil,AE,Gret ..& K.A. Garrett, A.E., Whitfield, K.E., Mauck, H.M., Alexander, E. Jacquot, & I. Abt, via shared commonly now are (Patterson barcodes databases Internet DNA and data (Bluemel questionable be also 2011 16 erpdydseiae n niiul hudb validated standards. reliable be on should based individuals and disseminated rapidly be ebr ikladMk isnfravc n discussions and advice for thank Wilson also on Mike authors and The Slovenia. Nickel Western Herbert in survey field ing of identification initial and collections https://doi.org/10.1017/S0007485317000669 idran .&Nernhu,R. Niedringhaus, & R. Biedermann, rahealsfs n eibedtriaino all needed. are of individuals patho- live in when approach determination studies, available transmission only the gen reliable present at be to and appears fast Psammotettix & enables (Abt proach understood poorly Psammotettix still is Since Jacquot, WDD genus. this of from species epidemiology unidentified another as well with as syntopically occur can it fields, common most the otele uAr Fac)adb udn rmthe from funding by P1-0255). and programme (research Agency Research (France) Slovenian (France), Agronomique SupAgro Recherche la Montpellier de National Institut the izry . aojni .&Vce J. Vacke, & R. Gaborjanyi, G., Bisztray, lee,JK,Drik . Pavlov M., Derlink, J.K., Bluemel, W. Symondson, & M. Virant-Doberet, A.R., King, J.K., Bluemel, nsmay u td hw ht although that, shows study our summary, In h uhr iht hn arjlSla o i epi field in help his for Seljak Gabrijel thank to wish authors The at found be can article this for material supplementary The Psammotettix n htseisietfcto nmlclrsuismay studies molecular in identification species that and ) Bulletin ofEntomological Research, 108 (2),185-202. , DOI:10.1017/S0007485317000669 138 interface. agro-ecological C.M. Malmstrom, 10.1079/9781780644264.0027. Crops ( R. Fermin, & ceßl emn,Wseshflc Akademischer Species all Wissenschaftlich to Key Germany, Buchvertrieb Identification Germany: Scheeßel, of Leafhoppers fazncuzJunlo ln iessadProtection and Diseases first 449 Plant the of for Pflanzenschutz-Journal Hungary. found virus in dwarf time wheat of characterization nertn irtoa inl,mtcodilDAand genus Cicadellidae). (Hemiptera: DNA the in determination M. mitochondrial species for Virant-Doberlet, morphology signals, & vibrational W.O.C. Integrating Symondson, A.J. Stewart, M.R., A., Wilson, E., Sherrard-Smith, E., Corbett, of Cicadellidae). spevimens chived O.C. Abt, I.,Derlink, M.,Mabon, R.,Virant-Doberlet, M., Jacquot, E.(2018). Integrating multiple https://www.cambridge.org/core tal et criteria for thecharacterization ofPsammotettix populations inEuropean cerealfields. 529 , – 2015 454. A nentoa,Patpoeto eisdoi: series protection Plant International, CAB . 21)Piesfrietfcto ftp n te ar- other and type of identification for Primers (2011) ., – ,ftr tde hudtk noacutwhole account into take should studies future ), niiul,ietfcto yvbainlsignals vibrational by identification individuals, 547. ha il omnte.Wiemlclrap- molecular While communities. field wheat 2014 aooy hswr a enspotdby supported been has work This taxonomy. – upeetr material Supplementary rn,49pp. 409 Fründ, Gwiazdowski ; oeua clg Resources Ecology Molecular Psammotettix Eds 21)Wetdaf p 27 pp. dwarf. Wheat (2015) Acknowledgements ) . 21)Plant (2014) iu iesso rpcladSubtropical and Tropical of Diseases Virus https://doi.org/10.1017/S0007485317000669 etcrf u faznrnhie Und Pflanzenkrankheiten Fur Zeitschrift References Aphrodes uoenJunlo ln Pathology Plant of Journal European ytmtcEntomology Systematic tal. et tal. et pce olce ntewheat the in collected species . č CIRAD DIC/DSI-INFODOC i č tal. et , – . us,IM,Kn,R.A., King, I.M., Russo, P., , , iu neatosadthe and interactions virus 2010 smoetxhelvolusPsammotettix .cnii n .helvolus P. and confinis P. 2014 efopr (Hemiptera, leafhoppers Comment citer cedocument: , (2009) 2015 Gibson ; .Snebiodiversity Since ). 18)Ioainand Isolation (1989) 11 – . ,msae may mistakes ), 41 770 , h ln-and Plant- The .alienus P. in tal et 39 – enn,P. Tennant, 774. , on 304 , Aphrodes

., 31 Jul2017 at10:14:41 (2014) 2012 – dur- was 324. 96 .Abt I. ; , . , tal. et wadwk,RA,Fott .. an ...&Hbr,P.D. Hebert, & H.E.L. Mawn, R.G., Foottit, R.A., Gwiazdowski, Hordijk, M., Anisimova, V., Lefort, J.F., Dufayard, S., Guindon, lr,MF dm,A.N. Adams, & M.F. Clark, ed,SE,Nut .. hmag,GF arhl,L. Fairchild, & G.F. Shambaugh, L.R., Nault, S.E., Heady, ot,M. Conti, otls A. Bortolus, T. Fartmann, & F. Borchard, el isia W. Giustina, Della rut . zs,M,Mnin . aqo,E ln,S. Blanc, & E. Jacquot, B., Monsion, M., Uzest, V., Brault, epeh .. uot .&Almn,R. Allemand, & C. Dupont, J.M., Delpuech, eln,M,At . ao,M,Jla,C,Vrn-oelt M. Virant-Doberlet, C., Julian, M., Mabon, I., Abt, M., Derlink, ruho,W.B. Broughton, omr . lc,M,He,W,Lt,RA rjnok R.C. Vrijenhoek, & R.A. Lutz, W., Hoeh, M., Black, O., Folmer, I. Ismail, & S.G. Kumari, A.M., Ekzayez, oti,RG,Mw .&Hbr,P.D.N. Hebert, & E. Maw, R.G., Foottit, ulemn,A il,E.G. Virla, & A. Guglielmino, M.C. Gillham, P.D. Travers, & K.K. Blevins, R.H., Kako, C.M., Gibson, , subjectto theCambridgeCore termsofuse,available at eeec irr fDAbarcodes. DNA of library reference N. O. Gascuel, & W. siaemxmmlklho hlgne:assigthe 3.0. assessing PhyML of performance phylogenies: maximum-likelihood estimate fAmerica of Cicadellidae). (Homoptera: 475 lt ehdo nyelne muoobn sa for viruses. assay plant of immunosorbent detection enzyme-linked the of method plate mtra,TeNtelns Elsevier. Netherlands, The Amsterdam, 0265 o:10.1371/journal.pone.0125635. doi: e0125635. cutcadmtn eairof behavior mating and Acoustic etrto nlahpe sebae Isca Auchenor- (Insecta: rhyncha). assemblages leafhopper on restoration el oit noooiaItaliana Entomologica Società della natdcneune fbdtxnm necology. in 37 taxonomy bad of consequences unwanted oitsd cecsntrle,IR dtos p 1 des pp. éditions, Française INRA naturelles, Fédération sciences de France. sociétés de Faune compléments. 3 Biologies viruses. plant for devices transport as Aphids eudt nue yitrpcfcmtn ewe two between mating interspecific species. by parasitoid trichogramma induced fecundity 103 aqo,E. Jacquot, & 294 Cicadellidae). 10.1111/1744-7917.12379. (Hemiptera: Dahlbom yohoeCoiaesbntIfo ies metazoan diverse from mitochondrial I of subunit amplification invertebrates. oxidase for C primers cytochrome DNA (1994) fetn ha n alycosi Syria. in crops 76 barley ( and vector wheat its affecting and virus dwarf wheat 9 Hemiptera). (Insecta: Auchenorrhyncha Nearctic iaelde ne aoaoyconditions. Bachicoltura di e laboratory Agraria Zoologia, under Cicadellidae) (Homoptera, (Dahlbom) alienus Psammotettix of biology and genus the of species leafhoppers among Cicadellidae). pone.0037528. insect terrestrial observations. continental-scale for taxonomy Integrative – 118.di 10.1271/journal.pone.0101385. doi: e101385. , 24 114 , – 21)TeHmpea(net)o aaa osrciga constructing Canada: of (Insecta) Hemiptera The (2015) 2,308 (2), – – 76. 483. 299. 19)Lahpe on ln iue nItaly. in viruses plant borne Leafhopper (1994) in – 118. 20)Errcsae ntebooia cecs the sciences: biological the in cascades Error (2008) 333 unl ..( R.G. Busnel, etrto Ecology Restoration – 79 19)Vraini cutcsgaswti and within signals acoustic in Variation (1992) 313. 524 , 727 , 16)Mto nbocutctriooy pp. terminology. bioacoustic in Method (1963) 21)Mtn eaiu of behaviour Mating (2016) ilgclJunlo h ina Society Linnean the of Journal Biological oeua aieBooyadBiotechnology and Biology Marine Molecular LSONE PLoS 18)Hmpèe iaelde oue3 volume Cicadellidae, Homoptères (1989) – – 538. 736. 21)Nwagrtm n ehd to methods and algorithms New (2010) Ed. 21)Efcso otn heathland montane of Effects (2014) 17)Caatrsiso h micro- the of Characteristics (1977) 19)Psebyncdevelopment Postembryonic (1997) 7 ) naso h noooia Society Entomological the of Annals 358 o:10.1271/journal. doi: e37528. , ytmtcBiology Systematic cutcBhvori Animals in Behaviour Acoustic 22 ora fGnrlVirology General of Journal 749 , ora fEooi Entomology Economic of Journal 29 72 ,65 541 , smoetxprovincialis Psammotettix 21)DAbroe for barcodes DNA (2014) – 757. – Dalbulus 80. 21)Frtrpr of report First (2011) – netScience Insect smoetxalienus Psammotettix Alebra 547. LSONE PLoS 21)Dces in Decrease (2010) ln Disease Plant ope Rendus Comptes 59 (Homoptera, oltiodi Bollettino leafhoppers 307 , LSONE PLoS 45 – Memoire 350. – ,1 doi: . Ambio (1986) (2010) (2012) 321. 10 – (4), 95 34 15. 3 ) , . , , https://www.cambridge.org/core/terms Downloaded from Version postprint eRu,JJ uiof D. Rubinoff, & J.J. Roux, Le M. Peterschmitt, & J.M. Lett, A., Kvarnheden, S. Kamitani, Redinbaugh, & A.E. Whitfield, E.-D., Ammar, S.A., Hogenhaut, & M.M. Wells, J.B., Johnson, P., Duelli, S.J., Brooks, C.S., Henry, i . hn . ag . ag .&W,Y.F. Wu, & N. Wang, Q., Wang, W., Chen, Y., Li, Report ICTV F. Ronquist, & J.P. Huelsenbeck, auug . isc,W,Mhe,S,Guti,M uh,E. Fuchs, & M. Gruntzig, S., Mehner, W., Witsack, B., Manurung, auug . isc,W,Mhe,S,Guti,M uh,E. Fuchs, & M. Gruntzig, S., Mehner, W., Witsack, B., Manurung, P. Areno, & M. Lindblad, kt,VAO,Dbosi ..&VnEdn H.F. Emden, Van & Z.T. Dabrowski, V.A.O., Okoth, atro,DJ,Cpe,J,Kr,PM,Pl,RL esn D.P. Remsen, & R.L. Pyle, P.M., Kork, J., Copper, D.J., Patterson, ec,DM,By,EA ode M.S. Hoddle, & E.A. Boyd, D.M., Percy, oaa,G er,M. Henry, & G. Posadas, Bulletin ofEntomological Research, 108 (2),185-202. , DOI:10.1017/S0007485317000669 rnmsino ln Pathogens 9780890545355.016. Plant of Transmission ESAKIA elw htpam nHawaii. 154 in phytoplasma leafhopper yellows invasive an of source species, potential the as California 231 pp. ge- miniviruses. leafhopper-Borne temperate and tropical Mastreviruses: International ictv_9th_report/ the Press. of Academic Viruses Report of Taxonomy Ninth on Committee Viruses: of ( Nomenclature E.J. Lefkowitz, & 327 viruses. transmitted history. evolutionary M.G. shaping in Reviews role Biological its Chysopidae): carnea Chrysoperla A. Mochizuki, neec fpyoeei trees. phylogenetic of inference 43 wheat during infection. phytoplasma periwinkle dwarf blue in normalization expression PCR gene real-time quantitative for genes reference of Assessment n Pflanzenschutz und in of (WDV) Germany. virus dynamics Saxony-Anhalt, dwarf wheat of population vector as and Auchenorrhyncha) leafhopper biology on the Studies (2005) curneo h leafhopper the Middle-Germany. to relation of in virus dwarf occurrence wheat of epidemiology The (2004) virus. of dynamics ain rmvrosciai oe nNgra(Hemiptera: Nigeria in zones Cicadellidae). climatic various popu- and from species lations Cicadulina some of biology Comparative 21)Nmsaekyt h i e biology. new big the to Evolution & key Ecology are Names (2010) fAmerica of Cicadellidae). (Hemiptera: ies:Rcn dacsadFtr Strategies Future and Advances CIMMYT. Recent Disease: cutcsgaln ntresharpshooters: three tripenis in signalling acoustic YVRVi ra ha gorcmcos 3 pp 139 cross. agrotricum x wheat bread in a in CYDV-RPV Abt, I.,Derlink, M.,Mabon, R.,Virant-Doberlet, M., Jacquot, E.(2018). Integrating multiple ,477 https://www.cambridge.org/core criteria for thecharacterization ofPsammotettix populations inEuropean cerealfields. er,M ca,A ( A. McNab, & M. Henry, 419 , – 359. nentoa ora fPs Management Pest of Journal International – 20)Isc etritrcin ihpersistently with interactions vector Insect (2008) , 485. – oaoic liturata Homalodisca Macrosteles 50 (2012) 427. 21)DAbroe fJpns leafhoppers. Japanese of barcodes DNA (2011) 101 ,81 smoetxalienus Psammotettix 253 , ultno noooia Research Entomological of Bulletin – in 21)Olgtr utigbhvori the in behaviour duetting Obligatory (2013) 88. . smoetxalienus Psammotettix 88 ig ... dm,MJ,Crtn,E.B. Carstens, M.J., Adams, A.M.Q., King, gopo rpi pce (Neuropetra: species cryptic of -group iu Research Virus – 112 . https://talk.ictvonline.org/ictv-reports/ 259. 25 787 , Eds https://doi.org/10.1017/S0007485317000669 – p r eeii rnmtigteaster the transmitting severini, nr. sp. 20)Tmoa n pta population spatial and Temporal (2002) 241 nulRveso Phytopathology of Reviews Annual 686 , 5,497 (5), 20)Rssac oBD-A and BYDV-PAV to Resistance (2002) ) – in iu aooy lsiiainand Classification Taxonomy: Virus 808. – naso h noooia Society Entomological the of Annals etcrf u Pflanzenkrankheiten fur Zeitschrift rw,JK ( J.K. Brown, 691. 20)Mlclrdt reveals data Molecular (2009) . and – CIRAD DIC/DSI-INFODOC 507. Bioinformatics Bayesian MRBAYES: (2001) P rs o:10.1094/ doi: Press APS . 100 a ig,UA Elsevier USA, Diego, San . Eds etro ha dwarf wheat of vector a , utaainPatPathology Plant Australasian rpoehl atropunctata Graphocephala naso ple Biology Applied of Annals smoetxalienus Psammotettix Comment citer cedocument: 1,109 (1), ) 20)Osrain on Observations (2008) al.(Homoptera: Dahlb. alyYlo Dwarf Yellow Barley hrceiainof Characterization Ed. ) – Vector-Mediated oaoic vi- Homalodisca 113. 17 48 77 8,754 (8), 233 , ,1 Mexico, . , on rnsin Trends –

– 8. 31 Jul2017 at10:14:41 238. (2016) (2014) (1987) – 755. 46 in , Psammotettix enru,PG enad L.A. Beanland, & P.G. Weintraub, cuet . aeus . u .. hee .&Wn,X.F. Wang, & T. Thieme, B.L., Wu, A., Habekuss, J., Schubert, ets .. eg,A,Nlo,L,Cmrn .. oeh .& L. Joseph, S.L., Cameron, L., Nelson, A., Seago, D.K., Yeates, Niedringhaus, & H. Nickel, R., Bidermann, A., Stewart, M., Wilson, aua .&Ni M. Nei, & K. Tamura, aeh,SE,Ddye,CA,Ral,G agy S. Tanguy, & G. Riault, C.A., Dedryver, S.E., Sadeghi, abn,W. Rasband, ihckn .Yu D. Tishechkin, cimn,H. Schiemenz, A. Vasarainen, & M. Raatikainen, eeomn oeTeam Core Development R ihckn .Yu D. Tishechkin, clc-tie,BC,Senr .. efr,B,Safe,C., Stauffer, B., Seifert, F.M., Steiner, B.C., Schlick-Steiner, ihckn .Yu D. Tishechkin, ak,J. Vacke, Vir J. Vacke, a esug G.D.J. Rensburg, Van ibse J. Vilbaste, šč , subjectto theCambridgeCore termsofuse,available at 1642-PDN. Slovenia. toplasmas. wr iu rmnwgorpia oain n descrip- forms. and defective locations their of geographical tions new wheat from the virus of isolates dwarf of genomes complete of Analysis (2014) biodiversity. exploring Entomology of to Review approach multisource rea,J.W.H. Trueman, Wissens Germany, Buchvertrieb Scheeßel, R. taxonomy? 512 chimpanzees. and in humans mitochondrial-DNA of control the in substitutions cleotide fbre n ha netdwt YVPVisolate. BYDV-PAV a with Techniques Science infected Agricultural wheat of Journal and barley roots and leaves of individual among content virus in Variation Health. of Institute 77 Hmpea iaelde rmRsi n daetcoun- adjacent and tries. Russia in from Cicadellidae) characters (Homoptera, morphological some Abhandlungen Auchenorrhyncha). (Homoptera, Trockenrasen lgtproso leafhoppers. of periods flight Computing. Statistical Computiing Statistical for fhge taxa. classification higher on of notes with groups related and Cicadellidae) Homoptera: auct., (Deltocephalinae leafhoppers Aphrodinae hita,E rze,R.H. Crozier, & E. Christian, il,rsrcin,adprospects. poten- and insects: restrictions, in tials, species cryptic between distinguishing for 289 228 151 h curneo ha wr iu netn ha in wheat infecting virus dwarf wheat of occurrence II. the Cicadinea. Homoptera, European North Cicadelloidea. of nymphs virus. g of ogy etro az tekdsae .Teefc ftemperature. of effect The 1. disease. Phytophylactica streak maize of vector kMr,M Mavri & M. Marn, ek – populations (2015) – 94. – – – 17)Hs lnsrneadsmtm fwetdwarf wheat of symptoms and range plants Host (1972) 526. 309. 233. 162. 16)Wetdafvrsdisease. virus dwarf Wheat (1961) olgcek Zhurnal Zoologichesky ykmyhUtv otin yoyPraha-Ruzyne Vyroby Rostlinné Ustavu Vyzkumnych iauiambila Cicadulina 18)Peiiaykyfrteietfcto fthe of identification the for key Preliminary (1982) (2006) h lnhpesadLahpeso rti n Ireland and Britain of Leafhoppers and Planthoppers The ln Disease Plant nulRve fEntomology of Review Annual ytmtcEntomology Systematic – 16)DeZkdnan mitteleurop.aischer Zikadenfauna Die (1969) rn,18pp. 138 Fründ, 19)Tevraiiyo cutcsgasand signals acoustic of variability The (1999) . 36 nae olgc Fennici Zoologici Annales 14 IMAGEJ 21)Teueo iaosi characters bioacoustic of use The (2014) . usa noooia Journal Entomological Russian ,201 20)Vbainlcmuiainin communication Vibrational (2000) . ,99 18)Lbrtr bevtoso h biol- the on observations Laboratory (1982) 21)Itgaietxnm riterative or taxonomy Integrative (2011) 19)Etmto ftenme fnu- of number the of Estimation (1993) – – 55 107. 280. Nué Hmpea iaelde,a Cicadellidae), (Homoptera: (Naudé) ehsa ayad S,National USA, Maryland, Bethesda, . (2010) 421 , ina uti,RFudto for Foundation R Austria, Vienna, . npes o:10.1094/PDIS-11-16- doi: press. in č Ple oeua ilg n Evolution and Biology Molecular 78 – nae giutreFenniae Agriculturae Annales 438. 17)Ery n high-summer and Early- (1973) 1) 1298 (11), 21)Itgaietxnm:a taxonomy: Integrative (2010) :ALnug n Environment and Language A R: iu Genes Virus š o I. ko, 20)Isc etr fphy- of vectors Insect (2008) noooia Review Entomological 34 hflc Akademischer chaftlich 209 , 21)Frtrpr of report First (2017) smoetxstriatus Psammotettix – 19 ilgaPlantarum Biologia 2 51 1305. – 151 , ,1 217. 48 ,91 – 9 133 , 20. 1,1 (1), – – Entomologische 160. 111. – 139. – 66. Annual (2000) 94 (3), 10 12 17 17 3 . , , , , https://www.cambridge.org/core/terms Downloaded from Version postprint hn,F,Zag . a,W hn,Y. Zhang, & W. Dai, C., Zhang, F., Zhang, 18 Bulletin ofEntomological Research, 108 (2),185-202. , DOI:10.1017/S0007485317000669 itlg ftedgsiesse ftevco leafhopper vector 43 the of system striatus digestive Psammotettix the of histology Abt, I.,Derlink, M.,Mabon, R.,Virant-Doberlet, M., Jacquot, E.(2018). Integrating multiple 725 , https://www.cambridge.org/core criteria for thecharacterization ofPsammotettix populations inEuropean cerealfields. – 738. . https://doi.org/10.1017/S0007485317000669 L)(eitr:Cicadellidae). (Hemiptera: (L.) . CIRAD DIC/DSI-INFODOC Comment citer cedocument: 21)Mrhlg and Morphology (2012) , on

Micron 31 Jul2017 at10:14:41 .Abt I. tal. et hn,X,Zo,GH ag X.F. Wang, & G.H. Zhou, X., Zhang, , subjectto theCambridgeCore termsofuse,available at wr iu WV nwetadvco leafhopper vector and wheat in (WDV) ( virus dwarf iooia Methods Virological smoetxalienus Psammotettix 169 al. yra-iePCR. real-time by Dahlb.) 2,416 (2), – 419. 21)Dtcino wheat of Detection (2010) ora of Journal